LiMYB75l and / or LiEGL3 gene, protein and application thereof in flower color regulation of michelia figo

By cloning and validating the LiMYB75L and LiEGL3 genes and their proteins, the problem of insufficient basic research on the regulation of crape myrtle flower color has been solved, providing exclusive gene resources and efficient means of regulating flower color, realizing the potential of molecular breeding and cross-species application of crape myrtle flower color.

CN122256373APending Publication Date: 2026-06-23NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610413914.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-31
Publication Date
2026-06-23

Smart Images

  • Figure CN122256373A_ABST
    Figure CN122256373A_ABST
Patent Text Reader

Abstract

The application discloses LiMYB75L and / or LiEGL3 genes, proteins and application thereof in flower color regulation of Lagerstroemia indica. The application discloses R2R3 MYB (LiMYB75L) transcription factors, basic helix-loop-helix bHLH (LiEGL3) transcription and WDR (LiTTG1-2) proteins of Lagerstroemia indica and a promoter (proDFR) of a downstream gene LiDFR gene. Three genes LiMYB75L, LiEGL3, LiTTG1-2 and proDFR are cloned in two different materials, it is proved that down-regulation of LiMYB75L and LiEGL3 in vivo of Lagerstroemia indica can down-regulate anthocyanin content of petals, and expression of multiple genes in an anthocyanin synthesis pathway is also down-regulated. Meanwhile, it is proved that LiMYB75L and LiEGL3 are located in a cell nucleus and interact with LiTTG1-2 to form a ternary complex.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the LiMYB75L and / or LiEGL3 genes, proteins, and their application in the regulation of flower color in crape myrtle, belonging to the field of crape myrtle flower color regulation. Background Technology

[0002] Crape myrtle ( Lagerstroemia indica Lagerstroemia indica (Chinese crape myrtle) is a native woody flowering plant in my country, with its peak blooming period from June to September. Its blooming period complements that of other traditional Chinese flowers such as plum blossoms, peonies, camellias, and chrysanthemums, making it a common tree species in Chinese landscaping. It has a cultivation history of over a thousand years and carries unique cultural significance. In the last two or three decades, through introduction and independent cultivation, a large red variety (Wang Xiaoming et al., 2016) and some multi-colored varieties (Yang Yanling et al., 2013) have been developed. However, due to insufficient basic research on controlling flower color, a modern biotechnology breeding system has not yet been established. Compared with crops such as corn and rice, crape myrtle breeding still mainly relies on hybridization and selection. To achieve or approach the level of biotechnology breeding in crape myrtle compared to crops, it is crucial to explore the gene resources controlling its important ornamental traits and clarify the molecular mechanisms of their genetic effects.

[0003] Current research on the color traits of crape myrtle flowers mainly focuses on the pigments and genes involved in petal color formation. Research over the past decade has shown that the composition of anthocyanins determines color, while their content determines the depth of color (Yu et al. 2021, Hong et al. 2022, Gao et al. 2024, Lv et al. 2024, Yu et al. 2024). Because the anthocyanin synthesis pathway in plants is relatively conserved (Saigo et al. 2020), homology comparison can be used to identify genes involved in anthocyanin synthesis in the crape myrtle genome. Currently, all genes involved in anthocyanin synthesis (…) Phenylalanin ammonialyase , PAL ; Cinnamate 4-hydroxylase , C4H ; 4-coumarate CoA ligase , 4CL ; Chalcone synthase , CHS ; Chalcone isomerase , CHI ; F lavanone 3-hydroxylase , F3H ; Flavonoid 3'-hydroxylase , F3'H ; Flavonoid 3'5'-hydroxylase , F3'5'H ; Dihydroflavonol-4-reductase , DFR ; Leucoanthocyanidin oxygenase / anthocyanidin synthase , LDOX / ANS The distribution and copy number of [a specific gene] in the genome have been annotated (Zhou et al. 2023, Lv et al. 2024, Yu et al. 2024). Transcriptome studies have shown that... PAL , CHS , DFR , F3H , F3'H , F3'5H as well as ANS ( LODX The expression levels of substances such as anthocyanins are directly proportional to their content, while... DFR , F3'H and F3'5H This may be related to the composition of anthocyanins (Zhou et al. 2023, Yu et al. 2024); in addition, the combination of different regulatory factors may be related to cyanidin and petunidin components in crape myrtle petals (Lv et al. 2024); signaling molecules such as auxins may also be involved in the regulation of anthocyanin and its synthesis in crape myrtle (Feng et al. 2024a, Gao et al. 2024). Some omics and homologous gene analyses suggest that multiple genes may interact in crape myrtle to synergistically regulate anthocyanin expression (Gu et al. 2024, Yu et al. 2024). However, apart from Ni et al. (2025) using the crape myrtle variety 'Zhewei 1' to analyze the process of petal color gradually changing from light purplish pink to strong purplish pink, Li-miR828z-LiMYB114 Regulatory modules are involved in the regulation of anthocyanin synthesis. The study by Feng et al. 2024 demonstrated that in addition to the LfiHY5, LfiMYB75 and LfibHLH1 modules regulating anthocyanin synthesis in leaves, the functions of the remaining genes need further investigation. Summary of the Invention

[0004] Purpose of the invention: The purpose of this invention is to provide the LiMYB75L and / or LiEGL3 genes, proteins, and their applications in the regulation of flower color in crape myrtle.

[0005] Technical solution: The present invention provides a LiMYB75L gene, the nucleotide sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0006] The present invention also provides a protein encoded by the LiMYB75L gene.

[0007] The present invention also provides a recombinant plasmid and a recombinant bacterium containing the LiMYB75L gene.

[0008] The present invention also provides a LiEGL3 gene, the nucleotide sequence of which is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0009] The present invention also provides a protein encoded by the LiEGL3 gene.

[0010] The present invention also provides a recombinant plasmid and a recombinant bacterium containing the LiEGL3 gene.

[0011] The present invention also provides a promoter for LiDFR, the nucleotide sequence of which is shown in SEQ ID NO.5 or SEQ ID NO.6.

[0012] The present invention also provides a recombinant plasmid and a recombinant bacterium containing the aforementioned promoter.

[0013] The present invention also provides the application of the LiMYB75L gene and / or the LiEGL3 gene, the encoded protein or recombinant plasmid, and the recombinant bacteria in the regulation of flower color in crape myrtle.

[0014] The present invention also provides the application of the LiDFR promoter or the recombinant plasmid and recombinant bacteria in the regulation of crape myrtle flower color.

[0015] The application also contains the LiMYB75L gene and the LiEGL3 gene, the encoded protein or recombinant plasmid, and recombinant bacteria.

[0016] > LiMYB75Lr (SEQ ID NO.1): ATGGGAGGTGTTCCTTGGACTGAGGAGGAGGATCACTTGCTTAAAAAATGCATAGAACAGTTCGGAGAAGGAAAGTGGCACCGCATCCCTCTCTTGGCCGGTCTAAACCGGTGCCGGAAAAGTTGCAGGTTGAGATGGCTTAACTACCTCCGCCCGAACATCAAAAGGGGAAGTTTCGCCCCAGAGGAAATCGAGCTCATCATCAAGCTTCACAAGCTTGTGGGGAACAGGTGGTCGTTGATTGCTGGGAGACTGCCCGGAAGAACGGCGAATGATGTCAAGAACTACTGGAACTGTCATCTCAGCAAGAAGCTGAGTGTCAAACAGATTGGCACCGGTTTCGGGGAGAACACTGACGTCAGAACCATCCAGGTTAAGGAGACCCAGCAGCCTCTAGACCTCAGTGGCATTGTTTCCCTGAGATCAGGTGGGAGAACTTGTCTAGAAGAGGCCCTGACTTATTACCCTCAATTGCCTCAATTGGAGCCGCCACCTCCAGAAATCGGAGCCTCGACCCAGTTCCTCGGAGTCCAAGATTGGGAAGAGCTCCGGTACGAGGAGAAGAAGGGTGCCCCAGCTGAAGAAAATGGCATTGTTCTCGGAGACCTGCCATCGGATTTCCAGCTAGATGAGGTCAGAGCGGACGGGTTCGGAAGCAACAAGCTGAGGTGGGACTGGGATGACCTGTTCATGGACATGGATCTGTGGAACAGTACCTTGTAA; > LiMYB75Lw (SEQ ID NO.2): ATGGGAGGTGTTCCTTGGACTGAGGAGGAGGATCACTTGCTTAAAAAATGCATAGAACAGTTCGGAGAAGGAAAGTGGCACCGCATCCCTCTCTTGGCTGGTCTAAACCGGTGCCGGAAAAGTTGCAGGTTGAGATGGCTTAACTACCTCCGCCCGAACATCAAAAGGGGAAGTTTCGCCCCAGAGGAAATCGAGCTCATCATCAAGCTTCACAAGCTTGTGGGGAACAGGTGGTCGTTGATTGCTGGGAGACTGCCCGGAAGAACGGCGAATGATGTCAAGAACTACTGGAACTGTCATCTCAGCAAGAAGCTGAGTGTCAAACAGATTGGCACCGGTTCCGGGGAGAACACCAACATCAGAACCATCCAGGTTAAGGAGACCCAGCAGCCTCTAGACCTCAGTGGCATTGTTTCCCTGAGATCAGGTGGGAGAACTTGTCTAGAAGAGGCCCTGACTTATTACCCTCAATTGCCTCAATTGGCGCCGCCACCTCCAGAAATCGGAGCCTCGACCCAGTTCCTCGGAGTCCAAGATTGGGAAGAGCTCCGGTACGAGGAGAAGAAGGGTGCCCCAGCTGAAGAAAATGGCATTGTTCTCGGAGACCTGCCATCGGATTTCCAGCTAGATGAGGTCAGAGCGGACGGGTTCGGAAGCAACAAGCTGAGGTGGGACTGGGATGACCTGTTCATGGACATGGATCTGTGGAACAGTACCTTGTAA; > LiEGL3r (SEQ ID NO.3): > LiEGL3w (SEQ ID NO.4): >proDFRr(SEQ ID NO.5): >proDFRw(SEQ ID NO.6):

