Polypeptides for presenting heterologous proteins to outer membrane vesicles and uses thereof

By linking the 25-amino acid sequence of the EngXCA signal peptide from Xanthomonas brassicae to a heterologous protein, efficient delivery of the heterologous protein in OMVs was achieved. This addresses the shortcomings of existing technologies that rely on OmpA and ClyA modifications, particularly filling the gap in the application of OMVs in plant pathogenic bacteria, and providing a new delivery method.

CN122256308APending Publication Date: 2026-06-23INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF MICROBIOLOGY CHINESE ACAD OF SCI
Filing Date
2024-12-23
Publication Date
2026-06-23

Smart Images

  • Figure BDA0005203322240000091
    Figure BDA0005203322240000091
  • Figure BDA0005203322240000092
    Figure BDA0005203322240000092
  • Figure BDA0005203322240000101
    Figure BDA0005203322240000101
Patent Text Reader

Abstract

The application discloses a polypeptide for presenting a heterologous protein to an outer membrane vesicle and application thereof. Specifically disclosed are a polypeptide with an amino acid sequence of SEQ ID No. 1 and application thereof in presenting a heterologous protein to an outer membrane vesicle of a host bacterium. The application successfully expresses the heterologous protein in OMVs of Xanthomonas campestris by connecting the polypeptide with the heterologous protein. Xanthomonas campestris is a plant pathogenic bacterium, has low immunogenicity to human bodies, has a unique advantage for biomedical application of OMVs, and realizes presentation of the heterologous protein in Xanthomonas campestris OMVs for the first time, thereby providing a solution for future plant biotechnology, development and application of a vaccine adjuvant and the like. The polypeptide of the application realizes presentation of the heterologous protein by using only 25 amino acids, and can minimally affect the conformation and activity of the presented protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to polypeptides for presenting heterologous proteins to outer membrane vesicles and their applications. Background Technology

[0002] Outer membrane vesicles (OMVs) are vesicle-like structures, typically 20-400 nm in size, released extracellularly by bacteria and encapsulated in a phospholipid bilayer. OMVs are structurally stable and possess good biocompatibility, capable of carrying proteins, toxins, nucleic acids (DNA and RNA), and small molecule compounds for long-distance delivery. For the development of modern biotechnology, OMVs are ideal delivery carriers due to their small size, transport capabilities, and ability to fuse with cell membranes. Through targeted modification, OMVs can be used in various biotechnology fields, such as vaccine adjuvant development, drug delivery, fluorescence tracking, cancer immunotherapy, and antibacterial therapy. The presentation of target proteins by OMVs has become a key issue in OMV applications, but related technologies are still under development.

[0003] The structure of OMVs protects the encapsulated drugs from degradation, improving the stability of drugs and proteins. Simultaneously, OMVs can bind to specific cells or tissues through surface molecules, enabling targeted delivery of drugs and proteins. Currently, there are two main methods for presenting heterologous proteins using OMVs: one is to express a scaffold protein on the OMV and then assemble it with the target protein in vitro, thus loading the target protein onto the OMV surface; the other is to directly fuse the target protein with proteins in the OMV, allowing the target protein to be directly expressed on the OMV.

[0004] Outer membrane vesicles (OMVs), as natural nanocarriers, have broad application prospects and unique advantages in the field of biotechnology. Therefore, exploring and developing molecules capable of presenting heterologous proteins into OMVs in a highly efficient and stable manner is of great significance for promoting the widespread application of OMVs in the field of biotechnology. Summary of the Invention

[0005] One object of this invention is to provide a polypeptide for presenting heterologous proteins to outer membrane vesicles. The technical problem to be solved is not limited to the described technical subject matter, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0006] To achieve the above objectives, the present invention first provides a polypeptide, which may be any of the following:

[0007] A1) The amino acid sequence is that of the polypeptide in SEQ ID No. 1;

[0008] A2) A polypeptide obtained by substituting, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 1, which has more than 80% identity with the polypeptide shown in A1) and has the same function;

[0009] A3) A fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] Furthermore, the substitution described in A2) can be a conservative substitution.

[0011] Furthermore, the connection described in A3) can be directly connected via peptide bonds or via a connector.

[0012] The tags include, but are not limited to: GST (glutathione thioredoxin) tag protein, Trx (thioredoxin) tag protein, nitrogen utilization substrate A (NusA) tag protein, His tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA (influenza hemagglutinin) tag protein, Myc tag protein, LacZ tag protein, CBD (cellulose-binding domain) tag protein, phage T7 protein kinase (T7PK) tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0013] The present invention also provides a nucleic acid molecule encoding the said polypeptide.

[0014] Furthermore, the nucleic acid molecule may be either B1) or B2):

[0015] B1) The coding sequence or nucleotide sequence is the DNA molecule shown in SEQ ID No. 2;

[0016] B2) has 75% or more identity with the nucleotide sequence defined in B1) and encodes a DNA molecule of the polypeptide of claim 1.

