Application of adzuki bean (Phaseolus angularis) seed coat-specific gene in improving drought tolerance of plants
By cloning the AnCML4a2 gene from Adiantum repens and overexpressing it in Arabidopsis thaliana, a gap in the research on stress-resistance genes in Adiantum repens was filled, significantly improving the plant's drought resistance and providing a scientific basis for the breeding of new varieties of highly stress-resistant plants.
Patent Information
- Application Number
- CN202610657619.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-19
AI Technical Summary
There is a significant technological gap in the current research on stress-resistance genes, especially drought-resistant and flood-resistant genes, of Adiantum repens, which affects the development and utilization of the species' genetic resources and hinders the breeding of new varieties of plants with high stress resistance.
The AnCML4a2 gene was cloned from Adiantum repens and transformed into Arabidopsis thaliana using gene overexpression technology to enhance the plant's drought resistance. This was achieved by promoting the expression of the AnCML4a2 gene or enhancing its protein function, thereby improving the plant's drought tolerance.
It significantly improved the survival rate of plants under drought stress, enhanced photosynthetic activity, maintained cell membrane integrity, increased proline content, reduced malondialdehyde and hydrogen peroxide content, and enhanced the drought resistance of plants, providing key gene resources for drought-resistant breeding.
Smart Images

Figure CN122235211A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the AnCML4a2 gene of Adiantum repens in improving the drought stress resistance of plants. Background Technology
[0002] Adiantum nelumboides, a maidenhair fern endemic to China, is listed as a Class I protected wild plant in China. It is found only on steep cliffs (slopes 65-87°) in the karst landscape of the Three Gorges Reservoir area of the Yangtze River. Its habitat is characterized by the dual stresses of long-term seasonal drought (due to insufficient water seepage from the rock face) and short-term flooding (fluctuations in the reservoir's water level). It is a key species in maintaining the stability of the karst ecosystem in the Three Gorges Reservoir area and plays an important role in soil and water conservation. In recent years, due to the combined effects of the Three Gorges Project's inundation, over-harvesting for medicinal purposes, and habitat fragmentation, the wild population of Adiantum nelumboides has declined sharply and it has been listed as an endangered (EN) species by the IUCN.
[0003] In the field of molecular biology research, the development of fern genetic resources is still in its early stages. Although some research has been conducted, there are still significant technological gaps in the systematic study of stress-resistance genes unique to *Adiantum repens* (such as genes related to drought tolerance, flood tolerance, and soil and water conservation). Therefore, cloning important trait genes of *Adiantum repens* using genetic engineering techniques and conducting functional studies to elucidate its stress-resistance molecular mechanisms is not only scientifically significant for revealing the evolution of fern environmental adaptation, but also provides crucial technical support for breeding highly stress-resistant new varieties and promoting ecological restoration. Summary of the Invention
[0004] This invention addresses a gap in existing technologies by providing the application of the AnCML4a2 gene from *Adiantum repens* in enhancing plant drought stress resistance. This invention is the first to clone the AnCML4a2 gene from *Adiantum repens* and transform it into wild-type *Arabidopsis thaliana* using gene overexpression technology, verifying its function of significantly improving plant drought resistance and filling a gap in the development and utilization of this species' genetic resources. This invention not only provides a new target for research on the stress resistance mechanisms of ferns but also, through transgenic technology, has significant implications and application value for breeding new varieties of highly stress-resistant plants.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides the application of the AnCML4a2 gene from the Adiantum repens in any of the following A1)-A4): A1) Application in improving plant drought resistance; A2) Application in the preparation of products that improve plant drought resistance; A3) Application in the cultivation of drought-resistant plant germplasm; A4) Application in the preparation of products for cultivating drought-resistant plant germplasm; The amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.2.
[0006] Furthermore, the nucleotide sequence of the AnCML4a2 gene is shown in SEQ ID NO.1.
[0007] Furthermore, by promoting the expression of the AnCML4a2 gene or enhancing the function or activity of its protein in plants, the drought resistance of plants can be improved.
[0008] Furthermore, the AnCML4a2 gene enhances the drought resistance of plants by increasing chlorophyll content and activity, maintaining cell membrane integrity, increasing proline content, and decreasing malondialdehyde, hydrogen peroxide, and superoxide anion content.
[0009] Furthermore, the plants include, but are not limited to: maidenhair fern, Arabidopsis thaliana, rice, corn, wheat, soybean, tobacco, etc.