[0017] This invention, through the following steps, identified and cloned the promoters of the LiMYB75L, LiEGL3, and LiDFR genes of Lagerstroemia indica, and conducted functional studies: 1. The transcriptomes of four flower colors were explored, and differentially expressed genes LiMYB75L and LiEGL3, which may be involved in the regulation of crape myrtle flower color, were obtained.

[0018] 2. Two crape myrtle varieties with different flower colors, 'Baiyun Yingxia' (abbreviated as 'BYYX', with white petals and its gene suffix 'w') and 'Guoqi Hong' (abbreviated as 'GQH', with bright red petals and its gene suffix 'r'), had their LiMYB75L, LiEGL3, and LiDFR gene promoters (abbreviated as proDFR) cloned. Through evolutionary analysis of the genes, their identities and names were determined.

[0019] 3. Using a TRV virus-induced gene silencing system, the expression of LiMYB75L and LiEGL3 was downregulated in flower petals, respectively.

[0020] 4. Annotate tobacco display cells with the GFP-LiMYB75L and GFP-LiEGL3 fusion genes to study the subcellular localization of LiMYB75L and LiEGL3 proteins.

[0021] 5. Through yeast two-hybrid experiments, it was demonstrated that LiMYB75L and LiEGL3 interact in yeast cells.

[0022] 6. The interaction and subcellular localization of LiMYB75L and LiEGL3 in plant cells were demonstrated by bimolecular fluorescence complementation (BIFC) experiments.

[0023] 7. The promoters of the DFR gene in the two varieties 'BYYX' and 'GQH' were cloned, and proDFRw and proDFRr were obtained respectively.

[0024] 8. The two promoters were constructed into the yeast one-hybrid vector pAbAi and then transferred into yeast strains to form transgenic yeast.

[0025] 9. The interaction between LiMYB75L and LiEGL3 and the proDFR promoter was verified by yeast one-hybrid experiments.

[0026] 10. ProDFRw and proDFRw were constructed into plant expression vectors, and LiMYB75L and LiEGL3 were demonstrated to regulate the expression of the DFR gene in plants through transient transformation of tobacco.

[0027] Based on our findings, the LiMYB75L and LiEGL3 genes can be applied to molecular breeding for modifying flower color in Lagerstroemia indica.

[0028] This invention aims to clarify the allelic variations and functions of LiMYB75L and LiEGL3 in crape myrtle varieties with different flower colors. Phylogenetic trees constructed using cloned genes show that the LiMYB75L and LiEGL3 genes obtained in this invention have not been previously reported in crape myrtle. Through a virus-induced gene silencing system, the expression of LiMYB75L and LiEGL3 genes was silenced in crape myrtle, resulting in lighter petal color. Yeast two-hybrid and bimolecular fluorescence complementary assays (BIFC) demonstrated the in vivo interaction between LiMYB75L and LiEGL3, further mediated by the promoters of downstream genes (…). LiDFR The reporter gene LUC enzyme activity assay driven by LiMYB75L showed that LiMYB75L alone can activate reporter gene expression. Although the addition of LiEGL3 alone has a certain inhibitory effect, the upregulation of reporter gene expression after the co-addition of LiMYB75L and LiEGL3 is much greater than that after the addition of LiMYB75L alone. Yeast one-hybrid experiments showed that LiMYB75L activation of DFR gene expression requires the binding of LiEGL3 to the promoter. Based on these studies, we believe that LiMYB75L and LiEGL3 can be further applied to molecular breeding of crape myrtle flower color.

[0029] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This invention adds regulatory factors to control the color of crape myrtle flowers, providing exclusive genetic resources for the breeding of crape myrtle flower color.

[0030] 2. This invention reveals that the LiMYB75L-LiEGL3 transcription factors have a synergistic effect, enhancing gene expression. This synergy is achieved through LiEGL3 directly binding to the promoter of the LiDFR gene, and through the physical interaction between LiMYB75L and LiEGL3. In the tobacco transient transduction system, the co-addition of LiMYB75L-LiEGL3 increased reporter gene activity by more than 50% in safflower compared to adding LiMYB75L alone, but the improvement was not significant in white flowers, indicating that the enhancement effect of LiMYB75L-LiEGL3 is variety-specific.

[0031] 3. This invention provides a promoter for the efficient expression of the LiDFR gene. In this invention, we found that the activity of the pro-LiDFRr promoter from safflower is twice that of the pro-LiDFRw promoter from white flower, providing endogenous gene resources for further improvement of the flower color of crape myrtle.

[0032] 4. This invention has the potential for cross-species application. The genetic resources of this invention were obtained from Lagerstroemia indica, and their function in Lagerstroemia indica was verified through a virus-induced gene silencing system. Simultaneously, we also demonstrated using a transient transformation system from tobacco that LiMYB75L, alone or in combination with LiEGL3, can function, and that this system is conserved in multiple plants. Therefore, this invention has the potential for cross-species application. Attached Figure Description

[0033] Figure 1 Evolutionary analysis of the MYB gene and sequence characteristics of LiMYB75L: (A) Evolutionary analysis diagram of the MYB gene; (B) Comparative analysis of multiple sequences of the amino acid sequence encoded by the LiMYB75L gene; Figure 2 Evolutionary analysis of the bHLH gene in subfamily III f; Figure 3 The expression of LiEGL3r and LiEGL3w during the flowering period of the four flower colors; Figure 4 Multiple sequence alignment of LiEGL3 and LfibHLH1; Figure 5 Positive regulation of anthocyanin synthesis in crape myrtle petals by LiMYB75L and LiEGL: (A) Construction of the pTRV2 vector; (B) Downregulation LiMYB75L and LiEGL3 Phenotype after gene expression, Bar = 2 cm; (CE) represents the CIELab value. L* , a* and b* Value; (F) Total anthocyanin content in petals; (G) Relative expression of LiMYB75L in silent lines; (H) Expression of anthocyanin pathway genes in LiMYB75L silent lines; (I) Relative expression of LiEGL3 in silent lines; (J) Expression of anthocyanin pathway genes in LiEGL3 silent lines. Figure 6 Subcellular localization of LiMYB75L and LiEGL3; Figure 7 For yeast two-hybrid experiments; Figure 8 For BIFC experiments; Figure 9 Cis-component analysis of red and white flower DFR promoters; Figure 10To investigate the synergistic positive regulation of LiDFR transcription by LiEGL3 and LiMYB75L: (A) yeast one-hybrid assay; (B) transcription factor and promoter construction; (C) Promter-LUC assay; (D) promoter partitioning validation. Mean ± SD, n ≥ 3, one-way ANOVA. p ≤ 0.05. Detailed Implementation

[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0035] Example 1: Identification of LiMYB75L, a transcription factor related to anthocyanin synthesis in Lagerstroemia indica. 1. Screening of candidate genes Based on the transcriptome data of petals from four flower colors (red, pink, purple, and white) of Lagerstroemia indica that have been sequenced, and using the white-flowered variety as a control, differentially expressed genes that were significantly overexpressed in red, pink, and purple flowers were screened. Emphasis was placed on transcription factor family members involved in the flavonoid biosynthesis pathway. The screened differentially expressed genes were compared with those in Arabidopsis thaliana (…). Arabidopsis thaliana Transcription factors involved in anthocyanin synthesis have been reported in [the literature]. AtMYB75 BLAST homology comparison was performed. Candidate genes belonging to the R2R3-MYB S6 subfamily and involved in anthocyanin regulation were screened out.

