Trichoderma reesei and its application in high-yield cellulase and protein and antibacterial
By screening and identifying Trichoderma reesei pcAH410, the problems of insufficient cellulase fermentation yield and enzyme preparation preservation stability under high temperature conditions were solved, realizing efficient and low-cost cellulase and protein production, possessing natural antibacterial ability, and simplifying the industrial fermentation and preservation process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF SCI & TECH
- Filing Date
- 2026-03-12
- Publication Date
- 2026-06-12
AI Technical Summary
Existing Trichoderma strains have insufficient yield and stability of cellulase fermentation under high temperature conditions, resulting in high cooling energy consumption and increased production costs. Furthermore, traditional preservatives have low efficiency and stability issues in enzyme preparation preservation.
A strain of Trichoderma reesei, pcAH410, was screened and identified. It can efficiently ferment cellulase in the range of 28℃-34℃, has natural antibacterial ability, and the fermentation broth contains highly active cellulase and protein, which can kill Escherichia coli and simplify temperature control and the use of preservatives.
This technology enables high-yield production of cellulase and protein under high-temperature conditions, reduces cooling energy consumption, extends the shelf life of enzyme preparations, improves production efficiency and product stability, and reduces production costs.
Smart Images

Figure CN122188806A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a strain of Trichoderma reesei and its application in high-yield cellulase and protein production as well as antibacterial activity. Background Technology
[0002] Trichoderma reesei ( Trichoderma reesei This is a key strain in the industrial production of cellulase, hemicellulase, and other recombinant proteins. Its asexual stage belongs to the Deuteromycetes, while its sexual form is *Cordyceps rubrum*. Hypocrea jecorina (The name has now been unified as) Trichoderma reesei The wild-type *Trichoderma reesei* QM6a was first isolated from rotting military supplies in the Solomon Islands during World War II and has attracted much attention due to its powerful extracellular cellulase secretion ability. *Trichoderma reesei* possesses a sophisticated protein secretion system, generally recognized as safe (GRAS) status, and good fermentation adaptability, making it one of the "chassis cells" of the enzyme industry.
[0003] Since the 1960s, the U.S. Army Natick Laboratory pioneered mutagenesis screening of wild-type *Trichoderma reesei* QM6a, obtaining the mutant strain QM9414, which significantly increased cellulase production. Subsequently, international enzyme giants Novozymes and Genencor (now part of DuPont) invested heavily in systematic mutagenesis and screening. Novozymes, relying on the Rut C30 strain (derived from QM6a after multiple rounds of mutagenesis, lacking genes related to carbon metabolism repression) released by Rutgers University, continuously combined traditional mutagenesis, genome rearrangement, and metabolic engineering. Genencor also independently developed a series of high-yielding strains. According to incomplete statistics, the two companies have invested more than one billion US dollars in *Trichoderma reesei* research and development, screened tens of thousands of strains, and established a vast private strain bank. These efforts have enabled cellulase fermentation yields to jump from less than 10 g / L initially to over 100 g / L. Novozymes has recently announced that its cellulase production has exceeded 120 g / L (based on total extracellular protein), and the enzyme composition is constantly being optimized. When compounded, it can be directly applied to second-generation biofuels, textiles, feed and other fields.
[0004] In contrast, research on *Trichoderma reesei* in China started relatively late. Although several universities and companies have successively carried out strain mutagenesis and fermentation optimization work, the publicly reported cellulase fermentation levels are mostly between 20-40 g / L, with few records exceeding 60 g / L. The gap mainly stems from the limitations of the original strains, insufficient scale of mutagenesis screening, and a lack of experience in industrial fermentation control. More importantly, for a long time, most of the *Trichoderma reesei* strains used in China have been derived from laboratory strains preserved abroad (such as QM9414 and Rut C30), whose high-yield potential has been fully explored, resulting in a shortage of strains with independent intellectual property rights.
[0005] In the field of industrial microbiology, the modification and screening of fungal heat resistance is a key direction for improving the economics and efficiency of fermentation. Conventional industrial fungi are generally sensitive to high temperatures; their growth and metabolism are typically significantly inhibited when the ambient temperature exceeds 34°C, and they die at 37°C, which is why mammals maintain a body temperature of 37°C. Currently, the optimal temperature for industrial fermentation of filamentous fungi is mostly maintained between 24-30°C, with 28°C being a typical optimal point. However, the industrial fermentation process itself generates a large amount of metabolic heat. To maintain the optimal temperature environment, continuous cooling measures must be taken, resulting in huge cooling energy and water consumption, significantly increasing production costs. Appropriately increasing the fermentation temperature can not only significantly reduce the cooling load and optimize the efficiency of the condensate recovery system, but also promote the comprehensive utilization of waste heat, thereby achieving significant energy-saving and cost-reduction effects.
[0006] Studies have shown that for every 1°C increase in fermentation temperature, production enterprises can achieve significant capacity increases and cost savings by reducing refrigeration energy consumption and improving equipment utilization. Currently, the most heat-resistant *Trichoderma reesei* strain is an important industrial *Trichoderma reesei* strain RL-P37 (NRRL 15709), obtained through mutagenesis and selection. Its genetic background can be traced back to the wild-type strain QM6a (ATCC 13631). The RL-P37 strain was obtained by Bland S. Montenecourt at Lehigh University in the United States through ultraviolet mutagenesis screening. The selection of RL-P37 aimed to enhance cellulase yield and thermal stability. Compared to its parent strain, it exhibits a significant high-temperature growth advantage (it can grow at 37°C), but fermentation for enzyme production still requires cooling to 28°C (US Patent 4797361; Canadian Patent CA466049).
