Use of pxgstd2 mutants and their and pxgstd2 wild type in catalyzing conjugation of pesticides with gsh and enhancing tolerance of non-target organisms to pesticides

By using the PxGSTD2 protein mutant from the diamondback moth to catalyze the conjugation of pesticides with GSH, the harm of pesticide residues to the ecological environment and non-target organisms was solved, and the pesticide toxicity was reduced and the biological tolerance was improved.

CN122256284APending Publication Date: 2026-06-23NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411911608.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-23
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The harm of pesticide residues to the ecological environment and non-target organisms is persistent and irreversible. Current technologies lack effective detoxification enzymes to reduce the biotoxicity of pesticides and improve the tolerance of non-target organisms.

Method used

We provide a PxGSTD2 protein mutant and its wild type from the diamondback moth. By catalyzing the conjugation of pesticides with glutathione (GSH), we form adducts that are easily excreted from the body, thereby reducing pesticide toxicity and improving the tolerance of non-target organisms to pesticides.

Benefits of technology

It significantly reduces the biotoxicity of pesticides, enhances the tolerance of non-target organisms such as bees to pesticides, and forms highly water-soluble, low-toxicity conjugated products that are easily excreted from the body.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256284A_ABST
    Figure CN122256284A_ABST
Patent Text Reader

Abstract

The present application relates to PxGSTD2 protein mutants, and the use of wild type and mutants of PxGSTD2 protein in catalyzing the conjugated coupling of pesticides with reduced glutathione (GSH) and improving the pesticide tolerance of non-target organisms. The PxGSTD2 protein and its mutants provided by the present application catalyze the conjugated coupling of various types of pesticides such as oxadiazines, neonicotinoids, pyrethroids and the like with GSH, improve the water solubility of the pesticides, reduce the toxicity of the pesticides, form adducts that are easily excreted out of the body by organisms, and thus significantly enhance the tolerance of non-target organisms to pesticides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to the use of PxGSTD2 protein mutants and wild-type and mutant PxGSTD2 proteins in catalyzing pesticide conjugation with GSH and enhancing pesticide tolerance in non-target organisms. Background Technology

[0002] Pesticides are a class of toxic chemicals primarily used for the control of agricultural, forestry, and sanitary pests, playing a vital role in global food security and human disease control. However, with the long-term and extensive use of pesticides, they have become a significant source of agricultural pollution, posing an increasingly prominent threat to the ecological environment and human health. Pesticides cause harm primarily through two pathways: first, their acute toxicity is high, causing harm to organisms within a short period; second, they accumulate in environmental media through residues and bioaccumulation, eventually leading to harm.

[0003] The harm caused by pesticide residues is persistent and irreversible. Environmental pollution (water, air, soil, etc.), reduced biodiversity, and various human diseases (deformity, cancer, infertility, neurological disorders, etc.) are all closely related to pesticide residues. Take bees as an example: bees play a crucial role in pollinating three-quarters of food crops and only 90% of flowering plants; however, bee populations, especially wild bees, are declining rapidly. The disappearance of bees will disrupt the entire ecosystem, affecting not only plants but also wildlife that depend on them for food and habitat. Agricultural production will also be severely impacted. A recent study indicates that the extensive use of pesticides, especially insecticides, is the main cause of the bee population decline. Common insecticides such as neonicotinoids, diamides, pyrethroids, organophosphates, and oxadiazons are highly toxic to bees; long-term exposure can cause colony collapse disorder, death, slowed growth and development, and weakened immunity in bees.

[0004] To reduce the harm of pesticides to the ecological environment and non-target organisms, the discovery and application of broad-spectrum detoxification enzymes is an effective approach. As an important detoxification enzyme in organisms, glutathione S-transferase (GST) can effectively cope with acute or long-term stress from pesticides and other harmful substances. GST catalyzes the conjugation of reduced glutathione (GSH) with pesticides and other harmful substances or their metabolites, forming products with low toxicity and easy excretion, effectively reducing the harm of pesticides and other harmful substances to organisms. This is one of the key reasons why pests and weeds develop broad-spectrum resistance to pesticides. Therefore, GST is a promising broad-spectrum detoxification enzyme for reducing pesticide residues in the environment and improving the pesticide tolerance of non-target organisms. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides a PxGSTD2 mutant detoxification enzyme derived from the diamondback moth, as well as the uses of the wild-type and mutant PxGSTD2 protein. The PxGSTD2 protein is a typical Delta-type insect glutathione S-transferase (GST) from the diamondback moth. The inventors have discovered for the first time that both the wild-type and mutant PxGSTD2 protein exhibit excellent catalytic activity in the conjugation of various pesticides, including oxadiazons, neonicotinoids, and pyrethroids, with GSH, significantly reducing pesticide biotoxicity and significantly enhancing the pesticide tolerance of non-target organisms. Furthermore, compared to the wild-type PxGSTD2 protein, the PxGSTD2 mutant provided by this invention exhibits superior performance in catalyzing the conjugation of GSH with pesticides and enhancing the pesticide tolerance of non-target organisms.

[0006] Therefore, in a first aspect, the present invention provides a PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, and the mutant contains a mutation in phenylalanine (F) at residue 205 of the amino acid sequence shown in SEQ ID NO.3.

[0007] In a second aspect, the present invention provides an isolated gene that encodes a mutant of the first aspect.

[0008] In a third aspect, the present invention provides an expression vector comprising the isolated gene from the second aspect.

[0009] In a fourth aspect, the present invention provides an expression cell comprising the isolated gene of the second aspect or the expression vector of the third aspect.