[0036] 2. Cloning of candidate genes in red and white crape myrtle varieties 2.1 Total RNA extraction and cDNA synthesis from crape myrtle petals The red-flowered crape myrtle variety 'Guoqi Hong' (GQH, bright red petals) and the white-flowered crape myrtle variety 'Baiyun Yingxia' (BYYX, white petals) were selected as materials. Total RNA was extracted from the petals at the bud stage and full bloom stage, respectively. The extraction method was performed according to the FastPure UniversalPlant Total RNA Isolation Kit (Vazyme) instructions. The integrity of RNA was detected by 1% agarose gel electrophoresis, and the mass concentration of total RNA was determined using a NanoDrop micro-spectrophotometer (Thermo Fisher Scientific 5225 VeronaRd). The RNA was stored at -80 °C for later use. cDNA was synthesized using the HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme) according to the manufacturer's instructions. The product was diluted 5-fold and stored at -20 °C for later use.

[0037] 2.2 Primer Design and PCR Amplification Based on the candidate gene sequences obtained from transcriptome sequencing, specific primers were designed using Oligo 7.0 software to amplify the complete coding regions of the candidate genes. Primer sequences are shown in Table 1. The LiMYB75L gene sequences are shown in SEQ ID NO.1 and SEQ ID NO.2. Table 1 Primer sequences used for gene cloning

[0038] PCR reaction system (50 μL): 25 μL 2× Phanta Master Mix, 2 μL cDNA template, 2 μL each of forward and reverse primers (10 μmol / L), and ddH2O to a final volume of 50 μL. PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 1-2 min (adjust according to product length), for a total of 35 cycles; final extension at 72℃ for 5 min; storage at 4℃. PCR products were detected by 1% agarose gel electrophoresis. After confirming the complete size of the amplified products, the target band was excised from the gel and purified using a gel extraction kit. Gene sequences obtained from red-flowered varieties were suffixed with "r", and gene sequences obtained from white-flowered varieties were suffixed with "w". After determining the concentration of the purified product, the purified product was ligated with the vector from the 5-minute TA / Blunt-Zero Cloning Kit (Nanjing Novizan, 5 min TA / Blunt-Zero Cloning Kit, catalog number C601-01) at 25°C for 5 minutes. The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing ampicillin (500 μg / mL), and incubated overnight at 37°C. Single colonies from the transformed plates were picked with a sterile toothpick as templates for positive colony identification. Three to four correctly identified positive colonies were selected for culture by shaking, and plasmids were extracted according to the instructions of the plasmid extraction kit and sent to a sequencing company for bidirectional sequencing. Successfully sequenced plasmids were stored at -20°C.

[0039] 3. Identification and evolutionary analysis of candidate genes To analyze the nucleotide and amino acid variations of candidate genes in red and white crape myrtle, DNAMAN 9.0 software was used to perform alignment analysis on the cloned gene sequences. The NCBI CDD database was used for online alignment analysis of conserved domains of the candidate protein amino acid sequences. R2R3-MYB and bHLH, known to be involved in anthocyanin synthesis in other species, were downloaded from the database, and their full-length amino acid sequences were aligned using DNAMAN 9.0 software. A phylogenetic tree (neighbor-join method, bootstrap value set to 1000 replicates) was constructed using MEGA 11 software to analyze the phylogenetic relationships between proteins.

[0040] 3.1 Sequence characteristics and evolutionary analysis of LiMYB75L Full-length CDS, 723 bp in length and encoding 240 amino acids, were successfully cloned from both varieties. The sequence from the red-flowered variety is shown in SEQ ID NO.1, and the sequence from the white-flowered variety is shown in SEQ ID NO.2. Figure 1 As shown in Figure A, using the reported R2R3 MYB genes of the S6 and S4 subfamilies in plants as controls, phylogenetic analysis revealed that the differentially expressed R2R3-MYB genes screened in the transcriptome—F01_transcript_24292 and F01_transcript_24831—are allelic variations from red-flowered and white-flowered varieties of Lagerstroemia indica, respectively, and belong to the same branch as Arabidopsis thaliana AtMYB75 of the S6 subfamily and the published Lagerstroemia indica LfiMYB75 and LiMYB114. Multiple sequence comparison analysis of the encoded amino acid sequences showed that, as Figure 1 As shown in B, the published LfiMYB75 and LiMYB114 differ significantly in amino acid sequence from the LiMYB75L obtained in this invention. However, there is only a 3-amino acid difference between LiMYB75L-BYYX (SEQ ID NO.2) and LiMYB75L-GQH (SEQ ID NO.1), indicating they are allelic variations encoded at the same gene locus. Figure 1 At in AtMYB90: Arabidopsis thaliana Br in BrMYB4: Brassica rapa Md in MdMYB6: Malus domestica Ph in PhMYB27: Petunia hybrida Vv in VvMYB5A: Vitis vinifera Sl in SlMYB12: Solanum lycopersicum Lj in LjTT2a: Lotus japonicus Pp in PpMYB75: Prunus persica Li in LiMYB114: Lagerstroemia indica LfiMYB75 is a hybrid of common crape myrtle.

[0041] In RNA extraction and cDNA synthesis, except for the primers used for PCR (as listed in Table 2), the basic process is the same as that for cloning the MYB75L gene in Example 1. After sequencing, the following analyses were performed.

[0042] Table 2 Primers for LiEGL3 cloning

[0043] The results are as follows Figure 2As shown, the LiEGL3-BYYX (LiEGL3w) obtained in this invention has a higher similarity to the transcriptomes F01_transcript_6483 and F01_transcript_52741, and the LiEGL3-GQH (LiEGL3r) has the same sequence as F01_transcript_6751. Among these, Figure 2 Am in AmDEL: Antirrhinum majus; At in AtMYC1: Arabidopsis thaliana; Br in BrTT8: Brassica rapa; In in InBHLH1: Ipomoea nil; Ip in IpbHLH2 and IpbHLH1: Ipomoea purpurea; It in ItbHLH2: Ipomoea tricolor; Li in LibHLH2 GQH: Lagerstroemia indica; Md in MdbHLH3: Malus domestica; Os in OsRc, OsB1 and OsB2: Orzya sativa; Pf in PfMYC-RP: Perilla frutescens; Ph in PhJAF13: Petunia hybrida; Vv in VvMYCA1: Vitis vinifera; Zm in ZmLC: Zea mays. Figure 3 In the study, transcript F01_transcript_6751 showed significant expression differences, with the highest expression level in red-flowered varieties and almost no expression in white-flowered varieties. The CDS length of the gene corresponding to transcript F01_transcript_6751 is 2100 bp, encoding 699 amino acids. The LiEGL3r sequence cloned from the red-flowered variety is shown in SEQ ID NO.3, and the LiEGL3w sequence cloned from the white-flowered variety is shown in SEQ ID NO.4. Figure 3 WB: White petals; PB: Purple petals; DPB: Deep pink petals; RBud: Bright red petal buds; RB: Bright red petals.

[0044] To further clarify the evolutionary position of these two bHLH genes within the transcription factor family, phylogenetic analyses were performed on them and compared with bHLH proteins from the III f subfamily previously reported to be involved in plant anthocyanin synthesis. For example... Figure 4As shown, the gene corresponding to transcript F01_transcript_7112 is homologous to LifbHLH1, which has been reported to be involved in anthocyanin synthesis in Lagerstroemia indica leaves; while the gene corresponding to transcript F01_transcript_6751 is in the same subbranch as Arabidopsis thaliana AtEGL3, possessing the potential function of regulating anthocyanin synthesis with the MBW complex. Multiple sequence alignment of LiEGL3 sequences cloned from red-flowered and white-flowered varieties showed only a 4-amino acid difference, representing allelic variation at the same gene locus in different flower colors. The sequence from the red-flowered variety was named LiEGL3r (SEQ ID NO.3), and the sequence from the white-flowered variety was named LiEGL3w (SEQ ID NO.4).