[0007] Based on this, a heat-resistant *Trichoderma reesei* strain that can grow well at temperatures above 30°C and efficiently produce enzymes through fermentation at temperatures above 30°C was screened, possessing extremely important industrial application value. This heat-resistant strain can maintain normal growth and metabolic activity at higher temperatures, significantly reducing dependence on cooling temperature control systems, thereby reducing cooling water consumption, saving energy consumption, improving the overall thermal efficiency and stability of the fermentation process, and ultimately achieving effective reduction in production costs and significant improvement in economic benefits.
[0008] Furthermore, in the preservation of liquid enzyme preparations, a series of preservatives are usually added to prevent microbial contamination that could lead to enzyme activity loss or deterioration. These preservatives primarily inhibit the growth of bacteria and molds by interfering with the permeability of microbial cell membranes and enzyme systems. However, traditional preservative combinations have limitations in practical applications. For example, large quantities are often used to achieve better results, and during long-term storage, enzyme proteins may precipitate, the solution may become turbid, affecting the product's appearance and stability, and even causing enzyme activity loss. If the *Trichoderma reesei* fermentation broth is rich in natural hydrolytic enzymes to hydrolyze bacterial cell walls and kill spoilage bacteria, it would give it extremely high application value, directly reducing raw material procurement costs, while also reducing the introduction of various external chemical reagents, simplifying the process, and avoiding the risk of enzyme activity decline due to interactions between certain chemical preservatives and enzyme proteins. This natural antibacterial activity, derived from the fermentation process itself, will help to more effectively control microbial growth in products, enhance their own preservative capabilities, and thus significantly extend the shelf life of liquid enzyme preparations. It will also improve the product's storage stability under ambient temperature or cold chain conditions, providing new ideas and competitive advantages for developing greener, safer, and more cost-effective enzyme products. However, there are currently no reports of *Trichoderma reesei* species capable of hydrolyzing bacterial cell walls and killing spoilage bacteria.
[0009] Therefore, leveraging China's abundant biological resources, isolating, identifying, and preserving thermoresistant strains of *Trichoderma reesei* with unique genetic backgrounds is particularly important. Systematic preservation, genome analysis, and targeted modification of these native strains hold promise for breaking down patent barriers held by multinational corporations, cultivating high-yield industrial strains with completely independent intellectual property rights, and gaining a competitive edge in today's increasingly fierce competition in bio-based products. Summary of the Invention
[0010] The purpose of this invention is to provide a strain of *Trichoderma reesei* and its application in high-yield cellulase and protein production, as well as antibacterial properties, to solve the problems existing in the prior art. The *Trichoderma reesei* pcAH410 provided by this invention, under optimal fermentation conditions, achieves a total extracellular protein concentration of 137 g / L in the fermentation broth, a cellulase activity of 1345 U / mL, and the fermentation broth exhibits activity against *Escherichia coli*, can act as a preservative, and extends the shelf life of the enzyme solution, thus meeting the industrial needs for hydrolysis of cellulose-containing raw materials.
[0011] To achieve the above objectives, the present invention provides the following solution: This invention provides a strain of Trichoderma reesei ( Trichoderma reesei pcAH410, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 2025961, deposited on May 6, 2025, at Wuhan University, Wuhan, China.
[0012] The present invention also provides the application of the above-mentioned Trichoderma reesei pcAH410 in the production of cellulase and extracellular protein.
[0013] The present invention also provides a method for preparing a product rich in highly active cellulase and high concentration of protein, the product comprising enzyme powder and enzyme solution; The enzyme solution was obtained by fermenting Trichoderma reesei pcAH410 and collecting the supernatant of the fermentation broth. The enzyme solution is dried to obtain the enzyme powder.
[0014] Furthermore, the culture medium used for fermentation is as follows: 20 g / L inverted sophora syrup, 27 g / L corn steep liquor, 3 g / L yeast powder, 3 g / L wheat bran, 6 g / L KH2PO4, 5 g / L (NH4)2SO4, 1 g / L Tween 80, 0.5 g / L CaCl2, 1 g / L MgSO4·7H2O, 5 mg / L FeSO4·7H2O, 1.6 mg / L MnSO4·H2O, 1.4 mg / L ZnSO4·7H2O, and 2 mg / L CoCl2·6H2O.
[0015] Furthermore, the fermentation culture method is as follows: fermentation culture at 34℃ for 2-3 days, during which the pH is maintained at 4.2; cooling to 28℃ and continuing fermentation culture for 6-8 days, during which the pH is maintained at 5.0; starting from 48h of fermentation culture, carbon and nitrogen sources are supplemented in a fed-batch manner so that the residual glucose content in the fermentation broth is 0.01-0.3g / L; During the fermentation process, the rotation speed is 100-1000 rpm and the aeration rate is 0.2-2 vvm.