[0010] In a fifth aspect, the present invention provides the use of the PxGSTD2 protein, the gene encoding the PxGSTD2 protein, a mutant of the first aspect, an isolated gene of the second aspect, an expression vector of the third aspect, or an expression cell of the fourth aspect in catalyzing the conjugation of pesticides with GSH in vitro or in non-target organisms, or in improving the pesticide tolerance of non-target organisms.

[0011] The beneficial effects of the present invention are at least one or more of the following:

[0012] 1) By ligating the PxGSTD2 gene or its mutant gene provided by this invention into an expression vector and transforming it into an Escherichia coli expression strain, a PxGSTD2 protein or its mutant gene with good catalytic activity can be prepared.

[0013] 2) The PxGSTD2 protein and its mutants provided by this invention can directly catalyze the conjugation of pesticides with different structures, such as oxadiazines, neonicotinoids, and pyrethroids, with GSH, thereby improving the water solubility of pesticides and forming adducts that are easily excreted from the body, thus reducing the biotoxicity of pesticides.

[0014] 3) After the PxGSTD2 gene or its mutant gene provided by this invention is transferred into non-target organisms, the tolerance of non-target organisms to pesticides can be significantly improved.

[0015] 4) Compared with wild-type PxGSTD2 protein, the PxGSTD2 mutant provided by this invention has superior performance in catalyzing the conjugation coupling of pesticides and GSH and improving the tolerance of non-target organisms to pesticides. Attached Figure Description

[0016] Figure 1 Neutral loss scanning chromatogram of PxGSTD2 protein catalyzing the conjugated coupling of GSH with indoxacarb.

[0017] Figure 2 .PxGSTD2 protein catalyzing the conjugated coupling of GSH and indoxacarb with neutral loss of characteristic peaks (retention time 7.5 min) mass spectrum.

[0018] Figure 3 .Product ion scanning mass spectrum of the precursor ion of GSH and indoxacarb conjugated by PxGSTD2 protein.

[0019] Figure 4 Comparison of neutral loss scanning chromatograms of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzing the conjugation of GSH with indoxacarb.

[0020] Figure 5 Mass spectra of neutral loss scanning characteristic peaks (retention time 7.5 min) catalyzed by the conjugation of GSH with indoxacarb by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0021] Figure 6Product ion scanning mass spectra of the 833.9 m / z precursor ion of the conjugated GSH and indoxacarb product catalyzed by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0022] Figure 7 Neutral loss scanning chromatograms of the conjugated coupling of GSH with lambda-cyhalothrin catalyzed by PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L, and PxGSTD2F205V. In the figure, CK represents the control, which is the sample treated with PxGSTD2 or its mutant protein at high temperature for 1 h.

[0023] Figure 8 Mass spectra of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L, and PxGSTD2F205V catalyzing the conjugated coupling of GSH with lambda-cyhalothrin (retention time 6.9 min). CK in the figure represents the control, which is the sample treated with PxGSTD2 or its mutant protein after high-temperature inactivation for 1 h.

[0024] Figure 9 Mass spectra of the characteristic peak (retention time 8.9 min) of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L, and PxGSTD2F205V catalyzing the conjugated coupling of GSH with lambda-cyhalothrin. CK in the figure represents the control, which is the sample treated with high-temperature inactivated PxGSTD2 or its mutant protein for 1 h.

[0025] Figure 10 Product ion scanning mass spectra of the 515 m / z precursor ions of the conjugated GSH product of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V.

[0026] Figure 11Product ion scanning mass spectra of the 757.5 m / z precursor ions of the conjugated GSH product of PxGSTD2 protein and its mutants PxGSTD2F205A, PxGSTD2F205C, PxGSTD2F205H, PxGSTD2F205L and PxGSTD2F205V catalyzed by GSH and lambda-cyhalothrin.

[0027] Figure 12 The mass spectrum of neutral loss scanning characteristic peak (retention time 7.3 min) catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A in the conjugated coupling of GSH and fipronil. CK in the figure represents the control, which is the sample treated with either PxGSTD2 or PxGSTD2F205A after 1 h of high-temperature inactivation.

[0028] Figure 13 .Product ion scanning mass spectra of the 509.7 m / z precursor ion of the conjugated GSH and fipronil product catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A.

[0029] Figure 14 The mass spectrum of neutral loss scanning characteristic peak (retention time 10.1 min) catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A in the conjugated coupling of GSH and acetamiprid. CK in the figure represents the control, which is the sample treated with PxGSTD2 or PxGSTD2F205A after 1 h of high-temperature inactivation.

[0030] Figure 15 Product ion scanning mass spectra of the 530.1 m / z precursor ion of the conjugated GSH and acetamiprid product catalyzed by PxGSTD2 protein and its mutant PxGSTD2F205A.

[0031] Figure 16 Whole-genome PCR detection of homozygous PxGSTD2 transgenic Drosophila melanogaster. Note: In the figure, IN represents the inserted fragment, WT represents non-transgenic Drosophila, and M represents the DNA marker.

[0032] Figure 17 Whole-genome PCR detection of homozygous Drosophila melanogaster transgenic strain PxGSTD2F205A gene. Note: In the figure, KI represents the inserted fragment, WT represents non-transgenic Drosophila, and M represents the DNA marker. Detailed Implementation

[0033] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0035] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of...". The expressions "comprising," "including," or "basically / mainly composed of..." are generally understood as open-ended expressions, indicating that they include not only the elements, components, parts, or method steps specifically listed after the expression, but also other elements, components, parts, or method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of..." can also be understood as closed-ended expressions in certain circumstances, indicating that they include only the elements, components, parts, or method steps specifically listed after the expression, and exclude any other elements, components, parts, or method steps. Furthermore, in the context of this invention, many embodiments use the expression "composed of...", which should be understood as a closed-ended expression, indicating that it includes only the elements, components, parts, or method steps specifically listed after the expression, and excludes any other elements, components, parts, or method steps.