[0045] Based on the results of sequence alignment, conserved domain analysis, and phylogenetic analysis: LiMYB75L is a homologous gene of Arabidopsis thaliana AtMYB75 in Lagerstroemia indica, belonging to the S6 subtribe of the R2R3-MYB family. The red-flowered variety is named LiMYB75Lr (SEQ ID NO.1), and the white-flowered variety is named LiMYB75Lw (SEQ ID NO.2). LiEGL3 is a homolog of AtEGL3 in Arabidopsis thaliana from Lagerstroemia indica. It belongs to the bHLH family III f subtribe. The one derived from the red-flowered variety is named LiEGL3r (SEQ ID NO.3), and the one derived from the white-flowered variety is named LiEGL3w (SEQ ID NO.4).

[0046] Example 3: Virus-induced gene silencing (VIGS) to verify the function of LiMYB75L and LiEGL3 genes 1. Plant material cultivation Using semi-lignified branches of the current year's growth of Black Diamond® Blush™ crape myrtle, 15cm cuttings were taken and propagated. Water was applied during the propagation process. Once roots developed and new shoots appeared, slow-release fertilizer (1% by weight of soil) was applied. After flower buds appeared, a 0.2% potassium dihydrogen phosphate solution was sprayed once a week. Experiments were conducted when a large number of flower buds appeared and one or two flowers were able to bloom. Each treatment consisted of three replicates, with three plants used in each replicate.

[0047] 2. Construction of the Silent Carrier Select LiMYB75L and LiEGL3Specific fragments (200-400 bp) of non-conserved gene domains were used as silencing targets. The pTRV2 vector was linearized by double digestion with restriction endonucleases EcoRI and SacI. The digestion reaction system (50 μL) consisted of: pTRV2 vector plasmid ≤1 μg, EcoRI (NEB) and SacI (NEB) 1 μL each, 10× CutSmart Buffer 5 μL, and ddH2O to a final volume of 50 μL. Digestion was carried out at 37℃ for at least 3 h. After detection by 1% agarose gel electrophoresis, the linearized vector was recovered from the gel. Specific primers were designed based on the target fragment sequence (Table 3). Using cDNA from LiMYB75Lr (SEQ ID NO.1) and LiEGL3r (SEQ ID NO.3) as templates, the specific fragment was amplified (PCR system and procedure were the same as in Example 1). After gel purification of the PCR products, the amplification products were ligated into a double-digested pTRV2 linearized vector using a 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit (e.g., ...). Figure 5 (As shown in A). The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing kanamycin (50 mg / L), incubated overnight at 37°C. Positive single clones were picked for colony PCR verification and sent to a sequencing company (Suzhou Genewiz Biotechnology Co., Ltd.) for sequencing verification. The correctly sequenced recombinant plasmids were named pTRV2-LiMYB75L and pTRV2-LiEGL3. The constructed recombinant plasmids pTRV2-LiMYB75L, pTRV2-LiEGL3, and the empty vectors pTRV2 (empty vector control) and pTRV1 were transformed into *Agrobacterium* GV3101 (pSoup-p19) competent cells, respectively. Positive single clones were picked for colony PCR verification (PCR system and procedure as in Example 1). Correctly identified positive *Agrobacterium* colonies were stored at -80°C for later use.

[0048] Table 3 Primer sequences used for constructing virus-induced gene silencing (VIGS) vectors.

[0049] 3. Agrobacterium infection methods (1) Agrobacterium containing pTRV1, pTRV2 empty vector, pTRV2-LiMYB75L, and pTRV2-LiEGL3 were streaked on LB solid medium (containing 50 mg / L Kan and 25 mg / L Rif) for activation and cultured at 28°C for 2 days.

[0050] (2) Pick single colonies and place them into 5 mL of LB liquid medium (containing 50 mg / L Kan and 25 mg / L Rif), and incubate overnight at 28°C and 220 r / min. Take 200 μL of Agrobacterium suspension and inoculate it into 20 mL of induction LB liquid medium (containing 50 mg / L Kan, 25 mg / L Rif, 200 μM acetylsalicylic acid, 10 mM MES, pH=5.6), and incubate overnight at 28°C and 220 r / min for 12-16 h.

[0051] (3) Shake the overnight bacterial culture to OD. 600 When the OD value was 1.0, the bacterial cells were collected by centrifugation at 5000 r / min for 8 min. The cells were resuspended in infection buffer (10 mM MES, 10 mM MgCl2, 200 μM acetylsylcholine) and the OD value was adjusted. 600 Adjust the concentration to 0.8-1.0. A 1:1 volume ratio of pTRV1 and pTRV2 empty vectors was used as the control group (VC). A 1:1 volume ratio of pTRV1 and pTRV2-LiMYB75L was used as the LiMYB75L silencing experimental group. A 1:1 volume ratio of pTRV1 and pTRV2-LiEGL3 was used as the LiEGL3 silencing experimental group. After mixing, the mixture was incubated in the dark at room temperature for 2-4 hours to obtain the infection solution.

[0052] (4) Use a needle to make incisions at the tips of the first 1-3 internodes of the new shoots of the crape myrtle black diamond flower buds. Use a 1ml syringe to slowly inject the bacterial solution into the wounds. Then immerse the entire shoot in the infection solution for 1-2 minutes. Perform this operation on all shoots with flower buds on the entire plant. After injection and infection, place the plant in a vacuum desiccator and evacuate to 0.08 MPa for 5 minutes. Then, incubate in the dark for 24 hours, and then transfer to a greenhouse for cultivation at a temperature of 18-24℃ and a light exposure time of 16 hours. Observe the color changes of the flower buds and petals during development regularly. When the petals are fully opened and the color difference between the experimental group and the control group is obvious, take pictures and record the phenotype.

[0053] Experimental results are as follows Figure 5 As shown in B: Compared with the pink petals of the empty control (pTRV-VC-1 and pTRV-VC-2), the petals of the LiMYB75L silenced lines (pTRV-MYBi-2 and pTRV-MYBi-3) and the LiEGL3 silenced lines (pTRV-EGL3i-2 and pTRV-EGL3i-3) were white or light pink, indicating that silencing LiMYB75L or LiEGL3 resulted in a reduction in the red color of the petals.

[0054] 4. Flower color phenotypic determination This experiment used a CS-421 colorimeter (Zhejiang Caipu) to measure the L*, a*, and b* values ​​of petals in the control and experimental groups, respectively. L represents brightness (0 for black, 100 for white), a represents red-green saturation (+ for red, - for green), and b represents yellow-blue saturation (+ for yellow, - for blue). Three petals from the same plant were selected for data measurement, and the average value was used as the final flower color phenotypic data. After color difference measurement, petal samples from the control and experimental groups were immediately collected, flash-frozen in liquid nitrogen, and stored at -80℃ for later use. The samples were divided into two parts: one for anthocyanin content determination and the other for RNA extraction and gene expression analysis. The results of the flower color parameter measurements are shown below. Figure 5 As shown in C-5E: Compared with the control group, the petals of the LiMYB75L silent lines (MYBi-2, MYBi-3) and the LiEGL3 silent lines (EGL3i-2, EGL3i-3) showed... a* The values ​​all decreased significantly (p<0.01), brightness L* The value increases accordingly. b* The increased value further confirms the phenotypic changes of reduced red color and paler flower color.

[0055] 5. Anthocyanin content determination After color difference measurement, petal samples from the control and experimental groups were immediately collected, flash-frozen in liquid nitrogen, and stored at -80℃ for later use. Anthocyanin content was determined using the pH differential method, with the following steps: 0.2 g of petals were weighed, ground into powder using liquid nitrogen, and then 4 mL of acidic ethanol buffer (60% ethanol, diluted with 1 mol·L⁻¹) was added. -1 Adjust the pH to 3 with HCl and extract for ≥2 h. Centrifuge the extract at 8000 g for 10 min at 4℃ and collect the supernatant. Divide the supernatant into two equal parts and add buffer A (0.4 M KCl, pH=1.0) and buffer B (0.4 M citric acid, pH=4.5) respectively at a volume ratio of 1:9, and incubate at 40℃ for 20 min. Measure the absorbance at 510 nm and 700 nm using a microplate reader. The relative anthocyanin content is calculated as follows: ((A510-A700) × dilution factor / mg FW tissue) × 1000. Each sample was replicated 3 times biologically and 3 times technically. The anthocyanin content determination results are as follows: Figure 5 As shown in Figure F: Anthocyanin accumulation was normal in the control pTRV-VC, while the anthocyanin content in the LiMYB75L-silenced lines (MYBi-2, MYBi-3) was significantly reduced (p<0.001), and the anthocyanin content in the LiEGL3-silenced lines (EGL3i-2, EGL3i-3) was also significantly reduced (p<0.01), but the reduction was weaker than that in the LiMYB75L-silenced lines. These results indicate that silencing both LiMYB75L and LiEGL3 leads to the inhibition of anthocyanin biosynthesis in Lagerstroemia indica, and their contributions to this metabolic pathway differ significantly, with LiMYB75L playing a more significant role.