[0010] This invention also provides the application of an overexpression vector containing the AnCML4a2 gene in any of the following A1)-A4): A1) Application in improving plant drought resistance; A2) Application in the preparation of products that improve plant drought resistance; A3) Application in the cultivation of drought-resistant plant germplasm; A4) Application in the preparation of products for cultivating drought-resistant plant germplasm; The amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.2.
[0011] Furthermore, the backbone vector of the overexpression vector is the pK7WG2D vector.
[0012] Furthermore, the construction method of the overexpression vector containing the AnCML4a2 gene includes: S1. Using the cDNA of Adiantum repens as a template, PCR amplification was performed using primers AnCML4a2-F and AnCML4a2-R as shown in SEQ ID NO.5-6 to obtain the AnCML4a2 gene fragment. S2. The AnCML4a2 gene fragment obtained in step S1 is ligated into the pDONR221 vector through the LR reaction to obtain the intermediate vector pDONR221-AnCML4a2. S3. Using the vector pDONR221-AnCML4a2 as a template, PCR amplification was performed using the attB1-adapter and attB2-adapter primers shown in SEQ ID NO.7-8. The amplification product was ligated to the pK7WG2D vector via BP recombination reaction to obtain the overexpression vector pK7WG2D-AnCML4a2 containing the AnCML4a2 gene.
[0013] The present invention also provides a method for improving plant drought resistance and / or cultivating drought-resistant plant germplasm, by promoting the expression of the AnCML4a2 gene or enhancing the function or activity of its protein, thereby improving plant drought resistance, wherein the amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.2.
[0014] Furthermore, using the expression vector pK7WG2D as the backbone vector, an overexpression vector pK7WG2D-AnCML4a2 containing the AnCML4a2 gene was constructed and transformed into plants to obtain AnCML4a2 gene overexpression lines, thereby improving the drought resistance of plants and / or cultivating drought-resistant plant germplasm.
[0015] Furthermore, the overexpression vector pK7WG2D-AnCML4a2 was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method, and then transformed into plants using the flower immersion method. After screening and culture, transgenic plants were obtained, resulting in AnCML4a2 gene overexpression plant lines.
[0016] Furthermore, the plants include, but are not limited to: maidenhair fern, Arabidopsis thaliana, rice, corn, wheat, soybean, tobacco, etc.
[0017] Beneficial Effects: This invention is the first to clone the AnCML4a2 gene from *Adiantum repens* and confirm its drought-resistant function using *Arabidopsis thaliana*. Overexpression of the AnCML4a2 gene from *Adiantum repens* in *Arabidopsis thaliana* resulted in transgenic plants exhibiting significantly higher survival rates under drought stress compared to wild-type plants. Overexpression of the AnCML4a2 gene enhanced photosynthetic activity, improved cell membrane integrity, increased proline content and superoxide anion capacity, and significantly reduced malondialdehyde (MDA) and hydrogen peroxide (H2O2) content, thereby improving the plant's drought tolerance. This invention not only fills a gap in the development and utilization of gene resources for this species and provides a theoretical basis for the study of the molecular mechanisms of drought resistance in ferns, but also provides valuable gene resources for drought-resistant crop breeding and an effective technical means for creating new drought-resistant plant germplasm, with broad application prospects. Attached Figure Description
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 The relative expression levels of the AnCML4a2 gene at different time points under drought stress in Example 1 of this invention are shown.
[0020] Figure 2 The relative expression levels of the AnCML4a2 gene at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA) in Example 2 of this invention are shown.
[0021] Figure 3 To identify the relative expression levels of the AnCML4a2 gene in transgenic Arabidopsis thaliana (OE-2 and OE-6) and wild-type lines in Example 3 of this invention.
[0022] Figure 4 This study aims to identify the phenotypic characteristics of Arabidopsis thaliana overexpressing AnCML4a2 under drought stress in Example 3 of this invention.
[0023] Figure 5 The chlorophyll content, relative conductivity, malondialdehyde (MDA), hydrogen peroxide (H2O2), and peroxide anion (O2) of the AnCML4a2 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana lines before and after drought stress treatment in Example 3 of this invention are shown. 2- Results of proline and proline detection. Detailed Implementation
[0024] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0025] Example 1: Relative expression levels of the AnCML4a2 gene in Adiantum repens at different time points under drought stress. Based on transcriptome analysis of previous drought stress experiments, this invention discovered some genes that respond to drought stress and whose expression levels change significantly. Based on this, the AnCML4a2 gene of Adiantum repens was cloned, and its nucleotide sequence is shown in SEQ ID NO.1, and the protein sequence it encodes is shown in SEQ ID NO.2.