[0036] In this invention, amino acids are generally represented by single-letter or three-letter abbreviations known in the art. For example, alanine can be represented by Ala or A, glycine by Gly or G, valine by Val or V, leucine by Leu or L, isoleucine by Ile or I, proline by Pro or P, phenylalanine by Phe or F, tyrosine by Tyr or Y, tryptophan by Trp or W, serine by Ser or S, threonine by Thr or T, cysteine ​​by Cys or C, methionine by Met or M, asparagine by Asn or N, glutamine by Gln or Q, aspartic acid by Asp or D, glutamic acid by Glu or E, lysine by Lys or K, arginine by Arg or R, and histidine by His or H.

[0037] Similarly, in this invention, nucleotides or bases are represented by single-letter abbreviations, for example, adenine is represented by A, guanine by G, cytosine by C, and thymine by T.

[0038] Because the harmful effects of pesticide residues, such as insecticides, are persistent and irreversible, there is an urgent need in the field for effective means to reduce the harm of pesticides to the ecological environment and non-target organisms. Therefore, this invention aims to provide a means to reduce the biotoxicity of pesticides, such as insecticides, and to improve the tolerance of non-target organisms to pesticides, such as insecticides.

[0039] PxGSTD2 protein is a typical Delta-type insect glutathione S-transferase (GST) from the diamondback moth. Its functional regions mainly consist of two sites: a G site (the GSH binding site) and an H site (the substrate binding site). The inventors discovered that PxGSTD2 protein can directly catalyze the conjugation of various types of pesticides with GSH, forming adducts with increased water solubility, reduced toxicity, and easier excretion from the organism, thereby reducing pesticide biotoxicity and achieving pesticide detoxification metabolism. The phenylalanine (F) residue at position 205 of the PxGSTD2 protein amino acid sequence (SEQ ID NO.3) is located at the H site. The inventors found that this amino acid residue might have modification potential and therefore performed site-directed mutagenesis at this site. The results showed that after site-directed mutagenesis, this site retained the activity of PxGSTD2 protein in catalyzing the conjugation of pesticides with GSH, and the activity was even higher. Thus, this invention was completed.

[0040] Therefore, in a first aspect, the present invention provides a PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, and the mutant contains a mutation (F205) in phenylalanine (F) at residue 205 of the amino acid sequence shown in SEQ ID NO.3.

[0041] The term "precursor protein" refers to the precursor molecule of a mature protein; in this article, it refers to a protein with a signal peptide at its N-terminus. The term "signal peptide" refers to a short peptide segment that guides the translocation of newly synthesized proteins into the secretory pathway; it is typically cleaved by a signal peptidase after guiding the protein to a specific site.

[0042] In a preferred embodiment, the signal peptide has an amino acid sequence as shown in SEQ ID NO.55.

[0043] In addition to the F205 mutation described above, the mutant may also contain other mutations that do not affect the function of the PxGSTD2 protein, such as the insertion, deletion, and / or substitution of one or more amino acids. In this document, the term "PxGSTD2 protein function" refers at least to the function of the PxGSTD2 protein in catalyzing the conjugation of various types of pesticides with GSH to form adducts with increased water solubility, reduced toxicity, and easier excretion from the organism.

[0044] Therefore, in one embodiment, the mutant may include a mutant containing only the F205 mutation, and may also include a mutant containing the F205 mutation and whose amino acid sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity with the amino acid sequence shown in SEQ ID NO.3, and which retains the function of the PxGSTD2 protein.

[0045] Regarding the choice of mutation direction, the inventors chose to mutate the 205th residue phenylalanine (F) into alanine (A), valine (V), histidine (H), cysteine ​​(C), leucine (L), glycine (G), isoleucine (I), proline (P), and threonine (T).

[0046] Therefore, in one embodiment, the mutant comprises any one of the mutations F205A, F205V, F205H, F205C, F205L, F205G, F205I, F205P, and F205T. In this document, the term "F205A" may refer to a mutation from phenylalanine (F) to alanine (A) at position 205, or to a mutant protein containing this mutation, depending on the context.

[0047] In a preferred embodiment, the mutant comprises any one of the mutants F205A, F205V, F205H, F205C, and F205L.

[0048] In a more preferred embodiment, the mutant comprises the mutant F205A.

[0049] In one embodiment, the mutant has any amino acid sequence as shown in SEQ ID NO. 8, 9, 14, 15, 18, 19, 22, 23, 28, 29, 34, 35, 39, 40, 45, 46, 51 or 52.

[0050] In a preferred embodiment, the mutant has any of the amino acid sequences shown in SEQ ID NO. 8, 9, 14, 15, 18, 19, 22, 23, 28 or 29.

[0051] In a more preferred embodiment, the mutant has an amino acid sequence as shown in SEQ ID NO. 8 or 9.

[0052] In a second aspect, the present invention provides an isolated gene that encodes a mutant of the first aspect.

[0053] In one embodiment, the isolated gene has a nucleic acid sequence or a degenerate sequence thereof as shown in any one of SEQ ID NOs.4-7, 10-13, 16-17, 20-21, 24-27, 30-33, 36-38, 41-44 or 47-50.

