High-throughput parallel synthesis of small molecule degraders
By using high-throughput parallel synthesis and SuFEx conversion technology, known ligands of target proteins are converted into molecular gel-type degraders, solving the problem of the lack of ligand binding pockets for target proteins and achieving efficient target protein degradation and expanding the target range.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE SCRIPPS RES INST
- Filing Date
- 2024-10-07
- Publication Date
- 2026-06-05
AI Technical Summary
Existing technologies struggle to efficiently and prospectively convert known ligands of target proteins into small molecule degraders, especially for proteins lacking functional ligand binding pockets. Furthermore, PROTAC design suffers from issues related to large size, solubility, and cell permeability, limiting the target range.
By employing a high-throughput parallel synthesis method, through sulfur(VI) fluoride exchange (SuFEx) conversion and N-hydroxysuccinimide (NHS)-ester-derived amide coupling, known ligands of the target protein are reused to form compounds that can approach other proteins, thus developing a molecular colloidal degrader.
It achieves efficient degradation of target proteins, expands the addressable target range, improves the affinity and degradation efficiency of compounds, and overcomes the shortcomings of PROTAC design.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Cross-reference to related applications
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 588,354, filed October 6, 2023, which is incorporated herein by reference in its entirety.
[0002] Government support This invention was carried out with government support, based on DP-5-OD26380 granted by the National Institutes of Health (NIH). The government holds certain rights to this invention. Technical Field
[0003] This document discloses a high-throughput synthetic method for the deliberate and prospective discovery of molecular gels that can be used to form complex protein-ligand surfaces that promote interfacial binding with other proteins on dispersed surfaces. Specifically, this application discloses a high-throughput method using sulfur (VI) fluoride exchange (SuFEx) conversion and N-hydroxysuccinimide (NHS)-ester-derived amide coupling to prospectively reuse known ligands of proteins of interest as degrading agents and compounds capable of inducing proximity to other proteins. This document discloses methods for developing known ligands of target proteins into degrading agents of target proteins. It also discloses methods for developing novel small-molecule chromatin competitive inhibitors of the YEATS domain of 11-19 leukemia (ENL) into effective degrading agents for ENL. Background Technology
[0004] Small molecule drugs typically act by stoichiometrically binding to hydrophobic pockets on protein surfaces (Figure 1a). These pockets are usually present because they participate in binding native small molecule ligands as part of normal physiological processes. Unfortunately, many promising anticancer targets are proteins lacking functional ligand-binding pockets (Figure 1b). To overcome the challenges associated with targeting these proteins, new chemical discovery methods are needed. PROTACs, which induce the degradation of targeted proteins by independently binding to the target of interest and an E3 substrate adaptor, have been widely used as chemical probes and investigational drug candidates. 7 However, despite several examples of advanced PROTAC drug candidates, several aspects of PROTAC design can make clinical translation difficult. The most significant of these is the large size of the PROTAC molecule, which can lead to poor solubility, cell penetration, and pharmacokinetics. Furthermore, only two E3 molecules (CRBN and VHL) are widely used in PROTAC design, limiting the range of addressable targets.
[0005] Molecular adhesives have emerged as a class of molecules that can overcome many of the drawbacks associated with PROTAC. 1 , 2Unlike PROTACs, molecular gels do not require independent ligand-binding pockets on each dimerized protein. Instead, they rely on the ability of a complex protein-ligand surface to promote interfacial binding with another protein on the dispersed surface (Fig. 1c). This mechanism allows for pharmacological manipulation of proteins that lack identifiable ligand-binding pockets. For example, pomalidomide binds to CRBN and generates a complex surface that recruits the undrugifiable transcription factor IKZF1 / 3 (Fig. 1d). 8 – 11 Since CRBN is the E3 substrate receptor for the cullin-RING ubiquitin ligase complex, pomalidomide-induced proximity leads to ubiquitination and degradation of IKZF1 / 3. The discovery that CRBN can degrade previously undrugable transcription factors has spurred extensive research into molecular glues.
[0006] Several other molecular gel degraders have now been discovered, either serendipitously through mechanism studies or prospectively through target-independent phenotypic screening. These (in particular) include: (i) CDK12 / cyclin K inhibitors that degrade cyclin K via DDB1, (ii) BTB ligands that degrade BCL6 by forming polymers recognized by SIAH1, and (iii) modified bromine-domain ligands that induce BRD4 degradation via DCAF16 (Figure 2a). 3 , 4 , 12 – 15 The molecular gel degraders in each of these examples are structurally related to previously known non-gel ligands of the target, differing only in subtle modifications presenting outward toward the solvent (Fig. 2a). These modifications, retrospectively discovered, result in complex protein-ligand surfaces that can lead to degradation (Fig. 2b). We hypothesize that such modifications can be prospectively identified for a given target of interest using high-throughput medicinal chemistry (Fig. 2c).
[0007] Our lab is dedicated to developing chemical probes that can be used as tools to study the regulatory mechanisms controlling mRNA transcription. Recently, we reported the discovery of compounds that can inhibit the function of ENLs in living systems. ENLs are chromatin reading proteins that selectively recruit transcriptional elongation mechanisms to the promoters of leukemia proto-oncogenes, such as... HOXA9 / 10 , MYB , ZEB2 and MYC ( 5 Based on our discovery that ENL is a leukemia-dependent factor ( 16, 17 We attempted to target its YEATS domain ( 5 , 18This domain binds acetylated lysine and is essential for ENL localization to chromatin. After screening 275,000 small molecules for chromatin-competitive inhibitors of the ENL YEATS domain, we identified an amide-imidazopyridine scaffold that binds with an affinity of approximately 5 µM.
[0008] As mentioned above, molecular colloidal degraders are highly sought-after small-molecule degraders capable of degrading proteins of interest. These molecules are often discovered incidentally and retrospectively, and are frequently anomalies in the medicinal chemistry development of inhibitors.
[0009] Therefore, a method for prospectively reusing known ligands of proteins of interest as degrading agents and compounds capable of inducing proximity to other proteins would have broad applicability in the fields of drug discovery and medicinal chemistry. Attached Figure Description
[0010] Figures 1a to 1d. (a) Schematic diagram of classically defined druggable targets. (b) “Undrugable” targets. (c) Colloidal interactions. (d) Pomalidomide-induced CRBN-IKZF1 interaction (PDB: 6H0F).
[0011] Figures 1a to 1c. (a) Slight structural modifications transform inhibitors into degradatives. (b) An example of “a” discovered incidentally through mechanism of action (MoA) studies. (c) Can we prospectively transform ligands into gels by systematically remodeling protein surfaces through high-throughput chemistry? Figure 2. (a) SuFEx high-throughput medicinal chemistry screening to diversify low-affinity ENL ligands. (b) The highest hits from the screening show an up to 100-fold increase in ENL inhibition (competitive binding assay). (c) The best hits led to the discovery of high-affinity ENL chemical probes SR-0813 and TM-7.
[0012] Figures 3a to 3d. (a) SuFEx screening to convert the high-affinity ENL ligand (TM-7) into an ENL degrader. TM-7 was diversified into a library of 3,234 analogs, which were then directly screened in a cell-based ENL abundance assay using HiBiT luminescence. (b) SuFEx screening identified several clusters of structure-related hits. Dashed line = 3 sd. (c) Confirmation that the succinimide hit from “c” (blue) induces ENL degradation via CRBN recruitment. JS8-100 was resynthesized, purified, and tested for chemical rescue in a HiBiT assay (24 h) to verify that the degradation was ENL, CRBN, CRL, and proteasome-dependent. (d) Same as “c”, but using Western blotting after 3 h.
[0013] Figures 5a to 5d. (a) Amine-reactive NHS esters can be synthesized in one step from the corresponding benzoic acid. (b) TM-7 was diversified into a library of 3,234 amide analogs, which were then directly screened in a cell-based ENL abundance assay using HiBiT luminescence. (c) JS8-115 is a resynthesized hit from our intracellular ENL binding assay. (d) It is nearly equivalent to TM-7.
[0014] Figure 6 Results of our initial HiBiT screening conducted in January 2023. The X-axis shows the molecular weight of the amine used in each well, and the Y-axis shows the ENL-HiBiT signal after 24 hours with a 5 µM concentration of the compound. The marker color indicates LogSw, a measure of the water solubility of the corresponding amine. The product we will later name JS8-100 is highlighted with a red circle.
[0015] Figure 7 The degradation of JS8-100 in ENL can be rescued by ENL ligands, cereblon ligands, NEDDing inhibitors, and proteasome inhibitors.
[0016] Figure 8 The fact that structural analogs of JS8-100 do not degrade ENL indicates that JS8-100 has a narrow structure-activity relationship (SAR).
[0017] Figure 9 JS8-100 is able to bind intracellular ENL with a higher affinity than our group’s previous ENL degraders, but lower than the corresponding inhibitors.
[0018] Figure 10 JS8-100 reduced the viability of MV4;11 and HB11;19 cells in a dose-dependent manner at 7 days. OCI AML2 cells were less affected by JS8-100 treatment.
[0019] Figure 11 The fact that .JQ1-spirocyclic does not degrade BRD4 supports our hypothesis that JS8-100 is a molecular gel, not a divalent PROTAC.
[0020] Figure 12 JS8-100 only showed observable binding to CRBN in biochemical assays at high concentrations, indicating that ENL is required for JS8-100 to bind to CRBN. Free spirocyclic compounds never observably bound to CRBN.
[0021] Figure 13 Pretreatment with JS8-100 could not salvage CRBN-dependent BRD4 degradation caused by dBET6.
[0022] Figure 14 JS8-100 exhibits strong binding with ENL-YEATS in HTRF (IC). 50 278 nM). This value is comparable to TM-7, which is an ENL inhibitor previously developed by our group and a scaffold for constructing JS8-100.
[0023] Figures 15A to 15B Synthesis and stereochemistry of dHTC1 and intermediates were determined. (A) Racemic dHTC1 was isolated into enantiomeric pure components, and their absolute stereochemistry was determined by VCD. The bioactive component was identified as ( S (B) 7 was protected by a benzyl group and isolated as an enantiomeric pure component by SFC, allowing for high-confidence stereochemical determination by VCD. SFC analysis of the coupling product with 6 further confirmed the active enantiomer. S ) configuration.
[0024] Figures 16A to 16C Using SFC rac -dHTC1 was separated into enantiomeric enriched components (–)-dHTC1 and (+)-dHTC1, which were determined by VCD as (–)-( R )-dHTC1 and (+)-( S )-dHTC1. Two enantiomers were separated using a Daicel IK-3 column (4.6 mm I.D x 100 mL, particle size 3 µm) under isocratic conditions (3.3 mL / min, CO2 / 50% MeOH containing 0.5 vol% 7M methanol NH3). The injection volume was 5 µL. (A) rac Analytical SFC trace of -dHTC1. (B) Preparative separation of (–)-( R Analytical SFC trace of )-dHTC1. This substance is inactive in bioassays. (C) Preparative separation of (+)-( S Analytical SFC trace of )-dHTC1. This substance is active in bioassays.
[0025] Figures 17A to 17B The active enantiomer of .dHTC1 has ( S ()- Stereochemical configuration. A: IR spectra of the active component (+)-dHTC1 (black) and its inactive enantiomer (-)-dHTC1 (red), separated by chiral stationary phase chromatography from racemic dHTC1, measured in DMSO (see Figure M2). SCalculated IR spectrum of (+)-dHTC1 in DMSO (blue) and comparison with measured IR spectrum of chromatographic fraction 2 (green). Pearson correlation coefficient for comparison: 0.82. B: VCD-IR spectra of (+)-dHTC1 (black) and (–)-dHTC1 (red) measured in DMSO. S The calculated VCD spectrum of (+)-dHTC1 in DMSO (blue) and its comparison with the measured VCD spectrum of (+)-dHTC1 (green). The Pearson correlation coefficient for the comparison is 0.41. (+)-dHTC1 is therefore determined to be (+)-( S )-dHTC1.
[0026] Figures 18A to 18B Using intermediates identified via VCD, dHTC1 with known stereochemistry was synthesized, and the active enantiomers were confirmed. S (A) Identification. Isomers were separated using a Daicel IG column (5 µm, 19 x 250 mm) on a Waters Prep SFC 150 AP. Purification was carried out at 40 °C under isocratic conditions (50% MeOH / CO2 containing 0.5 v / v 7M methanol NH3, 100 mL / min, 1600 psi back pressure). Fractionation was triggered by mass spectrometry (ESI+ on a Waters QDa, SIR channel m / z = 245.0). (A) Using ( R The intermediate with stereochemical configuration (+)-Bn-7 synthesized from (–)-( R The analytical SFC trace of )-dHTC1, as determined by VCD. This retention time matches the retention time of substances proven inactive in bioassays (see Figure 18). (B) Using known ( S (–)-Bn-7 intermediate with stereochemical configuration synthesized from (+)-( S The analytical SFC trace of dHTC1, as determined by VCD. This retention time matches the retention time of substances proven active in bioassays (see Figure 18).
[0027] Figures 19A to 19B The active enantiomer of .dHTC1 is composed of ( S Synthesis of spirocyclic structural units with stereochemical configurations. A: Synthesis of racemic spirocyclic structural units measured in chloroform. rac IR spectra of (+)-Bn-7 (black, resulting in the inactive enantiomer of dHTC1) and (–)-Bn-7 (red, resulting in the active enantiomer of dHTC1) separated by chiral stationary phase chromatography (see Figure 18). SCalculated IR spectrum of (+)-Bn-7 in chloroform (blue) and comparison with measured IR spectrum of (–)-Bn-7 (green). Pearson correlation coefficient for comparison: 0.99. B: VCD-IR spectra of (+)-Bn-7 (black) and (–)-Bn-7 (red) in chloroform. S The calculated VCD spectrum of (–)-Bn-7 in chloroform (blue) and its comparison with the measured VCD spectrum of (–)-Bn-7 (green). Pearson correlation coefficient for comparison: 0.90. (–)-Bn-7 is therefore determined to be (–)-( S )-Bn-7, which is further derivatized to produce the active enantiomer (+)-dHTC1, is then identified as (+)-( S )-dHTC1, consistent with the direct determination described in Figure 17.
[0028] Figure 20A To Figure 20H. Prospective discovery through high-throughput chemistry diversification rac -dHTC1. (A) TM-7 (1) with an iminosulfonyl difluoride SuFEx stem (2) was used for the parallel synthesis of 3,163 analogs (3). (B) Crude reaction products were screened for ENL degradation in MV4;11 cells expressing HiBiT-ENL (5 µM, 24 h). HiBiT luminescence was normalized relative to the DMSO:PBS mediator control ( n =1). This shows the molecular weight of the free amine structural unit. (C) By HiBiT-ENL ( n =3) Re-screen and re-synthesize hits, and target BRD4-HiBiT ( n =3) Reverse screening was performed. HiBiT luminescence was normalized relative to the DMSO:PBS medium control. (D) Chemical structures of structural unit 4 and rac-dHTC1 (5). (E) Purified rac Immunoblots of ENL in AML cell lines treated with dHTC1 (10 µM, 24 h) or DMSO medium. (F) In the presence of dHTC1 (10 µM, 24 h) or DMSO medium control. rac Time-dependent and dose-responsive loss of HiBiT-ENL signaling in MV4;11 cells treated with dHTC1. Emissions relative to DMSO mediator control normalized ( n =4). (G) After the specified pretreatment (1 hour), rac -dHTC1 dose-responsive effect in MV4;11 cells. HiBiT-ENL luminescence relative to DMSO mediator control normalized ( n =4). (H) Use racTMT-based quantitative analysis of expression proteomics in MV4;11 cells treated with dHTC1 (1µM, 16 h) or DMSO medium (5,512 proteins with >2 peptides, data filtered using DTAselect 2.0 within IP2). Two-tailed Student's t-tests were used to calculate... P value ,n =3.
[0029] Figure 21A To Figure 21I. Through rac ENL degradation by -dHTC1 is facilitated by CRL4. CRBN The reaction proceeded, but CRBN affinity was extremely low. (A) With DMSO, SR-1114 (10 µM) or rac FACS-based CRISPR screening of UPS components affecting ENL stability in KBM7 reporter cells (ENL-BFP-P2A-mCherry) treated with dHTC1 (10 µM) for 8 hours (6 sgRNAs targeting 1301 UPS-related genes). Gene-level fold changes were determined by one-sided MAGeCK analysis. P Value. (B) Using rac Immunoblot analysis of wild-type and CRBN-deficient MV4;11 cells treated with dHTC1 (10 µM, 24 h) or DMSO mediator control. (C) In rac Immunoblot analysis of MV4;11 cells pretreated with DMSO medium control, SR-0813 (10 µM), pomalidomide (pom, 25 µM), MLN4924 (1 µM), or carfilzomib (500 nM) for 1 hour prior to dHTC1 treatment (10 µM, 6 h) or DMSO medium control. (D) rac MV4;11 HiBiT-ENL cells were pretreated with pomalidomide (25 µM, 1 h) or DMSO control before treatment with dHTC1 (24 h). Luminescence relative to DMSO control was normalized ( n =4). Data in Figure 1G were taken from the same experiment (DMSO pretreatment was repeated in both figures). (E) HiBiT-ENL in wild-type and CRBN-deficient MV4;11 cells rac The reaction after dHTC1 treatment (24 hours). Emissions relative to the DMSO medium control, normalized ( n =4). (F) in rac SPR curves of CRBN binding to immobilized ENL-YEATS in the presence of -dHTC1 or buffer control. (G) FP determination of CRBN binding by displacement of fluorescent pomalidomide analogue. n=1). The data presented in this graph are repeated in Figure 26B. (H) Pomalidomide and CRBN measured by SPR midi The combination of. n =1). (I) rac -dHTC1 (same as H).
[0030] Figures 22A to 22L.ENL: ( S The dHTC1 complex binds CRBN synergistically and stereoselectively. (A), (B) Structures of the dHTC1 enantiomers. (C) Using ( S Luminescence-based measurement of HiBiT-ENL abundance in MV4;11 cells treated with dHTC1 (normalized relative to DMSO control). n =4). (D) ( R )-dHTC1 (same as C). (E) CRBN-DDB1 FP assay, which measures the BODIPY-thalidomide (10 nM) from CRBN-DDB1 (50 nM) in the presence of recombinant ENL YEATS protein (3 µM) or a buffer control. S )-dHTC1 substitution. (F) ( R )-dHTC1 (same as E). (G) in ( S )-or( R SPR curves of CRBN-DDB1 bound to immobilized ENL YEATS in the presence of )-dHTC1 (1 µM). (H) Measured by CellTiterGlo with ( S )-dHTC1 or ( R MV4;11 cell viability (relative to DMSO normalization) after 12 days of treatment with dHTC1. n =3). (I) In male C57BL / 6 mice administered 50 mg / kg via intraperitoneal injection ( S Mean plasma concentration of dHTC1 n =3). Depicting cellular DCs with and without adjusted protein binding percentage (PPB). 50 (MV4;11, at 8 hours). (J) via intraperitoneal injection of a medium, ( S )-dHTC1 (50 mg / kg) or ( R Immunoblot analysis of tumor lysates from MV4;11 xenografts following treatment with dHTC1 (50 mg / kg) (3 treatments, 12 hours apart). Sampling was performed 1 hour after the last treatment. n=4 mice). (K) RNA-seq analysis of tumor lysates (same processing conditions as Figure 3J). (L) Quantification of CD11b-positive cells in a specified tissue by flow cytometry (same processing conditions as Figure 3J).
[0031] Figure 23A To Figure 23G. S )-dHTC1 mediates extensive protein-protein contacts between ENL and CRBN. (A) Comparison rac Heatmap of CRBN DMS results for -dHTC1 and SR-1114. After CRBN DMS library transduction and drug treatment (dHTC1 or SR-1114, 1 µM for 8 hours), n =3) After that, MV4;11 CRBN was measured by flow cytometry. - / - C-terminal ENL-BFP levels in ENL-TagBFP-P2A-mCherry cells. The arrows above indicate selective residues for dHTC1 (blue), SR-1114 (grey), or a mixture of these (purple) residues selected for subsequent assays. (B) Expression of MV4;11 CRBN mutants treated with dHTC1 or SR-1114 (1 µM, 6 h). - / - Immunoblot analysis of ENL-TagBFP-P2A-mCherry cells. Image from Figure 31F was reused. (C) with CRBN. midi Combined ( S The crystal structure of )-dHTC1. (D) is composed of ( S A view of the thalidomide binding site of )-dHTC1. Residues indicated by arrows in Figure A are colored accordingly. (E) By protein coloring... S EM plot of DDB1:CRBN combined with dHTC1 and ENL. (F) and ( S A model of DDB1:CRBN bound to the )-dHTC1 and ENL complex, with magnified images showing the protein-protein interaction interface. The interaction between (G) CRBN H353 and ENL residues is less than 5 Å (R16, D31, M33, and E74).
[0032] Figures 24A to 24D. TM-7 is a high-affinity ligand for the ENL YEATS domain. (A) DMSO-normalized HiBiT signaling in MV4;11 cells expressing ENL-HiBiT after 24 hours of treatment. n =4). (B) Intracellular binding of ENL-YEAT by TM-7 and SR-0813 ( n=4). (C) ENL-YEATS affinity assay using SPR ( n =1). (D) The activity of ENL inhibitors against BRD4, as measured by HTRF ( n =3).
[0033] Figures 25A to 25D. rac -dHTC1 degrades ENL and AF9 in leukemia cell lines. (A) with 10 µM rac Immunoblot analysis of ENL in a group of AML cell lines treated with -dHTC1 or DMSO for 24 hours. (B) Using rac AML cell lines expressing ENL-HiBiT were treated with dHTC1 for 24 hours. Signal intensity was normalized relative to cells treated with DMSO. n =4). (C) Use rac Immunoblot analysis of AF9 levels in Jurkat cells treated with dHTC1 or DMSO control. (D) Validation of the ENL reporter gene construct. KBM7 cells expressing the ENL-tagBFP-P2A-mCherry dual fluorescent stable reporter gene were treated with 10 µM compound or DMSO control for 8 hours. n =1).