[0026] The relative expression levels of this gene at different time points under drought stress were analyzed by quantitative real-time PCR, as follows: Mature Adiantum capillus-veneris plants with good and uniform growth were selected and divided into experimental and control groups. The experimental group was watered with 250 ml of 20% PEG6000 to simulate drought stress in the natural environment, while the control group was watered normally with 250 ml of water. Both groups were cultured continuously for 48 hours under conditions of 12h light (140 lx) / 12h darkness, 70% humidity, and 25℃. Samples were taken at 0h, 6h, 12h, 24h, and 48h.
[0027] Total RNA was extracted from the leaves of Adiantum repens, and the first strand of cDNA was obtained by reverse transcription. The first strand of cDNA was used as a template for quantitative real-time PCR amplification, and gene 40S was used as an internal reference gene to verify the relative expression level of AnCML4a2 under drought at different time points.
[0028] Primers used to amplify the AnCML4a2 gene include: qAnCML4a2F:GAAAAAGGGGCGCATCACAG (SEQ ID NO.3) qAnCML4a2R: CATCATGCGCTTGAAGTCGT (SEQ ID NO.4) Primers used to amplify the 40S internal reference gene include: 40S-F:TTGTAGGTGAGTATGGGCTTCGCAA 40S-R:ATCAAGTGTCAGCAACATTCGGGCA The results are as follows Figure 1 As shown, the relative expression level of AnCML4a2 was significantly increased under drought stress, indicating that this gene responds to drought stress in Adiantum repens.
[0029] Example 2: Relative expression levels of the AnCML4a2 gene from *Adiantum repens* at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA). Mature Adiantum repens plants with good and uniform growth were selected and divided into experimental groups I, II, III, and a control group. The control group received no treatment and grew normally. Experimental groups I, II, and III were sprayed with 20 mL of IAA (100 nm), GA (100 μm), and ABA (100 μm), respectively. The experimental groups and the control group were then cultured continuously for 48 hours under conditions of 12 h light (140 lx) / 12 h darkness, 70% humidity, and 25℃. Samples were taken at 0 h, 6 h, 12 h, 24 h, and 48 h.
[0030] Total RNA was extracted from the leaves of *Adiantum repens*, and the first strand of cDNA was obtained by reverse transcription. The first strand of cDNA was used as a template for quantitative real-time PCR amplification. Gene 40S was used as an internal control gene to verify the relative expression levels of AnCML4a2 at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA). The primers used were the same as in Example 1.
[0031] The results are as follows Figure 2 As shown, AnCML4a2 is regulated by ABA, GA and IAA during the growth and development of Adiantum repens.
[0032] Example 3 Cloning and Functional Verification of the AnCML4a2 Gene from Adiantum repens This embodiment verifies the function of the AnCML4a2 gene through a transgenic experiment.
[0033] 1. Construction of overexpression vectors Total RNA was extracted from the leaves of *Adiantum repens*, and the first strand of cDNA was obtained by reverse transcription. Using the first strand of cDNA as a template, the target gene was amplified by PCR using the primers shown in SEQ ID NO. 5-6. The specific primers used were: AnCML4a2-F: aaaagcaggctccATGAAGCTTCCATTAAAGCTGGG (SEQ ID NO. 5); AnCML4a2-R: agaaagctgggttGAAAATGAGGGGCGTCATCA (SEQ ID NO. 6); The PCR reaction system is shown in Table 1. The PCR amplification program is as follows: 98℃ pre-denaturation for 30 sec; 98℃ denaturation for 10 sec, 65℃ annealing for 5 sec, 72℃ extension for 20 sec, 34 cycles; 72℃ complete extension for 1 min.
[0034] Table 1 PCR reaction system After recovering the amplification product, the AnCML4a2 gene was ligated into the intermediate vector pDONR221 via an LR reaction and transformed into DH5α competent cells. Positive clones were selected and sequenced. The sequencing results were consistent with the sequence shown in SEQ ID NO.1, indicating successful amplification and ligation of the gene into the vector, which was named pDONR221-AnCML4a2.