[0016] Optionally, the carbon source is selected from one or more of plant straw, cellulose, sulfuric acid hydrolyzed starch, sophorose, and lactose; the nitrogen source is selected from one or more of yeast powder, peptone, malt extract, corn steep liquor, soybean peptone, wheat bran, ammonia, ammonium sulfate, and urea.
[0017] The present invention also provides a product rich in highly active cellulase and high concentration of protein prepared by the above preparation method, the product comprising enzyme powder and enzyme solution.
[0018] The present invention also provides the application of the above-mentioned Trichoderma reesei pcAH410 in the production of antibacterial products.
[0019] Furthermore, the antibacterial product contains the aforementioned Trichoderma reesei pcAH410 and / or its fermentation broth.
[0020] Furthermore, the antibacterial product has the effect of killing Escherichia coli.
[0021] The present invention also provides an antibacterial product comprising the above-mentioned Trichoderma reesei pcAH410 and / or its fermentation broth.
[0022] Optionally, the antibacterial products include, but are not limited to, antibacterial agents, food preservatives, food freshness preservers, and feed bactericides.
[0023] The present invention discloses the following technical effects: This invention isolates a natural Trichoderma reesei strain from an abandoned factory in Yinchuan, Ningxia Hui Autonomous Region. Under optimal fermentation conditions, this strain achieves a total extracellular protein concentration of 137 g / L and a cellulase activity of 1345 U / mL, demonstrating excellent production performance. This strain possesses the ability to efficiently ferment cellulase within a wide temperature range of 28℃-34℃, and retains over 60% of its cellulase production capacity even at 37℃. This characteristic eliminates the need for precise temperature control in the industrial production of cellulase, significantly reducing production costs and simplifying industrial production procedures.
[0024] The *Trichoderma reesei* genome provided by this invention possesses naturally unique sequence characteristics and gene expression regulation patterns. It carries specific regulatory elements that efficiently drive the high expression of two genes, Tre103458 and Tre109278, exhibiting naturally high-efficiency antibacterial capabilities. This allows for preservation, extending the shelf life of enzyme solutions and better meeting the industrial needs of hydrolyzing cellulose-containing raw materials. Compared to conventional *Trichoderma reesei* strains in existing technologies, the strains of this invention demonstrate irreplaceable technical advantages in applications such as food preservation, feed preservation, and the development of biological antibacterial agents. It fills the technological gap in naturally high-expression lysozyme strains of *Trichoderma reesei*, providing a novel genomic resource and technical pathway for the efficient natural expression of fungal lysozyme. It also overcomes the technical bottleneck of existing technologies that require complex methods such as heterologous expression and gene editing to modify strains and obtain antibacterial function. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 The image shows the plate colony morphology of Trichoderma reesei CCTCC NO: M 2025961. Figure 2 BLAST diagram of the ITS sequence of Trichoderma reesei CCTCC NO: M 2025961 and the ITS sequence of Trichoderma reesei QM6a; Figure 3The results show the activity of pNPCase, an exonuclease of cellulase, during shake-flask fermentation of Trichoderma reesei at 28°C. Figure 4 The results show the activity of pNPCase, an exonuclease of cellulase, after 5 days of shake-flask fermentation of Trichoderma reesei at 30℃, 34℃, and 37℃. Figure 5 The antibacterial effect of Trichoderma reesei shake-flask fermentation broth on Escherichia coli (ATCC 25922); Figure 6 The results of monitoring CMCase activity and total extracellular protein concentration during the fermentation process of Trichoderma reesei in a fermenter; Figure 7 The effect of fermentation broth from a Trichoderma reesei fermenter on Escherichia coli (ATCC 25922) was studied. Detailed Implementation
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0032] The *Trichoderma reesei* pcAH410 (CCTCC NO: M 2025961) of this invention was isolated from an abandoned factory in Yinchuan, Ningxia Hui Autonomous Region. It is capable of producing high levels of cellulase and total extracellular protein, and has potential for use in enzyme preparation and protein production. The fermentation broth of this *Trichoderma reesei* pcAH410 contains natural antibacterial components and exhibits activity against *Escherichia coli*.
[0033] The present invention provides a fermentation culture method for the above-mentioned Trichoderma reesei pcAH410, the fermentation culture method comprising: inoculating the above-mentioned Trichoderma reesei into a fermentation medium and fermenting it in a shake flask or fermenter.
[0034] The term "fermentation culture" refers to the process by which Trichoderma reesei secretes and expresses enzymes and proteins through its life activities under aerobic conditions.
[0035] The present invention does not limit the fermentation culture method, as long as it can meet the culture requirements of Trichoderma reesei provided by the present invention. The fermentation culture can be carried out under any suitable conditions and any suitable culture medium can be used.
[0036] In one specific embodiment, the fermentation nitrogen source in the fermentation medium is selected from one or more of yeast extract, peptone, malt extract, corn steep liquor, soybean peptone, wheat bran, ammonia, ammonium sulfate, and urea. In one specific embodiment, the fermentation nitrogen source in the fermentation medium is yeast extract and corn steep liquor. In one specific embodiment, the fermentation nitrogen source in the fermentation medium is yeast extract, corn steep liquor, and ammonium sulfate.