[0054] As used herein, the term “degenerate sequence” refers to the phenomenon that the same amino acid is encoded by two or more codons, which includes all possible sequences of different base sequences encoding a single amino acid.

[0055] In a third aspect, the present invention provides an expression vector comprising the isolated gene from the second aspect.

[0056] In one implementation, the expression vector is a plasmid.

[0057] In a preferred embodiment, the expression vector is a pET vector such as pET-30a, a pBAD vector such as pBAD / HisC, a pGEX vector such as pGEX-6P-1, a pUAST vector, an Agrobacterium vector, a YIP vector, a YEp vector, a YCp vector, a pPIC series vector such as pPICZαA, a pGAP series vector such as pGAPZB, a pcDNA series vector such as pcDNA3.1, a pSV series vector, a baculovirus vector, a retroviral vector, a lentiviral vector, or an adenovirus vector.

[0058] In a fourth aspect, the present invention provides an expression cell comprising the isolated gene of the second aspect or the expression vector of the third aspect.

[0059] In one embodiment, the expressing cells are prokaryotic cells such as Escherichia coli cells, Bacillus cells, and Streptomyces cells.

[0060] In one embodiment, the expressing cells are Escherichia coli DE3 competent cells.

[0061] In one embodiment, the expressing cell is a eukaryotic cell, such as an animal cell, plant cell, or yeast cell; the animal cell includes cells from bees, earthworms, spiders, fruit flies, fall armyworms, white armyworms, silkworms, clawed frogs, Chinese hamsters, baby hamsters, mice, humans, etc.

[0062] In a fifth aspect, the present invention provides the use of the PxGSTD2 protein, the gene encoding the PxGSTD2 protein, a mutant of the first aspect, an isolated gene of the second aspect, an expression vector of the third aspect, or an expression cell of the fourth aspect in catalyzing the conjugation of pesticides with GSH in vitro or in non-target organisms, or in improving the pesticide tolerance of non-target organisms, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3.

[0063] In a preferred embodiment, the signal peptide has an amino acid sequence as shown in SEQ ID NO. 55.

[0064] In this invention, the non-target organism refers to the organisms covered in the series of standards (NY / T2882.1~NY / T2882.7) of the "Guidelines for Environmental Risk Assessment of Pesticide Registration" issued by the Ministry of Agriculture and Rural Affairs of the People's Republic of China. Transferring the wild-type or mutant PxGSTD2 gene involved in this invention into non-target organisms can significantly improve their tolerance to pesticides.

[0065] In one implementation, the non-target organisms include: all arthropod species that are not pests, such as bees, silkworms, parasitic wasps, ladybugs, spiders, predatory mites, etc.; birds such as small grain-eating birds, small insectivorous birds, large herbivorous birds, small omnivorous birds, etc.; soil organisms such as earthworms, etc.; and aquatic organisms such as fish, daphnia, algae, predatory amphibians, large crustaceans, etc.

[0066] In this article, pesticides refer to a chemically synthesized substance or a mixture of several substances and their preparations used to prevent and control diseases, insects, weeds, rodents and other harmful organisms that harm agriculture and forestry, as well as to purposefully regulate the growth of plants and insects. More specifically, pesticides can refer to the following categories: (i) prevention and control of diseases, insects (including insects, ticks, mites), weeds, rodents, mollusks and other harmful organisms that harm agriculture and forestry; (ii) prevention and control of diseases, insects, rodents and other harmful organisms in storage and processing sites; (iii) regulation of plant and insect growth; (iv) preservation or freshness of agricultural and forestry products; (v) prevention and control of mosquitoes, flies, cockroaches, rodents and other harmful organisms; and (vi) prevention and control of harmful organisms that harm river embankments, railways, docks, airports, buildings and other places.

[0067] In one embodiment, the pesticide includes insecticides, acaricides, herbicides, fungicides, and nematicides.

[0068] In this article, insecticides refer to pesticides used to control harmful insects in the living environment of humans or animals and in the natural environment. They can be classified into categories (i), (ii), (v), and (vi) of pesticides mentioned in the previous paragraph. Insecticides are diverse and can be classified according to their source into inorganic and mineral insecticides such as lead arsenate, calcium arsenate, sodium fluorosilicate, and mineral oil emulsions; plant-based insecticides such as pyrethroids, rotenone, and nicotine; organic synthetic insecticides such as organochlorines, organophosphates, and pyrethroids; and insect hormone insecticides such as juvenile hormones and sex pheromone analogs.

[0069] In this article, acaricides refer to chemical substances used to control harmful species of arachnids, such as mites and their eggs.

[0070] In this article, herbicides refer to chemical substances used to control weeds in farmland.

[0071] In this article, fungicides refer to chemical substances used to control plant pathogenic microorganisms.

[0072] In this article, nematicides refer to chemical substances used to control plant pathogenic nematodes.

[0073] In a preferred embodiment, the pesticide is an insecticide or an acaricide.

[0074] In a more preferred embodiment, the pesticide is an insecticide selected from one or more of oxadiazine, neonicotinoid, and pyrethroid insecticides.

[0075] In a more preferred embodiment, the oxadiazine insecticide is indoxacarb, the pyrethroid insecticide is lambda-cyhalothrin, and the neonicotinoid insecticide is dinotefuran and acetamiprid.

[0076] In a sixth aspect, the present invention also provides a transgenic animal comprising the PxGSTD2 gene, the isolated gene of the second aspect, the expression vector of the third aspect, or the expression cell of the fourth aspect.