[0017] The present invention also provides a biomaterial, which may be any one of the following C1) to C4):

[0018] C1) An expression cassette containing the nucleic acid molecule;

[0019] C2) A recombinant vector containing the nucleic acid molecule;

[0020] C3) Recombinant microorganisms containing the aforementioned nucleic acid molecules;

[0021] C4) Recombinant host cells containing the nucleic acid molecules.

[0022] The present invention also provides the use of the polypeptide, the nucleic acid molecule or the biological material in presenting heterologous proteins to the outer membrane vesicles of host bacteria.

[0023] Furthermore, the application can be achieved by fusing the polypeptide described herein with the heterologous protein and expressing it in a host bacterium. The polypeptide can present the heterologous protein into the outer membrane vesicles of the host bacterium for expression.

[0024] The present invention also provides a method for preparing outer membrane vesicles containing heterologous proteins, the method comprising the following steps:

[0025] D1) The coding gene of the polypeptide is linked to the coding gene of the heterologous protein and then fused and expressed in the host bacteria to obtain recombinant bacteria;

[0026] D2) Culturing the recombinant bacteria and extracting the outer membrane vesicles of the recombinant bacteria to obtain outer membrane vesicles containing heterologous proteins.

[0027] Furthermore, the gene encoding the polypeptide can be fused with the gene encoding the heterologous protein and then expressed in the outer membrane vesicles of the host bacterium. The polypeptide can then present the heterologous protein into the outer membrane vesicles of the host bacterium.

[0028] The gene encoding the polypeptide can be linked to the N-terminus of the gene encoding the heterologous protein. This linking can be direct or via a linker (such as a flexible peptide linker).

[0029] Furthermore, the D1) may include the following steps:

[0030] E1) Obtain the fusion gene of the coding gene of the polypeptide and the coding gene of the heterologous protein;

[0031] E2) The fusion gene is cloned into an expression vector to obtain a recombinant expression vector;

[0032] E3) The recombinant expression vector is introduced into the host bacteria to obtain recombinant bacteria.

[0033] The method for obtaining the fusion gene described in E1) is well known to those skilled in the art. For example, the nucleotide sequence of the polypeptide-encoding gene can be directly spliced ​​with the nucleotide sequence of the heterologous protein-encoding gene and then the fusion gene can be directly synthesized artificially by enzymatic or chemical synthesis. Alternatively, the heterologous protein-encoding gene can be amplified from the donor genome or a clone containing the heterologous protein-encoding gene using PCR technology, and then fused with the polypeptide-encoding gene of the present invention in vitro using molecular biology methods (such as DNA ligase-catalyzed ligation reaction) to form a fusion gene. Or, primer-mediated PCR amplification can be used, with the polypeptide-encoding gene of the present invention designed onto primers, and the fusion gene containing the polypeptide-encoding gene of the present invention and the heterologous protein-encoding gene can be directly amplified from the donor genome or a clone containing the heterologous protein-encoding gene using PCR technology.

[0034] In the above method, the host bacteria may include bacteria, fungi, and actinomycetes.

[0035] In the above method, the host bacteria can be selected from Escherichia coli, Corynebacterium, Breobrani, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, Yeast, Fusarium, Rhizoctonia, Verticillium, Penicillium, Aspergillus, and Streptomyces.

[0036] In the above method, the host bacteria can be Gram-negative bacteria.

[0037] In the above method, the Gram-negative bacteria may include, but are not limited to, Xanthomonas brassicae, Escherichia coli, Pseudomonas aeruginosa, Salmonella, Klebsiella pneumoniae, and Shigella.

[0038] In the above method, the heterologous protein may include, but is not limited to, antigenic proteins or peptides, proteins or peptides with therapeutic activity, proteins or peptides with targeting functions, and reporter proteins.

[0039] Furthermore, the heterologous protein can be any non-host bacterial endogenous protein that is not normally present in the host bacteria and is introduced through gene transfer, including antigenic proteins or peptides (such as antigens or cancer antigens from bacteria, viruses, or parasites), proteins or peptides with therapeutic activity (such as therapeutic antibodies against bacteria, viruses, or tumors), proteins or peptides with targeting functions (such as peptides that specifically target tumor cells), and reporter proteins (such as β-glucuronidase (GUS), luciferase, chloramphenicol acetyltransferase (CAT), β-galactosidase (β-gal), secretory human placental alkaline phosphatase (SEAP), yellow fluorescent protein (YFP), green fluorescent protein (GFP), etc.