[0037] In one specific embodiment, the fermentation carbon source in the fermentation medium is selected from one or more of plant straw, cellulose, sulfuric acid hydrolyzed starch, sophorose, and lactose. In one specific embodiment, the fermentation carbon source in the fermentation medium is cellulose. In one specific embodiment, the fermentation carbon source in the fermentation medium is inverted sophorose, whose main components include glucose and sophorose.
[0038] The shake-flask fermentation culture conditions are as follows: fermentation culture for 3-7 days at a temperature of 28℃, 34℃ or 37℃ and a rotation speed of 100-200 rpm.
[0039] The fermentation conditions in the fermenter are as follows: fermentation for 4-15 days at a temperature of 28-34℃, a rotation speed of 100-1000 rpm, and an aeration rate of 0.2-2 vvm, with added carbon and nitrogen sources, and a pH of 3-6. In one specific embodiment, the fermentation conditions are: fermentation for 10 days at a temperature of 28 or 34℃, a rotation speed of 200-800 rpm, and an aeration rate of 0.5-1 vvm. For the first three days of fermentation, the pH is kept constant at 4.2 and the temperature at 34℃; for the last 7 days, the pH is kept constant at 5.0 and the temperature at 28℃. After 48 hours of fermentation, a carbon source (a 600 g / L inverted sophorate solution) and a nitrogen source (100 g / L ammonium sulfate solution) are added. The carbon source flow rate is constant at 1 g / L / h, while the flow rate is not constant to ensure that the glucose concentration in the fermentation broth is maintained at 0.01-0.3 g / L.
[0040] This invention provides a method for preparing Trichoderma reesei pcAH410 (CCTCC NO: M 2025961) enzyme solution and enzyme powder. The preparation method includes: fermenting Trichoderma reesei using any of the above-described fermentation culture methods to obtain the supernatant of the fermentation broth as the enzyme solution, and drying the enzyme solution to obtain the enzyme powder.
[0041] The present invention does not limit the preparation method of the microbial powder. Conventional methods in the art can be used to treat the fermentation broth to obtain the enzyme solution and enzyme powder.
[0042] The reagents used in the following examples are as follows: Toyobo Corporation's KOD-Plus enzyme; Nanjing Novizan Corporation's One Step Clone Kit; OMEGA Corporation's Agarose Gel Recovery Kit; Dingguo Changsheng Biotechnology Co., Ltd.'s Goldview nucleic acid dye. TM CMCNa from Shanghai Yuanye Biotechnology Co., Ltd.; p-Nitrophenyl-β-Celluloside from Sigma-Aldrich ( p NPC); Beyotime BCA protein concentration rapid assay kit P0398S, or similar products from other companies can be used as substitutes. Other routine biochemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., etc.
[0043] The instruments used in the following embodiments are as follows: Clean bench (AIRTECH), PCR instrument (BioRad), induction cooker, electrophoresis apparatus (DYY-11B), mold incubator (MJX intelligent type), stacked shaking incubator, Zhenjiang Dongfang 5L fermenter, autoclave (Deqiang Instruments), electric drying oven (GFL-125), ultra-micro spectrophotometer, microplate reader, electronic analytical balance, large refrigerated centrifuge (Eppendorf 5804R), small benchtop centrifuge (Eppendorf MiniSpin), pH meter, blue light / ultraviolet gel imaging system, blue light transmission gel cutter, etc.
[0044] The culture medium formulations involved in the following examples are as follows: Luria Bertani (LB) medium formulation: 5g yeast extract, 10g peptone, 10g sodium chloride, bring to a final volume of 1L, natural pH.
[0045] Solid culture medium for spore generation (potato dextrose agar, PDA): Weigh 200 g of peeled potatoes, chop them, add no more than 1 L of water and boil for 30 min. Filter through 8 layers of gauze, take the filtrate, add 20 g of glucose, make up to 1 L, add 2% (w / v) agar powder, and sterilize at 115℃ for 30 min.
[0046] Solid culture medium (potato cellulose agar, PCA) for screening and identification: Weigh 200 g of peeled potatoes, chop them, add no more than 800 mL of water and boil for 30 min. Filter through 8 layers of gauze, take the filtrate and add 200 mL of ball-milled cellulose suspension, make up to 1 L, add 2% (w / v) agar powder, and sterilize at 115℃ for 30 min.
[0047] Ball-milled cellulose suspension: In a 500 mL Erlenmeyer flask, add 10 g of microcrystalline cellulose, 200 mL of deionized water, and glass beads with a diameter of 0.5-1 cm (preferably spread evenly at the bottom). Sterilize (121℃, 20 min). Seal the flask tightly with a rubber bag to prevent moisture evaporation, then place it in a shaker and shake at 200 rpm for 10-15 days. This yields a 5% ball-milled cellulose suspension.
[0048] Shake-flask fermentation medium: 30 g / L ball-milled cellulose, 5 g / L corn steep liquor, 1 g / L yeast extract, 6 g / L KH2PO4, 5 g / L (NH4)2SO4, 1 g / L urea, 0.5 g / L CaCl2, 1 g / L MgSO4·7H2O, 5 mg / L FeSO4·7H2O, 1.6 mg / L MnSO4·H2O, 1.4 mg / L ZnSO4·7H2O, 2 mg / L CoCl2·6H2O, pH 4.5, temperature 28-37℃.