[0034] Figures 26A to 26I. CRBN target binding assay. (A) Rescuing dBET6-mediated BRD4 degradation to assess CRBN target binding. MV4;11 cells expressing BRD4-HiBiT were pretreated with the compound in a dose-response manner for 2 h, followed by dBET6 (500 nM, n =3) Process for 1 hour. Data for pomalidomide are repeated in Figure 28 below, derived from a single experiment. (B) Fluorescence polarization (FP) assay, which measures CRBN binding by displacing the fluorescent pomalidomide analog in the presence of 3 µM recombinant ENL YEATS domain protein (containing ENL) or buffer (without ENL). Unlabeled thalidomide was used as a positive control. Thalidomide, rac -dHTC1, SR-1114 and 4 CRBN combination ( n =1). Repeat the curve from Figure 2G without ENL.
[0035] Figure 27A Figure 27F. Closely related analogues of dHTC1 do not induce ENL degradation. (A) Structure of dHTC1 analogues. (B) Intracellular ENL-YEATS target binding assay based on HiBiT (3 h). Potential for preventing compound-induced degradation by pretreatment with MLN4924 (1 µM, 1 h). Signal normalization relative to DMSO-treated cells (n =4). (C) Combination with immobilized ENL-YEATS, as measured by SPR ( n =1). (D) HiBiT-based ENL degradation assay (24 hours). Signal normalized relative to DMSO-treated cells ( n =4). (E) CRBN FP assay in the presence of recombinant ENL YEATS domain (3 µM) or buffer. (F) Urea analog 7 (same as E) n =1).
[0036] Figures 28A to 28G. Characterization of dHTC1 enantiomers. (A) In the expression of HiBiT-ENL and using ( S Assay of HiBiT-based ENL degradation in cells treated with dHTC1 (24 h). Signal normalized relative to DMSO-treated cells ( n =4). (B) is the same as D, but is ( R )-dHTC1. (C) Combination with ENL, as measured by SPR ( n =1). (D) Intracellular ENL-YEATS target binding assay based on HiBiT (3 h). Cells were pretreated with MLN4924 (1 µM, 1 h) to prevent the possibility of compound-induced degradation. Signal normalization relative to DMSO-treated cells ( n =4). (E) Intracellular CRBN target binding assessed in BRD4-HiBiT-expressing MV4;11 cells via rescue dBET6-induced BRD4 degradation. Cells were pretreated with the compound in a dose-response manner for 2 h, followed by dBET6 (500 nM, n =3) Treat for 1 hour. Repeat the data from the pomalidomide positive control in Figure 26A (both figures are from the same experiment). (F) Measured by SPR in the presence or absence of CRBN-DDB1 (500 nM). S The combination of )-dHTC1 and ENL ( n =1). Each trace is normalized relative to its response at saturation. Repeat from Figure 28C without CRBN-DDB1 ( S (G) Data using CRBN-DDB1 (500 nM) and dHTC1 analogues ( n =1) Binding with ENL as measured by SPR. Partial repeat from Figure 28F with CRBN-DDB1 ( S )-dHTC1 (Data taken from the same experiment).
[0037] Figures 29A to 29C. In vitro and in vivo assessment of dHTC1. (A) Measured by CellTiterGlo using ( S )-dHTC1 or ( R Viability of HL60 cells treated with dHTC1 for 12 days (normalized relative to cells treated with DMSO). n =3). (B) Administered intraperitoneally (IP) at 10 mg / kg, or intravenously (IV) at 2 mg / kg or Oral (PO) was administered at 2 mg / kg rac Mean plasma concentration of -dHTC1 in male C57BL / 6 mice ( n =3). (C) Mean plasma concentrations in male C57BL / 6 mice administered 25, 50, or 75 mg / mg via intraperitoneal injection ( n =3). Repeat the 50 mg / kg data from Figure 22I (all data were taken from the same experiment).
[0038] Figures 30A to 30D. Validation of the MV4;11 cell line for CRBN DMS screening. (A) Flow cytometry of MV4;11 CRBN knockout cells, an internal control of mCherry cells isolated from BFP-labeled ENL and P2A, after drug treatment. This cell line was defined as the “parental”. (The text abruptly ends here, likely due to an incomplete translation or missing information.) rac (a) Histograms of -dHTC1 and DMSO-treated cells overlap because ENL degradation is CRBN-dependent. (b) Controls show that reintroduction of wild-type CRBN restores ENL degradation in drug-treated cells. (c) Controls show that reintroduction of CRBN with an inactivating mutation does not mediate ENL degradation. (d) Cells transduced with a CRBN DMS library regained viability, with approximately 70% of cells showing ENL degradation.
[0039] Figures 31A to 31D Validation of CRBN DMS results. (A) MV4;11 CRBN knockout cells expressing ENL-TagBFP-P2A-mCherry were transduced using a DMS library, which reintroduced CRBNs with a single amino acid mutation within a 10 Å radius of the thalidomide binding site. rac -dHTC1 (1 µM, 8 hours) n =3) After processing these cells, endpoint ENL levels were quantified by flow cytometry. The results are plotted in a heatmap, indicating ENL relative to the unsorted cell. 高 (A) Log2 fold change. (B) SR-1114 (same as A). (C) Validation results of CRBN mutants expressed alone, as assessed by flow cytometry. n=3). (D) Immunoblot analysis of ENL levels in MV4;11 CRBN knockout cells expressing ENL-TagBFP-P2A-mCherry. Mutations that selectively affect the ability of dHTC1 or SR-1114 to degrade ENL (1 µM, 6 h) were evaluated by reintroducing wild-type or mutant CRBN via lentiviral expression. Part of this figure is also shown in Figure 23B.
[0040] Figures 32A to 32B Comparison of .dHTC1 DMS results with CC-885. (A) RKO cells treated with CC-885 (500 nM, 7 days) 44 (a) Differential activity between MV4;11 ENL-TagBFP-P2A-mCherry cells treated with dHTC1 (1 µM, 8 h) and those treated with dHTC1 (1 µM, 8 h). (b) Validation of MV4;11 CRBN- / - GSPT1-GFP treated with CC-885 relative to selected CRBN mutations in treated ENL-BFP cells. n =3).
[0041] Figures 33A to 33B. Certain distal CRBN amino acid residues are essential for dHTC1-mediated ENL degradation. (A) DMS screening reveals that CRBN P54 and G61 are essential for ENL degradation, despite their distance from the dHTC1 binding pocket. (B) Crystal structure of dHTC1 bound to CRBN, showing that residue H353 is solvent-exposed.
[0042] Figures 34A to 34B. Prioritization of dHTC2 and dHTC3. (A) In MV4;11 BRD4-HiBiT ( n =3) was re-screened for hits at 2 µM (16 hours), and targeted at MV4;11 ENL-HiBiT ( n =3) Perform reverse screening. HiBiT luminescence is normalized relative to the DMSO:PBS medium control. (B) Same as A, but hits will be re-screened and reverse-screened at 10 µM (16 h). Summary of the Invention
[0043] This application provides a method for identifying a degrader of a target protein, the method comprising: 1) selecting a known ligand for the target protein; 2) using high-throughput parallel synthesis to generate multiple analogs of the ligand; 3) identifying an analog with high affinity for the target protein from the multiple analogs formed in step 2); and 4) using cell-based HiBiT assays and other high-throughput assays to identify the high-affinity analog formed in step 3), which degrades the target protein or induces proximity to a second protein target.
[0044] This application also provides the above-described method, which further includes performing a subsequent cell-based HiBiT assay to determine whether the mechanism by which the high-affinity analog degrades the target protein occurs via: 1) proximity-driven pharmacology via a monovalent interface binding to the second protein as a molecular glue; 2) PROTAC-like bivalent binding to both the target protein and the E3 substrate adaptor; 3) autophagy; 4) the high-affinity analog acting as a hydrophobic tag; or 5) another pathway leading to the degradation of the protein of interest.
[0045] This application provides the above-described method for identifying degradative agents for target proteins, wherein high-throughput parallel synthesis includes 1) esterifying aryl-carboxylic acid derivatives of known ligands of target proteins to form the corresponding aryl-N-hydroxysuccinimide (NHS) esters; and 2) high-throughput addition of various amines to produce the corresponding amide compounds.
[0046] This application provides the above-described method for identifying degraders of target proteins, wherein high-throughput parallel synthesis includes 1) adding a carboxylic acid derivative to a known ligand of the target protein; 2) esterifying the carboxylic acid to convert it into the corresponding NHS-ester; and 3) high-throughput addition of various aliphatic amines to the NHS-ester derivative to form an amine-functionalized analog of the known ligand of the target protein via amide linkage.
[0047] This application provides the above method according to the following reaction scheme: in A is a known ligand of the target protein; R 1 To be optionally used by one or more R 2 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 2 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0048] This application also provides a method for identifying a degrader of a target protein, wherein high-throughput parallel synthesis includes 1) adding an ester-functionalized amine to a carboxylic acid derivative of a known ligand of the target protein to form an ester derivative via an amide bond; 2) converting the resulting ester derivative into a corresponding carboxylic acid derivative; and 3) treating the carboxylic acid derivative with a spirocyclic succinimide derivative.
[0049] This application provides the above method according to the following reaction scheme: in A is a known ligand of the target protein; R 3 It is an (C1-C6) alkyl group; R 4 To be optionally used by one or more R 5 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; R 5 It can be an oxo group, OH, NH2, a halo group, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl, or N((C1-C6)alkyl)2; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0050] This application provides the above-described method, wherein high-throughput parallel synthesis includes 1) subjecting an amine derivative of a known ligand of a target protein to a sulfur (VI) fluorine exchange (SuFEx) to form an iminosulfuroxydifluoride derivative; and 2) subjecting the iminosulfuroxydifluoride derivative to high-throughput addition of various aliphatic amines to form an amine-functionalized analog of the known ligand of the target protein via a sulfonamide bond.
[0051] This application provides the above method according to the following reaction scheme: in A is a known ligand of the target protein; R 6 To be optionally used by one or more R 12 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 7 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0052] This application provides the above method according to the following scheme: in A is a known ligand of the target protein; R 13 It is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl or (C1-C6)alkyl(C3-C7)heterocycloalkyl; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0053] This application also provides the above method according to the following reaction scheme: .
[0054] This application provides the above method according to the following reaction scheme: in A is a known ligand of the target protein; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0055] This application also provides ENL molecular degrader compound JS8-100 having the following structure: .
[0056] This application also provides a pharmaceutical composition comprising an ENL molecular degrader compound JS8-100 and a pharmaceutically acceptable carrier, excipient, or diluent.
[0057] This application also provides a method for treating leukemia in a subject, the method comprising administering a therapeutically effective amount of an ENL molecular degrader compound JS8-100 or a pharmaceutical composition thereof. Detailed Implementation
[0058] To address the need for enhanced ligand affinity to support cell-based research and identify novel degraders (monovalent, divalent, or those that degrade proteins of interest via different pathways), we have developed a novel high-throughput medicinal chemistry approach. This approach utilizes sulfur(VI) fluoride exchange (SuFEx) conversion to "click" small, amine-functionalized chemical structural units onto compounds already functionalized with an iminosulfonyl difluoride "SuFEx center" (Figure 3a). (5, 19) The SuFEx center reacts quantitatively with aliphatic amines to form stable sulfonamide bonds. Crucially, the reaction requires no catalyst, forms fluoride as the only byproduct, and proceeds in a mild DMSO / PBS mixture. Because the reactions are quantitative and biocompatible, they can be carried out in parallel, and the crude product can be measured directly in live cells without any further purification. 5 Using amine structural unit libraries, thousands of analogs can be synthesized and tested within a single day, thus accelerating medicinal chemistry work. Using this method, we were able to diversify the initial high-throughput screening hits to 288 analogs (synthesized and screened within 2 days), leading to the discovery of chemical probes with over 100-fold increased activity (Figure 3b). 5 Further improvements in cell penetration and pharmacokinetics resulted in SR-0813 and TM-7, high-quality chemical probes with ENL YEATS domains (Figure 3c). 5 ).
[0059] The compatibility between high-throughput medicinal chemistry based on SuFEx and cell-based assays has been established. 5 Inspired by this prospective discovery, we applied it to molecular glues. We were driven by the serendipitous discovery that molecular glue degraders for BCL6, cyclin K, and BRD4 exist in many other structurally related ligands of the same proteins that do not act as glues (Fig. 2a). This suggests that it is possible to find molecular glues from any large set of structurally similar high-affinity ligands targeting a given protein (Fig. 2c). Given our ability to generate such a large set of compounds using SuFEx-based high-throughput chemistry, we felt well-suited to test this hypothesis. Therefore, we mounted the SuFEx reactive center onto our in vivo optimized ENL chemical probe TM-7 (Fig. 4a). We then reacted it with a library of 3,234 aliphatic amine structural units to generate a library of TM-7 analogs, each modified at a permitted structure-activity relationship (SAR) site that is presented outward to the solvent (Fig. 4a). We used leukemia cells (in ENLHiBiT-based luminescence readouts of ENL abundance in MV4;11 cells with HiBiT knock-in at the C-terminus screened each compound for potential ENL degraders (Fig. 4b). Hit counts were determined using a statistical cutoff of 3 standard deviations from the mean, and reverse screening was performed using the BRD4-HiBiT knock-in MV4;11 cell line to prevent false positives. Since TM-7 cells do not bind BRD4, any hits showing loss of BRD4-HiBiT signaling were expected to be false positives (e.g., due to toxicity, luminescence quenching, etc.) (Fig. 4b). The highest hits from the screening included several class of structure-related amines (Fig. 4b), including two adamantanes, which have previously been used to induce targeted degradation via hydrophobic labeling (…). 20 This provided confidence in our screening. We also noted that the lowest molecular weight hit, spirocyclic succinimide, was similar to succinimide present in the cyclic asparagine degradation determinant recognized by the E3 ligase CRBN. 21 Therefore, we resynthesized and purified hit JS8-100 and verified ENL degradation by HiBiT luminescence and Western blotting (Fig. 4c). We demonstrated that degradation could be rescued by proteasome inhibition (carfilzomib), inhibition of cullin-RING ligase activity (MLN4924), saturation with free TM-7, and saturation with the CRBN ligand pomalidomide, thus confirming that degradation occurs via induced proximity between ENL and CRBN (Fig. 4c). These data provide well-defined evidence that parallel diversification based on SuFEx can be used to convert ligands into degrading agents.
[0060] While our research group and others have demonstrated the utility of SuFEx-based high-throughput chemistry in drug- and molecular glue-based discovery, obtaining SuFEx intermediates remains a challenge. SuFEx stems (Fig. 3a, Fig. 4a) can be synthesized using tetrafluorothionyl (a toxic and difficult-to-generate gas). Due to the limited supply of our SuFEx-processed compounds and the goal of generating hit compounds with easily achievable resynthesis, we developed a novel high-throughput synthetic strategy whose products can be directly tested in cell-based assays without purification. Based on our previous experience with functional groups (… 22 ) and recent literature ( 23We discovered that aryl-carboxylic acids can be esterified to generate aryl-N-hydroxysuccinimide (NHS) esters (Fig. 5a), whose reaction with alkylamines yields stable amide bonds. While highly synonymous with SuFEx-based parallel synthesis, this NHS-ester-based strategy allows the use of amide products without sourcing increasingly rare reagents and provides a readily available resynthesis that is easy for anyone with synthetic chemistry experience of any level (Fig. 5b). Furthermore, aryl-NHS esters perform well under aqueous post-treatment conditions and can be readily purified by C18 column chromatography, providing highly pure starting materials for our library synthesis. We employed this chemistry with the same amine library previously used in SuFEx-based libraries to generate a library of 3,234 amide analogs of our initial ENL-ligand. We tested the intracellular binding of ENL from this library and the degradation of endogenously HiBiT-labeled ENL. One of our hits from the target binding assay was JS8-115 (Fig. 5c), which was chosen because it contains a novel aromatic ring that can be further functionalized and derivatized using NHS-esterification. This compound exhibits almost identical intracellular binding to ENL as TM-7, indicating that it is a high-affinity scaffold from which we will be able to derive additional ENL-molecular gels.
[0061] References: Implementation Plan Implementation Scheme 1. A method for identifying a degrader of a target protein, the method comprising: 1) selecting a known ligand for the target protein; 2) using high-throughput parallel synthesis to generate multiple analogs of the ligand; 3) identifying from the multiple analogs formed in step 2) an analog with high affinity for the target protein; and 4) using cell-based HiBiT assays and other high-throughput assays to identify the high-affinity analog formed in step 3), the high-affinity analog degrading the target protein or inducing proximity to a second protein target.
[0062] Implementation Scheme 2. The method of Implementation Scheme 1, further comprising performing a subsequent cell-based HiBiT assay to determine whether the mechanism by which the high-affinity analog degrades the target protein occurs via: 1) proximity-driven pharmacology via a monovalent interface binding to a second protein as a molecular glue; 2) PROTAC-like bivalent binding to both the target protein and the E3 substrate adaptor; 3) autophagy; 4) the high-affinity analog acting as a hydrophobic tag; or 5) another pathway leading to the degradation of the protein of interest.
[0063] Implementation Scheme 3. The method as described in Implementation Scheme 1 or Implementation Scheme 2, wherein the mechanism for degrading the target protein occurs via proximity-driven pharmacology through a monovalent interface with the second protein, which acts as a molecular glue.
[0064] Implementation Scheme 4. The method as described in Implementation Scheme 1 or Implementation Scheme 2, wherein the mechanism for degrading the target protein occurs via PROTAC-like bivalent binding to both the target protein and the E3 substrate adaptor.
[0065] Implementation Scheme 5. The method as described in Implementation Scheme 1 or Implementation Scheme 2, wherein the mechanism for degrading the target protein occurs via autophagy.
[0066] Implementation Scheme 6. The method as described in Implementation Scheme 1 or Implementation Scheme 2, wherein the mechanism for degrading the target protein occurs via the high-affinity analogue used as a hydrophobic tag.
[0067] Implementation Scheme 7. The method of any one of Implementation Schemes 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) adding a carboxylic acid derivative to a known ligand of the target protein; 2) esterifying the carboxylic acid to convert it into the corresponding NHS-ester; 3) high-throughput addition of a variety of aliphatic amines to the NHS-ester derivative to form an amine-functionalized analog of the known ligand of the target protein via amide linkage.
[0068] Implementation Scheme 8. The method as described in Implementation Scheme 7, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 1 To be optionally used by one or more R 2 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 2 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0069] Implementation Scheme 9. The method of any one of Implementation Schemes 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) adding an ester-functionalized amine to the carboxylic acid derivative of the known ligand of the target protein to form the ester derivative via an amide bond; 2) converting the resulting ester derivative into the corresponding carboxylic acid derivative; and 3) treating the carboxylic acid derivative with a spirocyclic succinimide derivative.
[0070] Implementation Scheme 10. The method as described in Implementation Scheme 9, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 3 It is an (C1-C6) alkyl group; R 4 To be optionally used by one or more R 5 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; R 5 It can be an oxo group, OH, NH2, a halo group, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl, or N((C1-C6)alkyl)2; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0071] Implementation Scheme 11. The method as described in Implementation Scheme 10, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0072] Implementation Scheme 12. The method as described in Implementation Scheme 10 or Implementation Scheme 11, wherein n is 0.
[0073] Implementation Scheme 13. The method as described in Implementation Scheme 10 or Implementation Scheme 11, wherein n is 1.
[0074] Implementation Scheme 14. The method of any one of Implementation Schemes 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) subjecting an amine derivative of the known ligand of the target protein to a sulfur (VI) fluorine exchange (SuFEx) to form an iminosulfuroxydifluoride derivative; and 2) subjecting the iminosulfuroxydifluoride derivative to high-throughput addition of a variety of aliphatic amines to form an amine-functionalized analog of the known ligand of the target protein via a sulfonamide bond.
[0075] Implementation Scheme 15. The method as described in Implementation Scheme 14, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 6 To be optionally used by one or more R 12 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 7 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0076] Implementation Scheme 16. The method of any one of Implementation Schemes 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) treating an aryl carboxylic acid derivative of a known ligand of a target protein with an amine functionalizing group to form an amide derivative of the known ligand; 2) subjecting the amide derivative to a sulfur (VI) fluorine exchange (SuFEx) to form an iminosulfur difluoride derivative; and 3) further adding an aliphatic amine to form a sulfonamide-linked amine functionalized derivative of the known ligand.
[0077] Implementation Scheme 17. The method as described in Implementation Scheme 16, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 13 It is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl or (C1-C6)alkyl(C3-C7)heterocycloalkyl; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
[0078] Implementation Scheme 18. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis method includes, but is not limited to: 1) Sulfur(VI) Fluorine Exchange (SuFEx) ; 2) Copper-catalyzed cycloaddition of azide-alkyne hydrocarbons ; 3) Ruthenium-catalyzed cycloaddition of azide-alkyne hydrocarbons ; 4) Strain-promoted cycloaddition of azide-alkyne hydrocarbons ; 5) Strain-promoted alkyne-nitroketone cycloaddition ; 6) Diels-Alder (reverse electron demand of olefin-tetraazine) ; 7) Alkene-tetrazole photoclick reaction ; 8) Coupling of amides with activated esters ; 9) Coupling of amides with in-situ activated esters ; 10) Urea coupling of unactivated carboxylic acids ; 11) Urea coupling of isocyanates ; 12) Urea coupling of acyl azides ; 13) Radical coupling of activated alkyl halides ; 14) Free radical nitroketone coupling of carboxylic acids ;as well as 15) Cross-coupling catalyzed by transition metals ; in: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7)heterocycloalkyl, (C6-C4) ... 10 ) aryl or (C5-C8) heteroaryl.
[0079] Implementation Scheme 19. The method of any one of Implementation Schemes 1 to 18, wherein the second protein is a substrate receptor for E3 ubiquitin ligase.
[0080] Implementation Scheme 20. The method of any one of Implementation Schemes 1 to 19, wherein the second protein is CRBN.
[0081] Implementation Scheme 21. The method of any one of Implementation Schemes 1 to 20, wherein the target protein is a transcriptional co-regulatory factor.
[0082] Implementation Scheme 22. The method of Implementation Scheme 21, wherein the target protein is the chromatin reader YEATS domain of the transcriptional co-regulatory factor ENL.
[0083] Implementation Scheme 23. The method of any one of Implementation Schemes 1 to 22, wherein the known ligand of the target protein is an ENL inhibitor having an amide-imidazopyridine scaffold of formula (I): (I) in: R is (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, (C3-C7)cycloalkyl, or (C1-C6)alkyl(C3-C7)cycloalkyl.