[0040] In one or more embodiments of the present invention, the method for preparing outer membrane vesicles containing heterologous proteins may include the following steps:

[0041] (1) Obtain the fusion gene of the coding gene of the polypeptide (SEQ ID No. 1) and the coding gene of the heterologous protein eGFP;

[0042] (2) The fusion gene is cloned into an expression vector to obtain a recombinant expression vector;

[0043] (3) The recombinant expression vector was introduced into Xanthomonas spp. to obtain recombinant Xanthomonas spp.

[0044] (4) Cultivate the recombinant Xanthomonas oryzae and extract the outer membrane vesicles of the recombinant Xanthomonas oryzae to obtain outer membrane vesicles containing heterologous proteins.

[0045] Further, the nucleotide sequence of the gene encoding the polypeptide (SEQ ID No. 1) in step (1) may be SEQ ID No. 2.

[0046] Further, the nucleotide sequence of the fusion gene described in step (1) may be as shown in positions 1-819 of SEQ ID No. 3.

[0047] Furthermore, the expression vector mentioned in step (2) can be a prokaryotic expression vector or a eukaryotic expression vector.

[0048] Although the expression vector used in the embodiments provided in this invention is pBBR1MCS2, this invention is not limited to this specific vector. Those skilled in the art can use other suitable vectors, as long as the vector can express the fusion gene described herein. Those skilled in the art can choose conventional expression vectors in the art (such as pKK223-3, pET series vectors, pGEX series vectors, pMAL series vectors, etc.) as needed.

[0049] Furthermore, the method of importation described in step (3) can be electroconversion.

[0050] Furthermore, the cultivation in step (4) can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture, and fed-batch culture, and various culture conditions such as temperature, time, and pH of the culture medium can be appropriately adjusted according to actual conditions. In one or more embodiments of the present invention, the culture conditions are: 28°C, 220 rpm.

[0051] Furthermore, the method for extracting the outer membrane vesicles of the recombinant Xanthomonas brasiliensis in step (4) may include the following steps:

[0052] 1) Centrifuge the culture obtained after culturing the recombinant Xanthomonas brasiliensis and collect the supernatant;

[0053] 2) After filtering and sterilizing the supernatant, centrifuge it at high speed;

[0054] 3) Collect the precipitate after high-speed centrifugation, which is the outer membrane vesicle.

[0055] The conditions for ultrafiltration concentration can be: centrifugation at 100,000g and 4°C for 1.5 hours.

[0056] Furthermore, a washing and purification step may be included after step (3). For example, the outer membrane vesicles may be washed and purified using pre-cooled 1×PBS or physiological saline or other suitable buffer to further remove impurities.

[0057] The present invention also provides outer membrane vesicles containing heterologous proteins, characterized in that the outer membrane vesicles are prepared by any of the methods described herein.

[0058] Furthermore, the outer membrane vesicles contain the polypeptides described herein.

[0059] The polypeptide described in this article may be derived from the EngXCA signal peptide of Xanthomonas campestris.

[0060] Numerous studies have provided OMVs for target proteins; however, current delivery methods primarily rely on the modification and development of proteins OmpA and ClyA on OMVs, loading the target protein onto the surface of the OMVs. This invention proposes a novel delivery method entirely different from the OmpA and ClyA protein delivery methods. By linking 1-25 amino acids (MSIFRTASTLALATALALAAGPAFS) from the EngXCA signal peptide of Xanthomonas campestris (SEQ ID No. 1) to a heterologous protein, the heterologous protein was successfully expressed in Xanthomonas campestris OMVs, achieving OMVs delivery of the heterologous protein. Currently, the application of OMVs is mainly based on the development of OMVs from engineered bacteria such as Escherichia coli and animal pathogenic bacteria. There are currently no relevant methods for delivering OMVs from the plant pathogenic bacterium Xanthomonas campestris. Xanthomonas campestris is a plant pathogenic bacterium with low immunogenicity to humans, giving it unique advantages for biomedical applications of OMVs. This invention is the first to achieve the presentation of heterologous proteins in Xanthomonas campestris OMVs, providing a solution for future plant biotechnology and the development and application of vaccine adjuvants.

[0061] The polypeptide of this invention (SEQ ID No. 1) achieves OMV presentation of heterologous proteins using only 25 amino acid sequences, which is shorter than all existing presentation methods and minimizes the impact on the conformation and activity of the presented protein.

[0062] Terminology Definition

[0063] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0064] The term "expression cassette" generally refers to a nucleic acid construct containing sufficient nucleic acid elements to express a target gene. A typical expression cassette includes a promoter, a multiple cloning site (MCS), and a terminator. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences. Elements within an expression cassette can be directly linked or indirectly linked through adapters.

[0065] The term "vector" generally refers to a vector capable of delivering exogenous DNA or a target gene into host cells for amplification and / or expression. This vector can be a cloning vector or an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may also contain a replication initiation site.

