Development and application of oligonucleotide drugs targeting key assembly proteins g3bp1 / 2 of stress granules

Abstract

This invention belongs to the field of biomedicine, specifically relating to the development and application of oligonucleotide drugs targeting the key assembly proteins G3BP1 / 2 of stress granules. The oligonucleotides in these drugs are all composed of 20 bases, with 5 bases at each end modified with 2'-O-methoxyethyl, and 10 consecutive ordinary bases in the middle to ensure targeting specificity. Simultaneously, the entire nucleic acid chain is modified with thiophosphorylation. The oligonucleotide molecules disclosed in this invention possess targeting specificity, high molecular activity, and in vivo metabolic stability, providing research directions and candidate drugs for clinical targeting of stress granules and improvement of neurodegenerative diseases such as ALS.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically involving the development of specific antisense oligonucleotides (ASO) drugs targeting the key assembly protein G3BP1 / 2 of stress particles, and evaluating their preclinical efficacy in preventing or treating neurodegenerative diseases, especially ALS. Background Technology

[0002] Neurodegenerative diseases are a class of neurological disorders caused by the progressive loss of neurons in the central or peripheral nervous system. The degeneration of neural network structure and function, along with the loss of neurons, prevents neurons from renewing themselves in a timely and effective manner, leading to the collapse of the neural network and ultimately resulting in impairment of memory, cognition, behavior, sensation, and / or motor function. Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is one such neurodegenerative disease. It primarily damages upper and lower motor neurons and the muscles they innervate in the trunk, limbs, and face. Clinical manifestations include progressive skeletal muscle weakness, muscle atrophy, and bulbar palsy. As the disease progresses and worsens, it also affects respiratory muscle function, leading to respiratory distress. The survival time for patients is typically 2-5 years. The disease develops rapidly and seriously endangers human life and health. Although existing interventions with chemical and biological drugs can alleviate the progression of the disease to some extent, there is still no effective way to prevent or cure it.

[0003] Antisense oligonucleotides (ASOs) are single-stranded oligonucleotide molecules ranging in size from 18 to 30 nt. They can be DNA, RNA, or a hybrid DNA / RNA single strand. Intracellularly, they target specific mRNA sequences through complementary pairing mechanisms. Under the action of ribonuclease H1, the target mRNA is degraded, thereby inhibiting the expression of the target protein. They can also achieve alternative splicing of pre-mRNA through steric hindrance effects, regulating the translation process of target genes, and thus achieving the purpose of treating diseases.

[0004] Antisense oligonucleotides (ASOs) have shown unique advantages in the treatment of neurodegenerative diseases. Various ASOs have been developed targeting different proteins, and some have achieved good therapeutic effects in clinical trials. However, the targeting and metabolic stability of ASOs make the development of these drugs still challenging.

[0005] Stress granules (SG) are biomolecular condensates assembled within the cytoplasm by cells in response to external environmental stresses, such as temperature stimulation, osmotic pressure, redox reactions, viral infections, and pathological lesions. These granules are formed through a liquid-liquid phase separation (LLPS) mechanism, consisting of RNA and various RNA-binding proteins. As typical non-membrane organelles, stress granules exhibit highly kinetic properties, rapidly disassembling upon the removal of external stress conditions to release their RNA and proteins. Therefore, stress granules participate in the regulation of cellular homeostasis under stress. However, under pathological or excessive stress conditions, the disassembly process of stress granules is disrupted, leading to an irreversible phase transition from liquid to solid phase. Solid-like protein deposition is closely related to the occurrence and development of various diseases, such as neurodegenerative diseases and tumors.

[0006] G3BP protein is a key molecule in the assembly of stress granules under various stress states in mammalian cells. The intermolecular interaction network mediated by this protein is the molecular basis of stress granule assembly. The absence of G3BP1 / 2 proteins disrupts intracellular protein-protein and protein-nucleic acid interactions, thereby completely inhibiting stress granule assembly. Therefore, G3BP1 / 2, as the hub of stress granule assembly, plays a crucial role in physiological processes. Targeting G3BP1 / 2 proteins can regulate the assembly and disassembly of stress granules, thereby modulating the physiological and pathological processes involved in stress granule assembly. Currently, various proteins and peptides that negatively regulate stress granule assembly have been discovered, such as USP10 and nsP3 (a non-structural protein 3 of alpha viruses), and their inhibitory effects on stress granules by interfering with the integrity of the intermolecular interaction network have been verified at the cellular level. However, oligonucleotide molecules targeting G3BP1 / 2 have not yet been reported, and whether regulating stress granule assembly in the nervous system effectively intervenes in the development of neurodegenerative diseases remains unclear.