[0049] Fermentation medium in the fermenter: 20 g / L inverted sophora sugar, 27 g / L corn steep liquor, 3 g / L yeast extract, 3 g / L wheat bran, 6 g / L KH₂PO₄, 5 g / L (NH₄)₂SO₄, 1 g / L Tween 80, 0.5 g / L CaCl₂, 1 g / L MgSO₄·7H₂O, 5 mg / L FeSO₄·7H₂O, 1.6 mg / L MnSO₄·H₂O, 1.4 mg / L ZnSO₄·7H₂O, 2 mg / L CoCl₂·6H₂O, pH 4.2. Inverted sophora sugar was prepared by catalyzing the conversion of glucose into sophora sugar using glucosidase, resulting in a mixed sugar containing both sophora sugar and glucose. The preparation method is referenced in: Li et al. Overproduction of cellulase by Trichoderma reesei RUT C30 through batch-feeding of synthesized low-cost sugarmixture. Bioresource Technology 216 (2016) 503-510.
[0050] The detection methods involved in the following embodiments are as follows: The principle and method for determining cellulase activity (CMCase): Under certain conditions, cellulase can hydrolyze sodium carboxymethyl cellulose (CMCNa) to reduce sugars. The amount of reducing sugars is measured using the DNS method, and the cellulase activity is calculated according to the national standard method "GB / T 35808—2018".
[0051] Cellulose exonuclease activity ( p NPCase determination method: p NPCase assay method.
[0052] The principle and method of BCA (Bicinchoninic Acid) protein concentration determination: The BCA method is a widely used protein quantification method, and its principle is based on two steps. 1. Biuret reaction: Under alkaline conditions, the peptide bonds in the protein will release Cu... 2+ Reduced to Cu + 2. Color reaction: Two molecules of BCA react with one Cu... + The protein chelates to form a stable purple complex with a maximum absorption peak at 562 nm. The absorbance of this complex shows a good linear relationship with protein concentration over a wide range (20-2000 μg / mL). This invention uses the Beyotime BCA protein concentration rapid assay kit (product number P0398S) for detection.
[0053] Since over 90% of the protein components in the *Trichoderma reesei* fermentation broth are cellulase, the cellulase yield in the following embodiments of the present invention is mainly expressed as the protein concentration of the fermentation broth. The protein concentration was determined using the BCA method.
[0054] Experimental methods in the following examples, unless otherwise specified, were generally performed under standard conditions, such as those described in *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratory Press, 1989). DNA sequencing, DNA synthesis, genomics analysis, and transcriptomics analysis were performed by conventional biological services companies, whose operating principles and protocols are mature, scientifically validated, and recognized.
[0055] Example 1: Isolation, screening and identification of Trichoderma reesei (1) Treatment of microbial strains Multiple strains of suspected saprophytic fungi from an abandoned factory in Yinchuan, Ningxia Hui Autonomous Region, were diluted with 0.9% saline solution at concentrations of 1:100, 1:1000, and 1:10000.
[0056] (2) Isolation of bacterial strains The diluted bacterial sample was spread onto PCA solid medium and then incubated at 37°C for 72 hours until colonies appeared.
[0057] A suspected Trichoderma strain producing green spores was selected and diluted twice, then spread onto PCA solid medium and incubated at 37°C for 72 hours until colonies appeared. At this stage, the growing strains showed the ability to secrete cellulase, and the enzyme production capacity, growth rate, and colony size were positively correlated.
[0058] (3) Identification of strains In the plate, suspected Trichoderma strains producing green spores are selected for identification; single colonies are picked and genomic DNA is extracted, and the ITS sequence is amplified and sequenced using universal fungal primers ITS1 and ITS4. BLAST comparison analysis is used to determine whether it is Trichoderma reesei. If the sequence similarity is >99%, it can be identified as the same species.
[0059] The primers and sequencing sequences are as follows: The forward primer (ITS1) is: 5'-TCCGTAGGTGAACCTGCGG-3'; The reverse primer (ITS4) is: 5'-TCCTCCGCTTATTGATATGC-3'.
[0060] (4) Characteristic sequence identification Single colonies were picked and genomic DNA was extracted, then amplified and sequenced using specific primers LOX1 and LOX2.
[0061] The primers and sequencing sequences are as follows: The forward primer (LOX1) is: 5'-ATAACTTCGTATAATGTATGC-3'; The reverse primer (LOX2) is: 5'-GAAGTTCCTATTCCGAAG-3'.
[0062] (5) Screening results After identification, a strain of *Trichoderma reesei* was finally obtained and named pcAH410. This strain can grow using cellulose in PCA medium as a carbon source at 37°C. In PDA solid medium, it presents as green, round spores; the plant growth ability of the fungal hyphae is reduced, and after 7 days of culture, it fails to occupy the entire culture dish. Figure 1 The ITS sequence obtained from PCR sequencing was compared with the ITS sequence of the original Trichoderma reesei strain QM6a (GenBank: Z31016.1) using BLAST. Excluding the sequences at both ends used for PCR primer design, the cloned sequence in the middle was completely identical, with a similarity of 100%. (See attached image). Figure 2 According to the research report in the literature on the identification of Trichoderma reesei (Proc. Natl. Acad. Sci. USA 93 (15) 7755-7760), this strain can be identified as... Trichoderma reesei .