[0066] The term "microorganism" typically includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria mentioned can be from genera such as *Escherichia sp.* (e.g., *Escherichia coli*), *Erwinia sp.*, *Agrobacterium sp.* (e.g., *Agrobacterium tumefaciens*), *Flavobacterium sp.*, *Alcaligenes sp.*, *Pseudomonas sp.*, and *Bacillus sp.* (e.g., *Bacillus*). The viruses mentioned can include rotaviruses, baculoviruses, retroviruses (e.g., lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, influenza viruses, papillomaviruses (e.g., SV40), and herpesviruses (e.g., herpes simplex virus). The fungi may originate from genera such as *Saccharomyces* sp. (e.g., *Saccharomyces cerevisiae*, *Methanolac*, *Pichia pastoris*), *Fusarium* sp., *Rhizoctonia* sp., *Verticillium* sp., *Penicillium* sp., *Aspergillus* sp., and *Cephalosporium* sp. The actinomycetes may originate from genera such as *Streptomyces* sp. The algae may originate from phylum Cyanophyta (e.g., cyanobacteria), genera such as *Fucus* sp., *Achna nthes* sp., *Amphiprora* sp., *Amphora* sp., *Ankistrod esmus* sp., *Asteromonas* sp., and *Boekelovia* sp.

[0067] The term "host cell," also known as the recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as plant and animal cells. The term "host cell" can be understood not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, may not necessarily be identical to the original parent cell but are still included within the scope of the host cell. Suitable host cells are those known in the art, including: plant cells such as Arabidopsis thaliana, tobacco (Nicotiana tabacum), maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), etc., but not limited to these; animal cells such as mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary cell subline (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc.), avian cells (e.g., chicken or duck cells), and amphibian cells (e.g., Xenopus laevis cells or Andrias davidianus cells). These include, but are not limited to, davidianus cells, fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells, Sf-9 cells, or Hi-5 cells).

[0068] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by linking a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0069] The term "recombinant microorganism" generally refers to a recombinant microorganism whose genes have been manipulated and modified to obtain a functionally altered microorganism. This can be achieved by introducing a foreign target gene or recombinant vector into the target microorganism, or by directly editing the endogenous genes of the target microorganism.

[0070] The term "recombinant host cell" generally refers to a recombinant host cell whose genes have been manipulated and modified to obtain a recombinant host cell with altered function. This can include introducing a foreign target gene or recombinant vector into the host cell, or directly editing the host cell's endogenous genes.

[0071] The term "linkage" generally refers to the association of two or more molecules. Linkages can be covalent or non-covalent. The linkages described herein can be direct peptide bonds or linkages via linkers (connectors).

[0072] The term "identity" generally refers to the degree to which two (nucleotide or amino acid) sequences have identical residues at the same position in an alignment, and is usually expressed as a percentage. The identity described herein can refer to the identity of an amino acid sequence or a nucleotide sequence. Two copies having completely identical sequences have 100% identity. Those skilled in the art will recognize that the identity of an amino acid or nucleotide sequence can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, the identity of an amino acid sequence can be calculated by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and then performing a search to obtain the identity value (%). Alternatively, it can be determined using sequence analysis software such as CLC Main Workbench and MegAlign™, for example, using the computer program BLAST with default parameters, especially BLASTP or TBLASTN. The 75% or higher identity mentioned herein can be 75%, 80%, 85%, 90%, or 95% or higher. In this document, the 80% or higher identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher.

[0073] The term "conservative substitution" generally refers to the replacement of one amino acid residue with another amino acid residue in a side chain that has similar physicochemical properties. For example, conservative substitutions can occur between hydrophobic side chain amino acid residues (e.g., Met, Ala, Val, Leu, and Ile), between neutral hydrophilic side chain residues (e.g., Cys, Ser, Thr, Asn, and Gln), between acidic side chain residues (e.g., Asp, Glu), between basic side chain amino acids (e.g., His, Lys, and Arg), or between aromatic side chain residues (e.g., Trp, Tyr, and Phe). It is known in the art that conserved substitutions generally do not cause significant changes in the conformational structure of peptides and proteins and essentially do not alter their biological activity. Conservative substitutions in peptide and protein sequences that are expected to have only minimal or no effect on structure or function can be readily designed by those skilled in the art.

[0074] The term "heterologous protein," also known as "exogenous protein," typically refers to a protein derived from a species different from the host (or the object of study). In this invention, heterologous protein can refer to any non-host bacterial endogenous protein that is not normally present in the host bacteria and is introduced through gene transfer.

[0075] The term "reporter protein" usually refers to a protein or enzyme that is easily detected. The reporter gene is fused with other target genes and expressed under the control of regulatory sequences. The expression regulation of the target gene is "reported" by detecting the expression product of the reporter gene.