[0007] Currently, there are no effective clinical interventions or treatments for neurodegenerative diseases. Although these diseases pose a threat to humans no less than cardiovascular diseases, their development success rate is less than 6% due to the difficulty in targeting and penetrating the blood-brain barrier, resulting in a success rate far lower than that of other drug development methods, as the disease originates in neural tissue. RNA interference, which specifically inhibits the expression of target genes by complementary base pairing of small nucleic acid molecules such as siRNA or ASO, shows promising application potential in the treatment of neurodegenerative diseases. However, the application of siRNA to neurodegenerative diseases still faces several major challenges, the most significant being the "delivery" problem. Traditional siRNA administration relies on intracranial injection, a invasive process that easily induces neuroinflammation. While nanocarriers developed in recent years can be administered intravenously, they still face the serious challenges of immunogenicity and difficulty in crossing the blood-brain barrier to enter the central nervous system. Another issue is "stability." ASO, with its small molecular weight, can specifically target neural tissue after modification and has strong tissue permeability, making it one of the main types of drugs developed for this type of disease. However, naked nucleotides are highly susceptible to degradation by nucleases, leading to their inactivation. While chemical modifications to the nucleic acid backbone have significantly improved their stability in recent years, drug molecules achieving good clinical results remain rare. Therefore, the development of novel targets is urgently needed to advance the clinical diagnosis and treatment of neurodegenerative diseases. Summary of the Invention

[0008] This invention provides a class of antisense oligonucleotide molecules targeting the key stress granule assembly protein G3BP1 / 2. These oligonucleotides are single-stranded molecules consisting of 20 bases and bind through complementary pairing with target genes. They can significantly reduce the expression level of G3BP1 / 2 protein in cells and mice, thus delaying the progression of neurodegenerative diseases characterized by TDP43 protein aggregation.

[0009] To achieve the above objectives, the specific technical solution of the present invention is as follows: This invention provides an oligonucleotide molecule targeting G3BP1 / 2 protein. The oligonucleotide molecule consists of 20 bases, with 5 bases at each end of the oligonucleotide molecule modified with 2'-O-methoxyethyl, and 10 consecutive unmodified bases in the middle. The oligonucleotide molecule is also fully thiophosphorylated. The oligonucleotide molecule has the structure shown in formula (IA); 5'-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*X*X*X*X*X*X*X*X*X*-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*-MOE-3'; (IA); Where X is selected from nucleotide bases; MOE is 2'-O-methoxyethyl; * represents a thiomodified phospholipid skeleton, or its stereoisomer, or its tautomer.

[0010] Preferably, the nucleotide sequence of the oligonucleotide molecule is selected from the group consisting of SEQ ID NO. 1~24. This invention commissioned Hippo Biotechnology Co., Ltd. to synthesize targeted... g3bp1 and g3bp2 Twelve oligonucleotide sequences (ASOs) for each gene were dissolved in PBS to a final concentration of 10 μM, and the stock solution was stored at -20°C. The amino acid sequences and three-dimensional molecular structures of G3BP1 and / or G3BP2 proteins exhibit high evolutionary conservation in humans and mice, with encoding gene similarities as high as 86% and 93%, respectively. This invention uses mouse genes as the target sequence in the ASO sequence design, but does not intentionally emphasize species specificity. The specific base sequences of oligonucleotide molecules targeting mouse G3BP1 / 2 proteins are shown in SEQ ID NO. 1-24, and the specific base sequences of oligonucleotide molecules targeting human G3BP1 / 2 proteins are shown in SEQ ID NO. 25-48.

[0011] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the oligonucleotide molecule targeting the G3BP1 / 2 protein, and at least one pharmaceutically acceptable carrier or excipient.

[0012] Specifically, the drug composition is administered via intrathecal injection, intraventricular injection, or intracranial administration.

[0013] The present invention also provides the use of the oligonucleotide molecules targeting G3BP1 / 2 proteins or the pharmaceutical compositions thereof in the preparation of products for downregulating the expression of G3BP1 and / or G3BP2 genes in cells, tissues or organisms.

