Method for constructing a conditional overexpression zfp595 transgenic mouse model and applications thereof
Patent Information
- Application Number
- CN202610368088.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-24
- Publication Date
- 2026-06-23
Smart Images
Figure CN122256428A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of transgenic technology, and in particular to a method for constructing a conditionally overexpressing ZFP595 transgenic mouse model and its application. Background Technology
[0002] Zinc is an essential nutrient and a cofactor for many enzymes, participating in the metabolism of various biomolecules such as proteins, carbohydrates, nucleic acids, and lipids. It is well known that zinc plays a crucial role in the immune system, influencing both cellular and humoral immunity. Zinc finger proteins are an important class of zinc proteins, first discovered in the nucleus of the African clawed frog. They are transcription factors with finger-like domains, consisting of a series of repeating amino acids and cysteine or histidine residues spaced at specific intervals forming the functional domain, which contains Zn. 2+ The zinc finger gene (ZFP) family binds to its domains, recognizes and binds to nucleic acid sequences to regulate gene expression. Based on the number and order of cysteine (Cys) and histidine (His) residues in its zinc finger domains, it can be classified into C2H2, C8, C6, C3HC4, C2HC, C2HC5, C4, C3H, and C4HC3, with the C2H2 type being the most common. As an important class of transcription factors in the human body, the ZFP family plays a crucial role in various physiological processes through different molecular mechanisms, such as the regulation of keratinization, cell differentiation, muscle differentiation, and tumor stem cells. Simultaneously, abnormal expression of the ZFP family leads to various pathological processes, such as tumor development and progression, diabetes, skin diseases, and neurodegeneration. Particularly in tumor immunity, the ZFP family has a significant impact on cell proliferation, invasion and metastasis, the immune microenvironment, and targeted immunotherapy in various cancers such as colon cancer, breast cancer, lung cancer, and gastric cancer.
[0003] ZFP595 (Zinc Finger Protein 595, human gene name ZNF595), a member of the ZFP family, is a C2H2 type zinc finger protein. As a transcription factor, it can specifically bind to the cis-regulatory region of RNA polymerase II, regulating transcriptional activity. Current research reports significant differential expression of ZFP595 in tumors, but its role in immunity remains largely unexplored. Therefore, there is an urgent need to further investigate and explore the impact of ZFP595 on tumor immunity, potentially making it a novel biomarker for tumor diagnosis and prognosis, and a new molecular target for tumor immunotherapy. Currently, there is a pressing need for ZFP595 research in this field, and constructing animal models that conditionally overexpress ZFP595 is one of the main methods. Summary of the Invention
[0004] The purpose of this invention is to provide a method for creating a ZFP595 conditionally overexpressing transgenic mouse model. By using transgenic technology, a ZFP595 conditionally overexpressing mouse model is established to obtain a mouse model that can stably inherit and positionally express the ZFP595 protein.
[0005] This invention provides the following technical solutions:
[0006] In a first aspect, the present invention provides a method for constructing a conditionally overexpressing ZFP595 transgenic mouse model, comprising the following steps:
[0007] A homologous recombination vector containing the ZFP595 gene was constructed. This vector contains a 3.3 kb 5' homologous arm, CAG-LSL-Zfp595-HA-IRES-tdTomato-Wpre-pA, and a 3.3 kb 3' homologous arm.
[0008] Cas9 mRNA, gRNA and the homologous recombination vector were microinjected into recipient mouse zygotes to obtain F0 generation mice, which were then identified. The F0 generation mice that were identified as positive were mated with wild-type mice and backcrossed to obtain a mouse model that conditionally overexpresses ZFP595.
[0009] In the homologous recombination vector, there are two loxp between the ZFP595 gene sequence and the CAG promoter.
[0010] The ZFP595 gene sequence is shown in SEQ ID NO: 1.
[0011] The gRNA sequence is shown in SEQ ID NO: 2.
[0012] The identification method used is long-fragment PCR.
[0013] The primer sequences used in the long fragment PCR method are SEQ ID NO: 3 to SEQ ID NO: 6.
[0014] Secondly, the present invention provides the application of the above-mentioned construction method in specific overexpression in different tissues, organs and cells, and the mouse model constructed by the above-mentioned construction method is hybridized with the corresponding Cre mouse.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] The ZFP595 conditionally overexpressing mouse model constructed using the method provided in this invention can be hybridized with various Cre mice to achieve specific overexpression in different tissues, organs, and cells. This mouse can be used to study the function of the ZFP595 gene and can be applied to almost all ZFP595-related diseases, such as various tumors, neurodegenerative diseases, and immune-related diseases. Attached Figure Description
[0017] Figure 1 A schematic diagram illustrating the strategy for constructing transgenic mice that overexpress ZFP595;
[0018] Figure 2 This is a schematic diagram of the plasmid map of the ZFP595 homologous recombination vector;
[0019] Figure 3 Electrophoresis image for enzyme digestion identification of the ZFP595 homologous recombinant vector;
[0020] Figure 4 A schematic diagram of the identification strategy for F0 generation mice;
[0021] Figure 5 Electrophoresis image of F0 generation homologous recombination positive mice for PCR identification;
[0022] Figure 6 Electrophoresis images of PCR identification of the 5' and 3' homologous arms of F1 generation mice;
[0023] Figure 7 This is a schematic diagram illustrating the primer identification for short-fragment PCR in stable ZFP595 mice.