[0076] The term "polypeptide" generally refers to a chain containing at least two consecutively linked amino acid residues, with no upper limit on chain length. One or more amino acid residues in a protein may contain modifications, such as, but not limited to, glycosylation, phosphorylation, or disulfide bond formation. "Protein" can include one or more polypeptides. Unless otherwise stated, the terms "protein" and "polypeptide" are used interchangeably.

[0077] The term "fusion expression" typically refers to splicing together the coding genes of two or more proteins or peptides and expressing them as a new open reading frame.

[0078] The term "introduction" generally refers to the transfer of a foreign gene into recipient cells, such as eukaryotic or prokaryotic recipient cells. There are no particular limitations on the method of introduction; any known transformation method that can transfer the target gene (such as the fusion gene of this invention) into the recipient cell is acceptable. The introduction methods described herein may include introducing the target gene or a recombinant vector containing the target gene into the host bacteria through chemical transformation (such as Ca ion-induced transformation, polyethylene glycol-mediated transformation, or metal cation-mediated transformation) or physical transformation (such as electroporation transformation).

[0079] The term "culture" generally refers to a liquid or solid product (all substances within a culture container) that has grown a microbial community after being artificially inoculated and cultured. Attached Figure Description

[0080] Figure 1 This is a schematic diagram of the carrier construction pattern in Example 1.

[0081] Figure 2 The results show the morphology and particle size distribution of Xanthomonas oryzae OMVs.

[0082] Figure 3 This is the result of immunoblotting detection of the polypeptide-presenting protein eGFP in OMVs of Xanthomonas campestris, as described in this invention. Detailed Implementation

[0083] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0084] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0085] The vector pBBR1MCS2 in the following examples is described in the following literature: Kovac, ME et al. Four newed erivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes[J]. Gene

[1995] .DOI:10.1016 / 0378-1119(95)00584-1.

[0086] The homologous recombinase used in the following examples is 2x Hieff MultiS Enzyme Premix, purchased from YEASEN, part number 10912-A.

[0087] The Xanthomonas campestris species described in the following examples are described in the following literature: Deng CY, Zhang H, Wu Y, et al. Proteolysis of histidine kinase VgrS inhibits its autophosphorylation and promotes osmostress resistance in Xanthomonas campestris[J]. Nature Communications[2024-12-18]. DOI:10.1038 / s41467-018-07228-4.

[0088] The method for preparing Xanthomonas oryzae competent cells is as follows:

[0089] (1) Streak Xanthomonas oryzae on solid culture medium to activate it, pick a single colony and put it into M210 liquid culture medium, shake overnight at 28°C.

[0090] (2) Transfer the bacterial culture from the previous step into M210 liquid culture medium and incubate at 28°C and 220 rpm for 6–8 hours.

[0091] (3) When the bacterial solution OD 600 When the temperature reaches between 0.4 and 0.6, place the bacterial solution on ice for 20 minutes to cool it down rapidly.

[0092] (4) Centrifuge at 5000 rpm, 4℃, for 5 min to collect bacterial cells.

[0093] (5) Use pre-cooled 10% glycerol to resuspend the bacterial cells, then centrifuge at 5000 rpm, 4°C, for 5 min and discard the supernatant. Repeat 3 times to wash away the bacterial cells.

[0094] (6) Use 2 mL of 10% pre-cooled glycerol per liter of initial bacterial cells to resuspend the bacterial cells, dispense 80 μL into pre-cooled 1.5 mL centrifuge tubes, quick-freeze in liquid nitrogen, and store at -80℃ for later use.

[0095] Example 1: Application of peptides in presenting heterologous proteins to outer membrane vesicles (OMVs)

[0096] Currently, OMVs used for presenting heterologous proteins mainly focus on engineered bacteria such as *Escherichia coli* and some other bacteria, and the related heterologous protein expression schemes are all based on the modification of proteins OmpA and ClyA on OMVs. Through extensive and in-depth research, the inventors of this invention have proposed a scheme not based on OmpA and ClyA. By using 25 amino acids from the EngXCA signal peptide of *Xanthomonas campestris* (SEQ ID No. 1), specifically MSIFRTASTLALATALALAAGPAFS, to link with the heterologous protein, the heterologous protein was successfully expressed in the host bacterium's OMVs. The amino acid sequence of the polypeptide of this invention is shown in SEQ ID No. 1. By linking the coding gene of the polypeptide of this invention with the coding gene of the heterologous protein in vitro and then transforming it into the host bacterium for fusion expression, the heterologous protein can be expressed in the host bacterium's OMVs. In this embodiment, eGFP is selected as the heterologous protein, and the polypeptide (SEQ ID No. 1) is used to present the heterologous protein into the outer membrane vesicles (OMVs) of the host bacterium. The specific method is as follows:

[0097] 1. Construction of recombinant vectors

[0098] 1) Using pBBR1MCS2 as the original plasmid, double digestion with restriction endonucleases KpnⅠ and HindⅢ was performed, followed by agarose gel electrophoresis and gel extraction to purify the vector fragment (pBBR1MCS2 linearized plasmid), which was then stored for later use.