[0084] Implementation Scheme 24. The method as described in Implementation Scheme 23, wherein R is cyclobutane.
[0085] Implementation Scheme 25. The method as described in Implementation Scheme 17, wherein the method is based on the following reaction scheme: .
[0086] Implementation Scheme 26. A compound having the following structure: .
[0087] Implementation Scheme 27. The method as described in Implementation Scheme 8, wherein the method is based on the following reaction scheme: .
[0088] Implementation Scheme 28. The method as described in Implementation Scheme 26, wherein R 1 for .
[0089] Implementation Scheme 29. The method as described in Implementation Scheme 28, wherein the method is based on the following reaction scheme: .
[0090] Implementation Scheme 30. A compound having the following structure: .
[0091] Implementation Scheme 31. The method as described in Implementation Scheme 12, wherein the method is based on the following reaction scheme: .
[0092] Implementation Scheme 32. A compound having the following structure: .
[0093] Implementation Scheme 33. The method as described in Implementation Scheme 13, wherein the method is based on the following reaction scheme: .
[0094] Implementation Scheme 34. A compound having the following structure: Implementation Scheme 35. A pharmaceutical composition comprising a compound as described in Implementation Scheme 26 and a pharmaceutically acceptable carrier, excipient, or diluent.
[0095] Implementation Scheme 36. A method of treating a subject with leukemia, the method comprising administering a therapeutically effective amount of a compound as described in Implementation Scheme 26 or a pharmaceutical composition as described in Implementation Scheme 35.
[0096] Implementation Scheme 37. The method as described in Implementation Scheme 356, wherein the leukemia is acute myeloid leukemia (AML).
[0097] Implementation Scheme 38. The method as described in Implementation Scheme 36, wherein the leukemia is acute lymphoblastic leukemia (ALL).
[0098] Implementation Scheme 39. Any compound, composition, or method as described herein.
[0099] definition As used herein, the compound referred to as "JS8-100" is also referred to as "dHTC1" in this application, since both are expressed as... N -A compound of cyclobutyl-2-(3-((2-(4-((6,8-dioxo-2,7-diazaspiro[4.4]nonane)-2-sulfonylamino)piperidin-1-yl)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridine-6-carboxamide.
[0100] As used herein, the phrase “an” or “a” refers to one or more of the same entity; for example, “a compound” refers to one or more compounds or at least one compound. Therefore, the terms “an” (or “a”), “one or more”, and “at least one” are used interchangeably herein.
[0101] The phrase "as defined above" refers to the broadest definition of each group provided in the summary, detailed description, experiment, or the broadest claims. In all other embodiments provided below, substituents that may be present in each embodiment and are not explicitly defined retain the broadest definition provided in the summary.
[0102] As used herein, the term "comprising" is to be interpreted in an open-ended sense, whether in transitional phrases or in the body of the claims. That is, the term is to be interpreted as synonymous with the phrases "having at least" or "comprising at least". When used in the context of a method, the term "comprising" means that the method includes at least the listed steps, but may include additional steps. When used in the context of a compound or composition, the term "comprising" means that the compound or composition includes at least the listed features or components, but may also include additional features or components.
[0103] As used herein, unless otherwise explicitly stated, the word "or" is used in an inclusive sense of "and / or" rather than in an exclusive sense of "either / or".
[0104] This document uses the term "independently" to mean that a variable is applied in any given case, regardless of the presence or absence of variables with the same or different definitions within the same compound. Therefore, in compounds where "R" appears twice and is defined as "independently selected," it means that each occurrence of the R group is individually identified as a member of the set conforming to the definition of that R group. For example, "each R..." 1 and R 2 "Independently selected from carbon and nitrogen" means R 1 and R 2 Both can be carbon, R1 and R 2 Both can be nitrogen, or R 1 or R 2 It could be carbon and the other could be nitrogen, or vice versa.
[0105] When any variable appears more than once in any part or chemical formula of a compound used in or claimed in the description and illustration of this invention, its definition for each occurrence is independent of its definition for each subsequent occurrence. Furthermore, combinations of substituents and / or variables are permitted only if the resulting compound is a stable compound.
[0106] The symbol “*” at the end of a bond, or the line or “~~~~” that passes through a bond, respectively indicates the connection point between a functional group or other chemical part and the rest of the molecule to which it belongs.
[0107] A bond drawn into a ring system (as opposed to a bond attached to a specific vertex) indicates that the bond can be attached to any suitable ring atom.
[0108] As used herein, the terms “optional” or “optionally” mean that an event or situation described below may occur but does not have to occur, and the description includes instances where the event or situation occurs and instances where it does not occur. For example, “optionally substituted” means that the “optionally substituted” portion may contain hydrogen or substituents.
[0109] The phrase "optional bond" means that the bond may or may not be present, and the description includes single, double, or triple bonds. If a substituent is specified as "bonded" or "not present," the atom attached to the substituent is directly connected.
[0110] The term "about" in this document means approximately, roughly, roughly, or about. When the term "about" is used in conjunction with a numerical range, it modifies the range by expanding the upper and lower boundaries of the listed numerical value. Generally, the term "about" is used in this document to modify a value that fluctuates by 20%.
[0111] Some of the compounds disclosed herein exhibit tautomerism. Tautomers can exist in the form of two or more interconvertible substances. Proton transfer tautomers arise from the migration of covalently bonded hydrogen atoms between two atoms. Tautomers typically exist in equilibrium, and attempts to separate individual tautomers usually yield mixtures with chemical and physical properties consistent with those of the mixture of compounds. The position of equilibrium depends on the intramolecular chemical signature. For example, in many aliphatic aldehydes and ketones (such as acetaldehyde), the ketone form is dominant; while in phenols, the enol form is dominant. Common proton transfer tautomers include ketone / enol (-C(=O)-CH- -C(-OH)=CH-), amide / imino acid (-C(=O)-NH-) -C(-OH)=N-) and amidine (-C(=NR)-NH-) -C(-NHR)=N-) tautomers. The latter two are particularly common in heteroaryl and heterocyclic compounds, and this invention covers all tautomer forms of the compounds.
[0112] In this disclosure, a "pharmaceutically acceptable salt" is a pharmaceutically acceptable organic or inorganic acid or base salt of the compounds described herein. Representative pharmaceutically acceptable salts include, for example, alkali metal salts, alkaline earth metal salts, ammonium salts, water-soluble and water-insoluble salts, such as acetates, 4,4-diaminostilbene-2,2-disulfonate, benzenesulfonate, benzoate, bicarbonate, bisulfate, tartrate, borate, bromide, butyrate, calcium, calcium ethylenediaminetetraacetate, camphorsulfonate, carbonate, chloride, citrate, clavulanate, dihydrochloride, ethylenediaminetetraacetate, ethylenedisulfonate, etolate, esethionate, fumarate, gluconate, gluconate, glutamate, glycolamide benzoarsylate, hexafluorophosphate, hexylresorcinol, hyaluronic acid, hydrobromide, hydrochloride, hydroxynaphthylcarbamate, iodide, isocyanate, etc. Thiosulfates, lactates, lacturonic acids, laurates, malates, maleates, mandelates, methanesulfonates, methyl bromides, methyl nitrates, methyl sulfates, mucilages, naphthalenesulfonates, nitrates, N-methylglucosamine ammonium salts, 3-hydroxy-2-naphthoate, oleates, oxalates, palmitates, bis(hydroxynaphthoate) (1,1-methylene-bis-2-hydroxy-3-naphthoate, emborate), pantothenates, phosphates / bisphosphonates, picrates, polygalacturonic acids, propionates, p-toluenesulfonates, salicylates, stearates, basic acetates, succinates, sulfates, sulfosalicylates, suraminates, tannates, tartrates, theochloroate, toluenesulfonates, triiodoacetate, and valerates. Pharmaceutically acceptable salts may have more than one charged atom in their structure. In this case, pharmaceutically acceptable salts may have multiple counterions. Therefore, pharmaceutically acceptable salts can have one or more charged atoms and / or one or more counterions.
[0113] Unless otherwise defined, the technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Various methods and substances known to those skilled in the art are mentioned herein. Standard references explaining the general principles of pharmacology include Goodman and Gilman's works. The Pharmacological Basis of Therapeutics10th Edition, McGraw Hill Companies Inc., New York (2001). Any suitable substances and / or methods known to those skilled in the art can be used to carry out this invention. However, preferred substances and methods are described herein. Unless otherwise stated, the substances, reagents, etc. mentioned in the following description and examples are available from commercial sources.
[0114] The definitions described herein can be appended to form chemically related combinations, such as “heteroalkylaryl,” “haloalkylheteroaryl,” “arylalkylheterocyclic,” “alkylcarbonyl,” “alkoxyalkyl,” etc. When the term “alkyl” is used as a suffix following another term, such as in “phenylalkyl” or “hydroxyalkyl,” this is intended to refer to an alkyl group as defined above that is substituted with one or two substituents selected from other specifically named groups. Thus, for example, “phenylalkyl” refers to an alkyl group having one or two phenyl substituents, and therefore includes benzyl, phenethyl, and biphenyl. “alkylaminoalkyl” is an alkyl group having one or two alkylamino substituents. “Hydroxyalkyl” includes 2-hydroxyethyl, 2-hydroxypropyl, 1-(hydroxymethyl)-2-methylpropyl, 2-hydroxybutyl, 2,3-dihydroxybutyl, 2-(hydroxymethyl), 3-hydroxypropyl, etc. Therefore, as used herein, the term “hydroxyalkyl” is used to define a subset of heteroalkyl groups as defined below. The term -(aryl)alkyl refers to an unsubstituted alkyl or arylalkyl group. The term "(hetero)aryl" refers to aryl or heteroaryl.
[0115] As used herein, the term "acyl" denotes a group of the formula -C(=O)R, where R is hydrogen or a lower alkyl group as defined herein. The term "alkylcarbonyl" as used herein denotes a group of the formula C(=O)R, where R is an alkyl group as defined herein. The term C... 1-6 An acyl group is a group -C(=O)R containing 6 carbon atoms. As used herein, the term "aryl carbonyl" refers to a group of the formula C(=O)R, where R is an aryl group; and the term "benzoyl" refers to an aryl carbonyl group, where R is a phenyl group.
[0116] As used herein, the term "alkyl" refers to a non-branched or branched saturated monovalent hydrocarbon residue containing 1 to 12 carbon atoms. As used herein, the terms "lower alkyl" or "C1-C6 alkyl" refer to straight-chain or branched hydrocarbon residues containing 1 to 6 carbon atoms. 12 "Alkyl" means an alkyl group consisting of 1 to 12 carbon atoms. Examples of alkyl groups include, but are not limited to, lower alkyl groups, including methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl or pentyl, isopentyl, neopentyl, hexyl, heptyl and octyl.
[0117] When the term "alkyl" is used as a suffix following another term, such as in "phenylalkyl" or "hydroxyalkyl," it is intended to refer to an alkyl group as defined above, substituted with one or two substituents selected from other specifically named groups. Thus, for example, "phenylalkyl" indicates the group R'R"-, where R' is phenyl and R" is an alkylene group as defined herein, and it should be understood that the phenylalkyl moiety will be connected at the alkylene group. Examples of arylalkyl groups include, but are not limited to, benzyl, phenethyl, and 3-phenylpropyl. The terms "arylalkyl" or "aralkyl" are interpreted similarly, except that R' is aryl. The terms "(hetero)arylalkyl" or "(hetero)arylalkyl" are interpreted similarly, except that R' is optionally aryl or heteroaryl.
[0118] When listing a range of values, it is intended to cover every value within that range and its subranges. For example, "C 1-6 "Alkyl" is intended to encompass C1, C2, C3, C4, C5, C6, C 1–6 C 1–5 C 1–4 C 1–3 C 1–2 C 2–6 C 2–5 C 2–4 C 2–3 C 3–6 C 3–5 C 3–4 C 4–6 C 4–5 and C 5–6 alkyl.
[0119] "alkyl" refers to a straight-chain or branched saturated hydrocarbon group having 1 to 20 carbon atoms ("C"). 1-20 Alkyl group). In some embodiments, the alkyl group has 1 to 15 carbon atoms (“C15”). 1-15 Alkyl group). In some embodiments, the alkyl group has 1 to 14 carbon atoms (“C14”). 1-14 Alkyl group). In some embodiments, the alkyl group has 1 to 13 carbon atoms (“C13”). 1-13 Alkyl group). In some embodiments, the alkyl group has 1 to 12 carbon atoms (“C12”). 1-12 Alkyl group). In some embodiments, the alkyl group has 1 to 11 carbon atoms (“C1”). 1-11 Alkyl group). In some embodiments, the alkyl group has 1 to 10 carbon atoms (“C10”). 1-10 Alkyl group). In some embodiments, the alkyl group has 1 to 9 carbon atoms (“C1”). 1-9 Alkyl group). In some embodiments, the alkyl group has 1 to 8 carbon atoms (“C1”). 1-8 Alkyl group). In some embodiments, the alkyl group has 1 to 7 carbon atoms (“C1”). 1-7Alkyl group). In some embodiments, the alkyl group has 1 to 6 carbon atoms (“C6”). 1-6 Alkyl group (“C”). In some embodiments, the alkyl group has 1 to 5 carbon atoms (“C”). 1-5 Alkyl group). In some embodiments, the alkyl group has 1 to 4 carbon atoms (“C1”). 1-4 Alkyl group). In some embodiments, the alkyl group has 1 to 3 carbon atoms (“C1”). 1-3 Alkyl group (“alkyl”). In some embodiments, the alkyl group has 1 to 2 carbon atoms (“C”). 1-2 Alkyl group (“C1 alkyl”). In some embodiments, the alkyl group has 1 carbon atom (“C1 alkyl”). In some embodiments, the alkyl group has 2 to 6 carbon atoms (“C1 alkyl”). 2-6 Alkyl group). C 1-6 Examples of alkyl groups include methyl (C1), ethyl (C2), n-propyl (C3), isopropyl (C3), n-butyl (C4), tert-butyl (C4), sec-butyl (C4), isobutyl (C4), n-pentyl (C5), 3-pentyl (C5), pentyl (C5), neopentyl (C5), 3-methyl-2-butyl (C5), tert-pentyl (C5), and n-hexyl (C6). Other examples of alkyl groups include n-heptyl (C7), n-octyl (C8), etc.
[0120] "Alkenyl" or "olefin" refers to a straight-chain or branched hydrocarbon group having 2 to 10 carbon atoms and 1, 2, 3, or 4 carbon-carbon double bonds ("C"). 2-10 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 9 carbon atoms (“C”). 2-9 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 8 carbon atoms (“C”). 2-8 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 7 carbon atoms (“C”). 2-7 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 6 carbon atoms (“C”). 2-6 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 5 carbon atoms (“C”). 2-5 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 4 carbon atoms (“C”). 2-4 Alkenyl group (“Alkenyl”). In some embodiments, the alkenyl group has 2 to 3 carbon atoms (“C”). 2-3 The alkenyl group (“C2-alkenyl”) has two carbon atoms in some embodiments. The one or more carbon-carbon double bonds can be internal (e.g., in 2-butenyl) or terminal (e.g., in 1-butenyl). 2-4 Examples of alkenyl groups include vinyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), etc. 2-6Examples of alkenyl groups include the aforementioned C... 2-4 Alkenyl groups include pentenyl (C5), pentadienyl (C5), and hexenyl (C6). Other examples of alkenyl groups include heptenyl (C7), octenyl (C8), and octtrienyl (C8).
[0121] "Alkyne" refers to a straight-chain or branched hydrocarbon group having 2 to 10 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds). 2-10 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 9 carbon atoms (“C”). 2-9 The alkynyl group (“acetylenic”) has 2 to 8 carbon atoms in some embodiments. 2-8 The alkynyl group (“acetylation”) has 2 to 7 carbon atoms in some embodiments. 2-7 The alkynyl group (“C”) is present in some embodiments. In some embodiments, the alkynyl group has 2 to 6 carbon atoms (“C”). 2-6 The alkynyl group (“H”) has 2 to 5 carbon atoms in some embodiments. 2-5 The alkynyl group ("alkynyl group"). In some embodiments, the alkynyl group has 2 to 4 carbon atoms ("alkynyl group"). C2-4 The alkynyl group ("alkynyl group"). In some embodiments, the alkynyl group has 2 to 3 carbon atoms ("alkynyl group"). C2-3 The alkynyl group (“C2-alkynyl”) is used in some embodiments. The one or more carbon-carbon triple bonds can be internal (as in 2-butynyl) or terminal (as in 1-butynyl). 2-4 Examples of alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), and 2-butynyl (C4). 2-6 Examples of alkenyl groups include the aforementioned C... 2-4 Alkynyl groups include pentynyl (C5), hexynyl (C6), etc. Other examples of alkynyl groups include heptynyl (C7), octynyl (C8), etc.
[0122] The terms “haloalkyl” or “halo-lower alkyl” or “lower haloalkyl” refer to straight-chain or branched hydrocarbon residues containing 1 to 6 carbon atoms, wherein one or more carbon atoms are replaced by one or more halogen atoms.
[0123] Unless otherwise stated, the terms "alkylene" or "alkanediol" as used herein refer to a divalent saturated straight-chain hydrocarbon group of 1 to 10 carbon atoms (e.g., (CH2)). n ) or branched saturated divalent hydrocarbon groups of 2 to 10 carbon atoms (e.g., -CHMe- or -CH2CH). i-Pr)CH2-). Except for the case of methylene, the free valences of alkylene groups are not attached to the same atom. Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, 2-methyl-propylene, 1,1-dimethyl-ethylene, butylene, and 2-ethylbutylene.
[0124] As used herein, the term "alkoxy" means -O-alkyl, where the alkyl group is as defined above, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, tert-butoxy, pentoxy, hexoxy, including their isomers. As used herein, "lower alkoxy" refers to an alkoxy group having a "lower alkyl group" as previously defined. As used herein, "C1- 10 "Alkoxy" refers to -O-alkyl, where the alkyl group is C. 1-10 .
[0125] As used herein, the term "hydroxyalkyl" means an alkyl group as defined herein, in which one to three hydrogen atoms on different carbon atoms are replaced by hydroxyl groups.
[0126] As used herein, the terms “alkylsulfonyl” and “arylsulfonyl” refer to a group of the formula -S(=O)2R, where R is either alkyl or aryl, and alkyl and aryl are as defined herein. As used herein, the term “heteroalkylsulfonyl” denotes a group of the formula -S(=O)2R, where R is a “heteroalkyl” as defined herein.
[0127] As used herein, the terms "alkylsulfonylamino" and "arylsulfonylamino" refer to groups of the formula -NR'S(=O)2R, where R is either alkyl or aryl, and R' is hydrogen or C. 1-3 Alkyl groups, and alkyl and aryl groups as defined herein.
[0128] As used herein, the term "cycloalkyl" refers to a saturated carbocyclic ring containing 3 to 8 carbon atoms, namely cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or cyclooctyl. As used herein, "C 3-7 "Cycloalkyl" refers to a cycloalkyl group consisting of 3 to 7 carbons in its carbon ring.
[0129] As used herein, the term carboxyl-alkyl refers to an alkyl moiety in which one hydrogen atom has been replaced by a carboxyl group. It is important to understand that heteroalkyl groups are connected via carbon atoms. The term "carboxy" refers to the –CO2H moiety.
[0130] As used herein, the term "heteroaryl" or "heteroaromatic" refers to a monocyclic or bicyclic group having 5 to 12 ring atoms having at least one aromatic ring, each ring containing four to eight atoms, incorporating one or more N, O, or S heteroatoms, with the remaining ring atoms being carbon. It should be understood that the heteroaryl group's linkage will be on the aromatic ring. As is well known to those skilled in the art, the aromatic properties of heteroaryl rings are weaker than their all-carbon counterparts. Therefore, for the purposes of this invention, heteroaryl groups only need to possess a certain degree of aromaticity. Examples of heteroaryl moieties include monocyclic aromatic heterocycles having 5 to 6 ring atoms and 1 to 3 heteroatoms, including but not limited to pyridinyl, pyrimidinyl, pyrazinyl, pyrroleyl, pyrazolyl, imidazolyl, oxazole, isoxazole, thiazole, isothiazole, triazoline, thiadiazole, and oxadiazoline, which may optionally be substituted by one or more, preferably one or two, substituents selected from hydroxyl, cyano, alkyl, alkoxy, thio, lower haloalkoxy, alkylthio, halogen, lower haloalkyl, alkylsulfinyl, alkylsulfonyl, halogen, amino, alkylamino, dialkylamino, aminoalkyl, alkylaminoalkyl and dialkylaminoalkyl, nitro, alkoxycarbonyl and carbamoyl, alkylcarbamoyl, dialkylcarbamoyl, arylcarbamoyl, alkylcarbonylamino and arylcarbonylamino. Examples of bicyclic moieties include, but are not limited to, quinolinyl, isoquinolinyl, benzofuranyl, benzobenzylthio, benzoxazole, benzoisoxazole, benzothiazole, and benzoisothiazole. The bicyclic moieties may optionally be substituted on either ring; however, the bonding point is on the ring containing the heteroatom.
[0131] Unless otherwise stated, as used herein, the terms “heterocyclic group,” “heterocyclic alkyl group,” or “heterocyclic” refer to a monovalent saturated cyclic group consisting of one or more rings, preferably one or two rings, including spirocyclic systems with three to eight atoms per ring, incorporating one or more cyclic heteroatoms (selected from N, O, or S(O)). 0-2 It may optionally be independently substituted by one or more, preferably one or two, substituents selected from hydroxyl, oxo, cyano, lower alkyl, lower alkoxy, lower haloalkoxy, alkylthio, halogen, lower haloalkyl, hydroxyalkyl, nitro, alkoxycarbonyl, amino, alkylamino, alkylsulfonyl, arylsulfonyl, alkylaminosulfonyl, arylaminosulfonyl, alkylsulfonylamino, arylsulfonylamino, alkylaminocarbonyl, arylaminocarbonyl, alkylcarbonylamino, and arylcarbonylamino. Examples of heterocyclic groups include, but are not limited to, aziridine, pyrrolidinyl, hexahydroaziridine, oxadiazinyl, tetrahydrofuranyl, tetrahydrophenylthio, oxazolidinyl, thiazolyl, isoxazolidinyl, morpholinyl, piperazinyl, piperidinyl, tetrahydropyranyl, thiomorpholinyl, quininecycloyl, and imidazolinyl.