[0035] Further PCR amplification was performed using pDONR221-AnCML4a2 as a template and the primers shown in SEQ ID NO.7-8. The specific primers used were as follows: attB1-adapter:GGGGACAAGTTTGTACAAAAAAGCAGGCT (SEQ ID NO.7); attB2-adapter: GGGGACCACTTTGTACAAGAAAGCTGGGT (SEQ ID NO.8); The PCR reaction system is shown in Table 2. The PCR amplification program is as follows: 98℃ pre-denaturation for 30 sec; 98℃ denaturation for 10 sec, 65℃ annealing for 5 sec, 72℃ extension for 20 sec, 34 cycles; 72℃ complete extension for 1 min.
[0036] Table 2 PCR reaction system The amplification product was recovered, and the amplified AnCML4a2 gene product was ligated into the pK7WG2D vector via a backpropagation (BP) reaction. This vector was then transformed into DH5α competent cells, and positive clones were selected for sequencing. After successful sequencing, the AnCML4a2 gene overexpression vector was obtained and named pK7WG2D-AnCML4a2.
[0037] 2. Preparation of Arabidopsis thaliana lines overexpressing AnCML4a2 The AnCML4a2 gene overexpression vector pK7WG2D-AnCML4a2 prepared above was transferred into the model plant Arabidopsis thaliana to verify its function.
[0038] (1) Construction of Agrobacterium The overexpression vector pK7WG2D-AnCML4a2 was introduced into Agrobacterium tumefaciens GV1301 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) using the freeze-thaw method. The resulting Agrobacterium was labeled as pK7WG2D-AnCML4a2-GV1301.
[0039] (2) Transformation by soaking flowers ① Select healthy Arabidopsis thaliana plants that are in a suitable growth stage (the main inflorescence has just emerged and a small number of flowers have opened), Columbia (WT) ecotype.
[0040] ② After incubating Agrobacterium carrying the target gene upside down in an incubator at 28℃ for 2-3 days, inoculate it into 50 mL of MS liquid medium and incubate at 28℃ and 220 r / min on a shaker until the Agrobacterium is dispersed and homogenized to OD. 600 The concentration was 0.6~0.8; acetylsyleugenol (AS) was added to a final concentration of 150 μmol / L; ③ Flower soaking procedure: Carefully invert the prepared Arabidopsis thaliana inflorescences into a container (centrifuge tube or small beaker) containing Agrobacterium resuspension, ensuring the inflorescences are completely immersed in the Agrobacterium solution, and soak for 5 minutes. After soaking, gently remove the plants, place them sideways on a tray, cover with black plastic film or cling film, maintain humidity and darkness, and allow the plants to stand in this environment for 18-24 hours to allow Agrobacterium to fully infect the plants.
[0041] ④ Subsequent cultivation and selection: Remove the covering and place the plant upright under normal growth conditions (16h light cycle / 8h darkness, 22-24℃) to continue growing, allowing it to flower and bear fruit.
[0042] ⑤ Seed Collection and Screening: After the siliques of Arabidopsis plants mature, seeds are collected. Seeds are placed in 1.5ml centrifuge tubes and washed with sterile water for 2 minutes in a clean bench. After centrifugation, the sterile water is discarded, and 75% alcohol is added for disinfection for 2 minutes. After centrifugation, the alcohol is discarded, and 10% (v / v) sodium hypochlorite disinfectant is added for 2-5 minutes. After centrifugation, excess disinfectant is aspirated, and sterile water is added for washing. This process is repeated three times. The aseptically treated seeds are sown in 1 / 2 MS medium containing 50 mg / L. Positive plants obtained through screening are designated as Generation T1. Generation T1 seeds are then screened for two more generations to obtain Generation T3 pK7WG2D-AnCML4a2 transgenic Arabidopsis.
[0043] 3. Identification of AnCML4a2 expression levels in transgenic Arabidopsis thaliana (OE-2 and OE-6) Total RNA was extracted from T3 generation pK7WG2D-AnCML4a2 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana (WT), and cDNA was obtained by reverse transcription. The AnCML4a2 gene was analyzed by qRT-PCR using ChamQ Universal SYBR qPCR Master Mix, with actin2 as an internal control gene, to detect the expression level of AnCML4a2 in each transgenic Arabidopsis thaliana line. The results are as follows: Figure 3As shown in the results, the expression level of the AnCML4a2 gene in the transgenic Arabidopsis thaliana lines was significantly increased compared with the wild type. The two lines with the highest expression levels (OE-2 and OE-6) were selected for subsequent experiments.