[0077] It is understandable that, since the transgenic animal has the gene encoding the PxGSTD2 protein with the amino acid sequence shown in SEQ ID NO.3 or a mutant containing the F205 mutation, the transgenic animal can express the PxGSTD2 protein or its mutant, thereby avoiding the harm caused by pesticide application.

[0078] In one implementation, the transgenic animal is any non-pest arthropod species that has been genetically engineered, such as transgenic bees, silkworms, parasitic wasps, ladybugs, spiders, predatory mites, etc.; transgenic birds such as transgenic small grain-eating birds, small insectivorous birds, large herbivorous birds, small omnivorous birds, etc.; transgenic soil organisms such as transgenic earthworms, etc.; and transgenic aquatic organisms such as transgenic fish, daphnia, algae, predatory amphibians, large crustaceans, etc.

[0079] Example

[0080] The embodiments of the present invention will be described in detail below with reference to examples. Those skilled in the art will understand that the following examples are merely illustrative and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0081] Example 1: Cloning of the PxGSTD2 gene and preparation of the protein

[0082] Experimental Methods: Total RNA was extracted from third-instar larvae of the diamondback moth and cDNA was prepared using reverse transcription. Then, using the prepared diamondback moth cDNA as a template, the ORF sequence of the PxGSTD2 gene was cloned using PCR and confirmed by sequencing. The cloned PxGSTD2 gene was ligated into the pET-30a(+) vector, transformed into E. coli DE3 competent cells, and prokaryotic expression of PxGSTD2 was induced by low temperature. The prokaryotically expressed PxGSTD2 protein was purified using affinity chromatography. The original sequence of the PxGSTD2 gene is shown in SEQ ID NO.1, the amino acid sequence encoded by the ORF of the PxGSTD2 gene is shown in SEQ ID NO.2, and the amino acid sequence of the mature PxGSTD2 protein after removing the signal peptide is shown in SEQ ID NO.3.

[0083] Results: The PxGSTD2 gene sequence was successfully cloned using reverse transcription and PCR techniques, and the recombinant PxGSTD2 protein was prepared by prokaryotic expression and nucleophilic chromatography.

[0084] Example 2: Preparation of PxGSTD2 protein mutant

[0085] Experimental Methods: PxGSTD2 protein mutants were prepared by site-directed mutagenesis, where residue 205 (phenylalanine, F) was sequentially mutated to alanine (A), valine (V), histidine (H), cysteine ​​(C), leucine (L), glycine (G), isoleucine (I), proline (P), and threonine (T). The mutants were then prepared using the method described in Example 1. The gene sequences, ORF-encoded amino acid sequences, and corresponding amino acid sequences of the mature protein (with signal peptide removed) of the multiple mutants obtained through site-directed mutagenesis are shown in SEQ ID NOs. 4-52.

[0086] Results: Mutant PxGSTD2 genes, including PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, PxGSTD2F205L, PxGSTD2F205G, PxGSTD2F205I, PxGSTD2F205P, and PxGSTD2F205T, were successfully obtained using site-directed mutagenesis. The corresponding PxGSTD2 protein mutants were then prepared using prokaryotic expression and affinity chromatography techniques.

[0087] Example 3: Catalytic activity experiment of PxGSTD2 protein and its mutants on the conjugated coupling of indoxacarb and GSH. Method: 4 mM glutathione (GSH), 100 μM indoxacarb, and 2 U of recombinant PxGSTD2 protein were mixed and dissolved in PBS buffer (10 mM, pH 7.2) to a total volume of 500 μL. The mixture was incubated at 30°C for 0 h and 1 h. Three control groups were also set up: “4 mM GSH + 100 μM indoxacarb,” “4 mM GSH + 2 U PxGSTD2,” and “100 μM indoxacarb + 2 U PxGSTD2.” The control group reaction volume was also 500 μL, and incubation was also performed at 30°C for 0 h and 1 h. Then, an equal volume of acetonitrile (HPLC grade) was added, and the reaction was terminated by incubation at 4°C for 1 h. Both the treatment and control groups were set up in triplicate. The sample was centrifuged at 4°C and 10,000 rpm for 15 min using a low-temperature centrifuge. The supernatant was collected and purified with a 0.22 μm organic nylon membrane before being placed into a sample vial.

[0088] The product obtained by the conjugation of indoxacarb and GSH catalyzed by the PxGSTD2 recombinant protein was detected using an AB Sciex Qtrap 5500 triple quadrupole liquid chromatography-mass spectrometry system (AB, USA). Gradient elution was performed with 0.1% formic acid aqueous solution and acetonitrile according to the program in Table 1, with a total elution time of 18 min and a flow rate of 0.2 mL / min. The ionization source was positive electrode electrospray (ES), with a collision energy of 30 eV. The detection mode was neutral loss scanning, with a loss fragment size of 129 amu and a scan range of 300–800 m / z. The precursor ions obtained from the neutral loss scanning were then scanned for product ions, with a collision energy of 30 eV and a detection mode of product ion scanning, with a scan range of 100–760 m / z.

[0089] Table 1. LC-HRMS ( / MS) elution program

[0090]

[0091] Results: Neutral loss scanning and mass spectrometry analysis showed that the sample treated with PxGSTD2 for 1 h showed peak accumulation at 7.5 min. Figure 1 ), and this characteristic peak contains a precursor ion of 833.9 m / z ( Figure 2 The mass spectrum of the product ion scan showed that the 833.9 m / z precursor ion had neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid). Figure 3 The 833.9 m / z precursor ion is consistent with the characteristics of neutral fragment loss in GSH adducts, indicating that the precursor ion is an adduct of GSH and indoxacarb.