[0056] 6. Silent Efficiency Detection Total RNA was extracted from petal samples flash-frozen in liquid nitrogen and reverse transcribed to synthesize cDNA. Real-time quantitative PCR was performed using the UltraSYBR Mixture (CWBIO) kit (primer sequences are shown in Table 4). First, using the internal control gene LiActin as a control, the relative expression level of the target gene was detected to verify the VIGS silencing effect. For samples confirmed to have been successfully silenced (significantly reduced target gene expression), the same cDNA template was used to detect the relative expression levels of key structural genes in the anthocyanin synthesis pathway (EGL3, ...). CHS , CHI , F3H , F3'H , F3'5'H , DFR , ANS and UFGT This study investigated the effects of target gene silencing on the expression of structural genes in the anthocyanin biosynthesis pathway and their function in flower color formation by analyzing the changes in the expression of downstream structural genes after target gene silencing. —△△Ct The relative expression levels of each gene were calculated. Using the control group as a baseline (set as 1), the silencing efficiency of the target gene and the relative expression levels of downstream structural genes were analyzed. Each sample was tested in triplicate, and data are expressed as mean ± standard deviation.

[0057] qRT-PCR test results are as follows Figure 5 G and Figure 5 As shown in Figure I: Compared with the empty vector control, the expression level of the LiMYB75L gene was significantly downregulated in the LiMYB75L silencing lines (MYBi-2, MYBi-3) (p<0.001), and the expression level of the LiEGL3 gene was also significantly downregulated in the LiEGL3 silencing lines (EGL3i-2, EGL3i-3) (p<0.001). The differences between each silencing line and the control were statistically significant, confirming that the VIGS system successfully downregulated the expression of the target genes.

[0058] 7. Structural gene expression analysis To investigate the molecular basis of LiMYB75L and LiEGL3 regulation of anthocyanin synthesis, eight structural genes in the anthocyanin synthesis pathway in their silenced lines were examined. CHS, CHI, F3H, F3'H, F3'5'H, DFR, ANS, UFGT The expression changes of ). For example Figure 5 As shown in H, in the LiMYB75L silent line: in the MYBi-2 line, CHS, CHI, F3'5'H, DFR, ANS, UFGT All genes were significantly downregulated (p<0.01), F3H showed no significant change, while F3'H was unexpectedly upregulated; in the MYBi-3 line, all structural genes showed a downregulated trend, consistent with the petal fading phenotype. Figure 5As shown in J, in the LiEGL3 silent strain: F3H, F3'H and UFGT All three genes were significantly downregulated (p<0.05), indicating that LiEGL3 positively regulates these three genes; F3'5'H, DFR, ANS LiEGL3 was significantly upregulated in the silent lines (p<0.05), especially in the EGL3i-3 line, indicating that LiEGL3 may have a negative regulatory effect on these genes or have a compensatory regulatory mechanism. CHS and CHI were moderately downregulated or showed no significant changes in the silent lines, indicating that LiEGL3 has a weak regulatory effect on early synthetic genes.

[0059] The VIGS experimental results above indicate that both LiMYB75L and LiEGL3 positively regulate the biosynthesis of anthocyanins in Lagerstroemia indica, but their regulatory patterns and contributions differ: LiMYB75L has a broad positive regulatory effect on structural genes in the anthocyanin synthesis pathway, while the regulatory effect of LiEGL3 is more complex, affecting only some structural genes (such as...). F3'5'H, DFR, ANS It has a negative regulatory effect or a compensation mechanism.

[0060] Table 4 Primer sequences used for real-time quantitative PCR detection

[0061] The references for structural gene qPCR primers are as follows: Feng L, Shen P, Chi X, et al. The anthocyanin formation of purpleleaf is associated with the activation of LfiHY5 and LfiMYB75 in crape myrtle[J]. Horticultural Plant Journal, 2024, 10(5): 1230-1246. Yu C, Lian B, Fang W, et al. Transcriptome-based analysis reveals that the biosynthesis of anthocyanins is more active than that of flavonolsand proanthocyanins in the colorful flowers of lagerstroemia indica[J]. Biologia Futura, 2021, 72(4): 473-488.

[0062] Example 4 Subcellular localization analysis of LiMYB75L and LiEGL3

[0063] 1. Construction of subcellular localization vectors The subcellular localization vector was pCAMBIA2300-N-eGFP (http: / / www.cambia.org.au) (hereinafter referred to as p2300-eGFP), which carries the green fluorescent protein (GFP) reporter gene. Based on the vector's multiple cloning site, [the following was selected]. Xba I and BamH Linearization was achieved by double digestion at both restriction sites. The double digestion reaction system (50 μL) consisted of: ≤1 μg of p2300-eGFP empty vector plasmid, 1 μL each of restriction endonucleases Xba I (Takara) and BamHI (Takara), 5 μL of 10× Universal Buffer, and ddH2O to a final volume of 50 μL. Digestion was carried out at 37℃ for at least 3 h. The digestion products were then analyzed by 1% agarose gel electrophoresis, and the linearized vector was recovered from the gel.

[0064] Gene-specific primers were designed based on the restriction enzyme sites (Table 5). Using cDNA from LiMYB75Lr (SEQ ID NO.1) and LiEGL3r (SEQ ID NO.3) as templates, the complete coding region of the target gene was amplified (system and procedure were the same as in Example 1). After gel purification, the PCR products were ligated into a double-digested p2300-eGFP linearized vector using a 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit. The ligation products were transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing kanamycin (50 mg / L), and incubated overnight at 37°C. Positive single clones were picked for colony PCR verification and sent to a sequencing company for bidirectional sequencing. The correctly sequenced recombinant plasmids were named 35S::eGFP-LiMYB75L and 35S::eGFP-LiEGL3.

[0065] Table 5 Primer sequences used for subcellular localization vector construction

[0066] 2. Agrobacterium-mediated transformation and transient expression in tobacco The correctly sequenced 35S::eGFP-LiMYB75L, 35S::eGFP-LiEGL3 recombinant plasmids, p2300-eGFP empty plasmid (hereinafter referred to as 35S::eGFP), and nuclear localization marker plasmid (pCAMBIA2300-mCherry-H2B, hereinafter referred to as 35S::mCherry-H2B) (http: / / www.cambia.org.au) were transformed into Agrobacterium GV3101 (pSoup) competent cells according to the manufacturer's instructions. Positive single colonies were picked and inoculated into LB liquid medium containing kanamycin (50 mg / L) and rifampin (25 mg / L), and cultured overnight at 28°C with shaking at 220 r / min. After identifying positive Agrobacterium colonies, the bacterial culture was stored at -80°C. 200 μL of Agrobacterium-positive culture containing the recombinant plasmid was inoculated into 20 mL of LB liquid medium (containing 50 mg / L Kana and 25 mg / L Rif) and cultured at 28℃ with shaking at 220 r / min for 12–20 h. After culture, the bacterial cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in ddH2O, washed again by centrifugation, and then resuspended in infection buffer (10 mM MMEs, 10 mM MgCl2, 200 μM acetylsyl syringone) and the OD was adjusted. 600 =0.7. The 35S::eGFP empty vector, 35S::eGFP-LiMYB75L, and 35S::eGFP-LiEGL3 were gently mixed with the nuclear localization marker 35S::mCherry-H2B at a 1:1 volume ratio and incubated in the dark for 2-4 hours. Then, 0.5 ml of the mixture was injected into well-grown *Nicotiana benthamiana* (Nicotiana benthamiana) at approximately 4 weeks of growth. Nicotiana benthamiana In the leaves. After injection, the cells were cultured in the dark for 24 h, and then cultured under normal light for 2 days.

[0067] 3. Observation using a laser confocal microscope Three days after injection, tobacco subepidermal cells were harvested and slides were prepared. Images were acquired using a Nikon AXR NSPARC super-resolution laser confocal microscope with GFP fluorescence excitation at 488 nm and mCherry fluorescence excitation at 587 nm. Cell morphology under GFP fluorescence, mCherry fluorescence, and bright field conditions was observed, and the images were then merged.