[0099] 2) Primer design: The gene encoding the polypeptide of this invention, 5'-ATGTCCATATTCAGGACC GCAAGCACGCTCGCTTTGGCCACCGCCCTCGCACTGGCCGCCGGGCCGGCCTTCAGC-3' (SEQ ID No. 2), was added to the 5' end of the heterologous protein eGFP encoding gene using PCR technology. The vector was constructed using homologous recombination, and the primers were designed as follows:

[0100] F1:

[0101] R1:

[0102] The primers used for constructing the negative control vector were:

[0103] F2:

[0104] R2:

[0105] The lowercase letters represent homologous arm sequences, the underlined portions represent the DNA sequence of the added polypeptide, and the bold uppercase letters represent the primer sequences required for cloning the target gene (eGFP gene).

[0106] 3) PCR amplification of the target fragment:

[0107] Using the eGFP gene fragment as a template and F1 and R1 primers, PCR amplification was performed to obtain target fragment 1. Target fragment 1 contains a DNA fragment formed by linking the coding gene of the polypeptide of this invention with the coding gene of the heterologous protein eGFP. For ease of subsequent Western blotting detection, the C-terminus of the eGFP gene sequence contains a 6-histidine tag. The full-length nucleotide sequence of the fusion gene of the coding gene of the polypeptide of this invention, the coding gene of the heterologous protein eGFP, and the coding gene of the histidine tag is shown in SEQ ID No. 3. Specifically, positions 1-819 of SEQ ID No. 3 represent the fusion gene sequence of the polypeptide of this invention and the heterologous protein eGFP. Positions 1-75 of SEQ ID No. 3 represent the coding gene of the polypeptide of this invention; positions 76-819 of SEQ ID No. 3 represent the coding gene of eGFP.

[0108] The PCR reaction system and PCR reaction conditions are as follows:

[0109] Table 1. PCR amplification reaction system

[0110] Element Added amount DNA template 50ng Forward primer (10 μM) 2.5μL Reverse primer (10 μM) 2.5μL 2×SuperTaq PCR Mix 25μL <![CDATA[ddH2O]]> Add to 50μL

[0111] Table 2. PCR Reaction Cycling Conditions

[0112]

[0113] Using the eGFP gene fragment as a template and F2 and R2 as primers, PCR amplification was performed to obtain target fragment 2. This target fragment 2 contains the heterologous protein eGFP encoding gene. To facilitate subsequent Western blotting detection, the eGFP gene sequence has a 6-histidine tag at the C-terminus. The PCR reaction system is the same as in Table 1. The PCR reaction conditions are the same as in Table 3.

[0114] After PCR, agarose gel electrophoresis was performed, and the gel was excised and the target fragment was purified.

[0115] 4) The recombinant vector was constructed using the homologous recombination method. The homologous recombination reaction conditions were: 37℃ for 30 min, and the homologous recombination reaction system was:

[0116] Table 3. Homologous recombination reaction system

[0117]

[0118] The recombinant vectors constructed using the above homologous recombination method were named pBBR1MCS2-EngXCA. (1-25aa) -eGFP and pBBR1MCS2-eGFP (control vector). Recombinant vector pBBR1MCS2-EngXCA (1-25aa) -eGFP is a recombinant vector obtained by cloning the DNA fragment with the nucleotide sequence shown in SEQ ID No. 3 into the vector pBBR1MCS2, while keeping the other sequences of the pBBR1MCS2 vector unchanged. The recombinant vector pBBR1MCS2-EngXCA (1-25aa) -eGFP can express the fusion protein EngXCA of the polypeptide and eGFP of this invention. (1-25aa) -eGFP (SEQ ID No. 4). Vector construction diagram as shown below. Figure 1 As shown.

[0119] 5) Transform the recombinant vector into Escherichia coli DH5α competent cells.

[0120] 6) On the second day, positive clones were screened by colony PCR. The primers for identification were:

[0121] M13-F-pBBR1MCS: 5'-TGTAAAACGACGGCCAGTG-3',

[0122] M13-R-pBBR1MCS: 5'-CAGGAAACAGCTATGACCATGA-3'.

[0123] 7) The correct clones obtained from colony PCR screening were cultured, plasmids were extracted, and then sequencing was performed to confirm that the recombinant plasmids were correctly constructed.

[0124] 2. Transformation of Xanthomonas brassicae

[0125] 1) Take competent Xanthomonas oryzae cells, thaw them on ice, then add no more than 1 / 10 of the total volume of the correctly constructed recombinant plasmid, mix gently, transfer to a pre-cooled electroporation cup, and gently tap to remove air bubbles.