[0044] 4. Phenotypic identification and physiological index determination of Arabidopsis thaliana overexpressing AnCML4a2 under drought stress (1) AnCML4a2 overexpressing Arabidopsis thaliana plants and WT plants that had grown to 4 true leaves on the culture medium were transferred to nutrient soil for further culture. When they grew to 14 days, they were irrigated with 20% PEG6000 to simulate drought. The irrigation was carried out once a day, 100 ml each time, for 5 consecutive days. The results were photographed on the 5th day. Figure 4 As shown, the results indicate that after drought simulation treatment, most leaves of the wild-type plants wilted to varying degrees, while only a small number of leaves of the overexpressed line showed wilting. This result directly reveals that the AnCML4a2 gene can effectively improve the drought stress resistance of Arabidopsis thaliana, a model plant, and provides a key scientific basis for using this gene in the stress resistance breeding of other plants.
[0045] (2) Determination of chlorophyll content in transgenic and wild-type lines before and after drought stress treatment Sampling: Select Arabidopsis thaliana plants with uniform growth status, cut leaves with scissors, or use a hole punch to take leaf discs from the same part of the leaf. Quickly place them in pre-cooled aluminum foil packets and put them on ice.
[0046] Weighing: Accurately weigh 100 mg of the leaves (fresh weight, FW).
[0047] a. Place the weighed leaves into a pre-cooled mortar, add a small amount of quartz sand and about 2 mg of calcium carbonate powder.
[0048] b. Add 2-3 mL of pre-cooled 80% acetone and quickly grind into a homogenate under weak or green light until the tissue turns white.
[0049] c. Transfer the homogenate to a 25 mL brown volumetric flask using a funnel or pipette.
[0050] d. Rinse the mortar and pestle several times with a small amount of 80% acetone, and combine all the washings into a volumetric flask.
[0051] e. Dilute to the mark with 80% acetone. Tighten the cap and shake vigorously to mix.
[0052] f. Extraction in the dark: Wrap the volumetric flask with aluminum foil and place it in a 4°C refrigerator for 4-6 hours or overnight to ensure complete extraction.
[0053] g. Centrifugation: Aliquot the extract into 1.5 mL centrifuge tubes, centrifuge at 10,000 rpm for 10 minutes at 4°C, and use the supernatant for determination.
[0054] h. Pour the supernatant after centrifugation into a cuvette (optical path 1 cm) and read the optical density values (OD values) at wavelengths of 750 nm, 663 nm, and 645 nm, respectively.
[0055] The results are as follows Figure 5 As shown, regardless of whether drought stress treatment was applied, the chlorophyll content of the overexpressing Arabidopsis thaliana lines was significantly higher than that of the wild-type Arabidopsis thaliana lines, indicating that this gene can significantly improve the photosynthetic activity of the plants.
[0056] (3) Measurement of electrical conductivity of transgenic and wild-type lines before and after drought stress treatment Place the leaflets in a clean 50mL centrifuge tube and add 15mL of distilled water. Prepare a separate tube of distilled water as a control. Place the centrifuge tubes on a rotary shaker at room temperature (50 rpm) for 1.5 hours. Measure the conductivity of the sample (C1) and control (CK1) using a conductivity meter (DSS-307, SPSIC, China). Then, boil the centrifuge tubes in boiling water for 10 minutes. After cooling naturally to room temperature, measure the conductivity values C2 and CK2 at this point. The formula for calculating relative conductivity (%) is: C(%) = (C1 - CK1) / (C2 - CK2) × 100%.
[0057] The results are as follows Figure 5 As shown, when plants faced drought stress, the relative conductivity of the overexpressing Arabidopsis thaliana lines was significantly lower than that of the wild-type Arabidopsis thaliana lines, indicating that the cell membrane maintained better integrity.
[0058] (4) Measurement of physiological indicators of transgenic and wild-type lines before and after drought stress treatment Leaves from Arabidopsis thaliana plants overexpressing the drug before and after treatment, and WT plants were ground under liquid nitrogen. The malondialdehyde (MDA) content, hydrogen peroxide (H2O2) content, anti-peroxide anion content, and proline content of each plant were detected using a malondialdehyde (MDA) assay kit (Nanjing Jiancheng Technology Co., Ltd.), a hydrogen peroxide (H2O2) assay kit (Nanjing Jiancheng Technology Co., Ltd.), an anti-peroxide anion assay kit (Nanjing Jiancheng Technology Co., Ltd.), and a proline assay kit (Nanjing Jiancheng Technology Co., Ltd.).