[0014] Furthermore, the product is a medicine.

[0015] Furthermore, the drug is used to prevent and / or treat diseases associated with abnormal expression or function of G3BP1 and / or G3BP2 proteins.

[0016] Furthermore, the disease is a neurodegenerative disease.

[0017] Preferably, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0018] The beneficial effects of this invention are: This invention targets various g3bp1 and g3bp2 The bioactivity of the gene's ASO was evaluated at the intracellular RNA and protein levels, as well as at the animal level. The specific effects of the invention are as follows: (a) Bioactivity at the mRNA level Using mouse N2A cells as an experimental model, after transient transfection with each ASO for 48 hours, the results were detected. g3bp1 and g3bp2 RNA expression levels were measured, with PBS serving as a blank control. Compared to the control group, the targeted RNA expression level was significantly lower. g3bp1 ASO can reduce [the impact] to some extent. g3bp1 RNA expression was significantly reduced, with ASO-3 / -8 / -9 downregulated by more than 75%. Targeting g3bp2 ASO also exhibited similar biological activity, particularly with ASO-3 / -8 being downregulated by more than 80%. This demonstrates that the 24 oligonucleotides included in this invention exhibit good biological activity at the cellular level.

[0019] (ii) Bioactivity effects at the protein level Using mouse N2A cells as an experimental model, after transient transfection with each ASO for 48 hours, cells were directly lysed with 1x Sample buffer, and total cellular protein was collected. Proteins were separated by SDS-PAGE gel electrophoresis, and the expression levels of proteins G3BP1 and G3BP2 were characterized by Western blotting. PBS was used as a blank control, and GAPDH was used as an internal control. Compared with the control group, the experimental results characterized the targeted... g3bp1 ASO downregulates G3BP1 protein expression levels, with ASO-1 / -8 / -9 showing the most significant effects. The same method was used to target... g3bp2 The molecular effects of each ASO protein level were evaluated, and the results showed that they could all reduce the expression level of G3BP2 protein to varying degrees, especially ASO-8 / -9, which significantly downregulated the expression of G3BP2 protein.

[0020] (III) Bioactive effects in mice The biological effects of various oligonucleotide molecules at the cellular level are screened for molecular activity at the RNA and protein levels. This invention ultimately selects targeted molecules. g3bp1 ASO-N / -M / -5 / -8 / -9 and targeted g3bp2 The bioactivity of ASO-1 / -3 / -5 / -7 / -8 at the animal level was characterized. Transgenic mice overexpressing humanized TDP43 protein were used as an experimental model, and homozygous TDP43 was obtained after hybridization. Tg / Tg Mice were injected unilaterally into the ventricle with different ASOs on days 4 or 5 after birth (P4-P5). Changes in mouse body weight and survival curves were then monitored to characterize the bioactivity of different ASOs in mice. (Pure and TDP43) Tg / TgMice begin to exhibit ALS phenotypes around day 18, such as limb twitching, difficulty standing, and inability to walk in a straight line, and their body weight begins to decrease slowly. Around day 23, they show difficulty eating, and their body weight drops sharply. Treatment with ASO can alleviate early mortality and weight loss in mice caused by ALS to some extent. Especially targeted... g3bp1 ASO-5 / -8 and targeted g3bp2 ASO-7 / -8. To further verify the targeting and bioactivity of each ASO at the animal level, this invention used qPCR and WB to detect their RNA and protein activities, respectively. The results showed that ASO significantly downregulated the RNA and protein expression of various genes in mice. This indicates that the ASO targets... g3bp1 / 2 ASO regulates the protein level of target genes by silencing their transcription and translation processes, and also indicates... g3bp1 / 2 It could potentially become a novel target for intervention in ALS.

[0021] In summary, this invention overcomes the shortcomings of existing technologies and provides a class of antisense oligonucleotide molecules with well-defined structures, high stability, strong targeting, and excellent biological activity in both cell and animal models (especially ALS models). These molecules can serve as important tools for studying the function of G3BP1 / 2 proteins and stress particle biology, and also have broad clinical application prospects and development value in the treatment of neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS). Attached Figure Description

[0022] Figure 1 This is a schematic diagram of an intracellular experimental design; where a represents ASO cell transfection; b represents RNA extraction and reverse transcription; and c represents protein extraction and development.

[0023] Figure 2 A schematic diagram for designing animal experiments.