[0132] "Heterocyclic group" or "heterocyclic" refers to a group having a 3- to 14-membered non-aromatic ring system with a ring carbon atom and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("3- to 14-membered heterocyclic group"). In heterocyclic groups containing one or more nitrogen atoms, the bonding point can be a carbon or nitrogen atom, provided the valence state allows. Heterocyclic groups can be monocyclic ("monocyclic heterocyclic group") or polycyclic (e.g., fused ring, bridged ring, or spirocyclic systems, such as bicyclic systems ("bicyclic heterocyclic group") or tricyclic systems ("tricyclic heterocyclic group")), and can be saturated or may contain one or more carbon-carbon double or triple bonds. Heterocyclic polycyclic systems may include one or more heteroatoms in one or two rings. "Heterocyclic group" also includes a ring system in which a heterocyclic ring as defined above is fused with one or more carbocyclic groups, wherein the connection point is on the carbocyclic or heterocyclic ring, or a ring system in which a heterocyclic ring as defined above is fused with one or more aryl or heteroaryl groups, wherein the connection point is on the heterocyclic ring, and in such cases, the number of ring members still refers to the number of ring members in the heterocyclic ring system.
[0133] In some embodiments, the heterocyclic group is a 5-10 membered non-aromatic ring system having a cyclic carbon atom and 1-4 cyclic heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-10 membered heterocyclic group”). In some embodiments, the heterocyclic group is a 5-8 membered non-aromatic ring system having a cyclic carbon atom and 1-4 cyclic heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-8 membered heterocyclic group”). In some embodiments, the heterocyclic group is a 5-6 membered non-aromatic ring system having a cyclic carbon atom and 1-4 cyclic heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-6 membered heterocyclic group”). In some embodiments, the 5-6 membered heterocyclic group has 1-3 cyclic heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclic group has 1-2 cyclic heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heterocyclic group has 1 cyclic heteroatom selected from nitrogen, oxygen, and sulfur.
[0134] Exemplary 3-membered heterocyclic groups containing one heteroatom include, but are not limited to, aziridinyl, oxetane, and thiopyrane. Exemplary 4-membered heterocyclic groups containing one heteroatom include, but are not limited to, aziridanebutane, oxetanebutane, and thiopyranebutane. Exemplary 5-membered heterocyclic groups containing one heteroatom include, but are not limited to, tetrahydrofuranyl, dihydrofuranyl, tetrahydrophenylthio, dihydrophenylthio, pyrrolyl, dihydropyrrolyl, and pyrrolyl-2,5-diketone. Exemplary 5-membered heterocyclic groups containing two heteroatoms include, but are not limited to, dioxopentyl, oxothiopentanyl, and dithiopentanyl. Exemplary 5-membered heterocyclic groups containing three heteroatoms include, but are not limited to, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclic groups containing one heteroatom include, but are not limited to, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thiadialkyl. Exemplary 6-membered heterocyclic groups containing two heteroatoms include, but are not limited to, piperazinyl, morpholinyl, dithiaalkyl, and dioxane. Exemplary 6-membered heterocyclic groups containing three heteroatoms include, but are not limited to, triazinealkyl. Exemplary 7-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirheptanyl, oxetaneheptyl, and thioheptanyl. Exemplary 8-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirheptanyl, oxetaneheptyl, and thioheptanyl. Exemplary bicyclic heterocyclic groups include, but are not limited to, indololinyl, isoindololinyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, tetrahydrobenzothiophenyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydrochromenyl, octahydroisochromenyl, decahydronaphridyl, decahydro-1,8-naphridyl, octahydropyrrolo[3,2-b]pyrrole, indololinyl, phthalimide, naphthalimide, chromenyl, 1H-benzo[e][1,4]diazazolyl, 1,4,5,7-tetrahydropyranolo[3,4-b]pyrrole, 5, 6-Dihydro-4H-furano[3,2-b]pyrrolithyl, 6,7-Dihydro-5H-furano[3,2-b]pyrrolithyl, 5,7-Dihydro-4H-thieno[2,3-c]pyrrolithyl, 2,3-Dihydro-1H-pyrroli[2,3-b]pyridyl, 2,3-Dihydrofurano[2,3-b]pyridyl, 4,5,6,7-Tetrahydro-1H-pyrroli[2,3-b]pyridyl, 4,5,6,7-Tetrahydrofurano[3,2-c]pyridyl, 4,5,6,7-Tetrahydrothieno[3,2-b]pyridyl, 1,2,3,4-Tetrahydro-1,6-naphthidyl, etc.
[0135] "Aryl" refers to a monocyclic or polycyclic aromatic ring (e.g., bicyclic or tricyclic) group having 6-14 ring carbon atoms and no heteroatoms in the aromatic ring system (e.g., a 4n+2 aromatic ring system in which 6, 10, or 14 π electrons are enjoyed in a ring array). 6-14Aryl group (“C6 aryl”). In some embodiments, the aryl group has 6 ring carbon atoms (“C6 aryl”; for example, phenyl). In some embodiments, the aryl group has 10 ring carbon atoms (“C6 aryl”). 10 Aryl; for example, naphthyl, such as 1-naphthyl (α-naphthyl) and 2-naphthyl (β-naphthyl)). In some embodiments, the aryl group has 14 ring carbon atoms (“C”). 14 "Aryl" (e.g., anthracene). "Aryl" also includes ring systems in which an aryl ring as defined above is fused with one or more carbocyclic or heterocyclic groups, wherein the linking group or linking point is on the aryl ring, and in such cases, the number of carbon atoms still refers to the number of carbon atoms in the aryl ring system.
[0136] "Heteroaryl" refers to a 5-14 member monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., a ring array with 6, 10, or 14 π electrons) having a ring carbon atom and providing 1-4 ring heteroatoms in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-14 member heteroaryl"). In heteroaryls containing one or more nitrogen atoms, the bonding point can be a carbon or nitrogen atom, provided the valence state allows. Heteroaryl polycyclic systems may include one or more heteroatoms in one or two rings. "Heteroaryl" includes a ring system in which the heteroaryl ring as defined above is fused with one or more carbocyclic or heterocyclic groups, wherein the bonding point is on the heteroaryl ring, and in such cases, the ring membership number still refers to the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which a heteroaryl ring, as defined above, is fused with one or more aryl groups, wherein the linking point is on the aryl or heteroaryl ring, and in such cases, the ring membership number still refers to the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. In polycyclic heteroaryl rings (e.g., indolyl, quinolinyl, carbazolyl, etc.) where one ring does not contain a heteroatom, the linking point can be on either ring, i.e., a ring with a heteroatom (e.g., 2-indolyl) or a ring without a heteroatom (e.g., 5-indolyl).
[0137] In some embodiments, the heteroaryl group is a 5-10 membered aromatic ring system having a cyclic carbon atom and providing 1-4 cyclic heteroatoms in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-10 membered heteroaryl”). In some embodiments, the heteroaryl group is a 5-8 membered aromatic ring system having a cyclic carbon atom and providing 1-4 cyclic heteroatoms in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-8 membered heteroaryl”). In some embodiments, the heteroaryl group is a 5-6 membered aromatic ring system having a cyclic carbon atom and providing 1-4 cyclic heteroatoms in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5-6 membered heteroaryl”). In some embodiments, the 5-6 membered heteroaryl group has 1-3 cyclic heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heteroaryl group has 1-2 cyclic heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6 membered heteroaryl group has one cyclic heteroatom selected from nitrogen, oxygen, and sulfur.
[0138] Exemplary 5-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrroleyl, furanyl, and phenylthioyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetraazinyl, respectively. Exemplary 7-membered heteroaryl groups containing one heteroatom include, but are not limited to, aziryl, oxazinyl, and thioazinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazole, benzotriazolyl, benzobenzylthio, isobenzobenzylthio, benzofuranyl, benzoisofuranyl, benzoimidazolyl, benzoxazolyl, benzoisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolazinyl, and purinel. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthidyl, pteridyl, quinolinyl, isoquinolinyl, cenolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary tricyclic heteroaryl groups include, but are not limited to, phenanthridine, dibenzofuranyl, carbazole, acridineyl, phenothiazinyl, phenotoxazinyl, and phenothiazinyl.
[0139] "Saturation" refers to a ring portion that does not contain double or triple bonds, meaning that the ring contains only single bonds.
[0140] Alkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be substituted. Optional substitution refers to groups that can be substituted or are not substituted. Generally, the term "substituted" means that at least one hydrogen atom present on the group is replaced by a non-hydrogen substituent, and the substitution results in a stable compound, such as a compound that does not spontaneously undergo transformations such as through rearrangement, cyclization, elimination, or other reactions. Heteroatoms such as nitrogen, oxygen, and sulfur may have hydrogen substituents and / or non-hydrogen substituents that satisfy the heteroatom's valence state and lead to the formation of a stable compound.
[0141] As used herein, an exemplary non-hydrogen substituent where a portion is "optionally substituted" means that the portion may be substituted by any other portion selected from, but not limited to, the following: halogen, –CN, –NO2, –N3, –SO2H, –SO3H, –OH, –OR aa –N(R) bb 2. –N(OR) cc )R bb –SH, –SR aa –C(=O)R aa –CO2H, –CHO, –CO2R aa –OC(=O)R aa –OCO2R aa –C(=O)N(R) bb )2、–OC(=O)N(R bb )2、–NR bb C(=O)R aa –NR bb CO2R aa –NR bb C(=O)N(R bb )2、–C(=NR bb )R aa –C(=NR) bb OR aa –OC(=NR) bb )R aa –OC(=NR) bb OR aa –C(=NR) bb )N(R bb )2、–OC(=NR bb )N(R bb )2、–NR bb C(=NR bb )N(R bb )2、–C(=O)NR bb SO2R aa –NR bb SO2R aa –SO2N(R) bb)2、–SO2R aa –S(=O)R aa –OS(=O)R aa -B(OR) cc 2. C 1–10 Alkyl, C 2–10 alkenyl, C 2–10 alkynyl group, C 3–14 Carbocyclic groups, 3 to 14-membered heterocyclic groups, C 6–14 Aryl and 5 to 14-membered heteroaryl groups, wherein each alkyl, alkenyl, alkynyl, carbocyclic, heterocyclic, aryl, and heteroaryl group is independently bounded by 0, 1, 2, 3, 4, or 5 R groups. dd Group substitution, or the replacement of two hydrogen atoms on a carbon atom by the =O group; each R that appears aa Selected independently from C 1–10 Alkyl, C 1–10 All-halogenated alkyl, C 2–10 alkenyl, C 2–10 alkynyl group, C 3–14 Carbocyclic groups, 3 to 14-membered heterocyclic groups, C 6–14 aryl and 5 to 14 heteroaryl, or two R aa The groups are linked to form a 3- to 14-membered heterocyclic group or a 5- to 14-membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclic, heterocyclic, aryl, and heteroaryl group is independently bounded by 0, 1, 2, 3, 4, or 5 R groups. dd Group substitution; each R that appears bb Independently selected from hydrogen, –OH, –OR aa –N(R) cc )2、–CN、–C(=O)R aa –C(=O)N(R) cc )2、–CO2R aa –SO2R aa –SO2N(R) cc )2、–SOR aa C 1–10 Alkyl, C 1–10 All-halogenated alkyl, C 2–10 alkenyl, C 2–10 alkynyl group, C 3–14 Carbocyclic groups, 3 to 14-membered heterocyclic groups, C 6–14 aryl and 5 to 14 heteroaryl, or two R bb The groups are linked to form a 3- to 14-membered heterocyclic group or a 5- to 14-membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclic, heterocyclic, aryl, and heteroaryl group is independently bounded by 0, 1, 2, 3, 4, or 5 R groups. dd Group substitution; each R that appears cc Independently selected from hydrogen and C 1–10 Alkyl, C1–10 All-halogenated alkyl, C 2–10 alkenyl, C 2–10 alkynyl group, C 3–14 Carbocyclic groups, 3 to 14-membered heterocyclic groups, C 6–14 aryl and 5 to 14 heteroaryl, or two R cc The groups are linked to form a 3- to 14-membered heterocyclic group or a 5- to 14-membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclic, heterocyclic, aryl, and heteroaryl group is independently bounded by 0, 1, 2, 3, 4, or 5 R groups. dd Group substitution; and each R that appears dd Independently selected from halogens, –CN, –NO2, –N3, –SO2H, –SO3H, –OH, –OC 1–6 Alkyl, –ON(C 1–6 Alkyl)2、–N(C 1–6 Alkyl)2、–N(OC) 1–6 Alkyl)(C 1–6 Alkyl), –N(OH)(C 1–6 Alkyl groups, –NH(OH), –SH, –SC 1–6 Alkyl group, –C(=O)(C 1–6 Alkyl group), –CO2H, –CO2(C 1–6 Alkyl), –OC (=O)(C 1–6 Alkyl), –OCO2(C 1–6 Alkyl groups, –C(=O)NH2, –C(=O)N(C 1–6 Alkyl)2、–OC(=O)NH(C 1–6 Alkyl), –NHC(=O)(C 1–6 Alkyl), –N(C) 1–6 Alkyl)C(=O)( C 1–6 Alkyl), –NHCO2(C 1–6 Alkyl), –NHC(=O)N(C 1–6 Alkyl)2、–NHC(=O)NH(C 1–6 Alkyl groups), –NHC(=O)NH2, –C(=NH)O(C 1–6 Alkyl), –OC(=NH)(C 1–6 Alkyl group), –OC (=NH)OC 1–6 Alkyl group, –C(=NH)N(C 1–6 Alkyl)2、–C(=NH)NH(C 1–6 Alkyl groups, –C(=NH)NH2, –OC(=NH)N(C 1–6 Alkyl)2、–OC(NH)NH(C 1–6 Alkyl groups), –OC(NH)NH2, –NHC(NH)N(C 1–6Alkyl)2, –NHC(=NH)NH2, –NHSO2(C 1–6 Alkyl), –SO2N(C 1–6 Alkyl)2、–SO2NH(C 1–6 Alkyl groups, –SO2NH2, –SO2C 1–6 Alkyl group, -B(OH)2, -B(OC) 1–6 Alkyl)2, C 1–6 Alkyl, C 1–6 All-halogenated alkyl, C 2–6 alkenyl, C 2–6 alkynyl group, C 3–10 carbon cyclo group, C 6–10 aryl, 3- to 10-membered heterocyclic and 5- to 10-membered heteroaryl; or two geminal R groups on a carbon atom. dd Substituents can connect to form =O.
[0142] "Halogen" or "halogen" refers to fluorine (fluorinated, -F), chlorine (chlorinated, -Cl), bromine (brominated, -Br), or iodine (iodinated, -I).
[0143] As used herein, the term "composition" is intended to cover products that contain the specified ingredients and any products produced directly or indirectly from combinations of the specified ingredients.
[0144] “Salt” includes any and all salts. “Pharmaceutically acceptable salts” are those salts that, within reasonable medical judgment, are suitable for use in contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic reactions, etc., and in proportion to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. in… J. Pharmaceutical SciencesPharmaceutically acceptable salts are described in detail in (1977) 66:1–19. Pharmaceutically acceptable salts include salts derived from inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include salts formed by amino groups with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods employed in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogen sulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, disaccharide, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucono-heptahydrate, glyceryl phosphate, gluconate, hemisulfate, heptahydrate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lacturonate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, dihydroxynaphthalate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, neopentanoate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and nitrogen salts. + (C 1–4 Alkyl)4 salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharmaceutically acceptable salts include non-toxic ammonium salts, quaternary ammonium salts, and amine cation salts formed, where appropriate, with the use of counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.
[0145] Unless otherwise stated, the compounds described herein may contain one or more asymmetric centers and therefore may exist in a variety of stereoisomeric forms, such as enantiomers and / or diastereomers. For example, the compounds described herein may be in the form of individual enantiomers, diastereomers, or geometric isomers, or may be in the form of mixtures of stereoisomers, including racemic mixtures and mixtures enriched with one or more stereoisomers. Isomers can be separated from mixtures by methods known to those skilled in the art, including chiral high-performance liquid chromatography (HPLC). The compounds described herein may be in the form of individual isomers substantially free of other isomers, or in mixtures of various isomers.
[0146] Unless otherwise stated, the structures described herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the structure of the invention but with hydrogen replaced by deuterium or tritium... 19 F was18 F replacement, carbon bedding 13 C- or 14 C-enrichment carbon substitution and / or oxygen atoms being... 18 O-substituted compounds are within the scope of this disclosure. Other examples of isotopes include... 15 N、 18 O、 17 O、 31 P, 32 P, 35 S, 18 F, 36 Cl and 123 I. Compounds with such isotopically enriched atoms can be used as analytical tools or probes, for example, in bioassays.
[0147] Some isotope-labeled compounds (e.g., with) 3 H and 14 C-labeled compounds can be used for the determination of compound and / or substrate tissue distribution. Tritiumization (i.e., 3 H) and carbon-14 (i.e., ... 14 C) Isotopes are particularly preferred due to their ease of preparation and detectability.
[0148] Certain isotope-labeled compounds of formula (I) can be used for medical imaging purposes, such as positron-emitting isotopes. 11 C or 18 F-labeled compounds can be used in positron emission tomography (PET) applications and to emit isotopes using gamma rays, such as... 123 I-labeled compounds can be used in single-photon emission computed tomography (SPECT) applications. Furthermore, heavier isotopes such as deuterium (i.e.,...) can be used... 2 H) substitution can offer certain therapeutic advantages due to greater metabolic stability (e.g., increased in vivo half-life or reduced dose requirement), and may therefore be preferred in some cases. Furthermore, the use of heavier isotopes such as deuterium (i.e., 2 H) substitution can offer certain therapeutic advantages due to increased metabolic stability (e.g., increased in vivo half-life or reduced dose requirement), and may therefore be preferred in some cases. Additionally, isotopic substitution at the site of epimerization can slow down or weaken the epimerization process, thereby maintaining the more active or more potent form of the compound for a longer period. Isotopically labeled compounds of formula (I), particularly those containing a longer half-life (t), can generally be prepared by replacing the non-isotopically labeled reagent with a suitable isotopically labeled reagent according to a procedure similar to that disclosed in the schemes and / or examples herein. 1 / 2 Compounds of isotopes with a concentration greater than 1 day.
[0149] If there is a discrepancy between the described structure and the name given to that structure, the described structure shall prevail. Furthermore, if the stereochemistry of a structure or part thereof is not indicated, for example, in bold or dashed lines, then that structure or part thereof should be interpreted to encompass all its stereoisomers. However, in some cases where more than one chiral center is present, the structure and name may be represented as a single enantiomer to aid in describing the relative stereochemistry. Those skilled in the art of organic synthesis will know from the methods used to prepare the compound whether it is prepared as a single enantiomer.
[0150] Example abbreviation Commonly used abbreviations include: Acetyl (Ac), Azobisisobutyronitrile (AIBN), Atmospheric pressure (Atm), 9-boronbicyclo[3.3.1]nonane (9-BBN or BBN), tert-butyloxycarbonyl (Boc), di-tert-butyl pyrocarbonate or boc anhydride (BOC2O), benzyl (Bn), butyl (Bu), Chemical Abstracts Service Registry Number (CASRN), benzyloxycarbonyl (CBZ or Z), carbonyl diimidazole (CDI), 1,4-diazabicyclo[2.2.2]octane (DABCO), diethylaminosulfur trifluoride (DAST), dibenzylacetone (dba), 1,5-diazabicyclo[4.3.0]non-5-ene (DBN), 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), N,N'-dicyclohexylcarbodiimide (DCC), 1,2-dichloro Ethane (DCE), dichloromethane (DCM), diethyl azodicarbonate (DEAD), diisopropyl azodicarbonate (DIAD), diisobutylaluminum hydride (DIBAL or DIBAL-H), 1,3-diisopropylcarbodiimide (DIC), diisopropylethylamine (DIPEA), N,N-dimethylacetamide (DMA), 4-N,N-dimethylaminopyridine (DMAP), N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,1'-bis-(diphenylphosphino)ethane (dppe), 1,1'-bis-(diphenylphosphino)ferrocene (dppf), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI), ethyl (Et), ethyl acetate (EtOAc), ethanol (EtOH), 2-ethoxy-2 H1-Quinoline-1-carboxylic acid ethyl ester (EEDQ), diethyl ether (Et2O), O-(7-azabenzotriazol-1-yl)-N,N,N'N'-tetramethylureonium hexafluorophosphate acetic acid (HATU), acetic acid (HOAc), 1-N-hydroxybenzotriazole (HOBt), high performance liquid chromatography (HPLC), isopropanol (IPA), lithium hexamethyldisilazane (LiHMDS), methanol (MeOH), melting point (mp), MeSO2-(methanesulfonyl) Or Ms), methyl (Me), acetonitrile (MeCN), m-chloroperoxybenzoic acid (MCPBA), mass spectrometry (ms), methyl tert-butyl ether (MTBE), N-bromosuccinimide (NBS), N-carboxylic anhydride (NCA), N-chlorosuccinimide (NCS), N-methylmorpholine (NMM), N-methylpyrrolidone (NMP), pyridinium chlorochromate (PCC), pyridinium dichromate (PDC), phenyl (Ph), propyl (Pr), isopropyl ( i -Pr), psi, pyridine (pyr), room temperature (rt or RT), tert-butyldimethylsilyl or t -BuMe2Si (TBDMS), triethylamine (TEA or Et3N), 2,2,6,6-tetramethylpiperidine-1-oxy (TEMPO), trifluoromethanesulfonate or CF3SO2- (Tf), trifluoroacetic acid (TFA), 1,1'-bis-2,2,6,6-tetramethylheptane-2,6-dione (TMHD), O-benzotriazol-1-yl-N,N,N',N'-tetramethylureon tetrafluoroborate (TBTU), thin-layer chromatography (TLC), tetrahydrofuran (THF), trimethylsilyl or Me3Si (TMS), p-toluenesulfonic acid monohydrate (TsOH or pTsOH), 4-Me-C6H4SO2- or toluenesulfonyl (Ts), N-urethane-N-carboxylic anhydride (UNCA). Including the prefix positive ( n ),different( i- ), Zhong( sec- Uncle tert- ) and new ( neo Conventional nomenclature, including alkyl moiety, has its usual meaning when used with alkyl groups. (J. Rigaudy and DP Klesney, Nomenclature in Organic Chemistry IUPAC 1979 Pergamon Press, Oxford.).