[0063] Amplification and sequencing using specific primers LOX1 and LOX2 identified a characteristic sequence as shown in SEQ ID NO. 1 in this strain. Comparison and analysis showed that no other *Trichoderma reesei* strain possessed a 100% homologous sequence. Therefore, the sequence in SEQ ID NO. 1 can be used as a characteristic identification sequence for this strain. Any *Trichoderma reesei* strain whose genome contains a sequence with 100% homology to SEQ ID NO. 1 can be considered a progeny of that strain.
[0064] SEQ ID NO.1: ATAACTTCGTATAATGTATGCTATACGAAGTTATACTAGAGAAGTTCCTATACTTTTTAGAGAATAGGAACTTCGGAATAGGAACTTC.
[0065] Trichoderma reesei ( Trichoderma reeseipcAH410 was deposited on May 6, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with accession number CCTCC NO: M2025961.
[0066] Example 2: Shake-flask fermentation culture of Trichoderma reesei (1) Preparation of spore solution Trichoderma reesei was inoculated onto a 10 cm diameter PDA plate and incubated statically at 28°C for 7 days. The PDA plate was then washed with 2 mL of sterile physiological saline to obtain a green spore solution for later use. The spore concentration was calculated using a hemocytometer.
[0067] (2) Shake flask culture The spore suspension was inoculated into shake-flask fermentation medium for fermentation culture. The final spore concentration in the shake-flask fermentation medium after inoculation was 2 × 10⁻⁶. 6 The sample size was measured per mL. The culture temperature was 28℃ or 37℃, the rotation speed was 200 rpm, and the culture time was 5 days. Samples were taken starting from the third day. p NPCase. The original Trichoderma reesei strain QM6a (ATCC 13631) and the classic heat-resistant mutant strain RL-P37 (NRRL 15709) of Trichoderma reesei were used as controls.
[0068] Figure 3 The results show the results of shake-flask fermentation at 28°C. It can be seen that the cellulase exonuclease activity produced by *Trichoderma reesei* CCTCC No. M 2025961 during shake-flask fermentation is several times higher than that of the original *Trichoderma reesei* strain QM6a and the classic heat-resistant mutant strain RL-P37. This indicates that the CCTCC NO: M 2025961 strain of this invention is an excellent *Trichoderma reesei* strain with high cellulase production and has significant industrial value.
[0069] Figure 4The enzyme production was observed after 5 days of shake-flask fermentation at 30℃, 34℃, and 37℃. It can be seen that the exonuclease activity of *Trichoderma reesei* CCTCC NO: M 2025961 during shake-flask fermentation was higher than that of QM6a and RL-P37. At 34℃, QM6a showed a 70% decrease in cellulase activity; at 37℃, growth was very slow, and fermentation was almost impossible. At 34℃, RL-P37 showed a 30% decrease in cellulase activity; it could grow at 37℃, but enzyme production was severely limited, with a 70% decrease in cellulase activity. Therefore, RL-P37 can grow at 37℃, but cannot maintain its fermentation enzyme production performance at this temperature. This is consistent with previously reported patents (US Patent 4797361; Canadian Patent CA466049), as the RL-P37 strain is not a mutant strain screened under high-temperature conditions and is fundamentally different from the *Trichoderma reesei* CCTCC NO: M 2025961 of this invention. The *Trichoderma reesei* CCTCC NO: M 2025961 of this invention can grow using cellulose in PCA medium as a carbon source at 37°C. At 34°C, its cellulase activity does not decrease and is comparable to that at 28°C and 30°C; at 37°C, the cellulase activity decreases by only 38%, which is also superior to RL-P37 and QM6a. This indicates that *Trichoderma reesei* CCTCC NO: M 2025961 of this invention possesses the ability to efficiently ferment cellulase within a wide temperature range of 28°C-34°C. Furthermore, in the industrial production of cellulase, precise temperature control is not required, and even if the fermentation temperature occasionally exceeds 34°C, it will not significantly affect the fermentation results, greatly reducing production costs and simplifying the operation procedure.
[0070] Example 3: Antibacterial function of Trichoderma reesei CCTCC NO: M 2025961 (1) Analysis of the antibacterial function of fermentation broth Take 5 mL of each of the Trichoderma reesei fermentation broths from Example 2 at 37°C, add 0.1 g of calcium carbonate to neutralize the pH, and centrifuge at 12000 rpm for 10 minutes. Filter the supernatant through a 0.45 µm sterile syringe filter to obtain sterile Trichoderma reesei fermentation broth, and store it in a refrigerator for later use.
[0071] Escherichia coli (ATCC 25922) was selected as the indicator bacterium. The indicator bacterium was streaked on LB agar plates and incubated at 37°C for about 12 hours. Single colonies were picked from the agar plates and transferred to LB tubes, which were then incubated on a shaker at 37°C for about 12 hours to obtain the indicator bacterium seed culture, which was then stored in the refrigerator for later use.