[0024] Figure 3 The regulatory activities of each ASO on RNA levels in N2A cells; where a represents the target g3bp1 The regulatory activity of each ASO on RNA levels in N2A cells; b is the target g3bp2 The regulatory activity of each ASO on RNA levels in N2A cells.

[0025] Figure 4 The regulatory activities of each ASO on protein levels in N2A cells; where a represents the target protein. g3bp1 The regulatory activities of each ASO on protein levels in N2A cells; b is the target g3bp2 The regulatory activity of each ASO on protein levels in N2A cells.

[0026] Figure 5 TDP43 Tg / Tg In a homologous mouse background, targeting g3bp1 Survival curves of mice in each ASO treatment group.

[0027] Figure 6 TDP43 Tg / Tg In a homologous mouse background, targeting g3bp2 Survival curves of mice in each ASO treatment group.

[0028] Figure 7 This represents the regulatory activity of some ASOs on RNA and protein levels in mice; where 'a' represents the target... g3bp1 The regulatory activity of ASO-8 on RNA levels in mice, #1 and #2 represent two different mouse individuals; b is the target g3bp2 The regulatory activities of ASO-7 and ASO-8 on RNA levels in mice, #1 and #2 represent two different mouse individuals; c represents the regulatory activities of ASO-8 targeting g3bp1 on protein levels in mice; d represents the regulatory activities of ASO-8 targeting g3bp1 on protein levels in mice. g3bp2 The regulatory activity of ASO-7 and ASO-8 on protein levels in mice. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings. It should be noted that this embodiment is based on the present invention and provides detailed implementation methods and specific operation procedures, but the protection scope of the present invention is not limited to this embodiment.

[0030] Example 1 This invention commissioned Hippo Biotechnology Co., Ltd. to synthesize targeted [materials / products]. g3bp1 (Mouse Gene ID: 27041; Human Gene ID: 10146) and g3bp2 Twelve ASOs for each of the (mouse Gene ID: 23881; human Gene ID: 9908) genes were dissolved in PBS to a final concentration of 10 μM, and the stock solution was stored at -20°C. The specific base sequences are shown in Table 1, where the differentially sequenced base alignment results targeting human genes are highlighted in bold. Table 1. Oligonucleotide sequences of the present invention Example 2: Detection of bioactivity at mRNA levels First, this invention selected mouse embryonic fibroblasts (NIH 3T3) and neuroblastoma cells (Neuro-2a) as cell models to detect the targeting properties of each oligonucleotide and its regulatory effect on target gene mRNA. The specific experimental procedure is as follows: 1. Cells at 1x10 6The cells were seeded at a density in 12-well cell culture plates, with 1 ml of fresh DMEM medium (containing 10% FBS (fetal bovine serum) and 1% penicillin / streptomycin) added to each well. The cells were then cultured at 37°C in a 5% CO2 incubator for 24 hours to allow them to adhere completely.

[0031] 2. Transfect each well with ASO / 100 nM. Mix PEI (polyethyleneimine) (μl):DNA (μg) in serum-free medium at a ratio of 3:1. Let stand at room temperature for 15 minutes, then add the mixture to each well. After culturing for 24 hours, replace the medium with fresh medium and continue culturing for another 24 hours. Figure 1 As shown in a.

[0032] 3. Remove the cell culture medium, add 1 ml of TRIzol to each well to lyse the cells, and collect the cells into 1.5 ml EP tubes free of RNase / DNase. Subsequent RNA extraction and reverse transcription will yield cDNA, such as... Figure 1 As shown in b.

[0033] Configure the qPCR reaction system as shown in Table 2.

[0034] Table 2 The specific conditions for the qPCR reaction are shown in Table 3.

[0035] Table 3 GAPDH was used as an internal control to calibrate the mRNA levels of the target genes G3BP1 and G3BP2. The detection primers were as follows: mm GAPDH _F:AGGTCGGTGTGAACGGATTTG; mm GAPDH _R;GGGGTCGTTGATGGCAACA; mm G3BP1 _F:GGAGAAGCCTAGTCCCCTG; mm G3BP1 _R:CCGTGGGCATAGGAAGAGT; mm G3BP2 _F:TGCCTCCTAGTGGTACTGTTT; mm G3BP2 _R:CTCGGCTGTGAGACTGGTG.

[0036] The relative levels of target gene mRNA were calculated to characterize the targeting and bioactivity at the ASO cell level. In the real-time quantitative PCR experiments, all experimental data were statistically analyzed from three biological replicates.