[0151] Biological program Cell lines and cultures The following cell lines were used in this study: HL-60, OCI-AML-2, OCI-AML-3, HB11;19, MV4-11, MOLM-13, Kasumi-1, EOL1, KBM7 iCas9, K562, KBM7, Lenti-X 293 T, and HEK293T. All cell lines were cultured in RPMI-1640, IMDM, or DMEM medium supplemented with streptomycin and penicillin, containing 10% or 20% heat-inactivated fetal bovine serum (FBS), and stored at 37°C and 5% CO2. HB11;19, MV4;11, MOLM13, and EOL1 cell lines were cultured in 10% FBS in RPMI-1640. OCI-AML-2, OCI-AML-3, Kasumi-1, and CMK cell lines were cultured in 20% FBS in RPMI-1640. HEK293T and Lenti-X 293 T cell lines were cultured in DMEM with 10% FBS. HL-60 and KBM7 cells were cultured in IMDM supplemented with 10% FBS. Commercial cell lines were obtained from ATCC or DSMZ and were authenticated using short tandem repeat (STR) DNA analysis prior to use. The HB11;19 cell line was generously provided by Akihiko Yokoyama. KBM7 iCas9 cells were a gift from J. Zuber. All cell lines were confirmed to be mycoplasma negative at 1-month intervals.
[0152] For lentivirus generation, Lenti-X 293 T cells were seeded in 6-well plates or 10 cm culture dishes and transfected using PEI (PolySciences) with 0.6 / 3.4 μg target plasmid, 1.7 / 0.3 μg psPAX2 (Addgene 12260), and 0.85 / 0.15 μg pMD2.G (Addgene 12259) at approximately 80% confluence. Viral supernatant was collected 60 hours later, filtered through a 0.45 μm filter, and stored in aliquots for transduction.
[0153] Vitality Research To assess drug response, 20 x 10⁶ cells were seeded per well in a 96-well plate (VWR) treated with non-tissue culture. 5 MV4;11 or HL-60 cells, and treated with 0.1% DMSO or increased concentration ( R )-or( SCells were treated with dHTC1 at concentrations of 39.07 nM, 78.13 nM, 156 nM, 312 nM, 625 nM, 1.25 µM, 2.5 µM, 5 µM, and 10 µM. Cells were passaged at a 1:10 ratio, with fresh drug added every 3 days. Cell proliferation was measured on day 12 using the CellTiterGlo® Luminescent Cell Viability Assay (Promega). Drug response was calculated based on luminescence relative to the DMSO-treated sample. Experiments were independently repeated 3 times with technical replicates, and mean luminescence was calculated for each technical replicate. The graphs show the mean of the three experiments, and the error bars represent the standard error (SEM) of the mean.
[0154] ENL-HiBiT cell line The following cell lines generated N-terminal ENL HiBiT cells with endogenous markers via homologous directed repair are: OCI-AML2, OCI-AML3, MV4;11 (WT and CRBN KO ( 31 The required components were MOLM-13, EOL1, and HL60. All necessary components were purchased from Integrated DNA Technologies. Cells were electroporated using the Neon transfection system (ThermoFisher). In short, the sgRNA complex was synthesized by mixing equal volumes of crRNA (2 µL, 160 µM, in nuclease-free water, ggcgccagccatggacaatc) and tracrRNA (2 µL, 160 µM), incubating at 37°C for 30 min, followed by the addition of Cas9 (2.7 µL, 10 µg / µL, Alt-R™ Sp Cas9 nuclease V3, catalog number 1081058) and double-stranded buffer (1.3 µL, 30 mM HEPES, pH 7.5; 100 mM potassium acetate, in nuclease-free water). The suspension was then incubated at 37°C for another 15 min to form an active RNP complex. Add 1 µL of RNP solution to ssODN (2 µM, in nuclease-free water). Electroporate 200,000 cells in the resulting mixture in electroporation buffer and deposit the cells into antibiotic-free medium (see [conditions] for details). Cell lines and culturesThe sample was incubated at 37°C for 24 hours, and then additional antibiotic-containing medium was added. Replicates with the highest overall signal were selected and amplified.
[0155] The electroporation conditions for each cell line are as follows: MV4;11, OCI-AML2, OCI-AML3, MV4;11, MOLM-13, EOL1: 1600 pulse voltage, 10 ms pulse width, 3 pulses. HL-60: 1350 pulse voltage, 35 ms pulse width, 1 pulse.
[0156] MV4;11 BRD4-HiBiT cell line All necessary components were purchased from Integrated DNA Technologies. Cells were electroporated using the Neon transfection system (ThermoFisher). In short, the sgRNA complex was synthesized by mixing equal volumes of crRNA (2 µL, 160 µM, in nuclease-free water, aatcttttctgagcgcacct) and tracrRNA (2 µL, 160 µM), incubating at 37°C for 30 min, followed by the addition of Cas9 (2.7 µL, 10 µg / µL, Alt-R™ Sp Cas9 nuclease V3, catalog number 1081058) and double-stranded buffer (1.3 µL, 30 mM HEPES, pH 7.5; 100 mM potassium acetate, in nuclease-free water). The suspension was then incubated at 37°C for another 15 min to form an active RNP complex. Add 1 µL of RNP solution to ssODN (2 µM, in nuclease-free water). Electroporate 200,000 cells in the resulting mixture in electroporation buffer (1600 pulse voltage, 10 ms pulse width, 3 pulses) and deposit the cells into antibiotic-free medium (see [conditions]). Cell lines and cultures The sample was incubated at 37°C for 24 hours, and then additional antibiotic-containing medium was added. Replicates with the highest overall signal were selected and amplified.
[0157] endpoint HiBiT protein degradation MV4;11 cells were engineered using a protocol adapted from the Neon™ Transfection System Rapid Reference, employing CRISPR to knock HiBiT tags into the n-terminus of ENL and the c-terminus of BRD4. Cells were seeded at 20,000 cells / well in 384-well plates and treated with the specified compound and equivalent concentration of DMSO for the time specified in the experiment, typically 3 h, 24 h, or 72 h. The levels of HiBiT-tagged proteins were detected via luminescence using the Nano-Glo® HiBiT lysis detection system (Promega, catalog number N3050). Dose-response curves were fitted using nonlinear regression, and the data presented are from n=3 or n=4 independent replicates, i.e., the mean plus or minus the standard error of the mean.
[0158] ENL Intracellular Conjugation Assay Intracellular ENL binding assays were performed as previously described. 80 In short, the drug was transferred at a 10-point dose-response ratio (100 nL) into the wells of a 384-well plate treated with white tissue culture using an Echo acoustic liquid processor (Labcyte). Stable ENL(YEATS)-HiBiT-expressing OCI / AML-2 cells were added to these wells at a concentration of 20,000 cells per 20 µL of medium. The plate was placed on an orbital oscillator for 15 seconds, then incubated at 37°C for 3 hours or another specified time, after which each well was treated with a 20 µL Nano-Glo® HiBiT lysis detection system (Promega, N3050). Following this treatment, the plate was mixed on an orbital oscillator for 15 seconds and allowed to stand in the dark for 20 minutes, after which luminescence was measured using a Clariostar microplate reader (BMG Labtech). The luminescence values were normalized relative to the DMSO-treated wells, and a dose-response curve was fitted using nonlinear regression.
[0159] CRBN Intracellular Binding Assay The drug was delivered in 10-point dose-response transfers (100 nL) to the wells of a 384-well plate treated with white tissue culture using an Echo acoustic liquid processor (Labcyte). MV4;11 cells stably expressing endogenous BRD4 with C-terminal HiBiT were added at a concentration of 20,000 cells per 18 µL of medium. 31The plate was then mixed on an orbital shaker for 15 seconds. The plate was incubated at 37°C for 2 hours, then 2 µL of 5 µM dBET6 solution in RPMI containing 10% FBS was added to each well, and the plate was again placed on an orbital shaker for 15 seconds (the final concentration of dBET6 was 500 nM; control wells were treated with an equal volume of DMSO in RPMI containing 10% FBS). After incubation at 37°C for 1 hour, each well was treated with 20 µL of a Nano-Glo® HiBiT lysis detection system (Promega, N3050). Following this treatment, the plate was mixed on an orbital shaker for 15 seconds and allowed to stand in the dark for 20 minutes, then luminescence was measured using a Clariostar microplate reader (BMG Labtech). The luminescence values were normalized relative to the DMSO-treated wells, and a dose-response curve was fitted using nonlinear regression.
[0160] Cell viability assay Using an Echo acoustic liquid processor (Labcyte), the drug was transferred in 10-point dose-response transfers (100 nL) to empty wells in a 384-well plate treated with white tissue culture. Designated cells were added at a concentration of 1,000 cells per 50 µL of culture medium, and the plate was mixed on an orbital oscillator for 15 seconds. After 72 hours or a specified time, 25 µL of an ATPlite™ 1-step luminescence assay system (Perkin Elmer / Revvity) was added to each well, and the plate was mixed on an orbital oscillator for 15 seconds. After incubation in the dark for 20 minutes, luminescence was measured using a Clariostar microplate reader (BMG Labtech). The luminescence values were normalized relative to the DMSO-treated wells, and a dose-response curve was fitted using nonlinear regression.
[0161] Protein blot For adherent cell lines, cells are spaced at approximately 1 x 10⁻⁶ cells per well. 6 10 cells were seeded in 6-well or 12-well plates and allowed to adhere overnight. For suspension systems, cells were seeded at a rate of 1 x 10⁶ cells per well. 6Cells were seeded and used shortly thereafter. Wells were treated with the specified compound for the time specified in each experiment. Cells were then washed with ice-cold PBS and lysed with 1X RIPA buffer (Life Technologies) supplemented with protease and phosphatase inhibitors. Lysates were sonicated and centrifuged, and the supernatant was collected. Protein concentration in cell lysates was measured using the BCA assay. 25 µg of denatured total protein from each sample was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 4%–12% Bis-Tris gel and transferred to nitrocellulose membranes. Membranes were blocked with 5% milk in TBST and then incubated overnight at 4°C with primary antibodies (all antibodies were diluted 1:1000 in 5% milk in TBST, while GAPDH primary antibody was diluted 1:5000 in 5% milk in TBST). The bound primary antibody was incubated with appropriate secondary antibodies (IRDye680 goat anti-mouse: 925-68070, IRDye800 goat anti-rabbit: 926-32211, diluted 1:5000 in 5% milk in TBST). The secondary antibody was incubated at room temperature for 90 minutes, then washed with additional TBST and visualized on an Odyssey CLx (Li-Cor Biosciences).
[0162] Alternatively, MV4;11 CRBNs rescued using wild-type or mutant CRBNs will be used. - / - ENL-TagBFP-P2A-mCherry cells at 1x10 6Cells were seeded at 100 cells / mL in 12-well plates and treated with DMSO, 1 μM dHTC1, or 1 μM SR-1114 for 6 h. Cells were washed twice in ice-cold PBS and lysed on ice for 15 min with RIPA buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with a mixture of benzonase protease (25 U / mL) and 1x Halt protease inhibitor. After centrifugation, protein concentration of the lysates was determined using a Pierce BCA protein assay system (23225, Fisher Scientific), and 30 μg of lysate was prepared using 4x LDS sample buffer (Thermo Fisher) and 10% 2-mercaptoethanol and run on NuPAGE 4%–15% bis-tris gel (Thermo Fisher). Proteins were transferred to nitrocellulose membranes, blocked in 5% milk TBS-T at room temperature for 30 minutes, and then incubated with primary antibodies at room temperature for 1 hour. The following primary antibodies were used: ENL (1:1,000, D9M4B, Cell Signaling Technology), CRBN (1:2,000, a gift from R. Eichner and F. Bassermann), and GAPDH (1:2,000, FL-335, Santa Cruz Biotechnology). The membranes were then washed in TBS-T and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 45 minutes, followed by further washing and development with a chemiluminescent membrane. The secondary antibodies used were peroxidase-conjugated AffiniPure goat anti-rabbit IgG (1:10,000, Jackson Immuno Research, 111-035-003) and peroxidase-conjugated AffiniPure goat anti-mouse IgG (1:10,000, Jackson Immuno Research, 115-035-003).
[0163] For Western blotting of xenografted MV4;11 cells, mouse cell removal was performed on whole bone marrow cells using a mouse cell removal kit and an LS column (Miltenyi Biotec). Purified human cells were lysed using RIPA, and 25 µg of protein was loaded onto a 10% Bis-Tris-GelNuPAGE gel containing MOPS SDS running buffer (Life Technologies). Samples were transferred to a nitrocellulose iBlot 3 transfer membrane kit (Life Technologies) using an iBlot 3 gel transfer device (Thermo Fisher). The membranes were blocked in 5% milk in TBS-Tween buffer (TBST) at room temperature for one hour and incubated overnight at 4°C with antibodies against ENL (Millipore, 1:1000 in 5% milk in TBST) or GAPDH (Cell Signaling Technologies, 1:1000 in 5% milk in TBST). The membrane was washed and then incubated with IrDye® 800CW donkey-rabbit secondary antibody (Thermo Fisher Scientific, 1:7000 in 5% milk at TBST) for one hour at room temperature, followed by washing. The membrane was then imaged on a LI-COR imager.
[0164] Primary antibodies used: ENL: D9M4B (Cell Signaling Technologies) or ABE2596-100UG (Millipore) AF9: E5Z7U (Cell Signaling Technologies) GAPDH: sc-32233 (Santa Cruz Biotechnology) The secondary antibody used: Goat anti-mouse IgG with IRDye 680RD: 925-68070 (Li-Cor) Goat anti-rabbit IgG with IRDye 800CW: 926-32211 (Li-Cor) HRP-containing goat anti-rabbit IgG: 111-035-003 (Jackson ImmunoResearch) HRP-containing goat anti-mouse IgG: 115-035-003 (Jackson ImmunoResearch) Donkey-to-rabbit antibiotic with IRDye800CW: 926-32213 (Li-Cor) Expression proteomics Sample preparation The treated cells were resuspended in 200 µL of cold DPBS containing a protease inhibitor (COPLETE ULTRAtablets mini EDTA-free, Roche, catalog number 05892791001; dissolve one tablet in 10 mL of DPBS before use). Cells were lysed by probe sonication using a Branson Sonifer 250 sonic cell disruptor (2 x 12 pulses, 10% power output). The protein content of the whole-cell lysate was determined using a DC protein assay (Bio-Rad, catalog numbers 5000113 and 5000114), with absorbance measured at 750 nm on a CLARIOstar plate reader. A volume corresponding to 200 µg of protein was transferred to a new low-binding Eppendorf tube containing 48 mg of urea, bringing the total volume to 100 µL. The sample was reduced with DTT by adding 5 µL of 200 mM solution (10 mM final concentration) and incubated at 65 °C for 15 min. Next, the samples were alkylated with iodoacetamide by adding 5 µL of 400 mM solution (20 mM final concentration) and incubated in the dark at 37 °C for 30 min. Proteins in each sample were precipitated by adding cold MeOH (500 µL), CHCl3 (100 µL), and H2O (400 µL). The samples were vortexed and centrifuged (16000 g, 10 min, 4 °C). The supernatant was aspirated, leaving protein discs, and another 1 mL of cold MeOH was added. The samples were vortexed and centrifuged again (16000 g, 10 min, 4 °C). The supernatant was aspirated, and the protein precipitates were briefly air-dried. The protein precipitates were then resuspended in 160 µL of EPPS buffer (200 mM, pH 8.0) by probe sonication (10 pulses, 10% power output). The proteome was digested with Lys-C by adding 4 µL of 0.5 µg / µL Lys-C solution in HPLC-grade water, and the samples were incubated at 37 °C for 2 h. The proteome was then digested with trypsin by adding 8 µL of 0.5 µg / µL trypsin solution in trypsin resuspension buffer with 20 mM CaCl2, and the samples were incubated overnight at 37 °C. Peptide concentrations were determined using a Micro BCA™ assay (Thermo Scientific, catalog number 23235), and volumes corresponding to 25 µg were transferred to new low-binding Eppendorf tubes and brought to a total volume of 25 µL with EPPS buffer. 9 µL of HPLC-grade acetonitrile was added to each sample, followed by 3 µL (20 µg / µL, in anhydrous acetonitrile) of the corresponding TMT. 6plexLabel the samples and vortex the reactants, incubating at room temperature for 1 hour, repeating the vortexing every 20 minutes. Quench the reaction by adding 6 µL of 5% hydroxylamine in H₂O solution, vortex, and incubate at room temperature for 15 minutes. Acidify each sample by adding 2.5 µL of LCMS-grade formic acid. Combine the samples by taking 25 µL of each sample (approximately 12.5 µg of labeled peptide per channel) and centrifuging under vacuum. Desalt the combined samples using a Sep-Pak C18 column and fractionate offline by HPLC.
[0165] Sample desalting and offline fractionation The sample was resuspended in 500 µL of buffer A (95% H2O, 5% acetonitrile, 0.1% formic acid), vortexed, and sonicated in a water bath at room temperature for 5 minutes. Before loading the sample onto a Sep-Pak C18 column (Waters, catalog number WAT054955), the column was conditioned with acetonitrile (3 x 1 mL) and equilibrated with buffer A (3 x 1 mL). The sample was then loaded onto the column, and the sample flow was added back onto the column. The sample was desalted by adding buffer A (3 x 1 mL) and allowing it to pass through, followed by elution with 1 mL of buffer B (80% acetonitrile, 20% H2O, 0.1% formic acid). The eluted sample was collected into a new low-binding Eppendorf tube and evaporated to dryness using a SpeedVac vacuum concentrator.
[0166] The sample was then resuspended in 500 µL of buffer A and fractionated using Agilent HPLC (Agilent Infinity 1260 II system) into 96-well plates containing 20 µL of 20% formic acid, as previously reported. 81, 82The peptide was eluted onto a capillary column (ZORBAX Extend-C18, 80 Å, 4.6 x 250 mm, 5 µM) using a gradient of 0.5 μL of buffer A (10 mM NH4HCO3 aqueous solution) and buffer B (100% acetonitrile). Separation at flow rates of mL / min: 0-2 minutes for 100% buffer A, 2-3 minutes for 0%-13% buffer B, 3-60 minutes for 13%-42% buffer B, 60-61 minutes for 42%-100% buffer B, 61-65 minutes for 100% buffer B, 65-66 minutes for 100%-0% buffer B, 66-75 minutes for 100% buffer A, 75-78 minutes for 0%-13% buffer B, 78-80 minutes for 13%-80% buffer B, 80-85 minutes for 80% buffer B, 86-91 minutes for 100% buffer A, 91-94 minutes for 0%-13% buffer B, 94-96 minutes for 13%-80% buffer B, 96-101 minutes for 80% buffer B, and 101-102 minutes for 80%-0% buffer B. Evaporate the eluent collected in the 96-well plate to dryness using a SpeedVac vacuum concentrator. Resuspend the peptides in 80% acetonitrile containing 0.1% formate buffer and combine them into 12 fractions (fractions are combined along one column of the plate) by adding 200 µL of buffer, resuspend by pipetting, and combine to the next row. Repeat the process with another 200 µL. The final volume of each fraction is 400 µL, and evaporate to dryness using a SpeedVac vacuum concentrator.
[0167] TMT liquid chromatography-mass spectrometry (LC-MS) analysis The dried fraction was dissolved in 50 mL of 0.1% trifluoroacetic acid and desalted using 2 μg capacity ZipTips (Millipore, Billeric, MA) according to the manufacturer's instructions. The peptide was then eluted online from an EASY PepMap™ RSLC C18 column (2 µm, 100 Å, 75 μm x 50 cm, Thermo Scientific, San Jose, CA) to a Fusion Tribrid mass spectrometer (Thermo Scientific, San Jose, CA) and held for 15 min with 6% Solvent B (80 / 20 acetonitrile / water, 0.1% formic acid). The following gradient was then applied: 6%–28% Solvent B over 105 min, 28%–49% Solvent B over 15 min, 40%–100% Solvent B over 10 min, 100% Solvent B for 10 min, restored to 5% Solvent B over 3 min, and finally held for 3 min with 5% Solvent B. Then, for column cleaning purposes, the gradient was extended as follows: Solvent B was increased to 100% over 3 minutes, held at 100% solvent B for 10 minutes, then returned to 5% solvent B over 3 minutes, held at 5% solvent B for 3 minutes, then increased to 100% solvent B again over 3 minutes, held at 100% solvent B for 10 minutes, then returned to 5% solvent B over 3 minutes, held at 5% solvent B for 3 minutes, and finally increased to 100% solvent B for the last time over 3 minutes, and held at 100% solvent B for 10 minutes. All flow rates were 250 nL / min, delivered using an nEasy-LC1000 nano-liquid chromatography system (Thermo Scientific, San Jose, CA). Solvent A consisted of water and 0.1% formic acid. Ions were generated using an EASY Spray source (Thermo Scientific, San Jose, CA) maintained at 50 °C at 2.0 or 1.9 kV. Based on Ting et al. ( 83The study employed simultaneous precursor selection (SPS)-MS3 mass spectrometry. MS1 was scanned at a resolution of 120,000 between 380 and 2000 m / s using an Orbitrap mass analyzer with a standard AGC target (as defined in ThermoScientific Xcalibur v 4.6.67.17) and a maximum injection time of 50 ms. Collision-induced dissociation (CID) was then performed in a linear ion trap with 2–8 charge peptide monoisotope ions above an intensity threshold of 5E3, using a quadrupole isolation of 0.7 m / s and 35% of the CID energy. The ion trap AGC target was also set to standard, with a maximum injection time of 50 ms. The dynamic exclusion duration was set to 60 seconds, and ions were excluded after one pass within a + / - 10 ppm mass tolerance window. The top 10 MS2 ions in the ion trap between 400 and 1200 m / s were then selected for higher-energy C-trap dissociation (HCD) at 65% of the energy. Detection occurred in Orbitrap at a resolution of 50,000, an AGC target of 1E5 (or 200% custom settings, as defined in Thermo Scientific Xcalibur v4.6.67.17), and an injection time of 120 milliseconds (MS3). All scan events occurred within a specified cycle time of 3 seconds. Analysis was performed at The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology, Mass Spectrometry and Proteomics Core Facility (RRID: SCR_023576).