[0126] 2) Place the electroporation cup in the electroporator and perform electroporation using the following parameters (V = 1.8 kV, C = 25 μF, R = 200 Ω). Immediately after electroporation, add 1 mL of antibiotic-free M210 liquid culture medium (5 g / L sucrose, 8 g / L enzyme-hydrolyzed casein, 4 g / L yeast extract, 3 g / L K2HPO4). Then, transfer competent cells to a 50 mL centrifuge tube and incubate at 28°C and 220 rpm for 2 hours.

[0127] 3) Add the electrolyzed bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 4000 rpm for 2 min, discard part of the supernatant, then suspend the precipitate and spread it on NYG solid medium containing the corresponding antibiotic (kanamycin 50 μg / mL) (Peptone 5 g / L, Yeast extract 3 g / L, glycerol 20 g / L, pH 7.0, solid medium with 1.5% agar), and incubate upside down at 28℃ for 2–3 days.

[0128] 4) Use colony PCR to detect the correct single colony after electroporation, extract the plasmid, and then perform sequencing to confirm that the recombinant plasmid has been successfully transformed into Xanthomonas brassicae.

[0129] 3. Extraction of OMVs from Xanthomonas brassicae

[0130] 1) Small-scale culture: Select positive Xanthomonas campestris colonies containing recombinant plasmids and incubate them in 5-10 mL of NYG liquid medium containing 50 μg / mL kanamycin (Peptone 5 g / L, Yeast extract 3 g / L, glycerol 20 g / L, pH 7.0, solid medium with 1.5% agar) at 28℃ and 220 rpm.

[0131] 2) Expand the culture by transferring the bacterial culture to 200-500 mL of NYG liquid medium containing 50 μg / mL kanamycin and incubating at 220 rpm at 28°C until OD500. 600 It is approximately 0.6-0.8.

[0132] 3) Centrifuge at 10000g for 10 minutes at 4℃ and collect the supernatant.

[0133] 4) Filter the supernatant using a 0.45μm syringe filter to remove residual bacteria, and then transfer the supernatant to a high-speed centrifuge tube.

[0134] 5) Centrifuge at 100,000g, 4℃ for 1.5h, collect the supernatant for extracellular protein separation, and use the precipitate for OMVs separation.

[0135] 6) Aspirate the supernatant with a pipette tip, add 5 mL of pre-cooled 1×PBS to suspend the precipitate, then centrifuge at 100,000 g, 4 °C for 1 h, discard the supernatant, aspirate the supernatant with a pipette tip, and repeat once.

[0136] 7) Use 50-200 μL of pre-cooled 1×PBS to suspend the precipitate and obtain Xanthomonas vegetans OMVs samples, and store at -80℃.

[0137] 4. Detection of OMVs separation effect

[0138] 1) Use tweezers to pick up the copper mesh from the transmission electron microscope and place it in the plasma surface treatment instrument for glow discharge treatment for 30 seconds.

[0139] 2) Take 5 μL of OMVs sample and adsorb it on the copper grid after glow discharge for 30 s-1 min, then use filter paper to remove excess liquid.

[0140] 3) Take 10 μL of deionized water to wash the sample, repeat 1-3 times.

[0141] 4) Add 5 μL of 0.3% uranium acetate solution to a copper grid, stain negatively for 30 seconds, then blot away excess stain with filter paper. Observe and detect the morphology of OMVs using transmission electron microscopy. Figure 2 A).

[0142] 5) A 9 μL sample of OMVs was taken and its particle size distribution was detected using a dynamic light scattering instrument. Figure 2 B).

[0143] 5. Western blot assay to detect heterologous proteins presented in OMVs of Xanthomonas campestris.

[0144] 1) SDS-PAGE protein electrophoresis was performed on Xanthomonas virgaurea-mastella OMVs and their corresponding bacterial proteins.

[0145] 2) Semi-dry transfer: After electrophoresis, remove the gel block, cut off the stacking gel and the lanes without sample loading, and put the remaining part into the transfer buffer (5.82g / L Tris; 2.93g / L glycine; 0.375g / L SDS; 200mL methanol, add ddH2O to 1L), shake at room temperature for 5min, take the pre-cut filter paper and PVDF membrane, wet the filter paper in the transfer buffer, and activate the PVDF membrane by soaking it in methanol, shake at room temperature for 5min.

[0146] 3) Place two layers of filter paper in the semi-dry transfer apparatus, then place the activated PVDF membrane, then add the adhesive, and finally cover with two more layers of filter paper. Cover the semi-dry transfer apparatus and perform the transfer.

[0147] 4) Blocking: Place the transferred membrane into an incubation box, add blocking solution, and block at room temperature for 1 hour or at 4°C overnight. (Blocking solution formula: 1×TBST containing 5% skim milk).