[0068] Experimental results are as follows Figure 6As shown: In tobacco leaf cells transformed with the control 35S::eGFP empty vector, GFP fluorescence was distributed throughout the entire cell (cytoplasm and nucleus). However, in tobacco leaf cells transformed with 35S::eGFP-LiMYB75L and 35S::eGFP-LiEGL3, the GFP fluorescence completely overlapped with the red fluorescence of the nuclear localization marker (35S::mCherry-H2B), indicating that both LiMYB75L and LiEGL3 proteins are localized in the nucleus and interact with LiTTG1-2 to form a ternary complex, which meets the requirement for transcription factors to localize to the nucleus to exert their function. Figure 6 In the middle: from top to bottom, the images show control GFP, GFP-LiMYB75L co-injected with mCherry-H2B, and GFP-LiEGL3 co-injected with mCherry-H2B. All genes are driven by the 35S promoter. From left to right: GFP fluorescence (488 nm), mCherry fluorescence (525 nm), bright-field cell morphology image, and overlay image (Merge). Bar = 20 μm.

[0069] Example 5: Yeast two-hybrid verification of protein interactions 1. Construction of bait carriers and prey carriers Using cDNAs of LiMYB75Lr (SEQ ID NO.1), LiMYB75Lw (SEQ ID NO.2), LiEGL3r (SEQ ID NO.3), and LiEGL3w (SEQ ID NO.4) as templates, they were cloned into yeast expression vectors using homologous recombination. Based on the multiple cloning site of the vectors, the pGADT7 vector was linearized by double digestion with NdeI and XhoI, and the pGBKT7 vector was linearized by double digestion with NdeI and PstI. Specific primers (Table 6) were designed to amplify the complete coding region of the target gene (system and procedure were the same as in Example 1). After gel purification of the PCR products, LiMYB75L and LiEGL3 were cloned into the pGADT7 vector (bait vector) using a 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit to obtain recombinant plasmids pGADT7-LiMYB75L and pGADT7-LiEGL3, respectively; LiEGL3 and LiTTG1-2 were cloned into the pGBKT7 vector (prey vector) to obtain recombinant plasmids pGBKT7-LiEGL3 and pGBKT7-LiTTG1-2. The ligation products were transformed into *E. coli* DH5α, and positive single clones were selected for colony PCR verification. The colonies were then sent to a sequencing company for bidirectional sequencing to verify sequence accuracy.

[0070] Table 6 Primer sequences used for yeast two-hybrid vector construction

[0071] 2. Yeast Transformation and Interaction Detection The recombinant plasmid was transformed into Y2H Gold yeast competent cells using the PEG / LiAc method, following the manufacturer's instructions. Co-transformation was performed using the following combinations: Positive control: pGADT7-T + pGBKT7-p53; Negative control: pGADT7-T + pGBKT7-Lam; Self-activation control: pGADT7 empty vector + pGBKT7-LiEGL3, pGADT7-LiMYB75L + pGBKT7 empty vector; Experimental group: pGADT7-LiMYB75L + pGBKT7-LiEGL3 (Note that LiMYB75L and LiEGL3 represent two allelic variants from red and white flowers, respectively). The transformed yeast cells were plated on SD / -Trp / -Leu double-deficient solid medium and cultured at 30°C for 3 days. Single colonies were selected for identification of recombinant yeast. Colony PCR was performed using primers pGAD T7 Sequencingprimer-F / 3' AD Sequencing Primer R (Clontech, catalog number 630442) and pGBK T7 Sequencingprimer-F / 3' BD Sequencing Primer R (Clontech, catalog number 630489). Due to the thick yeast cell wall, the pre-denaturation time was extended to 10 min, with the remaining procedures the same as in Example 1. For correctly identified positive recombinant yeast, single colonies were inoculated into SD / -Trp / -Leu liquid medium and cultured at 30°C with shaking at 220 r / min for 12-16 h until the bacterial culture reached OD. 600 Reached version 1.0.

[0072] The bacterial suspension was diluted 1, 10, 100, 1000, and 10000 times, respectively. 10 μL of the suspension was spotted onto the following culture media: SD / -Trp / -Leu medium (for screening co-transformants), SD / -Trp / -Leu / -His / -Ade medium (four-deficient medium, for screening interactions), and SD / -Trp / -Leu / -His / -Ade + X-α-gal medium (for colorimetric screening). After drying, the media were incubated at 30℃ for 3 days, and colony growth and colorimetric reactions were observed. If the co-transformed yeast grew on the four-deficient medium and the colonies turned blue, it indicated that the two proteins interacted in the yeast cells. The experimental results are as follows: Figure 7As shown: the positive control (pGADT7-T + pGBKT7-p53) grew normally and appeared blue on the four-deficient medium, while the negative control (pGADT7-T + pGBKT7-Lam) could not grow on the four-deficient medium. The self-activation controls also failed to grow on the four-deficient medium, indicating that the bait proteins lacked self-activation activity. In the experimental groups, pGADT7-LiMYB75L and pGBKT7-LiEGL3 could grow. Figure 7 In the Chinese text, AD-P53 is pGADT7-P53, BD-T is pGBKT7-T; BD-Lam is pGBKT7-Lam; AD-EV is pGAD-EV; BD-LiEGL3r is pGBKT7-LiEGL3r; AD-LiMYB75Lr is pGADT7-LiMYB75Lr; BD-LiEGL3r is pGBKT7-LiEGL3r; BD-LiEGL3w is pGBKT7-LiEGL3w; and AD-LiMYB75Lw is pGAD-LiMYB75Lw.

[0073] The above results indicate that there is an interaction between LiMYB75L and LiEGL3. Since the allele sequence similarity from red and white varietals is over 98.5%, and the interaction patterns are the same, it is believed that the LiEGL3-LiMYB75L complex is active in both red and white varietals.

[0074] Example 6: Bimolecular fluorescence complementation (BiFC) verification of protein interactions in plant cells

[0075] 1. Construction of BiFC vector Using cDNAs of LiMYB75Lr (SEQ ID NO.1) and LiEGL3r (SEQ ID NO.3) as templates, they were cloned into the BiFC expression vector using homologous recombination. Based on the multiple cloning site of the vector, the pSPYNE-35S vector (containing the N-terminal fragment of YFP) was... BamH I and KpnLinearization was performed using double enzyme digestion. The pSPYCE-35S vector (containing the C-terminal fragment of YFP) was linearized using Spe I and Cla I. Specific primers (Table 7) were designed to amplify the complete coding region of the target gene (system and procedure were the same as in Example 1). After gel purification of the PCR products, LiEGL3 was cloned into the pSPYNE-35S vector using a 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit to obtain the recombinant plasmid pSPYNE-LiEGL3; LiMYB75L was cloned into the pSPYCE-35S vector to obtain the recombinant plasmid pSPYCE-LiMYB75L. The ligation products were transformed into E. coli DH5α, and positive single clones were selected for colony PCR verification and sent to a sequencing company for bidirectional sequencing to verify the sequence correctness.

[0076] Table 7 Primer sequences used in this application for the construction of bimolecular fluorescence complementary (BiFC) vectors

[0077] 2. Transient expression and fluorescence observation in tobacco The correctly sequenced recombinant plasmids pSPYNE-LiEGL3 and pSPYCE-LiMYB75L, along with the empty vectors pSPYNE and pSPYCE, were transformed into Agrobacterium GV3101 (pSoup-p19) competent cells, according to the manufacturer's instructions. Positive single colonies were picked and inoculated into LB broth containing the appropriate antibiotics, and cultured overnight at 28°C with shaking at 220 rpm. After confirming the presence of positive Agrobacterium colonies, the bacterial culture was stored at -80°C. (Example 4: Agrobacterium culture preparation method, adjusting OD...) 600 =0.7. The bacterial culture was mixed with the nuclear localization marker (NLS-mCherry-H2B, hereinafter referred to as 35S::mCherry-H2B) at a volume ratio of 1:1:1 as follows: Negative Control 1: pSPYNE empty vector + pSPYCE-LiMYB75L + 35S::mCherry-H2B; Negative Control 2: pSPYNE-LiEGL3 + pSPYCE empty vector + 35S::mCherry-H2B; Negative Control 3: pSPYNE empty vector + pSPYCE empty vector + 35S::mCherry-H2B; Experimental Group: pSPYNE-LiEGL3 + pSPYCE-LiMYB75L + 35S::mCherry-H2B. After the mixed bacterial culture was allowed to stand in the dark for 2-4 hours, 0.5 ml was injected into well-grown *Nicotiana benthamiana* leaves after approximately 4 weeks. After injection, the cells were cultured in the dark for 24 hours, and then cultured under normal light for 3-4 days.