[0092] The catalytic activity of five randomly selected PxGSTD2 protein mutants (PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, and PxGSTD2F205L) on the conjugated coupling of indoxacarb and GSH was tested using the same method. The results are as follows: Figures 4-5 As shown, treatment with indoxacarb using PxGSTD2F205A significantly increased the characteristic peak area at 7.5 min, but the peak areas of the other four PxGSTD2 mutants were not significantly different from those of the wild-type PxGSTD2. Figure 4 Furthermore, the characteristic peaks of the five PxGSTD2 mutant treatments involved in this invention all contain a precursor ion at 833.9 m / z. Figure 5 Furthermore, all of these precursor ions exhibit the characteristic of neutral fragment loss in GSH adducts. Figure 6 ).

[0093] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of indoxacarb with GSH, among which the PxGSTD2F205A mutant exhibits the strongest catalytic activity for the conjugation of indoxacarb with GSH.

[0094] Example 4: Catalytic activity of PxGSTD2 protein and its mutants on the conjugated coupling of lambda-cyhalothrin and GSH.

[0095] Experimental Methods: Similar to Example 3, the catalytic activity of PxGSTD2 and its mutants (PxGSTD2F205A, PxGSTD2F205V, PxGSTD2F205H, PxGSTD2F205C, and PxGSTD2F205L) for the conjugated coupling of lambda-cyhalothrin and GSH was detected using a method similar to that in Example 3. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, and the detection method was neutral loss scanning. The lost fragment size was set to 129 amu, and the scan range was 300-800 m / z. The precursor ions detected by the neutral loss scanning were then scanned for product ions, with a collision energy of 30 eV and a product ion scanning method, with a scan range of 100-760 m / z.

[0096] Results: The experimental results are as follows Figures 7-11 As shown in the figure. Neutral loss scanning and mass spectrometry analysis results showed that peak accumulation occurred at 6.9 min and 8.9 min in samples of PxGSTD2 and its mutant treatment groups. Among them, the peak areas of mutants PxGSTDF205A, PxGSTD2F205C, and PxGSTD2F205V were significantly higher than those of PxGSTD2, while the peak areas of mutants PxGSTD2F205H and PxGSTD2F205L were basically the same as those of PxGSTD2. Figure 7 Mass spectrometry analysis revealed that the characteristic peak at 6.9 min contained a precursor ion of 515 m / z, and the characteristic peak at 8.9 min contained a precursor ion of 757.5 m / z. Figure 8 , Figure 9 The mass spectra of the product ions showed that the precursor ions at 515 m / z and 757.5 m / z both exhibited neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid), which is consistent with the neutral fragment loss characteristics of GSH adducts. Figure 10 , Figure 11 ).

[0097] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugated coupling of lambda-cyhalothrin and GSH. Among them, the mutants PxGSTDF205A, PxGSTD2F205C and PxGSTD2F205V have significantly higher catalytic activity for the conjugated coupling of lambda-cyhalothrin and GSH than the wild-type PxGSTD2 protein.

[0098] Example 5: Catalytic Activity of PxGSTD2 Protein and its Mutants on the Conjugated Coupling of Fipronil and GSH: The detoxification metabolic activity of PxGSTD2 and its mutants on fipronil was detected using a method similar to that in Example 3. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, the detection method was neutral loss scanning, the lost fragment size was set to 129 amu, and the scan range was 300-600 m / z. The precursor ions detected by the neutral loss scanning were then scanned for product ions, with a collision energy of 30 eV and a product ion scanning method, with a scan range of 100-512 m / z.

[0099] Results: The experimental results are as follows Figures 12-13 As shown. No significant peak area changes were observed in the chromatograms of the neutral loss scan samples of PxGSTD2 and its mutant treatment groups. However, mass spectrometry analysis revealed an increase of 509.7 m / z precursor ions at 7.3 min in both the PxGSTD2 and PxGSTD2F205A treatment groups, with the PxGSTD2F205A treatment group showing a higher abundance. Figure 12 The mass spectrum of the product ion scan showed that the precursor ion at 509.7 m / z exhibited neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid), consistent with the neutral fragment loss characteristics of GSH adducts. Figure 13 ).

[0100] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of fipronil and GSH, and the catalytic activity of the PxGSTD2 mutant for the conjugation of fipronil and GSH is significantly higher than that of the wild-type PxGSTD2 protein.

[0101] Example 6: Catalytic Activity of PxGSTD2 Protein and its Mutants on the Conjugated Coupling of Acetamiprid and GSH Experimental Method: The catalytic activity of PxGSTD2 and its mutants on the conjugated coupling of acetamiprid and GSH was detected using a method similar to that in Example 3. During detection, the ionization source was positive electrode electrospray (ES), the collision energy was 30 eV, the detection method was neutral loss scanning, the lost fragment size was set to 129 amu, and the scan range was 300-600 m / z. The precursor ions detected by the neutral loss scanning were then scanned for product ions, with a collision energy of 30 eV and a product ion scanning method, with a scan range of 100-532 m / z.

[0102] Results: The experimental results are as follows Figures 14-15 As shown. No significant peak area changes were observed in the chromatograms of the neutral loss scan samples of PxGSTD2 and its mutant treatment groups. However, mass spectrometry analysis revealed an increase of 530.1 m / z precursor ions at 10.1 min in both the PxGSTD2 and PxGSTD2F205A treatment groups, with the PxGSTD2F205A treatment group showing a higher abundance. Figure 14 The mass spectrum of the product ion scan showed that the precursor ion at 530.1 m / z exhibited neutral losses of 75 amu (glycine), 129 amu (pyroglutamic acid), and 147 amu (ammoniated pyroglutamic acid), consistent with the neutral fragment loss characteristics of GSH adducts. Figure 15 ).