[0148] 5) Primary antibody incubation: Remove the blocking buffer and add 1×TBST to wash the membrane. Shake for 10 min each time, repeat 3 times. Then add 10 mL of the prepared primary antibody solution (Anti-6X His). The antibody (purchased from Abcam, catalog number AB18184) was incubated at room temperature on a shaker for 1 hour or overnight at 4°C.

[0149] 6) Recover the primary antibody and wash away excess primary antibody with 1×TBST, shaking for 10 minutes each time, repeating 3 times.

[0150] 7) Secondary antibody incubation: Add 10 mL of prepared secondary antibody solution (Goat Anti-Mouse IgG H&L (HRP), purchased from Abcam, catalog number ab205719), and incubate on a shaker at room temperature for 1 h.

[0151] 8) Recover the secondary antibody and wash away the unbound secondary antibody with 1×TBST. Shake for 10 minutes each time, and repeat 3 times.

[0152] 9) Development: Prepare the luminescence enhancement solution, place the membrane in double-layered transparent plastic film, and add an appropriate amount of luminescence enhancement solution (SuperSignal). TM The West Pico PLUS chemiluminescent substrate (purchased from Thermo Fisher, item number 34580) was applied evenly and then developed and photographed using a chemiluminescence analyzer. Figure 3 ).

[0153] The results of OMV separation effect detection and protein immunoblotting assay are as follows: Figure 2 and Figure 3 As shown. Results of transmission electron microscopy (TEM) examination ( Figure 2 A) indicates that the OMVs isolated by the Xanthomonas brasiliensis OMVs isolation method provided by this invention exhibit a typical vesicular structure and contain no obvious non-OMV component impurities. Dynamic light scattering was used to determine the particle size range of the OMVs (…). Figure 2 B) indicates that the size distribution of OMVs separated by this method is between 20-400 nm, which is the typical size of OMVs. Western blot analysis results ( Figure 3 This indicates that the eGFP protein and the fusion protein EngXCA (1-25aa) -eGFP was successfully expressed in Xanthomonas campestris cells, but eGFP could not be presented in Xanthomonas campestris OMVs, while EngXCA... (1-25aa) -eGFP was successfully presented into OMVs of Xanthomonas brassicae. Based on the solution provided by this invention, the heterologous protein eGFP can be replaced with other heterologous target proteins that need to be presented, thereby achieving efficient presentation of the target protein in the host bacterium's OMVs.

[0154] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A polypeptide, characterized in that, The polypeptide is any one of the following: A1) The amino acid sequence is that of the polypeptide in SEQ ID No. 1; A2) A polypeptide obtained by substituting, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 1, which has more than 80% identity with the polypeptide shown in A1) and has the same function; A3) A fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).

2. A nucleic acid molecule encoding the polypeptide of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleic acid molecule is either B1) or B2): B1) The coding sequence or nucleotide sequence is the DNA molecule shown in SEQ ID No. 2; B2) has 75% or more identity with the nucleotide sequence defined in B1) and encodes a DNA molecule of the polypeptide of claim 1.

4. A biomaterial, characterized in that, The biomaterial is any one of the following C1) to C4): C1) An expression cassette containing the nucleic acid molecule of claim 2 or 3; C2) A recombinant vector containing the nucleic acid molecule of claim 2 or 3; C3) Recombinant microorganisms containing the nucleic acid molecules described in claim 2 or 3; C4) A recombinant host cell containing the nucleic acid molecule of claim 2 or 3.

5. The use of the polypeptide of claim 1, the nucleic acid molecule of claim 2 or 3, or the biomaterial of claim 4 in presenting heterologous proteins to the outer membrane vesicles of host bacteria.

6. A method for preparing outer membrane vesicles containing heterologous proteins, characterized in that, The method includes the following steps: D1) The coding gene of the polypeptide described in claim 1 is linked to the coding gene of the heterologous protein and then fused and expressed in a host bacterium to obtain a recombinant bacterium; D2) Culturing the recombinant bacteria and extracting the outer membrane vesicles of the recombinant bacteria to obtain outer membrane vesicles containing heterologous proteins.

7. The method according to claim 6, characterized in that, The host bacteria include bacteria, fungi, and actinomycetes.

8. The method according to claim 7, characterized in that, The host bacteria are selected from Escherichia coli, Corynebacterium, Breobrani, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, Yeast, Fusarium, Rhizoctonia, Verticillium, Penicillium, Aspergillus, and Streptomyces.

9. The method according to any one of claims 6-8, characterized in that, The heterologous proteins include antigenic proteins or peptides, proteins or peptides with therapeutic activity, proteins or peptides with targeting functions, and reporter proteins.

10. An outer membrane vesicle containing a heterologous protein, characterized in that, The outer membrane vesicles are prepared by the method described in any one of claims 6-9.