[0072] After sterilizing LB medium, when the medium temperature drops to 45-50℃ and before it solidifies, take 100µL of each of the above indicator bacterial seed solutions into 1000mL of unclogged LB medium, shake well, and quickly pour into petri dishes, 15mL of medium per dish, and wait for solidification. These are the indicator culture dishes.
[0073] Several stainless steel Oxford cups, with an outer diameter of 8 mm, an inner diameter of 6 mm, and a height of 10 mm, must be autoclaved before use. During the experiment, use sterile forceps to pick up the Oxford cups and gently place them vertically on the surface of the indicator petri dish, pressing lightly to ensure tight, seamless contact with the culture medium, taking care to avoid the Oxford cups sinking into the agar. Place three Oxford cups evenly on each plate, with a spacing of at least 25 mm and a distance of at least 15 mm from the edge of the dish. Carefully pour 200 µL of sterile *Trichoderma reesei* fermentation broth into each Oxford cup, filling it completely but not overflowing, while avoiding the formation of air bubbles. After adding the sample, incubate the plate horizontally at 37°C for 3 hours, then invert it for 15 hours. Observe whether a transparent inhibition zone appears around the Oxford cup.
[0074] The results of the inhibition zone experiment are as follows Figure 5 As shown, the fermentation broth of *Trichoderma reesei* CCTCC NO: M 2025961 produces a distinct inhibition zone. This indicates that *Trichoderma reesei* CCTCC NO: M 2025961 can ferment at 37°C to produce fungal proteins with lysozyme activity, which can kill *Escherichia coli*. Therefore, *Trichoderma reesei* CCTCC NO: M 2025961 of this invention is an excellent *Trichoderma reesei* strain, and its fermentation broth has bactericidal and food preservative functions.
[0075] (2) Transcriptome analysis Three Trichoderma reesei strains (QM6a, RL-P37, and CCTCC NO: M 2025961) were cultured at 37℃ for 72 hours, and then samples were sent to Shanghai Jierui Biotechnology Co., Ltd., where total RNA was extracted for RNA-seq high-throughput sequencing and subsequent bioinformatics comparative analysis. It was found that the proteins encoded by the genes Tre103458 (SEQ ID NO. 2) and Tre109278 (SEQ ID NO. 3) have certain evolutionary homology with lysozyme and belong to the fungal lysozyme family. However, these two genes are not expressed or are expressed in trace amounts in Trichoderma reesei QM6a and RL-P37; but are significantly expressed in Trichoderma reesei CCTCC NO: M 2025961, at levels tens to hundreds of times higher than in QM6a and RL-P37 (see Table 1). This indicates that the differences in antibacterial function between *Trichoderma reesei* QM6a, RL-P37, and CCTCC NO: M 2025961 are due to differences in the expression of these two genes. The *Trichoderma reesei* CCTCC NO: M 2025961 genome of this invention possesses naturally unique sequence characteristics and gene expression regulation patterns, carrying specific regulatory elements that efficiently drive the high expression of two genes, Tre103458 and Tre109278, thus exhibiting naturally efficient antibacterial capabilities.
[0076] Table 1 Expression differences of Tre103458 and Tre109278 in three Trichoderma reesei strains SEQ ID NO.2: ATGAAGTTTCTGACTCCCCTTGCCGTCCAATTGGCAGCCCTTGCCTCTATGGCCAGCGCAACCGTGCCAGGATTCGACATTTCCCACTACCAAGCCACCGTTGACTTTGCCAAAGCCTATGCCGATGGTGCACGCTTTGTGATCATCAAGGCTACTGAGGGCACCACCTACACTGACCCCAGCTTCAGCGATCACTATACCAAGGCGACCAATGCCGGCTTCATCCGGGGTGGTTACCACTTTGCCCAGCCCGCCTCCTCTTCCGGTGCTGCCCAAGCCAACTACTTTCTCAAACACGGAGGCGGCTGGTCAGCGGACGGCATCACACTTCCTGGTATGCTGGATCTTGAGTATGCTCCCAGCGGCGACAGCTGCTATGGCTTGAGCGCGAGTGCCATGGTCAGCTGGATCAACGACTTTGTCAACACTTACCACGCTGCTACGACCCAGTATCCTCTCATTTACACCTCCACAAGCTGGTGGCAACTCTGTACTGGGAACAATGGCTCGTTTGGTAGCAAATCGCCTCTTGTTATCGCGCGGTATGCTAGCTCTGTTGGGGCGCTGCCCAATGGCTGGAGCGTTTATACAATCTGGCAGAACAGTGATGCCTCTCCCTGGGGTGGCGATAATGATATCTTCAACGGAAATCTCGCACAACTGCAGAAGATTGCCCGCGGAAGTTAG。
[0077] SEQ ID NO.3: .
[0078] Example 4: Fermentation of Trichoderma reesei (1) Preparation of seed liquid The spore solution from Example 2 was inoculated into a shake-flask fermentation medium for fermentation. The final spore concentration in the shake-flask fermentation medium after inoculation was 2 × 10⁻⁶. 6 The culture temperature was 34℃, the rotation speed was 200 rpm, and the culture time was 2 days to obtain the seed culture for later use.