[0037] Using mouse neuroblastoma N2A cells (Neuro-2a cells) as an experimental model, after transient transfection with each ASO (SEQ ID NO. 1~24) for 48 hours, the results were detected. g3bp1 and g3bp2 RNA expression levels were measured, with PBS serving as a blank control. Compared to the control group, the targeted RNA expression level was significantly lower. g3bp1 ASO can reduce [the impact] to some extent. g3bp1 The expression of RNA, of which ASO-3 / -8 / -9 was downregulated by more than 75%, showed a significant difference. Figure 3 a). Targeting g3bp2 ASO also exhibits similar biological activity, especially ASO-3 / -8, which can be downregulated by more than 80% ( Figure 3 b). This demonstrates that the 24 oligonucleotides included in this invention exhibit good biological activity at the cellular level.

[0038] Example 3: Detection of bioactivity at protein levels This invention utilizes mouse N2A cells as a model to test the bioactivity of ASO protein levels in vitro. N2A cells were cultured at a density of 2 x 10⁻⁶ cells / cells. 5 Cells were seeded evenly at a density of cells / well in 12-well cell culture plates. After 24 hours, ASO / 100 nM was transfected with liposomes. After 6 hours, the medium was replaced with fresh DMEM. After culturing the cells for another 48 hours, the cell culture medium was removed, and the cells were washed three times with 1xPBS. 200 μl of 1x Sample buffer was added to each well. Cells were lysed directly with a scraper and collected into 1.5 ml EP tubes. The cells were repeatedly pipetted 10 times with a 1 ml syringe and heated at 95°C for 10 minutes. The sample can be stored at -20°C.

[0039] The composition of the sample buffer (5x) used in this experimental procedure is shown in Table 4.

[0040] Table 4 Western blotting was used for protein separation, and immunoblotting was used to detect the expression levels of target proteins in cells of each group. Protein quantification used GAPDH as an internal control to calibrate the expression levels of target proteins. The detection antibodies used were: GAPDH (Proteintech, Cat#: 10494-1-AP, RRID: AB_2263076), G3BP1 (BD Biosciences, Cat#: 611126, RRID: AB_2232034), and G3BP2 (Proteintech, Cat#: 16276-1-AP, RRID: AB_2878237).

[0041] Using mouse N2A cells as an experimental model, after transient transfection with each ASO (SEQ ID NO. 1~24) for 48 hours, cells were directly lysed with 1xSample buffer, and total cellular protein was collected. Proteins were separated by SDS-PAGE gel electrophoresis, and the expression levels of proteins G3BP1 and G3BP2 were characterized by Western blotting. PBS was used as a blank control, and GAPDH was used as an internal control. Compared with the control group, the experimental results characterized the targeted... g3bp1 ASO downregulates G3BP1 protein expression levels, with ASO-1 / -8 / -9 showing the most significant effects. The same method was used to target... g3bp2 The molecular effects of each ASO protein level were evaluated, and the results showed that they could all reduce the expression level of G3BP2 protein to varying degrees, especially ASO-8 / -9, which significantly downregulated the expression of G3BP2 protein. Figure 4 ).

[0042] Example 4: Detection of bioactivity in mice Amyotrophic Lateral Sclerosis (ALS) is a typical neurodegenerative disease with a rapid and severe onset. Transgenic mice overexpressing human wild-type TDP43 protein are a commonly used disease model, among which homozygous TDP43... Tg / Tg The average lifespan of these mice is only about 21 days. Around 18 days, they exhibit obvious neurodegenerative phenotypes such as limb weakness, inability to stand, and difficulty swallowing. Using these transgenic mice as a disease model, this study aims to verify whether intervening in the expression of G3BP1 / 2 proteins can effectively alleviate the occurrence of ALS, and to verify whether G3BP1 / 2 can serve as a target for neurodegenerative diseases such as ALS.

[0043] like Figure 2 The diagram shown is a schematic representation of the animal experiment involved in this embodiment: 1. Select a target g3bp1 ASO-N / -M / -5 / -8 / -9 and targeted g3bp2The bioactivity of ASO-1 / -3 / -5 / -7 / -8 at the animal level was characterized.