[0168] Peptide and protein identification and quantification The raw spectral files were uploaded to the Integrated Proteomics Pipeline (IP2) (http: / / ip2.scripps.edu / ip2 / mainMenu.html), and MS2 and MS3 files were extracted from the raw files using a RAW converter. The ProLuCID algorithm was then used to search for inversely linked non-redundant variants in the Human UniProt database (July 2016). The precursor ion mass tolerance for the minimum envelope of the three isotopic peaks was set to 50 ppm. Cysteine residues were searched for static modifications corresponding to carbamoyl methylation (+57.02146 Da), and up to two differential modifications (+15.994915 Da) were allowed per peptide for methionine oxidation. Lysine and N-terminal residues were also searched for static modifications corresponding to TMT tags (+229.1629 Da). The peptide length needed to be at least 6 amino acids. The ProLuCID data was filtered using DTAselect 2.0 within IP2 to allow a false positive rate of less than 1% at the spectral level. Peptide quantification based on MS3 was performed using IP2, with the reporter ion mass tolerance set at 20 ppm. Proteins were required to have at least two unique peptides. Peptide-spectral matches were grouped based on protein ID, and peptides were excluded if a) the sum of the reporter ion intensities was less than 10,000, b) the coefficient of variation was greater than 0.5, or c) they were non-unique or non-trypsin peptide sequences. Proteins were quantified by summing the reporter ion intensities of all matched peptide-spectral matches and normalizing them relative to the highest signal channel for each protein. Quantification was performed using the log2 fold change of the quotient of DMSO-treated cells versus drug-treated cells and the inverse logarithmic value of the two-tailed Student's T test. 10 Generate a curve graph.
[0169] In vivo experiments The study was conducted in 6-8 week old female NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice, according to Dana-Farber Cancer Institute Institutional Animal Care and Use Committee (IACUC) protocol number 16-021. Each mouse was intravenously injected with 1 x 10 6 MV4;11 cells were collected, and engraftment in peripheral blood was confirmed using flow cytometry-based human CD45+ cell detection with BD Biosciences' LSR Fortessa (human CD45-PE, clone HI30, 1:200; mouse CD45-APC-Cy7, clone 30-F11, 1:100, BioLegend). After confirming engraftment, mice were randomly assigned to the treatment group and received 3 doses of ( ). R )-、(S )-dHTC1 (50 mg / kg ip BID, i.e., every 12 hours) or the medium. Dissolve the compound in 5% DMAC and 95% PEG-300 (40%) + NaCl (0.9%) (60%).
[0170] One hour after the last administration, mice were euthanized by CO2 inhalation followed by cervical dislocation. Bone marrow cells were isolated from the tibia, femur, iliac crest, and spine by pulverizing bone in PBS (Life Technologies) + 2% FBS (Life Technologies) using a mortar and pestle and passing the cell suspension through a 40 µM cell filter (Falcon). The spleen was pulverized using a syringe plunger and passed through a 40 µM cell filter (Falcon). Blood was collected by cardiac puncture, and erythrocytes were lysed using RBC lysis buffer (BioLegend). The differentiation status of bone marrow, spleen, and blood cells was assessed by flow cytometry (LSRFortessa, BD Biosciences) using the following antibodies: human CD45-PE, clone HI30, 1:200; mouse CD45-APC-Cy7, clone 30-F11, 1:100; and human CD11b-FITC, clone ICRF44, 1:100 (BioLegend).
[0171] Ubiquitin-Proteasome System Screening plasmids and oligonucleotides The design and construction of human UPS-based sgRNA libraries and human CRBN deep mutation scanning (DMS) libraries for ENL stability screening have been previously described. 44, 74 The engineering of a fluorescent protein stability reporter gene for ENL for FACS-based CRISPR-Cas9 and DMS screening, and an engineering of a CRBN point mutant for validating DMS screening, were performed as previously described. 33, 44 The GSPT1 fluorescent protein stability reporter gene was generated by inserting the GSPT1 coding sequence into the pArtichoke plasmid (Addgene 73320) via Gibson assembly.
[0172] CRISPR-Cas9 ENL stability screening based on FACS Using 8 μg / mL polybrene (Szabo Scandic, SACSC-134220), with a multiplicity of infection of 0.19 and a library expression of 1,000x, lentiviral supernatant packaged with a UPS-based library was used to transduce KBM7 ENL-TagBFP-P2A-mCherry cells containing the doxycycline-inducible Cas9 allele (iCas9). KBM7 cells transduced with the library were selected with 1 mg / mL G418 (Gibco) for 14 days, expanded, and Cas9 expression induced with 0.4 μg / mL doxycycline (PanReac AppliChem). Three days after doxycycline induction, 50 million cells were treated for 8 hours under each condition in two biological replicates with DMSO, dHTC1 (10 μM), or SR-1114 (10 μM). Cells were washed with PBS and stained with APC anti-mouse Thy1.1 antibody (1:400, 202526, BioLegend) and Zombie NIR immobilizable viability dye (1:1000, BioLegend) at 4°C in the dark for 10 min in the presence of human TruStain FcX Fc receptor blocking solution (1:400, 422302, BioLegend). Cells were then fixed with 1 mL of BD CytoFix fixation buffer (BD Biosciences, 554655) at 4°C in the dark for 30 min. Cells were washed with FACS buffer (PBS containing 5% FCS and 1 mM EDTA) and stored overnight at 4°C. The following day, cells were filtered through a 35 μm nylon mesh and sorted using a 70 μm nozzle on BD FACSAria Fusion (BD Biosciences) running on BD FACSDiva software (v.8.0.2) to exclude aggregates, dead (ZombieNIR positive), Cas9 negative (GFP negative), and sgRNA library negative (Thy1.1-APC negative) cells. The remaining cells were sorted into ENLs based on their ENL-BFP and mCherry levels. 高 (5%-10% of cells), ENL 中 (25%-50%) and ENL 低 (5%-10%) fractionation. Each sample replicate is sorted to correspond to at least 750-fold library representation of cells. DNA libraries for next-generation sequencing (NGS) are prepared as previously described. 84In short, genomic DNA was extracted via cell lysis (10 mM Tris-HCl, 10 mM EDTA, 150 mM NaCl, 0.1% SDS), proteinase K treatment (New England Biolabs), and DNase-free RNase digestion (Thermo Fisher), followed by two rounds of phenol extraction and isopropanol precipitation. Barcoded NGS libraries for each sorted fraction were prepared using a two-step PCR protocol with AmpliTaq Gold polymerase (Invitrogen). Barcodes for each sample were introduced in the first PCR, and the products were purified using Mag-Bind TotalPure NGS beads (Omega Bio-tek) and amplified in a second PCR with a standard Illumina adaptor. The final Illumina libraries were bead-purified, pooled, and sequenced on a NovaSeq 6000 instrument (Illumina) using a 100-base-pair paired-end sequencing protocol. Screening analyses were performed as previously described. 84 In short, sequencing reads were pruned using fastx-toolkit (v0.0.14), aligned using Bowtie2 (v2.4.2), and quantified using featureCounts (v2.0.1). The crispr-process-nf Nextflow workflow is available at https: / / github.com / ZuberLab / crispr-process-nf / tree / 566f6d46bbcc2a3f49f51bbc96b9820f408ec4a3. For statistical analysis, we used the crispr-mageck-nf Nextflow workflow, available at https: / / github.com / ZuberLab / crispr-mageck-nf / tree / c75a90f670698bfa78bfd8be786d6e5d6d4fc455. To calculate gene-level enrichment, median-normalized read counts were used to sort the population (ENL). 高 or ENL 低 ) and MAGeCK (0.5.9)( 85 ENL in ) 中 Group comparison.
[0173] FACS-based deep mutation scanning screening 18 million MV4 cells were transduced from the viral supernatant of the CRBN DMS library at a multiplicity of infection of 0.17;11 CRBN - / -ENL-TagBFP-P2A-mCherry cells were used to generate a computational library representative of 1,760 cells per variant. For transduction, 1 million cells were seeded in 24-well plates containing 8 μg / mL polybrene (Szabo Scandic, SACSC-134220) and filled to 1 mL with titrated virus and culture medium. The plates were centrifuged at 760 g for 45 min at 37 °C, and the cells were then pooled and expanded. Three days after transduction, cells transduced from the library were selected for 7 days with 1 μg / mL blastomycin (Gibco, R21001), and the selected cells were expanded. In three biological replicates, 50 million cells were treated with either dHTC1 (1 μM) or SR-1114 (1 μM) for 8 hours under each condition. Cells were washed with PBS, stained with Zombie NIR fixative viability dye (1:1000, BioLegend) at 4°C in the dark for 10 min, and fixed with 1 mL BD CytoFix fixation buffer (BD Biosciences, 554655) at 4°C in the dark for 30 min. Cells were washed with FACS buffer (PBS with 5% FCS and 1 mM EDTA) and stored overnight at 4°C. Two groups of 50 million unsorted cells were also harvested as controls and washed and frozen directly. The next day, cells were filtered through a 35 μm nylon mesh and sorted using a 70 μm nozzle on BDFACSAria Fusion (BD Biosciences) running on BD FACSDiva software (v.8.0.2) to exclude aggregates, dead (Zombie NIR positive) and reporter gene negative (BFP and mCherry negative) cells. The remaining cells were sorted into ENLs based on their ENL-BFP and mCherry levels. 高 Fractionation (30%-35% of cells). Each sample replicate is sorted to correspond to at least 3,000-fold library representation of cells. Prepare sorted and unsorted cell pools of DNA libraries for next-generation sequencing (NGS) as previously described. 44, 84In summary, genomic DNA (gDNA) was extracted via cell lysis (10 mM Tris-HCl, 10 mM EDTA, 150 mM NaCl, 0.1% SDS), proteinase K treatment (New England Biolabs), and DNase-free RNase digestion (Thermo Fisher), followed by two rounds of phenol extraction and isopropanol precipitation. CRBN variant cDNA was amplified from gDNA by PCR using AmpliTaq Gold polymerase (Invitrogen) and primers CRBN_GA_fwd (AGGTGTCGTGACGTACGGGATCCCAGGACCATGGCCGGCGAAGGAG) and CRBN_GA_rev (GGGGGGGGGGGCGGAATTAATTCCTACTACTTACAAGCAAAGTATTACTTTGTCTGGAC). The cycle number for specific amplification of the 1.4 kb CRBN target was confirmed by agarose gel electrophoresis. PCR reactions for each sample were pooled and purified using Mag-Bind TotalPure NGS beads (Omega Bio-tek). Libraries from the amplified DNA were prepared using the Tagment DNATDE1 Enzyme and IDT for Illumina Unique Dual Indexes (Illumina). Library concentrations were quantified using a Qubit 2.0 quantitative PCR system (Life Technologies), and size distribution was assessed using a 2100 Bioanalyzer instrument (Agilent). For sequencing, samples were diluted and pooled into NGS libraries, and sequenced on a NovaSeq 6000 instrument (Illumina) using a 100-base-pair paired-end sequencing protocol. Raw sequencing reads were converted to FastQ format using the bamtofastq function, samtools (v1.15.1), and bedtools (v.2.30.0). Sequencing reads were trimmed using Trim Galore (v0.6.6) with nextera and pairing modes. Short reads were aligned with CRBN boxes, and SAM files were generated using the mem algorithm from the bwa package (v0.7.17). The SAM files were converted to BAM using samtools, and mutations were detected using the AnalyzeSaturationMutagenesis tool from GATK (v4.1.8.1). Given our sequencing strategy, >98% of reads corresponded to wild-type sequences and were filtered out in this step. Next, the relative frequency of variants at each position was calculated, and variants covered by less than one read out of 30,000 reads were excluded through further analysis.The read count for each variant is then normalized to the total read count for each sample, and the ENL relative to the unsorted cell is calculated. 高 The log2 fold change was calculated. To correct for differential drug efficacy, each variant was then normalized to the maximum log2 fold change. For drug comparisons, the ENL relative to the unsorted pool for each drug was subtracted. 高 The change is log2 multiple. Generate a heatmap using the pheatmap (v.1.0.12) package in R (v.4.1.0) or using Prism version 10.
[0174] Flow cytometry ENL reporter gene assay Lentiviral transduction of MV4;11 CRBN expressed in pRRL-EF1a-CRBN-IRES-BlastR plasmid. - / - ENL-TagBFP-P2A-mCherry or GSPT1-GFP-P2A-mCherry cells were used to generate stable cell lines. To evaluate reporter gene degradation on different CRBN backgrounds, cells were treated with DMSO or dHTC1, SR-1114 (1 µM, 6 h, ENL reporter gene) or CC885 (1 µM, 5 h, GSPT1 reporter gene) and then analyzed by flow cytometry on LSR Fortessa (BD Biosciences) running on BD FACSDiva software (v9.0).
[0175] CRBN combined with dHTC1 midi Crystallization 3.4 mg / mL of CBRN will be added to a buffer containing 20 mM HEPES pH 7.5, 500 mM NaCl, and 0.5 mM TCEP. midi The mixture was mixed with 4 moles of excess dHTC1 (364 µM, final 1.8% (v / v) DMSO). The complex was co-crystallized at 20 °C using a seated drop vapor diffusion method on several sparse matrix sieves by mixing equal volumes of protein solution and reservoir solution. Crystal hits from Morpheus H10 (0.1 M buffer system 3, pH 8.5, 0.12 M alcohol, 30% precipitant mixture 2) were harvested directly from the droplets and rapidly cooled in liquid nitrogen.
[0176] Diffraction data were collected at beamline I24 of the diamond source at a wavelength of 0.6199 Å using an Eiger CdTe 9M detector. Dials ( 86 Processing the 2.2 Å dataset, in PIndexed in the 31-space group, and using 8RQA coordinates as the search model, via phenix.phaser( 87 Molecular substitution analysis of the structure. Using Phenix.refine ( 88 ) and coot ( 89 Refinement and model building.
[0177] Surface Plasmon Resonance Surface plasmon resonance experiments were performed on a Biacore S200 (Cytiva) sensor. Ligand immobilization (Cytiva) was performed using the S-series streptavidin sensor chip. Biotinylated ENL and biotinylated CRBN were prepared in HBS-EP+ buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% P2O, pH 7.4). midi Ligand immobilization was performed in flow cells 2 and 4, with a series of ligand injections at a flow rate of 5 mL / min until the desired density was reached (700 RU for ENL and for CRBN). midi (4432 RU). Flow cells 1 and 3 were left empty as a reference. HBS-EP+ buffer with 2% DMSO was used as the run buffer and for preparing all analyte samples. For samples containing CRBN-DDB1 in the eluent, CRBN-DDB1 was serially diluted in HBS-EP+ and 1% DMSO buffer or HBS-EP+ and 1% DMSO buffer with 1 µM of the compound. The analyte was serially diluted in a polystyrene 96-well plate just before injection. Three start-up cycles were run, injecting run buffer into all flow cells before analyte injection. Binding data were collected by injecting the analyte into two flow cells (reference and immobilized ligand) at a flow rate of 30 mL / min at 25 °C. Association with biotin-ENL or biotin-YEATS4 was measured within 60 seconds, and dissociation within 180 seconds. The flow cell surface was regenerated by injecting run buffer into each flow cell for 30 seconds. Each sample (including the blank) was injected in duplicate. Affinity curves, association and dissociation constants, and sensor maps were determined using Biacore S200 evaluation software.
[0178] Synthesis scheme General Experiment Instructions Unless otherwise specified, all reagents were purchased from Sigma Aldrich, Fischer Scientific, CombiBlocks, Oakwood Chemical, or ChemImpex and used as is without further purification. Recordings were performed on a Bruker AVIII HD 600 NMR spectrometer equipped with a 5 mm CPQCI (HCNP) cryopreservation probe or a 5 mm CPDCH (CH) cryopreservation probe, or on a Bruker AV NEO 399 NMR spectrometer equipped with a BBFO smart probe. 1 H and 13 10⁻⁶ C NMR spectra. Recorded on a Bruker AV NEO 399 NMR spectrometer equipped with a 5 mm BBFO smart probe. 19 F NMR. 1 The data from the 1H NMR spectra are reported as follows: chemical shift (δ ppm), multiplicity, coupling constant (Hz), and integral. 13 C and 19 F NMR spectral data are reported as chemical shifts. Unless otherwise noted, all NMR spectra were recorded at 295 K. Reactions were monitored by TLC, LC / MS, or UPLC / MS. Purification was performed using a Teledyne ISCO CombiFlash NextGen 300+ column, running on a Teledyne silica or C18 column. Optical rotation data were recorded on an Anton Paar 100 modular circular polarimeter.
[0179] Synthesis of SuFEx libraries The SuFEx library was synthesized in Echo-qualified 384-well low dead volume plates using an Echo acoustic liquid processor (Beckman Coulter). 1 µL of amine stock solution (50 mM, in DMSO) was transferred to each well, followed by the addition of 1.5 µL of SuFEx-activated difluoride (6.67 mM, in DMSO). Finally, 2.5 µL of phosphate-buffered saline (freshly prepared, pH 8) was added to each well via matrix pipettes. Each plate was heat-sealed and incubated at 37°C for 24 hours, after which HPLC analysis of different well groups was run to confirm the transformation prior to bioassays.
[0180] High-throughput methods High-throughput methods include, but are not limited to, the following methods: in: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7)heterocycloalkyl, (C6-C4) ...10 aryl or (C5-C8) heteroaryl: 1) Sulfur(VI) Fluorine Exchange (SuFEx) 2) Copper-catalyzed cycloaddition of azide-alkyne hydrocarbons 3) Ruthenium-catalyzed cycloaddition of azide-alkyne hydrocarbons 4) Strain-promoted cycloaddition of azide-alkyne hydrocarbons 5) Strain-promoted alkyne-nitroketone cycloaddition 6) Diels-Alder (reverse electron demand of olefin-tetraazine) 7) Alkene-tetrazole photoclick reaction 8) Coupling of amides with activated esters 9) Coupling of amides with in-situ activated esters 10) Urea coupling of unactivated carboxylic acids 11) Urea coupling of isocyanates 12) Urea coupling of acyl azides 13) Radical coupling of activated alkyl halides 14) Free radical nitroketone coupling of carboxylic acids 15) Cross-coupling catalyzed by transition metals General procedure for miniaturized synthesis of NHS-derived amides: Using an Echo 650 Series Acoustic Liquid Processor (Labcyte), 1 µL of amine stock solution (50 mM, in anhydrous DMSO) was transferred from the wells of the source plate to the wells of the reaction plate. Next, 1 µL of NHS-ester solution (20 mM, in anhydrous DMSO) was transferred to each well containing the amine using an E1 ClipTip micropipette (ThermoFisher). Finally, 8 µL of DIPEA solution (12.5 mM, in anhydrous DMSO) was added to each well, and the plate was sealed with adhesive foil and placed in a 60°C oven for 16 hours. The reactions were analyzed by HPLC.
[0181] Experimental Procedure 2-Bromoimidazole[1,2- a ]Pyridine-6-carboxylic acid Adapted from literature condition (i), 2-bromoimidazole [1,2-] was added to a 250 mL round-bottom flask. a Methyl pyridine-6-carboxylate (commercially available from Sigma Aldrich, Astressch, Combi Blocks, or Chemscene, 10 g, 39.2 mmol, 1 equivalent) and 4:1 methanol:water (156 mL, 250 mM relative to the limit reagent) were added to the suspension. LiOH (1.88 g, 78.4 mmol, 2 equivalents) was added. The resulting solution was stirred at 35 °C for 16 h and then cooled to room temperature. The solution was acidified to pH 1 with 6N HCl, and the resulting white precipitate was filtered, dried, and washed successively with cold ethanol (40 mL) and diethyl ether (80 mL) to give the product (9.36 g, >95%).
[0182] 1 H NMR (600 MHz, DMSO)δ 9.22 (s, 1H), 8.23 (s, 1H), 7.70 (d, J = 9.4Hz, 1H), 7.60 (d, J = 9.4 Hz, 1H), 3.96 (s, 1H); 13 C NMR (150 MHz, DMSO)δ 166.1, 145.2, 130.8, 125.5, 123.1, 117.4,115.9, 114.1; HRMS (ESI), C8H6BrN2O2 calculated value: (M+H + ) 240.9613, Observed value: 240.9611.
[0183] (i) CA Schulte et al. , A knowledge-based, structural-aided discovery of a novel class of 2-phenylimidazo[1,2-a]pyridine-6-carboxamide H-PGDSinhibitors. Bioorg Med Chem Lett 47, 128113 (2021). 2-Bromo- N -Cyclobutylimidazo[1,2- a ]Pyridine-6-carboxamide Add 2-bromoimidazole [1,2-] to a 250 mL round-bottom flask. a Pyridine-6-carboxylic acid (9.36 g, 38.8 mmol, 1 equivalent), anhydrous DMF (155 mL, 250 mM relative to the limit reagent), HATU (18.5 g, 48.5 mmol, 1.25 equivalent), DIPEA (16.9 mL, 97.1 mmol, 2.5 equivalent), and cyclobutanamine (3.65 mL, 42.7 mmol, 1.1 equivalent). The flask was sealed with a rubber diaphragm and placed under a nitrogen atmosphere. The reaction mixture was stirred at 35 °C until LC-MS analysis indicated that the reaction was complete after three hours. The reaction mixture was concentrated to dryness under vacuum, reconstituted and adsorbed onto silica in a 1:1 DCM:MeOH mixture, and purified by rapid silica gel column chromatography with a gradually increasing gradient of methanol / DCM (0%–>20%, eluting the product in approximately 10% MeOH) to obtain a grayish-white powder. The substance was further purified by recrystallization from methanol to obtain a pure product (7.53 g, 66%).
[0184] 1 H NMR (500 MHz, DMSO)δ 9.04 (s, 1H), 8.78 (d, J = 7.4 Hz, 1H), 8.21(s, 1H), 7.74 (d, J = 9.1 Hz, 1H), 7.59 (d, J = 9.4 Hz, 1H), 4.43 (h, J = 8.1 Hz,1H), 2.28 – 2.19 (m, 2H), 2.13 – 2.01 (m, 2H), 1.76 – 1.62 (m, 2H); 13 C NMR (125 MHz, DMSO)δ 163.3, 144.8, 128.1, 124.6, 122.8, 120.9,115.7, 113.7, 45.11, 30.5, 15.2; HRMS (ESI)C 12 H 13 Calculated value of BrN3O: (M+H) + ) 294.0242, Observation value: 294.0242.