[0079] (2) Fermentation tank culture Before inoculation, a 2.7L fermenter culture medium was prepared and placed in a 5L fermenter, then steam-sterilized at 115℃ for 30 minutes. 300mL of seed culture was inoculated into the fermenter at a 10% inoculation rate for fermentation. The culture was incubated at 34℃ for 3 days, then moved to the optimal enzyme production temperature of 28℃ and incubated for another 7 days, with an initial rotation speed of 200 rpm. During fermentation, carbon source (600 g / L inverted sophorose solution) and nitrogen source (100 g / L ammonium sulfate solution) were fed in a fed-batch manner, starting after 48 hours of fermentation, to maintain residual glucose levels below 0.3 g / L. Ammonia was used to adjust the pH to 4.2 in the early stage and 5.0 in the later stage. CMCase and extracellular total protein concentrations were measured daily. Figure 6 The Trichoderma reesei fermentation broth provided by this invention has a total extracellular protein concentration greater than 137 g / L and a cellulase activity (CMCase) of up to 1345 U / mL, which can better meet the industrial needs of hydrolysis of cellulose-containing raw materials.
[0080] Samples were taken at 3, 6, and 9 days of fermentation in the fermenter to verify the expression of fungal lysozyme in the fermentation broth. The results of the inhibition zone experiment are as follows: Figure 7 As shown. This indicates that Trichoderma reesei CCTCC NO: M 2025961, under the conditions of cellulase production in a fermenter, simultaneously produces fungal lysozyme with lysozyme activity, which can kill Escherichia coli.
[0081] Therefore, CCTCC NO: M 2025961 of this invention is an excellent *Trichoderma reesei* strain, and its fermentation broth has bactericidal and food preservative functions. Enzyme preparations produced based on CCTCC NO: M 2025961 have bactericidal effects, and their bactericidal activity can serve as or replace some preservatives. Enzyme preparations produced based on CCTCC NO: M 2025961 are natural and environmentally friendly preservatives, which can reduce the cost of adding artificial preservatives.
[0082] (3) Preparation of enzyme solution and enzyme powder After fermentation, the fermentation broth was collected and mixed with diatomaceous earth at a weight ratio of 400:1-200:1. The mixture was then poured into a plate and frame filter (10 μm) to obtain the supernatant as crude enzyme solution. The crude enzyme solution after plate and frame filtration was further sterilized and deturbided by tubular membrane microfiltration (0.2 μm), and then concentrated and purified by spiral wound ultrafiltration membrane with a molecular weight cutoff of 10 kDa to obtain enzyme solution. Finally, maltodextrin was used as an adjuvant for spray drying to obtain enzyme powder.
[0083] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A strain of Trichoderma reesei ( Trichoderma reesei pcAH410, characterized in that, It is deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 2025961, deposited on May 6, 2025, at Wuhan University, Wuhan, China.
2. The use of Trichoderma reesei pcAH410 as described in claim 1 in the production of high-activity cellulase and high-concentration extracellular protein.
3. A method for preparing a product rich in highly active cellulase and high-concentration protein, characterized in that, The products include enzyme powder and enzyme solution; The enzyme solution was obtained by fermenting Trichoderma reesei pcAH410 according to claim 1 and collecting the supernatant of the fermentation broth. The enzyme solution is dried to obtain the enzyme powder.
4. The preparation method according to claim 3, characterized in that, The culture medium used for fermentation was as follows: 20 g / L inverted sophora syrup, 27 g / L corn steep liquor, 3 g / L yeast powder, 3 g / L wheat bran, 6 g / L KH2PO4, 5 g / L (NH4)2SO4, 1 g / L Tween 80, 0.5 g / L CaCl2, 1 g / L MgSO4·7H2O, 5 mg / L FeSO4·7H2O, 1.6 mg / L MnSO4·H2O, 1.4 mg / L ZnSO4·7H2O, and 2 mg / L CoCl2·6H2O.
5. The preparation method according to claim 3, characterized in that, The fermentation culture method is as follows: ferment at 34℃ for 2-3 days, during which the pH is maintained at 4.2; cool down to 28℃ and continue fermentation culture for 6-8 days, during which the pH is maintained at 5.0; starting from 48h of fermentation culture, carbon and nitrogen sources are added in a fed-batch manner to make the residual glucose in the fermentation broth 0.01-0.3g / L; During the fermentation process, the rotation speed is 100-1000 rpm and the aeration rate is 0.2-2 vvm.
6. The preparation method according to claim 5, characterized in that, The carbon source is selected from one or more of plant straw, cellulose, sulfuric acid hydrolyzed starch, sophorose, and lactose; the nitrogen source is selected from one or more of yeast powder, peptone, malt extract, corn steep liquor, soybean peptone, wheat bran, ammonia, ammonium sulfate, and urea.
7. A product rich in highly active cellulase and high-concentration protein, prepared by the method according to any one of claims 3-6, characterized in that, The products include enzyme powder and enzyme solution.
8. The application of Trichoderma reesei pcAH410 as described in claim 1 in the production of antibacterial products.
9. The application according to claim 8, characterized in that, The antibacterial product contains Trichoderma reesei pcAH410 as described in claim 1 and / or its fermentation broth.
10. An antibacterial product, characterized in that, The antibacterial product contains Trichoderma reesei pcAH410 as described in claim 1 and / or its fermentation broth.
Citation Information
Patent Citations
Microorganism and process
US4797361A