[0103] Conclusion: The PxGSTD2 protein and its mutants involved in this invention can directly catalyze the conjugation of acetamiprid with GSH, and the catalytic activity of the PxGSTD2 mutant for the conjugation of acetamiprid with GSH is significantly higher than that of the wild-type PxGSTD2 protein.

[0104] Example 7: Preparation of transgenic Drosophila melanogaster overexpressing PxGSTD2 protein or its mutant

[0105] Experimental Methods: The target gene PxGSTD2 was cloned into the Not I / XbaI site of the pJFRC28-10XUAS-IVS-GFP-p10 vector (Addgene, USA), and then transformed into DH5α competent cells (Transgen, China). After confirmation by PCR and sequencing, the plasmid was extracted, thus obtaining the recombinant plasmid UAS-PxGSTD2 containing the target gene fragment. The extracted recombinant plasmid was diluted to 500 ng / μL with ddH2O, and then 30 μL of the sample was used for microinjection.

[0106] The Drosophila strain attP40 (Fungene, China) was reared on a large scale. Adult Drosophila were collected using collection cages, with 400 adults per cage, and their eggs were laid on agar coated with yeast. Fresh eggs collected within 60 minutes were rinsed onto coverslips. Embryos were arranged neatly on coverslips, tails facing outwards. Transgenic plasmids were injected under an Olympus CKX3-SLP microscope (Olympus, Japan) using an Eppendorf FemtoJet4i injector (Eppendorf, Germany), injecting a total of 200 embryos. The injected eggs were then inserted into the feed and placed in an artificial temperature and humidity incubator. They were reared to adulthood at 25°C, 60%-70% relative humidity, and a light-dark ratio of 12:12, and this generation was designated P0.

[0107] P0 adults were hybridized with wild-type fruit flies w1118, with two P0 adults per hybridization tube, and cultured in an incubator at 25℃. Red-eyed positive fruit flies were selected from the F1 generation adults, and each was individually hybridized with a Bc / CyO fruit fly. After successful hybridization, molecular identification was performed on the F2 generation red-eyed fruit flies, confirming that UAS-PxGSTD2 had been inserted into the fruit fly chromosome. Red-eyed / CyO phenotyped male and female fruit flies were selected from the F2 generation adults and self-crossed to create stable genetic lines and homozygous lines.

[0108] Male UAS transgenic fruit flies constructed in the previous step were crossed with Sp / CyO;TM2 / TM6B virgin fruit flies. From the offspring, the desired genotype (UAS-PxGSTD2 / CyO;+ / TM6B) was selected and crossed with laboratory-preserved Sp / CyO;tub-gal14,tub-gal80ts fruit flies. After the offspring emerged, based on the red-eyed phenotype, the desired UAS-PxGSTD2 / CyO;tub-gal4,tub-gal80ts / TM6B red-eyed fruit flies were selected for self-pollination to construct stable lines. Further, by removing the balancer through self-pollination, a temperature-controlled overexpression homozygous UAS-PxGSTD2 transgenic line was constructed: UAS-PxGSTD2;tub-gal4,tub-gal80ts. The genome of Drosophila was extracted and confirmed by PCR using HSP-F (AAGTAACCAGCAACCAAGTA(SEQ ID NO.53)) and P10-R (GCCACTAGCTCGCTATACACT(SEQ ID NO.54)) as upstream and downstream primers.

[0109] Using the same method, the selected mutant PxGSTD2F205A gene was transferred into Drosophila to construct a transgenic homozygous line of temperature-controlled overexpression mutant PxGSTD2F205A.

[0110] Results: PCR results of the whole genome of *Drosophila melanogaster* transgenic with PxGSTD2 and PxGSTD2F205A genes both showed a band of approximately 1100 bp, consistent with the size of the inserted fragment (results are shown in Figure 1). Figure 16 and Figure 17 (As shown). Further sequencing results showed that the gene sequence corresponding to this band was completely identical to the inserted fragment sequence.

[0111] Conclusion: This invention successfully constructed a transgenic, temperature-controlled overexpression homozygous Drosophila melanogaster strain that stably expresses PxGSTD2 protein or its mutants. Given that Drosophila is a commonly used model organism in transgenic research, we hypothesize that transferring the PxGSTD2 gene or its mutants into non-target organisms such as bees and silkworms is also feasible.

[0112] Example 8: Indoor toxicity determination of insecticides against different strains of Drosophila melanogaster