[0185] 3-(6-(cyclobutylcarbamoyl)imidazo[1,2- a pyridin-2-yl)benzoic acid Add 2-bromoimidazopyridine (7.53 g, 25.6 mmol, 1 equivalent), pinacol 3-carboxyphenylboronic acid (9.53 mg, 38.4 mmol, 1.5 equivalent), potassium carbonate (8.84 g, 64.0 mmol, 2.5 equivalent), and a 5:1 solution of dioxane:water (256 mL, 100 mM relative to the starting bromide) to a 500 mL double-necked round-bottom flask. The flask was equipped with a reflux condenser, and both the second outlet and the condenser were sealed with rubber stoppers. The resulting suspension was vigorously bubbled under nitrogen for 30 minutes, then a rubber stopper was removed and PdCl2(dppf)•DCM (2.09 g, 2.56 mmol, 10 mol%) was added. The resulting suspension was bubbled again for 20 minutes, and then the reaction flask was heated to 90 °C via an oil bath. The reaction was stirred under nitrogen for 16 hours, and then LCMS indicated complete consumption of the starting material. The reaction was cooled to room temperature and diluted with saturated sodium bicarbonate aqueous solution (50 mL) and DCM (2 x 75 mL). The aqueous layer was filtered through a diatomaceous earth mat and acidified to pH 1 with 6 M HCl. The precipitate was separated by vacuum filtration through a Buchner funnel to give a product as a grayish-white solid (4.91 g, 57%). This substance can be used in subsequent steps without further purification; it can also be purified by C18 column chromatography with a gradually increasing gradient of MeCN / H2O (10%–>60%, containing 0.1 v% TFA, product eluted at approximately 35%).
[0186] 1 H NMR (600 MHz, DMSO)δ 9.12 (s, 1H), 8.84 (d, J = 7.4 Hz, 1H), 8.69(s, 1H), 8.57 (s, 1H), 8.22 (d, J= 1.5 Hz, 1H), 7.96 (d, J = 1.4 Hz, 1H), 7.84(d, J = 1.8 Hz, 1H), 7.72 (d, J = 9.4 Hz, 1H), 7.63 (t, J = 7.7 Hz, 1H), 4.45 (h, J =8.1 Hz, 1H), 2.30 – 2.21 (m, 2H), 2.15 – 2.05 (m, 2H), 1.75 – 1.65 (m, 2H); 13 C NMR (150 MHz, DMSO)δ 167.6, 163.1, 158.5, 144.5, 142.9, 132.6,132.0, 130.5, 129.8, 129.0, 127.0 126.0, 121.6, 115.3, 111.6, 45.2, 30.5,15.3; HRMS (ESI)C 19 H 18 Calculated value of N3O3: (M+H) + ) 336.1348, Observation value: 336.1348.
[0187] 2-(3-((2-(4-aminopiperidin-1-yl)ethyl)carbamoyl)phenyl)- N -Cyclobutylimidazo[1,2- a ]Pyridine-6-carboxamide According to the literature ( iiPreparation of tert-butyl (1-(2-aminoethyl)piperidin-4-yl)carbamate. Acid (352 mg, 1.05 mmol, 1 equivalent), DMF (4.62 mL, 250 mM relative to the starting acid), DIPEA (457 µL, 2.62 mmol, 2.5 equivalent), HATU (499 mg, 1.31 mmol, 1.25 equivalent), and tert-butyl (1-(2-aminoethyl)piperidin-4-yl)carbamate (281 mg, 1.15 mmol, 1.1 equivalent) were sequentially added to a 20 mL scintillation vial. The vial was sealed under ambient atmosphere and stirred at 35 °C for 3 hours. The consumption of the starting material was then observed by UPLC-MS. The reactants were diluted with EtOAC (25 mL) and washed with brine (25 mL). The aqueous layer was further extracted with EtOAC (2 x 25 mL), the organic layers were combined, and the mixture was concentrated to dryness by rotary evaporation and high vacuum. The substance can be used in the next step without further purification.
[0188] (ii) I. HIROAKI et al., EP Office, Ed. (DAIICHI SANKYO CO LTD (JP),Taiwan, 2009), vol. TW-200946528-A, chap. WO2009125809A1. The Boc-protected intermediate amine was transferred to a 20 mL scintillation vial, which was then further filled with 1,4-dioxane (3 mL) and HCl in 1,4-dioxane (4N, 3 mL). UPLC-MS analysis at 18 hours indicated the consumption of the starting material. The resulting suspension was filtered through a Hertzsprung funnel, washed with toluene (5 mL), and manually transferred to a 50 mL round-bottom flask. The suspension was dissolved in 2:1 MeOH:DCM and adsorbed onto diatomaceous earth. The diatomaceous earth was packed into a solid-supported column and purified by C18 column chromatography using a gradually increasing gradient of acetonitrile / water (2.5% --> 30%, containing 0.1 v / v TFA). The purified fractions were combined and lyophilized to give the product (229 mg, 47%) as a white flocculent solid.
[0189] 1 H NMR (600 MHz, DMSO)δ 9.65 (s, 1H), 9.14 (s, 1H), 8.94 (t, J = 5.5Hz, 1H), 8.84 (d, J= 7.4 Hz, 1H), 8.62 (s, 1H), 8.51 (s, 1H), 8.20 (s, 3H), 8.16 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 7.7 Hz, 1H), 7.80 (d, J = 9.7 Hz, 1H), 7.69(d, J = 9.4 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.70 –3.66 (m, 2H), 3.29 (t, J = 6.6 Hz, 3H), 3.11 (t, J = 13.0 Hz, 2H), 2.30 – 2.21(m, 2H), 2.17 – 2.05 (m, 4H), 1.84 – 1.66 (m, 4H); 13 C NMR (150 MHz, DMSO)δ 167.2, 163.3, 145.0, 144.2, 134.9, 133.3,129.5, 129.3, 129.0, 127.6, 125.4, 125.1, 121.1, 115.7, 111.3, 55.7, 50.7,45.5, 45.1, 34.8, 30.5, 27.7, 15.2; HRMS (ESI)C 26 H 33 Calculated N6O2 value: (M+H) + ) 461.2660, Observed value: 461.2654.
[0190] (1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2- a ]pyridin-2-yl)benzoamide)ethyl)piperidin-4-yl)thionyl difluoride Amine (126.1 mg, 0.254 mmol) was added to a 25 mL round-bottom flask equipped with a magnetic stir bar. The compound was dissolved in anhydrous DMF (3 mL), and DIPEA (133 μL, 0.761 mmol, 3.0 equivalent) was added. The flask was sealed with a rubber diaphragm, evacuated (with the solvent gently bubbling), and backfilled with tetrafluorothionyl. The mixture was stirred vigorously at room temperature for 1 hour until complete conversion of the starting material was confirmed by LC-MS analysis. The solution was then purified by reversed-phase preparative high-performance liquid chromatography (HPLC), eluting with water / MeCN containing 0.1% formic acid. The product (81.6 mg, 59% yield) was separated after lyophilization.
[0191] 1 H NMR (600 MHz, DMSO) δ 9.09 (s, 1H), 8.77 (d, J = 7.5 Hz, 1H), 8.58 –8.53 (m, 2H), 8.44 (t, J = 1.9 Hz, 1H), 8.25 (s, 1H), 8.12 (d, J = 7.8 Hz, 1H), 7.79 (d, J = 7.7 Hz, 1H), 7.70 (d, J = 9.7 Hz, 1H), 7.64 (d, J = 9.5 Hz, 1H), 7.55(t, J = 7.7 Hz, 1H), 6.63 (s, 1H), 4.45 (h, J = 8.1 Hz, 1H), 3.75 (s, 1H), 3.44 –3.38 (m, 2H), 2.80 (s, 2H), 2.30 – 2.16 (m, 4H), 2.14 – 2.05 (m, 2H), 1.89(q, J = 4.7 Hz, 2H), 1.74 – 1.66 (m, 2H), 1.62 (dtd, J = 13.2, 9.9, 3.6 Hz, 2H); 13C NMR (150 MHz, DMSO)δ 166.5, 163.5, 145.5, 145.5, 135.7, 134.1,129.3, 128.7, 128.7, 127.2, 125.0, 124.3, 120.5, 116.2, 111.0, 57.3, 55.0,51.2, 45.1, 37.6, 33.5, 30.6, 15.2; 19 F NMR (375 MHz, DMSO)δ 52.49, -74.19 (TFA); HRMS (ESI)C 26 H 31 Calculated value of F2N6O3S: (M+H) + 545.2141, Observation: 545.2140 N -cyclobutyl-2-(3-((2-(4-((6,8-dioxo-2,7-diazaspiro[4.4]nonane)-2-sulfonylamino)piperidin-1-yl)ethyl)carbamoyl)phenyl)imidazo[1,2- a ]Pyridine-6-carboxamide Add (1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2-)) to a 1-darabin vial equipped with a magnetic stir bar. a [Pyridin-2-yl)benzoylamino)ethyl)piperidin-4-yl)thioiminoyl difluoride (9.8 mg, 0.018 mmol, 1 equivalent), MeCN (0.5 mL, 40 mM relative to the limit reagent), triethylamine (6.8 µL, 0.049 mmol, 2.7 equivalent) and 2,7-diazaspiro[4.4]nonane-1,3-dione (7) (4.2 mg, 0.027 mmol, 1.5 equivalent). The vials were sealed and stirred for 4 hours under ambient atmosphere. The reaction solution was directly loaded onto a C18 column for column chromatography and purified with a gradually increasing gradient of MeCN / water (10% --> 60%, containing 0.1 v / v TFA). The purified fractions were combined and lyophilized to give the product (1.6 mg, 13%) as a white flocculent solid.
[0192] 1 H NMR (600 MHz, DMSO)δ 11.31 (s, 1H), 9.09 (t, J = 1.4 Hz, 1H), 8.79(d, J= 7.5 Hz, 1H), 8.57 (s, 2H), 8.45 (t, J = 1.8 Hz, 1H), 8.12 (d, J = 7.7 Hz, 1H), 7.79 (d, J = 7.6 Hz, 1H), 7.71 (d, J = 9.4 Hz, 1H), 7.65 (d, J = 9.4 Hz, 1H), 7.55 (t, J = 7.7 Hz, 1H), 7.27 (d, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.39(d, J = 15.5 Hz, 3H), 3.36 – 3.33 (m, 2H), 3.22 (td, J = 9.3, 6.9 Hz, 1H), 3.05(s, 1H), 2.88 (d, J = 10.7 Hz, 2H), 2.77 – 2.66 (m, 2H), 2.48 (s, 2H), 2.25(tdt, J = 9.8, 4.8, 2.5 Hz, 2H), 2.18 – 1.99 (m, 6H), 1.86 – 1.80 (m, 2H), 1.74– 1.65 (m, 2H), 1.46 (q, J = 12.0 Hz, 2H); 13 C (150 MHz, DMSO)δ 181.5, 177.4, 166.5, 163.5, 145.5, 135.7, 134.1,129.3, 128.7, 128.7, 127.2, 125.0, 124.3, 120.5, 116.2, 111.0, 57.4, 56.7,52.6, 51.4, 50.6, 47.6, 45.1, 42.4, 37.6, 36.5, 33.2, 30.6, 15.2; HRMS (ESI)C 33 H 41 Calculated value of N8O6S: (M+H) + ) 677.2864, Observed value: 677.2862; [α]D 25 = -9.300 ( c 1.00, MeOH): Inactive enantiomer, ( R ); [α] D 25 = +8.600 ( c 1.00, MeOH): Active enantiomer, ( S ).
[0193] 1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2- a ]pyridin-2-yl)benzoamide)ethyl)piperidine-4-carboxylic acid 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] were added sequentially to a 20 mL scintillation vial. a The following reagents were prepared: pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 equivalent), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 equivalent), HATU (140 mg, 0.373 mmol, 1.25 equivalent), and methyl 1-(2-aminoethyl)piperidin-4-carboxylate (61 mg, 0.328 mmol, 1.1 equivalent). The vials were sealed under ambient atmosphere and stirred at 35 °C for 3 hours. The consumption of the starting material was then observed by UPLC-MS. The reaction mixture was diluted with EtOAc (20 mL) and washed with saturated sodium chloride aqueous solution (2 x 20 mL), dried over sodium sulfate, and concentrated to dryness. The substance was ready for use in the next step without further purification.
[0194] The crude methyl ester intermediate described above, methanol:water (4:1, 2.4 mL methanol, 600 µL H₂O, 100 mM relative to methyl ester), and lithium hydroxide (28.5 mg, 1.19 mmol, 2 equivalents) were added to a 20 mL scintillation vial equipped with a magnetic stir bar. The vial was sealed under ambient atmosphere and stirred for 2 hours, after which the consumption of the starting material was observed by UPLC-MS. The material was acidified to pH 2 by adding a small amount of 1 M HCl aqueous solution, dissolved by adding 500 mL DMF, and directly loaded onto a preparative HPLC system using a gradual gradient (2.5% --> 60%, containing 0.1 v / v TFA) for purification. The purified fractions were combined and lyophilized to give a product (99 mg, 68%) as a white flocculent solid.
[0195] 1H NMR (600 MHz, DMSO) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J = 7.8Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz, 2H),3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 – 2.05(m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H); 13 C NMR (150 MHz, DMSO) δ 175.1, 167.2, 163.3, 145.0, 144.3, 135.0,133.4, 129.5, 129.2, 129.0, 127.6, 125.1, 121.0, 117.8, 115.7, 111.2, 55.8,51.8, 45.1, 38.3, 34.8, 30.5, 25.88, 15.2; HRMS (ESI)C 27 H 32 Calculated N5O4 value: (M+H) + ) 490.2454, Observed value: 490.2451.
[0196] 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] were added sequentially to a 20 mL scintillation vial. aThe following reagents were prepared: pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 equivalent), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 equivalent), HATU (140 mg, 0.373 mmol, 1.25 equivalent), and methyl 1-(2-aminoethyl)piperidin-4-carboxylate (61 mg, 0.328 mmol, 1.1 equivalent). The vials were sealed under ambient atmosphere and stirred at 35 °C for 3 hours. The consumption of the starting material was then observed by UPLC-MS. The reaction mixture was diluted with EtOAc (20 mL) and washed with saturated sodium chloride aqueous solution (2 x 20 mL), dried over sodium sulfate, and concentrated to dryness. The substance was ready for use in the next step without further purification.
[0197] The crude methyl ester intermediate described above, methanol:water (4:1, 2.4 mL methanol, 600 µL H₂O, 100 mM relative to methyl ester), and lithium hydroxide (28.5 mg, 1.19 mmol, 2 equivalents) were added to a 20 mL scintillation vial equipped with a magnetic stir bar. The vial was sealed under ambient atmosphere and stirred for 2 hours, after which the consumption of the starting material was observed by UPLC-MS. The material was acidified to pH 2 by adding a small amount of 1 M HCl aqueous solution, dissolved by adding 500 mL DMF, and directly loaded onto a preparative HPLC system using a gradual gradient (2.5% --> 60%, containing 0.1 v / v TFA) for purification. The purified fractions were combined and lyophilized to give a product (99 mg, 68%) as a white flocculent solid.
[0198] 1 H NMR (600 MHz, DMSO) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J = 7.8Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2 Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J= 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz, 2H),3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 – 2.05(m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H); 13 C NMR (150 MHz, DMSO) δ 175.1, 167.2, 163.3, 145.0, 144.3, 135.0,133.4, 129.5, 129.2, 129.0, 127.6, 125.1, 121.0, 117.8, 115.7, 111.2, 55.8,51.8, 45.1, 38.3, 34.8, 30.5, 25.88, 15.2; HRMS (ESI)C 27 H 32 Calculated N5O4 value: (M+H) + ) 490.2454, Observed value: 490.2451.
[0199] 1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2- a ]pyridin-2-yl)benzoamide)ethyl)piperidine-4-carboxylic acid 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] were added sequentially to a 20 mL scintillation vial. a The following reagents were prepared: pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 equivalent), DMF (3 mL, 100 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 equivalent), HATU (140 mg, 0.373 mmol, 1.25 equivalent), and methyl 1-(2-aminoethyl)piperidin-4-carboxylate (61 mg, 0.328 mmol, 1.1 equivalent). The vials were sealed under ambient atmosphere and stirred at 35 °C for 3 hours. The consumption of the starting material was then observed by UPLC-MS. The reaction mixture was diluted with EtOAc (20 mL) and washed with saturated sodium chloride aqueous solution (2 x 20 mL), dried over sodium sulfate, and concentrated to dryness. The substance was ready for use in the next step without further purification.
[0200] The crude methyl ester intermediate described above, methanol:water (4:1, 2.4 mL methanol, 600 µL H₂O, 100 mM relative to methyl ester), and lithium hydroxide (28.5 mg, 1.19 mmol, 2 equivalents) were added to a 20 mL scintillation vial equipped with a magnetic stir bar. The vial was sealed under ambient atmosphere and stirred for 2 hours, after which the consumption of the starting material was observed by UPLC-MS. The material was acidified to pH 2 by adding a small amount of 1 M HCl aqueous solution, dissolved by adding 500 mL DMF, and directly loaded onto a preparative HPLC system using a gradual gradient (2.5% --> 60%, containing 0.1 v / v TFA) for purification. The purified fractions were combined and lyophilized to give a product (99 mg, 68%) as a white flocculent solid.
[0201] 1 H NMR (600 MHz, DMSO, 25 ℃) δ 9.12 (s, 1H), 9.07 (s, 1H), 8.88 (t, J = 5.7 Hz, 1H), 8.80 (d, J = 7.5 Hz, 1H), 8.59 (s, 1H), 8.51 (s, 1H), 8.16 (d, J =7.8 Hz, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.76 (d, J = 9.4 Hz, 1H), 7.67 (d, J = 9.2Hz, 1H), 7.61 (t, J = 7.7 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.67 (d, J = 5.6 Hz,2H), 3.32 – 3.26 (m, 3H), 3.15 – 2.91 (m, 4H), 2.29 – 2.22 (m, 2H), 2.14 –2.05 (m, 4H), 1.99 – 1.89 (m, 1H), 1.79 – 1.66 (m, 4H); 13 C { 1H} NMR (150 MHz, DMSO, 25 ℃) δ 175.10, 167.21, 163.31, 145.04,144.33, 134.98, 133.41, 129.47, 129.24, 128.96, 127.59, 125.10, 121.02,117.82, 115.73, 111.23, 55.83, 51.80, 45.12, 38.28, 34.75, 30.54, 25.88,15.24.
[0202] HRMS (ESI), C 27 H 31 Calculated N5O4 value: (M+H) + 490.2454, Observed value: 490.2451 (ppm -0.611938).
[0203] N -cyclobutyl-2-(3-((2-(4-(6,8-dioxo-2,7-diazaspiro[4.4]nonane-2-carbonyl)piperidin-1-yl)ethyl)carbamoyl)phenyl)imidazo[1,2- a ]Pyridine-6-carboxamide Add 1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] to a scintillation vial equipped with a magnetic stir bar a Pyridin-2-yl)benzoamide)ethyl)piperidin-4-carboxylic acid (4.7 mg, 9.6 mmol, 1 equivalent), DMF (272 µL, 35 mM relative to carboxylic acid), HATU (9.1 mg, 0.024 mmol, 2.50 equivalent), and DIPEA (2.1 µL, 0.0119 mmol, 1.25 equivalent). The vials were sealed under ambient atmosphere and stirred at 35 °C until consumption of the starting material was observed by UPLC-MS at 16 hours. The reactants were directly loaded onto a C18 column for column chromatography using a gradually increasing acetonitrile / water gradient (10% --> 60%, containing 0.1 v / v TFA). The fractions were combined and lyophilized to give the product (2.3 mg, 38%) as a white flocculent solid.
[0204] 1H NMR (600 MHz, DMSO)δ 11.26 (s, 0.45H), 11.18 (s, 0.47H), 9.31 –9.01 (m, 2H), 8.78 (s, 1H), 8.68 (d, J = 7.4 Hz, 1H), 8.55 (s, 1H), 8.50 (s,1H), 8.15 (d, J = 7.7 Hz, 1H), 7.85 (d, J = 7.7 Hz, 1H), 7.73 (d, J = 9.5 Hz, 1H), 7.63 (d, J = 9.4 Hz, 1H), 7.59 (t, J = 7.7 Hz, 1H), 4.44 (h, J = 8.2 Hz, 1H), 3.83– 3.76 (m, 1H), 3.74 – 3.65 (m, 4H), 3.63 – 3.53 (m, 2H), 3.08 – 3.05 (m,4H), 2.79 – 2.64 (m, 3H), 2.31 – 2.21 (m, 3H), 2.11 (ddt, J = 18.1, 11.7, 9.0Hz, 3H), 2.05 – 1.78 (m, 5H), 1.78 – 1.66 (m, 2H).
[0205] 13 C NMR (150 MHz, DMSO, 320K)δ 181.8, 181.1, 177.1, 171.5, 167.4,163.5, 145.4, 145.1, 135.0, 134.1, 129.4, 128.8, 127.4, 125.1, 124.6, 120.9,116.0, 111.0, 56.2, 54.7, 54.4, 52.1, 50.8, 48.9, 45.6, 45.3, 41.5, 37.4,37.1, 36.3, 34.8, 34.3, 30.5, 25.9, 15.3; HRMS (ESI)C 34 H 40 Calculated N7O5 value: (M+H) + ) 626.3091, Observation value: 626.3091.
[0206] N -(1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] a [4.4]Pyridin-2-yl)benzoylamino)ethyl)piperidin-4-yl)-6,8-dioxo-2,7-diazaspiro[4.4]nonane-2-carboxamide Add 1-(2-(3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] to a 1-dark blue vial equipped with a magnetic stir bar. a [Pyridin-2-yl)benzoamide)ethyl)piperidin-4-carboxylic acid (17.5 mg, 0.035 mmol, 1 equivalent), DMF (350 µL, 100 mM relative to carboxylic acid), diphenyl azidophosphate (12 µL, 0.054 mmol, 1.5 equivalent), and triethylamine (12.5 µL, 0.089 mmol, 2.5 equivalent). The vials were sealed and stirred at 65 °C for 20 min. UPLC analysis showed complete conversion to the intermediate isocyanate. At this point, 2,7-diazaspiro[4.4]nonane-1,3-dione (4.14 mg, 0.089 mmol, 2.5 equivalent) was added to the vials and stirred at room temperature for 30 min. After UPLC analysis confirmed the complete formation of the starting material, the crude product was directly loaded onto a preparative HPLC system using a gradually increasing gradient of acetonitrile / water (10% --> 60%, containing 0.1 vol% TFA) for purification. The purified fractions were combined and lyophilized to obtain a white flocculent solid product (6.1 mg, 27%).