[0044] 2. Using transgenic mice overexpressing humanized TDP43 protein (Gene ID: 23435) as an experimental model, this invention uses heterozygous TDP43... Tg / + Mice with the RRID: IMSR_JAX:012836 were crossbred to produce homozygous TDP43 mice. Tg / Tg Mice were injected unilaterally into the ventricle with different ASOs on day 5 after birth (P5), and the changes in mouse body weight and survival curves were monitored to characterize the biological activity of different ASOs in mice.

[0045] 3. Pure and TDP43 Tg / Tg Mice begin to exhibit ALS phenotypes around day 18, such as limb twitching, difficulty standing, and inability to walk in a straight line, and their weight begins to decrease slowly. Around day 23, they show difficulty eating, and their weight drops sharply. Figure 5 and Figure 6 As shown, ASO treatment can alleviate early death and weight loss in mice caused by ALS to some extent. Especially when targeted... g3bp1 ASO-5 / -8 and targeted g3bp2 ASO-7 / -8.

[0046] 4. To further verify the targeting and bioactivity of each ASO at the animal level, this invention utilizes qPCR and WB to detect their activity at the RNA and protein levels, respectively. The results are as follows: Figure 7 As shown, the results indicate that ASO significantly downregulates the RNA and protein expression of various genes in mice. This demonstrates the effectiveness of targeted therapy. g3bp1 / 2 ASO regulates the protein level of target genes by silencing their transcription and translation processes, and also indicates... g3bp1 / 2 It could potentially become a novel target for intervention in ALS.

[0047] G3BP protein is a key molecule in the assembly of stress granules, and the phase transition of stress granules is closely related to the development of neurodegenerative diseases such as ALS (Amyotrophic Lateral Sclerosis). Previous research on the diagnosis and treatment of ALS has focused on how to clear pathogenic toxic protein molecules, such as the solid-like or fibrillary aggregates of TDP43 protein. This invention focuses on how to regulate the progression of ALS by modulating the assembly and phase transition of stress granules. This invention designs oligonucleotides targeting g3bp1 / 2, and through molecular activity assessments at the cellular and animal levels, validates that g3bp1 / 2 may serve as a novel therapeutic target for ALS.

[0048] Those skilled in the art can conceive and design various modifications and alterations based on the above technical solutions, but all such modifications and alterations should be included within the scope of the claims of this invention.

Claims

1. An oligonucleotide molecule targeting G3BP1 / 2 protein, characterized in that, The oligonucleotide molecule consists of 20 bases, with 5 bases at each end of the oligonucleotide molecule modified with 2'-O-methoxyethyl, and 10 consecutive unmodified bases in the middle, and the oligonucleotide molecule is fully thiophosphorylated. The oligonucleotide molecule has the structure shown in formula (IA); 5'-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*X*X*X*X*X*X*X*X*X*-X*-MOE-X*-MOE-X*-MOE-X*-MOE-X*-MOE-3'; (IA); Where X is selected from nucleotide bases; MOE is 2'-O-methoxyethyl; * represents a thiomodified phospholipid skeleton, or its stereoisomer, or its tautomer.

2. The oligonucleotide molecule targeting G3BP1 / 2 protein according to claim 1, characterized in that, The nucleotide sequence of the oligonucleotide molecule is selected from the group consisting of SEQ ID NO.1~24 or SEQ ID NO.25~48.

3. A pharmaceutical composition, characterized in that, The oligonucleotide molecule targeting the G3BP1 / 2 protein as described in claim 1 or 2 comprises a therapeutically effective amount, and at least one pharmaceutically acceptable carrier or excipient.

4. The pharmaceutical composition according to claim 3, characterized in that, The drug composition is administered via intrathecal injection, intraventricular injection, or intracranial administration.

5. The use of the oligonucleotide molecule targeting G3BP1 / 2 protein as described in claim 1 or 2, or the pharmaceutical composition as described in claim 3 or 4, in the preparation of a product for downregulating the expression of G3BP1 and / or G3BP2 genes in cells, tissues, or organisms.

6. The application according to claim 5, characterized in that, The product in question is a medicine.

7. The application according to claim 6, characterized in that, The drug is used to prevent and / or treat diseases associated with abnormal expression or function of G3BP1 and / or G3BP2 proteins.

8. The application according to claim 7, characterized in that, The disease in question is a neurodegenerative disease.

9. The application according to claim 8, characterized in that, The neurodegenerative disease mentioned is amyotrophic lateral sclerosis (ALS).

Images