[0113] Experimental Methods: Using laboratory-raised non-transgenic strains, PxGSTD2 transgenic strains, and PxGSTD2 mutant strains of *Drosophila melanogaster* as test insects, the indoor toxicity of five insecticides—indoxacarb, lambda-cyhalothrin, acetamiprid, dinotefuran, and imidacloprid—to different strains of *Drosophila melanogaster* was determined using the pesticide film method. Acetone containing Tween 80 (2 drops of 0.1% Tween 80 per 50 mL of acetone) was used as the solvent to prepare a 200 mg / L stock solution of the test insecticide, which was then serially diluted to five concentrations. 5 mL of the solution was added to a 50 mL Erlenmeyer flask, slowly tilted, and rotated uniformly for two revolutions to form a uniform pesticide film on the inner wall. Excess solution was poured off. The pesticide film formed by the solvent served as a control. After the inner wall air-dried naturally, a thin slice of apple (15 mm × 15 mm × 5 mm) was placed in the Erlenmeyer flask for the test insects to feed on. Subsequently, transgenic fruit fly adults that had emerged 4 days prior were placed in conical flasks and sealed with gauze. Each treatment was repeated 3 times, with 30 test insects per replicate. The test insects were placed in an artificial climate chamber under the following conditions: temperature 25℃, relative humidity 60-70%, and light-dark ratio 12h:12h. Abdominal rollover and six-leg twitching were used as the criteria for determining mortality. Adult mortality was recorded after 48 hours of treatment, and the mortality rate and corrected mortality rate were calculated. The median lethal concentration (LC50) of the insecticide was calculated using the Probit method in SPSS software. 50 ) and 95% confidence interval.

[0114] Results: The results are summarized in Table 2. It can be seen that transferring the PxGSTD2 or PxGSTD2F205A gene into Drosophila significantly reduced the toxicity of the tested insecticides to Drosophila. Specifically, the toxicity of the tested insecticides to PxGSTD2F205A-transformed Drosophila was significantly lower than that to PxGSTD2-transformed Drosophila.

[0115] Table 2. Indoor toxicity of insecticides to different strains of Drosophila melanogaster

[0116]

[0117] Note: F205A is an abbreviation for the PxGSTD2F205A gene.

[0118] Conclusion: Overexpression of PxGSTD2 or its mutant gene significantly improved the tolerance of Drosophila to various pesticides. Overexpression of PxGSTD2F205A significantly enhanced pesticide tolerance in Drosophila than overexpression of PxGSTD2. This result indicates that transferring PxGSTD2 or its mutant gene into non-target organisms can improve the pesticide tolerance of target organisms.

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

Claims

1. A PxGSTD2 protein mutant, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO.3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO.3, the mutant comprising a mutation of phenylalanine (F) at residue 205 of the amino acid sequence shown in SEQ ID NO.3; preferably, the signal peptide has an amino acid sequence as shown in SEQ ID NO.

55.

2. The mutant according to claim 1, wherein the mutant comprises any one of the mutants F205A, F205V, F205H, F205C, F205L, F205G, F205I, F205P and F205T; preferably, the mutant comprises any one of the mutants F205A, F205V, F205H, F205C and F205L; more preferably, the mutant comprises the mutant F205A.

3. An isolated gene encoding a mutant according to any one of claims 1-2.

4. The isolated gene according to claim 3, wherein the isolated gene has a nucleic acid sequence or a degenerate sequence thereof as shown in any one of SEQ ID NOs. 4-7, 10-13, 16-17, 20-21, 24-27, 30-33, 36-38, 41-44 or 47-50.

5. An expression vector comprising the isolated gene as described in claim 3 or 4.

6. The expression vector according to claim 5, wherein the expression vector is a plasmid; preferably, the expression vector is a pET series vector such as pET-30a, a pBAD vector such as pBAD / HisC, a pGEX vector such as pGEX-6P-1, a pUAST vector, an Agrobacterium vector, a YIP vector, a YEp vector, a YCp vector, a pPIC series vector such as pPICZαA, a pGAP series vector such as pGAPZB, a pcDNA series vector such as pcDNA3.1, a pSV series vector, a baculovirus vector, a retroviral vector, a lentiviral vector, or an adenovirus vector.

7. An expression cell comprising the isolated gene as described in claim 3 or 4 or the expression vector as described in claim 5 or 6.

8. The expression cell according to claim 7, wherein the expression cell is a prokaryotic cell such as Escherichia coli cells, Bacillus cells or Streptomyces cells, or a eukaryotic cell such as an animal cell, plant cell or yeast cell; wherein the animal cell includes cells from bees, earthworms, spiders, fruit flies, fall armyworms, white armyworms, silkworms, clawed frogs, Chinese hamsters, baby hamsters, mice, and humans.

9. Use of the PxGSTD2 protein, the gene encoding the PxGSTD2 protein, the mutant of claim 1 or 2, the isolated gene of claim 3 or 4, the expression vector of claim 5 or 6, or the expression cell of claim 7 or 8 in catalyzing the conjugation of pesticides with reduced glutathione (GSH) in vitro or in non-target organisms, or in improving pesticide tolerance in non-target organisms, wherein the PxGSTD2 protein is a mature protein with an amino acid sequence as shown in SEQ ID NO. 3 or a precursor protein having a signal peptide at the N-terminus of SEQ ID NO. 3; preferably, the signal peptide has an amino acid sequence as shown in SEQ ID NO.

55.

10. The use according to claim 9, wherein the non-target organism comprises: The pesticide includes all non-pest arthropod species, such as bees, silkworms, parasitic wasps, ladybugs, spiders, and predatory mites; birds such as small grain-eating birds, small insectivorous birds, large herbivorous birds, and small omnivorous birds; soil organisms such as earthworms; aquatic organisms such as fish, daphnia, algae, predatory amphibians, and large crustaceans; the pesticide includes insecticides, acaricides, herbicides, fungicides, and nematicides; preferably, the pesticide is an insecticide or an acaricide; more preferably, the pesticide is an insecticide; preferably, the insecticide is selected from one or more of oxadiazine, neonicotinoid, and pyrethroid insecticides; even more preferably, the insecticide is selected from one or more of oxadiazine insecticides such as indoxacarb, pyrethroid insecticides such as lambda-cyhalothrin, neonicotinoid insecticides such as dinotefuran and acetamiprid.