[0207] 1 H NMR (600 MHz, DMSO)δ 11.28 (s, 1H), 9.14 (d, J = 21.5 Hz, 2H), 8.92(t, J = 5.7 Hz, 1H), 8.81 (d, J = 7.5 Hz, 1H), 8.60 (s, 1H), 8.50 (d, J = 2.2 Hz, 1H), 8.15 (d, J = 7.7 Hz, 1H), 7.85 (d, J = 7.7 Hz, 1H), 7.77 (d, J = 1.8 Hz, 1H), 7.67 (d, J = 9.4 Hz, 1H), 7.60 (t, J = 7.7 Hz, 1H), 6.19 (d,J = 7.4 Hz, 1H), 4.45 (h, J = 8.2 Hz, 1H), 3.54 – 3.44 (m, 4H), 3.37 (d, J = 10.5 Hz, 2H), 3.31 – 3.23(m, 4H), 3.09 (q, J = 11.6 Hz, 2H), 2.68 (d, J = 3.0 Hz, 2H), 2.28 – 2.20 (m,2H), 2.16 – 2.04 (m, 3H), 2.02 – 1.93 (m, 3H), 1.92 – 1.83 (m, 1H), 1.75 –1.63 (m, 4H); 13 C NMR (150 MHz, DMSO)δ 181.9, 177.4, 167.3, 163.4, 156.2, 145.2,135.0, 133.6, 129.5, 129.2, 128.9, 127.5, 125.1, 120.9, 117.9, 116.0, 115.8,111.2, 55.8, 54.7, 52.0, 50.0, 45.7, 45.3, 45.1, 41.8, 35.8, 34.9, 30.5,30.0, 15.2; HRMS (ESI)C 34 H 41 Calculated N8O5 value: (M+H) + ) 641.3200, Observation: 641.3181.
[0208] 7-Benzyl-2,7-diazaspiro[4.4]nonane-1,3-dione 2,7-diazaspiro[4.4]nonane-1,3-dione hydrochloride, MeCN (6.5 mL, 100 mM relative to the starting material), benzyl bromide (81 µL, 0.681 mmol, 1.05 equivalents), and DIPEA (136 µL, 0.778 mmol, 1.2 equivalents) were sequentially added to a 20 mL scintillation vial. The vial was capped and placed on a heating block set to 35 °C. UPLC analysis at 16 h indicated the consumption of the starting material, significant amounts of monoalkylation products, and significant amounts of dialkylation and trialkylation products. The reaction suspension was concentrated to dryness, reconstituted in a small amount of dichloromethane, and directly loaded onto a silica gel column for purification by normal-phase column chromatography using a gradually increasing gradient of ethyl acetate to methanol in DCM. The product eluted as a broad peak in DCM solution close to 100% EtOAc.
[0209] 1 H NMR (400 MHz, CDCl3)δ 7.35 – 7.18 (m, 5H), 3.72 (d, J = 12.9 Hz, 1H), 3.61 (d, J = 12.9 Hz, 1H), 3.00 (ddd, J = 9.2, 7.7, 4.2 Hz, 1H), 2.87 – 2.67 (m,4H), 2.60 (td, J = 8.8, 7.4 Hz, 1H), 2.42 (ddd, J = 12.8, 8.5, 4.2 Hz, 1H), 1.88(dt, J = 12.8, 7.6 Hz, 1H); 13 C NMR (150 MHz, CDCl3)δ 182.8, 177.0, 138.1, 128.8, 128.4, 127.3,59.5, 53.7, 50.5, 45.9, 37.1; HRMS (ESI)C 14 H 17 Calculated N2O2 value: (M+H) + ) 245.1290, Observed value: 245.1288; [α] D 25 = +13.696 ( c 0.5, DCM): Peak 1, specified as R [α] D25 = – 13.600 ( c 1.00, DCM): Peak 2, specified as S .
[0210] 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (50 mg, 0.15 mmol, 1 equivalent), DMF (0.5 mL, 300 mM relative to the starting acid), DIPEA (65 µL, 0.37 mmol, 2.5 equivalent), HATU (71 mg, 0.19 mmol, 1.25 equivalent), and (4,6-dimethylpyridin-3-yl)methylamine (22 mg, 0.16 mmol, 1.1 equivalent) were sequentially added to 20 mL scintillation vials. The vials were sealed under ambient atmosphere and stirred at 35 °C for 16 h, and the consumption of the starting materials was then observed by UPLC-MS. The reaction mixture was aspirated into a syringe and directly loaded onto a C18 column using a gradually increasing acetonitrile / water gradient (2.5% --> 60%, containing 0.1 v / v TFA) for purification. The pure fractions were combined and dried by freeze-drying to obtain the product JS8-115 (59.5 mg, 88%), which was a white flocculent solid.
[0211] To a 20 mL scintillation vial, sequentially add 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-a]pyridin-2-yl)benzoic acid (500 mg, 1.49 mmol, 1 equivalent), DMF (3.0 mL, 500 mM relative to the starting acid), DIPEA (650 µL, 3.73 mmol, 2.5 equivalent), HATU (706 mg, 1.86 mmol, 1.25 equivalent), and 2-(piperidin-1-yl)ethyl-1-amine (230 µL, 1.64 mmol, 1.1 equivalent). Seal the vial under ambient atmosphere and stir at 35 °C for 5 hours. Then, observe the consumption of the starting material by UPLC-MS. Dilute the reactants with IPA:CHCl3 (1:1, 50 mL) and wash with saturated potassium carbonate aqueous solution (50 mL). The organic layer was dried with sodium sulfate, adsorbed onto diatomaceous earth, and loaded onto a solid-supported column for purification by C18 column chromatography using a gradually increasing acetonitrile / water gradient (10% --> 80%, containing 0.1 v / v TFA). The purified fractions were combined and lyophilized to give product TM-7 as a pink flocculent solid. The resulting solid was further washed with warm ethyl acetate to give a pure product (350 mg, 52%) as a white solid.
[0212] Add 3-(6-(cyclobutylcarbamoyl)imidazo[1,2-] to a 20 mL scintillation vial equipped with a magnetic stir bar. a Pyridin-2-yl)benzoic acid (100 mg, 0.298 mmol, 1 equivalent), DMF (anhydrous, stored on a sieve and in a desiccator, 1.19 mL, 250 mM relative to the starting acid), DIPEA (130 µL, 0.745 mmol, 2.5 equivalent), EDC • HCl (71.5 mg, 0.373 mmol, 1.25 equivalent), 4-dimethylaminopyridine (3.6 mg, 0.0298 mmol, 10 mol%), and N-hydroxysuccinimide (37.7 mg, 0.328 mmol, 1.1 equivalent). The vials were stirred at 45 °C for six hours under anhydrous nitrogen atmosphere, and the consumption of the starting materials was observed by UPLC-MS. The materials were purified in the reaction vessel by a brief aqueous post-treatment; ethyl acetate (5 mL) and saturated sodium bicarbonate aqueous solution (5 mL) were added to the vials. The vial was capped and shaken rapidly. After the layers separated, the aqueous layer was removed using a syringe. The organic layer was rapidly filtered through sodium sulfate and concentrated to dryness on a rotary evaporator. The crude substance was reconstituted in a small amount of anhydrous DMSO and directly loaded onto a C18 column for C18 column chromatography using a gradually increasing acetonitrile / water gradient (10% --> 60%, containing 0.1 v / v TFA). The pure fractions were combined and lyophilized to obtain the product (53 mg, 41%) as a white flocculent solid, which was stored under high vacuum until use.
[0213] Add 2-(3-((2-(piperidin-1-yl)ethyl)carbamoyl)phenyl)imidazo[1,2-]to a 20 mL scintillation vial equipped with a magnetic stir bar. aPyridine-6-carboxylic acid (148 mg, 0.377 mmol, 1 equivalent), DMF (anhydrous, stored on a sieve and in a desiccator, 1.5 mL, 250 mM relative to the starting acid), DIPEA (164 µL, 0.943 mmol, 2.5 equivalent), EDC • HCl (90.3 mg, 0.471 mmol, 1.25 equivalent), 4-dimethylaminopyridine (4.6 mg, 0.0377 mmol, 10 mol%), and N-hydroxysuccinimide (47.8 mg, 0.415 mmol, 1.1 equivalent). The vials were stirred at 45 °C for six hours under anhydrous nitrogen atmosphere, and the consumption of the starting materials was observed by UPLC-MS. The materials were purified in the reaction vessel by a brief aqueous post-treatment; ethyl acetate (5 mL) and saturated sodium bicarbonate aqueous solution (5 mL) were added to the vials. The vial was capped and shaken rapidly. After the layers separated, the aqueous layer was removed using a syringe. The organic layer was rapidly filtered through sodium sulfate and concentrated to dryness on a rotary evaporator. The crude substance was reconstituted in a small amount of anhydrous DMSO and directly loaded onto a C18 column for C18 column chromatography using a gradually increasing acetonitrile / water gradient (10% --> 60%, containing 0.1 v / v TFA). The pure fractions were combined and lyophilized to obtain the product (113 mg, 61%) as a white flocculent solid, which was stored under high vacuum until use.
[0214] Stereochemical determination of active dHTC1 enantiomers The stereochemical configurations of the active enantiomers of dHTC1 were determined by VCD-IR spectroscopy and DFT calculations, as schematically illustrated in Figure 17. In short, racemic dHTC1 was separated by chiral stationary phase chromatography and divided into two main chromatographic fractions (1:( S )-dHTC1,2:( R VCD-IR spectra of dHTC1 were obtained and compared with those calculated by DFT. To increase the confidence level of the stereochemical determination, the same analysis was performed on the intermediate (Bn-7) synthesized earlier, and each enantiomer of dHTC1 was independently synthesized using the resulting optically enriched material. In both cases, the comparison of the measured and calculated VCD-IR spectra supports that the active enantiomers of dHTC1 have ( S Conclusion regarding stereochemical configuration.
[0215] method dHTC1 and Bn-7 were separated into enantiomerically pure samples using a Waters Prep SFC 150 AP. For dHTC1, the two enantiomers were separated using a Daicel IK-3 column (4.6 mm ID x 100 mL, 3 µm particle size) under isocratic conditions (3.3 mL / min, CO2 / 50% MeOH containing 0.5 vol% 7M methanol NH3). The injection volume was 5 µL.
[0216] For Bn-7, isomers were separated using a Daicel IG column (5 µm, 19 x 250 mm) on a Waters Prep SFC 150 AP. Purification was carried out at 40 °C under isocratic conditions (50% MeOH / CO2 containing 0.5 v / v 7M methanol NH3, 100 mL / min, 1600 psi back pressure). Fractionation was triggered by mass spectrometry (ESI+ on a Waters QDa, SIR channel m / z = 245.0).
[0217] The enantiomeric excess of the dHTC1 product synthesized from Bn-7, as determined by stereochemistry, was determined by center-cleaved 2D LC-SFC. 4 The LC dimension consisted of a Waters I-Class LC with a Waters BEH C18 column (1.7 µm, 2.1 x 10⁵ mm) at 55 °C using a 0.1% NH₄OH aqueous solution:acetonitrile gradient (0.6 mL / min, 15%–99% acetonitrile over 2.1 min). Center cutting was performed at 0.97 min using a 6-port 2-position valve equipped with a 10 µL transfer ring. The SFC dimension consisted of a Waters UPC2 SFC with a Daicel IH column (3 µm, 4.6 x 250 mm) at 30 °C using isocratic conditions (3.3 mL / min, 35% MeOH / CO₂ containing 0.5% (v / v) 7M methanol NH₃, 1600 psi back pressure). Enantiomers were detected by UV light (256 nm).
[0218] (iii) CJ Venkatramani et al. , Simultaneous achiral-chiral analysis of pharmaceutical compounds using two-dimensional reversed phase liquidchromatography-supercritical fluid chromatography. Talanta148, 548-555 (2016). VCD-IR spectra were obtained as follows. Just before use, CDCl3 solvent (Cambridge Isotope Labs, with silver foil) was passed through a small activated basic alumina stopper. 200 µL of CDCl3 was added to a vial containing 7.5 mg of Bn-7 (enantiomer 1 or enantiomer 2). The resulting solution was transferred to a liquid IR cell (BaF2, 100 µm cell path) and placed in the measurement chamber. The instrument was a BioTools, Inc. (Jupiter, FL) ChiralIR 2X Dual PEM FT-VCD spectrometer, set to 4 cm⁻¹. -1 Resolution, PEM (both 1 and 2) maximum frequency set to 1400 cm⁻¹ -1 Then, the sample was measured for 8 hours in a one-hour block. The IR data from the first block were subtracted for solvent and water vapor, and then measured at 2000 cm⁻¹. -1 The offset is set to zero. The VCD data blocks are averaged and subtracted to produce the half-difference spectrum ((E1–E2) / 2). Finally, the VCD spectrum is set at 2000 cm⁻¹. -1 Offset to zero. Block averaging of VCD noise data allows for immediate use without further processing.
[0219] Use DMSO- d 6. (Cambridge Isotope Labs) Repeat the above procedure for the dHTC1 sample; no further purification is required.
[0220] Theoretical VCD-IR spectra were predicted and compared with experimental spectra using Jaguar Spectroscopy (Schrödinger Maestro version 13.9.138, MMshare version 6.5.138, revision 2024-1, platforms Linux-x64_64 and Darwin-x86_64). For spectral prediction, conformational search was first performed using the OPLS4 force field with mixed torsion / low mode sampling (200 steps, MM energy window 5.0 kcal / mol). Up to 24 conformational isomers were retained, exhibiting atomic biases up to 0.50 Å within the 5.0 kcal / mol QM energy window. Subsequently, the LACVP** basis set (solvent: chloroform [( S )-Bn-7] or DMSO [( S DFT calculations were performed at the theoretical B3LYP-D3 level. The predicted spectra shown are Boltzmann-weighted averages of the lowest-energy conformational isomers. At 950 cm⁻¹ -1 -2000 cm -1Comparison of VCD-IR spectra measured and averaged in the wavenumber region (Needleman-Wunsch algorithm).
[0221] References For purposes of clarity and understanding, the foregoing disclosure has been described in detail to a certain extent by way of example and embodiments. It will be apparent to those skilled in the art that variations and modifications can be made within the scope of the appended claims. Therefore, it is to be understood that the foregoing description is intended to be illustrative and not restrictive. Consequently, the scope of this disclosure should not be determined by reference to the foregoing description, but rather by reference to the following appended claims and the full scope of their equivalents.
[0222] This application references various granted patents, published patent applications, journal articles and other publications, each of which is incorporated herein by reference.
Claims
1. A method for identifying a degrading agent for a target protein, the method comprising: 1) Select a known ligand for the target protein; 2) High-throughput parallel synthesis was used to generate multiple analogues of the ligand; 3) Identify analogs with high affinity for the target protein from the plurality of analogs formed in step 2); And 4) use cell-based HiBiT or other high-throughput assays to identify high-affinity analogues of the target protein formed in step 3) that degrade the target protein, or to identify hits that can induce proximity between the protein of interest and a second protein target.
2. The method of claim 1, further comprising performing a subsequent cell-based HiBiT assay to determine whether the mechanism by which the high-affinity analog degrades the target protein occurs via: 1) proximity-driven pharmacology via a monovalent interface binding to a second protein as a molecular glue; 2) PROTAC-like bivalent binding to both the target protein and the E3 substrate adaptor; 3) autophagy; 4) the high-affinity analog acting as a hydrophobic tag; or 5) another pathway leading to the degradation of the protein of interest.
3. The method of claim 1 or claim 2, wherein the mechanism of degradation of the target protein occurs via proximity-driven pharmacology through a monovalent interface between the target protein and the molecular glue.
4. The method of claim 1 or claim 2, wherein the mechanism for degrading the target protein occurs via PROTAC-like bivalent binding to both the target protein and the E3 substrate adaptor.
5. The method of claim 1 or claim 2, wherein the mechanism for degrading the target protein occurs via autophagy.
6. The method of claim 1 or claim 2, wherein the mechanism of degradation of the target protein occurs via the high-affinity analogue used as a hydrophobic tag.
7. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) Adding a carboxylic acid derivative to a known ligand of the target protein; 2) Esterify the carboxylic acid to convert it into the corresponding NHS-ester; 3) Add a variety of aliphatic amines to the NHS-ester derivative in a high-throughput manner to form an amine-functionalized analog of the known ligand of the target protein via amide linkage.
8. The method of claim 7, wherein the method is based on the following reaction scheme: in: A is a known ligand of the target protein; R 1 To be optionally used by one or more R 2 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 2 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
9. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) Adding an ester-functionalized amine to the carboxylic acid derivative of the known ligand of the target protein to form the ester derivative via an amide bond; 2) Converting the resulting ester derivative into the corresponding carboxylic acid derivative; and 3) Treating the carboxylic acid derivative with a spirocyclic succinimide derivative.
10. The method of claim 9, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 3 It is an (C1-C6) alkyl group; R 4 To be optionally used by one or more R 5 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; R 5 It can be an oxo group, OH, NH2, a halo group, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl, or N((C1-C6)alkyl)2; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
11. The method of claim 10, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; and n is 0 or 1; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
12. The method of claim 10 or claim 11, wherein n is 0.
13. The method of claim 10 or claim 11, wherein n is 1.
14. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) subjecting the known ligand of the target protein to a sulfur (VI) fluorine exchange (SuFEx) to form an iminosulfuroxydifluoride derivative; and 2) subjecting the iminosulfuroxydifluoride derivative to high-throughput addition of various aliphatic amines to form an amine-functionalized analog of the known ligand of the target protein via a sulfonamide bond.
15. The method of claim 14, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 6 To be optionally used by one or more R 12 Substituted (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl, (C1-C6)alkyl(C3-C7)heterocycloalkyl, (C1-C6)alkyl(C6-C 10 )aryl or (C1-C6)alkyl (C5-C6) heteroaryl; and R 7 It can be an oxo group, OH, NH2, halogroup, (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, NH(C1-C6)alkyl or N((C1-C6)alkyl)2; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
16. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis comprises: 1) Treating an aryl carboxylic acid derivative of a known ligand of a target protein with an amine functionalizing group to form an amide derivative of the known ligand; 2) subjecting the amide derivative to a sulfur (VI) fluorine exchange (SuFEx) to form an iminosulfur difluoride derivative; and 3) further adding an aliphatic amine to form a sulfonamide-linked amine functionalized derivative of the known ligand.
17. The method of claim 16, wherein the method is based on the following reaction scheme: in A is a known ligand of the target protein; R 13 It is (C1-C6)alkyl, (C1-C6)heteroalkyl, (C1-C6)alkyl(C3-C7)cycloalkyl or (C1-C6)alkyl(C3-C7)heterocycloalkyl; This includes their enantiomers, non-racemic or racemic mixtures, and pharmaceutically acceptable salts.
18. The method of any one of claims 1 to 6, wherein the high-throughput parallel synthesis method includes, but is not limited to: 1) Sulfur(VI) Fluorine Exchange (SuFEx) ; 2) Copper-catalyzed cycloaddition of azide-alkyne hydrocarbons ; 3) Ruthenium-catalyzed cycloaddition of azide-alkyne hydrocarbons ; 4) Strain-promoted cycloaddition of azide-alkyne hydrocarbons ; 5) Strain-promoted alkyne-nitroketone cycloaddition ; 6) Diels-Alder (reverse electron demand of olefin-tetraazine) ; 7) Alkene-tetrazole photoclick reaction ; 8) Coupling of amides with activated esters ; 9) Coupling of amides with in-situ activated esters ; 10) Urea coupling of unactivated carboxylic acids ; 11) Urea coupling of isocyanates ; 12) Urea coupling of acyl azides ; 13) Radical coupling of activated alkyl halides ; 14) Free radical nitroketone coupling of carboxylic acids ;as well as 15) Cross-coupling catalyzed by transition metals ; in: R1, R2, R3, and R4 are each independently H, (C1-C6)alkyl, (C3-C7)cycloalkyl, (C3-C7)heterocycloalkyl, (C6-C4) ... 10 ) aryl or (C5-C8) heteroaryl.
19. The method of any one of claims 1 to 18, wherein the second protein is a substrate receptor for E3 ubiquitin ligase.
20. The method of any one of claims 1 to 19, wherein the second protein is CRBN.
21. The method of any one of claims 1 to 20, wherein the target protein is a transcriptional co-regulatory factor.
22. The method of claim 21, wherein the target protein is the chromatin reader YEATS domain of the transcriptional co-regulatory factor ENL.
23. The method of any one of claims 1 to 22, wherein the known ligand of the target protein (A) is an ENL inhibitor having an amide-imidazopyridine scaffold of formula (I): (I) in: R is (C1-C6)alkyl, (C1-C6)heteroalkyl, halo(C1-C6)alkyl, (C3-C7)cycloalkyl, or (C1-C6)alkyl(C3-C7)cycloalkyl.
24. The method of claim 23, wherein R is cyclobutane.
25. The method of claim 17, wherein the method is based on the following reaction scheme: 。 26. A compound having the following structure: 。 27. The method of claim 8, wherein the method is based on the following reaction scheme: 。 28. The method of claim 27, wherein R 1 for .
29. The method of claim 28, wherein the method is based on the following reaction scheme: 。 30. A compound having the following structure: 。 31. The method of claim 12, wherein the method is based on the following reaction scheme: 。 32. A compound having the following structure: 。 33. The method of claim 13, wherein the method is based on the following reaction scheme: 。 34. A compound having the following structure: 。 35. A pharmaceutical composition comprising the compound of claim 26 and a pharmaceutically acceptable carrier, excipient, or diluent.
36. A method of treating a subject with leukemia, the method comprising administering a therapeutically effective amount of the compound of claim 26 or the pharmaceutical composition of claim 35.
37. The method of claim 36, wherein the leukemia is acute myeloid leukemia (AML).
38. The method of claim 36, wherein the leukemia is acute lymphoblastic leukemia (ALL).
Citation Information
Patent Citations
An apparatus and method for emulating the touch and feel of a real piano
WO2009046528A1
Piperidine derivatives
WO2009125809A1