[0059] The results are as follows Figure 5 As shown, after drought treatment, AnCML4a2 overexpressing Arabidopsis malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion (O2) increased significantly. 2-The content of α-proline was significantly lower than that of wild type; the content of proline was significantly higher than that of wild type.
[0060] The above results indicate that overexpression of the AnCML4a2 gene can significantly improve the photosynthetic activity of plants, maintain better cell membrane integrity, increase proline content, and significantly reduce malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion (O2). 2- The content of ) increases the drought resistance of plants. The AnCML4a2 gene can be used for the genetic improvement of forest trees and ecological restoration plants, which can improve their survival rate and growth rate in arid and barren areas, and can be effectively used for afforestation, desertification control and restoration of degraded ecosystems.
[0061] In summary, this invention is the first to demonstrate the function of the AnCML4a2 gene in positively regulating plant drought tolerance in Adiantum repens. Overexpression of the AnCML4a2 gene can significantly improve the plant's ability to resist drought stress, providing valuable genetic resources for drought-resistant crop breeding and having important practical application value for the genetic improvement of forest trees and ecological restoration plants.
[0062] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. Application of the AnCML4a2 gene from *Adiantum repens* in any of the following A1)-A4): A1) Application in improving plant drought resistance; A2) Application in the preparation of products that improve plant drought resistance; A3) Application in the cultivation of drought-resistant plant germplasm; A4) Application in the preparation of products for cultivating drought-resistant plant germplasm; The amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the AnCML4a2 gene is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that, By promoting the expression of the AnCML4a2 gene or enhancing the function or activity of its protein, the drought resistance of plants can be improved.
4. The application according to claim 1, characterized in that, The AnCML4a2 gene enhances the drought resistance of plants by increasing chlorophyll content and activity, maintaining cell membrane integrity, increasing proline content, and decreasing malondialdehyde, hydrogen peroxide, and superoxide anion content.
5. Application of overexpression vectors containing the AnCML4a2 gene in any of the following A1)-A4): A1) Application in improving plant drought resistance; A2) Application in the preparation of products that improve plant drought resistance; A3) Application in the cultivation of drought-resistant plant germplasm; A4) Application in the preparation of products for cultivating drought-resistant plant germplasm; The amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.
2.
6. The application according to claim 5, characterized in that, The backbone vector of the overexpression vector is the pK7WG2D vector.
7. The application according to claim 6, characterized in that, Methods for constructing overexpression vectors containing the AnCML4a2 gene include: S1. Using the cDNA of Adiantum repens as a template, PCR amplification was performed using primers AnCML4a2-F and AnCML4a2-R as shown in SEQ ID NO.5-6 to obtain the AnCML4a2 gene fragment. S2. The AnCML4a2 gene fragment obtained in step S1 is ligated into the pDONR221 vector through the LR reaction to obtain the intermediate vector pDONR221-AnCML4a2. S3. Using the vector pDONR221-AnCML4a2 as a template, PCR amplification was performed using the attB1-adapter and attB2-adapter primers shown in SEQ ID NO.7-8. The amplification product was ligated to the pK7WG2D vector via BP recombination reaction to obtain the overexpression vector pK7WG2D-AnCML4a2 containing the AnCML4a2 gene.
8. A method for improving plant drought tolerance and / or cultivating drought-tolerant plant germplasm, characterized in that, By promoting the expression of the AnCML4a2 gene or enhancing the function or activity of its protein, the drought resistance of plants can be improved, wherein the amino acid sequence encoded by the AnCML4a2 gene is shown in SEQ ID NO.
2.
9. The method according to claim 8, characterized in that, Using the expression vector pK7WG2D as the backbone vector, an overexpression vector pK7WG2D-AnCML4a2 containing the AnCML4a2 gene was constructed and transformed into plants to obtain AnCML4a2 gene overexpression lines, thereby improving the drought resistance of plants and / or cultivating drought-resistant plant germplasm.
10. The method according to claim 9, characterized in that, The overexpression vector pK7WG2D-AnCML4a2 was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method, and then transformed into plants using the flower dipping method. After screening and culture, transgenic plants were obtained, resulting in plant lines overexpressing the AnCML4a2 gene.