[0078] 3. Observation using a laser confocal microscope Three to four days post-injection, tobacco lower epidermal cells were harvested and slides prepared. Images were acquired using a Nikon AXR NSPARC super-resolution laser confocal microscope, with YFP fluorescence excitation at 513 nm and mCherry fluorescence excitation at 587 nm. YFP fluorescence, mCherry fluorescence, and cell morphology under bright field were observed separately, and the images were merged. The presence of YFP fluorescence signals in leaf cells co-injected with pSPYNE-LiEGL3 and pSPYCE-LiMYB75L, with the signal overlapping the red fluorescence of the nuclear localization marker, indicates an interaction between the two proteins within the plant cell nucleus.

[0079] Experimental results are as follows Figure 8 As shown: No YFP fluorescence signal was detected in the negative control group (YFP-N empty vector + YFP-C empty vector, YFP-N empty vector + YFP-C-LiMYB75L, YFP-N-LiEGL3 + YFP-C empty vector). In the experimental group (YFP-N-LiEGL3 + YFP-C-LiMYB75L), a significant YFP fluorescence signal was detected in the nuclei of tobacco leaf cells, and it completely overlapped with the red fluorescence of the nuclear localization marker (mCherry-H2B). This result further confirms the interaction between LiMYB75L and LiEGL3 in the plant cell nucleus. Figure 8 From top to bottom, the images show cell images with YFP fluorescence (488nm), mCherry fluorescence (525nm), bright field fluorescence, and merged (GFP / mCherry / Bright) fluorescence. From left to right, the images show co-injection of control YNE with YCE and mCherry-H2B, co-injection of YCE-LiMYB75r with mCherry-H2B and the mCherry-H2B gene, and co-injection of YCE-LiMYB75r + EGL3-YNE + mCherry-H2B gene. All genes are driven by the 35S promoter. Bar = 20 μm.

[0080] Example 7 Cloning and Sequence Analysis of the LiDFR Promoter

[0081] 1. Promoter cloning Genomic DNA was extracted from young leaves of the red-flowered cultivar 'Guoqi Hong' and the white-flowered cultivar 'Baiyun Yingxia' of Lagerstroemia indica using a plant genomic DNA extraction kit (Tiangen, DP305). DNA concentration and purity (A) were determined using a NanoDrop 2000 analyzer. 260 / A 280DNA integrity was detected by 1% agarose gel electrophoresis (between 1.8 and 2.0). Based on the LiDFR gene sequence obtained from transcriptome sequencing, specific primers were designed using Primer Premier 5.0 software (Table 8) to clone the promoter sequence approximately 2000 bp upstream of the LiDFR gene start codon ATG.

[0082] clone separately LiDFR The promoter sequence approximately 2000 bp upstream of the ATG start codon was obtained and sequenced. At least three independent clones were sequenced for each variety to ensure sequence accuracy. The promoter obtained from the safflower variety was named... proDFR r (SEQ ID NO.5), the promoter obtained from the white-flowered variety is named proDFR w (SEQ ID NO.6).

[0083] Table 8 Primer sequences used for LiDFR promoter cloning

[0084] PCR reaction system (50 μL): 25 μL 2× Phanta Master Mix, 2 μL genomic DNA template (approximately 100 ng), 2 μL each of forward and reverse primers (10 μmol / L), and ddH2O to a final volume of 50 μL. PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; final extension at 72℃ for 5 min. PCR products were detected by 1% agarose gel electrophoresis, and the target band was recovered by gel excision.

[0085] The purified PCR product was ligated into the pMD18-T vector (Takara). The ligation mixture consisted of 4 μL of PCR product, 1 μL of pMD18-T vector, and 5 μL of Solution I, and was incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing ampicillin (100 μg / mL), and incubated overnight at 37°C. Positive single clones were picked for colony PCR verification. Three independent clones from each strain were sent to a sequencing company for bidirectional sequencing to ensure sequence accuracy.

[0086] Sequencing results showed that the LiDFR promoter sequence cloned from the red-flowered variety 'Guoqi Hong' was 2119 bp in length and named proDFRr (SEQ ID NO.5); the LiDFR promoter sequence cloned from the white-flowered variety 'Baiyun Yingxia' was 2114 bp in length and named proDFRw (SEQ ID NO.6).

[0087] 2. Promoter sequence alignment and cis-acting element analysis Using DNAMAN 9.0 software to... proDFR r and proDFR Sequence alignment was performed to analyze the differences in promoter sequences between red and white flower varieties. Cis-regulatory elements were predicted for the two promoter sequences using the PlantCARE database, with a focus on the distribution of MYB transcription factor binding sites (MRE) and bHLH transcription factor binding sites (G-box, MYC). Figure 9 As shown, both promoters contain binding sites for MYB and bHLH transcription factors, providing a structural basis for the direct regulation of LiDFR gene expression by the LiMYB75L-LiMYC1 transcriptional complex. The MYB binding sites (including MYB, MYB-like, MRE, and Myb) are essentially the same in both the red and white flower promoters. The bHLH binding sites (including MYC and G-box) are unevenly distributed between the red and white flower promoters; the white flower promoter has one more MYC element at the distal promoter than the red flower promoter, while the red flower promoter gains an additional G-box element due to a 9 bp insertion, increasing its total number of G-boxes to 9. This insertion is located in the proximal core region of the promoter (-201 bp to -209 bp).

[0088] Example 8: Analysis of the transcriptional regulation mechanism of the LiMYB75L-LiEGL3 complex on the LiDFR promoter 1. Yeast one-hybrid assay to verify the binding of transcription factors to the LiDFR promoter 1.1 Construction of the bait carrier Using the sequenced and verified pMD18-T-proDFRr and pMD18-T-proDFRw plasmids as templates, the full-length promoter sequence was amplified using specific primers with homologous arms (pAbAi-proDFRr-F1 / pAbAi-proDFRw-F1 and pAbAi-DFRpro-R, primer sequences are shown in Table 9) (conditions are the same as in Example 7). After gel purification, the PCR products were cloned into the target gene using the 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit. Hind III and Xho The linearized pAbAi reporter vector (Clontech) was double-digested with enzymes to obtain recombinant plasmids pAbAi-proDFRr and pAbAi-proDFRw. Sequencing was used to verify the sequence correctness.

[0089] The recombinant plasmids pAbAi-proDFRr and pAbAi-proDFRw were respectively subjected to... BstBThe NEB enzyme was linearized, and the purified linearized product was used to transform yeast Y1H-Gold competent cells using Yeastmaker™ Yeast Transformation System 2 (Clontech). The transformed bacterial culture was plated on SD / -Ura plates (Clontech) and incubated at 30°C for 2-3 days. Single clones were picked for colony PCR verification (under the same conditions as in Example 7) to screen for yeast bait strains containing pAbAi-proDFRr or pAbAi-proDFRw. The minimum abaminibrin (AbA) concentration for inhibiting self-activation was determined using a serial dilution plate assay. The bait strains were inoculated into SD / -Ura medium containing 0, 200, 250, 300, 350, 400, 450, and 500 ng / mL AbA and incubated at 30°C for 3 days. The results showed that the self-activation inhibition concentration for both proDFRr and proDFRw was 350 ng / mL AbA.

[0090] 1.2 Construction of the prey carrier Using the cDNA of LiMYB75Lr (SEQ ID NO.1) and LiEGL3r (SEQ ID NO.3), which were verified by sequencing, as templates, the complete coding region sequences were amplified using specific primers with homologous arms (pGADT7-LiMYB75L-F / pGADT7-LiMYB75L-R and pGADT7-LiEGL3-F / pGADT7-LiEGL3-R, primer sequences are shown in Table 9) (conditions are the same as in Example 1). After gel purification, the PCR products were cloned into the pGADT7 vector (Clontech) that had been linearized by double digestion with Nde I and Xho I using a 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO) homologous recombination kit to obtain recombinant plasmids pGADT7-LiMYB75L and pGADT7-LiEGL3. Sequencing was used to verify the sequence correctness.

[0091] Table 9 Primer sequences used for yeast one-hybrid vector construction

[0092] 1.3 Yeast Transformation and Interaction Detection pGADT7-LiMYB75L and pGADT7-LiEGL3 were transformed into yeast bait strains containing pAbAi-proDFRr or pAbAi-proDFRw, respectively. The transformation method followed the Yeastmaker™ Yeast Transformation System 2 instruction manual. A positive control (pAbAi-p53 + pGADT7-Rec-p53) and a negative control (pAbAi-p53 + pGADT7-Lam) were also established. The transformed yeast was plated on SD / -Leu / -Ura double-negative medium (Clontech) and incubated at 30°C for 2-3 days. Single colonies were picked and inoculated into SD / -Leu / -Ura liquid medium and cultured at 28°C with shaking at 200 rpm until OD500 was reached. 600 Approximately 0.1. 5 μL of bacterial culture was sampled and placed on SD / -Leu / -Ura double-deficient medium containing 350 ng / mL abscisic acid (AbA) and control medium (without AbA). The cultures were incubated at 30℃ for 3-5 days, and colony growth was observed. Experimental results are as follows: Figure 10 As shown in Figure A, the yeast strain transformed with LiMYB75L could not grow on medium containing AbA, while the yeast strain transformed with LiEGL3 could grow normally. This result indicates that LiMYB75L does not directly bind to the DFR promoter, while LiEGL3 can directly bind to the DFR promoter.

[0093] 2. Dual-luciferase reporter assay to verify transcriptional activation activity 2.1 Construction of promoter truncated fragments Based on the distribution of MYB and bHLH binding elements, the two types of promoters were divided into five truncated fragments (F1R~F2R2). Using pMD18-T-proDFRr and pMD18-T-proDFRw as templates, each truncated fragment was amplified using specific primers (primer sequences are shown in Table 10). After gel purification (under the same conditions as in Example 7), the PCR products were cloned into the pGreenII-0800-LUC vector, which had been linearized by double digestion with Kpn I and Xho I, using 2 × Ezmax® UltraUniversal CloneMix (TOLOBIO), to obtain the recombinant reporter plasmid. Sequencing was used to verify the sequence correctness.

[0094] Table 10 Primer sequences used for constructing dual-luciferase reporter vectors

[0095] 2.2 Construction of the effect vector Using cDNA from LiMYB75Lr (SEQ ID NO.1) and LiEGL3r (SEQ ID NO.3), which were verified by sequencing, as templates, the complete coding region sequence was amplified using specific primers with homologous arms (pWM101-LiMYB75L-F / pWM101-LiMYB75L-R and pWM101-LiEGL3-F / pWM101-LiEGL3-R, primer sequences are shown in Table 10) (conditions are the same as in Example 1). After gel purification, the PCR products were cloned into the pWM101 vector (containing a 35S promoter) that had been double-digested with Kpn I and Xba I using 2 × Ezmax® Ultra Universal CloneMix (TOLOBIO), obtaining the recombinant effect plasmids pWM101-LiMYB75L and pWM101-LiEGL3. Sequencing was used to verify the sequence correctness ( Figure 10 B). Among them, CmMYB6 is the MYB transcriptome factor in chrysanthemum, and serves as a positive control.

[0096] 2.3 Detection of transient tobacco conversion and luciferase activity 2.3.1 Agrobacterium-mediated transient transformation The reporter plasmid, effect plasmid, and empty vector (pWM101 empty vector as a control) constructed above were transformed into Agrobacterium GV3101 competent cells (carrying pSoup-p19 helper plasmid), respectively. The cells were plated on LB agar plates containing the corresponding antibiotics (hygromycin 25 mg / L + kanamycin 50 mg / L) and cultured at 28°C for 2 days. Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing the corresponding antibiotics) and cultured overnight at 28°C with shaking at 200 rpm. The next day, they were transferred to 50 mL of LB medium at a 1:100 ratio and cultured at 28°C with shaking at 200 rpm until OD (outlet count). 600 The concentration was set to 0.5. The bacterial cells were collected by centrifugation, resuspended in infection buffer (10 mM MgCl2, 10 mM MES, 200 μM acetylsalicylic acid, pH 5.6), and the OD was adjusted. 600 Adjust the pH to 0.6-0.8 and let it stand at room temperature for 2-3 hours.

[0097] Agrobacterium bacterial suspensions were mixed in the following combinations, with a reporter plasmid to effector plasmid ratio of 1:1 (volume ratio) in each combination: empty vector control: proDFRw or proDFRr + empty vector (VC); LiMYB75Lw + proDFRw from white flowers, and LiMYB75Lr + proDFRr from red flowers (reflecting the actual situation in vivo). Similarly, LiEGL3w and LiEGL3r also interact with their respective promoters. When the two transcription factors are combined, the promoters from red flowers correspond to the two alleles from red flower sources. 0.5 ml of the mixed bacterial suspension was injected into *Nicotiana benthamiana* (Tobacco Benzoinus) using the injection method. Nicotiana benthamiana Leaves were injected, with 3-4 leaves per tobacco plant, and 3 biological replicates were set up for each injection combination. After injection, the plants were placed in a culture room at 22-25℃ and cultured for 48-72 h under 16 h light / 8 h dark conditions.

[0098] 2.3.2 Luciferase activity detection Three days post-infection, leaf discs with a diameter of 2 cm were collected from the injection site using a punch and immediately frozen in liquid nitrogen. Luciferase activity was measured using a Dual-Luciferase® Reporter Assay System (Promega, E1980). The leaf discs were ground in passive lysis buffer (PLB), centrifuged at 12,000 rpm for 1 min, and the supernatant was collected. The luminescence values ​​of firefly luciferase (LUC) and kidney luciferase (REN) were sequentially detected using a Glomax 20 / 20 luminescence detector (Promega). The LUC / REN ratio was calculated and normalized to 1.0 with the proDFRw promoter activity co-transformed with the empty vector as a base. Three technical replicates were performed for each sample.

[0099] The results are as follows Figure 10 As shown in Figure C, after tobacco injection, the activity of the safflower promoter proDFRr was found to be approximately twice that of the white flower promoter proDFRw. The addition of LiMYB75L (representing two allelic variants) further activated LUC gene expression, approximately twice that of each individual promoter. However, the addition of LiEGL3s alone inhibited the expression of both promoters. But, the simultaneous addition of LiMYB75L and LiEGL3 synergistically enhanced the activity of both promoters. Given that in petals... LiMYB75L and LiEGL3 Simultaneous expression. Therefore, LiMYB75L and LiEGL3 synergistically promote expression in plants. DFR Gene expression.

[0100] 2.3.3 Further Validation of Differences in Promoter Activity To verify whether the difference in proDFRr and proDFRw activities is determined by differences in the promoter sequence itself, rather than a specific response of a particular transcription factor, the exogenous transcription factor CmMYB6 (a transcription activator that has been reported in chrysanthemum to positively regulate DFR genes) was used for verification. The full-length promoter reporter plasmids of proDFRr and proDFRw were co-transformed into Nicotiana benthamiana with the pWM101-CmMYB6 effector plasmid, respectively, using the same method as described in 2.3.1 of this example. The luciferase activity detection method was the same as described in 2.3.2 of this example. The experimental results are as follows: Figure 10 As shown in Figure D, regardless of the presence or absence of the CmMYB6 effector, the activity of proDFRr was significantly higher than that of proDFRw, and this difference persisted in the full-length promoter. This indicates that the fundamental activity difference between proDFRr and proDFRw is determined by their own sequence differences and is unrelated to the response of specific transcription factors.

Claims

1. A LiMYB75L gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A protein encoded by the LiMYB75L gene as described in claim 1.

3. A recombinant plasmid and a recombinant bacterium, characterized in that, It contains the LiMYB75L gene as described in claim 1.

4. A LiEGL3 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.

4.

5. A protein encoded by the LiEGL3 gene as described in claim 4.

6. A recombinant plasmid and a recombinant bacterium, characterized in that, It contains the LiEGL3 gene as described in claim 4.

7. A promoter for LiDFR, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.5 or SEQ ID NO.

6.

8. A recombinant plasmid and a recombinant bacterium, characterized in that, It contains the promoter as described in claim 7.

9. The application of the LiMYB75L gene of claim 1 and / or the LiEGL3 gene of claim 4, the encoded protein or recombinant plasmid, and the recombinant bacteria in the regulation of flower color in crape myrtle.

10. The application of the LiDFR promoter of claim 7 or the recombinant plasmid and recombinant bacteria of claim 8 in the regulation of flower color in Lagerstroemia indica.