[0024] Figure 8 Electrophoresis image for subsequent stable genetic ZFP595 mouse short fragment PCR identification;
[0025] Figure 9 ZFP595-OE F / F CD8a-Cre + / - Mice and ZFP595-OE F / F Electrophoresis images of mouse PCR identification; The top image represents 12 mice that are all homozygous for ZFP595, with only a 410bp band amplified; The bottom left image shows 6 mice carrying CD8a-Cre, with 338 and 378bp bands amplified; The bottom right image shows 6 mice that do not carry CD8a-Cre, with no amplified band.
[0026] Figure 10 For Western blot detection of ZFP595-OE F / F CD8a-Cre + / - Mice and ZFP595-OE F / F mouse spleen CD8 +A schematic diagram illustrating the overexpression of ZFP595 in T cells. Detailed Implementation
[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.
[0028] This embodiment provides a method for constructing a conditionally overexpressing ZFP595 transgenic mouse model. The ZFP595 gene sequence is introduced into recipient mice to obtain a stable genetically inherited and ZFP595 overexpressing transgenic mouse model. The procedure is as follows: a homologous recombination vector containing the ZFP595 gene is constructed; Cas9 mRNA, gRNA, and donor vector (homologous recombination vector) are microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice; positive F0 generation mice are PCR amplified and sequenced to identify positive F0 generation mice, and then mated with C57BL / 6J mice to obtain positive F1 generation mice. The F1 generation mice are backcrossed with C57BL / 6J mice continuously until a transgenic mouse model with stable DNA levels is obtained, which is the conditionally overexpressing ZFP595 mouse model.
[0029] This model can be used to study the role of the ZFP595 gene in the pathogenesis of diseases, the discovery of new drug targets, and the evaluation of preclinical efficacy, and has significant clinical and scientific value.
[0030] Furthermore, the above construction method includes the following steps:
[0031] Cas9 mRNA and gRNA were obtained through in vitro transcription using CRISPR / Cas9 technology.
[0032] A homologous recombination vector containing the ZFP595 gene was constructed using a seamless cloning method. This vector contains a 3.3 kb 5' homologous arm, CAG-LSL-Zfp595-HA-IRES-tdTomato-Wpre-pA, and a 3.3 kb 3' homologous arm. There are two loxp between the ZFP595 gene sequence and the CAG promoter.
[0033] Cas9 mRNA, gRNA, and homologous recombinant plasmid (homologous recombinant vector) were microinjected into the nucleus of C57BL / 6 mouse zygote cells, and the target gene homologous recombinant plasmid was introduced into the pronucleus of the recipient mouse zygote via pronuclear microinjection, so that it was integrated with the mouse genome. As the cells continue to divide, each cell will carry the fragment. The ZFP595 transgenic mouse that was finally constructed was able to overexpress the ZFP595 protein under the action of Cre recombinase.
[0034] After pronuclear microinjection, F0 generation transgenic positive mice were obtained, and the first generation of ZFP595 transgenic positive mice born were called first-generation mice. Each first-generation mouse was treated as an independent strain for breeding, and tail clipping gene identification was performed on each first-generation mouse strain. After identifying the F0 generation transgenic positive mice, transgenic mouse models with stable inheritance of ZFP595 were screened to obtain them.
[0035] The identification method used is PCR.
[0036] The screening process includes: mating the identified F0 generation transgenic positive mice with C57BL / 6J mice to obtain F1 generation mice, and then backcrossing the F1 generation mice with C57BL / 6J mice continuously until a transgenic mouse model with stable DNA levels is obtained.
[0037] The nucleotide sequence of the ZFP595 gene is as follows (SEQ ID NO: 1):
[0038]
[0039] The nucleotide sequence of the gRNA is as follows (SEQ ID NO: 2):
[0040] GGGGACACACTAAGGGAGCTTGG .
[0041] The following specific examples will provide a detailed explanation.
[0042] (1) Construction of ZFP595 transgenic vector
[0043] The ROSA26 gene (ENSMUSG00000086429) is located on chromosome 6 and has no function. Sequence insertion at the ROSA26 site results in stable expression without affecting the mouse phenotype. The expression cassette CAG-LSL-Zfp595-HA-IRES-tdTomato-Wpre-pA was inserted at the Rosa26 gene locus, as shown in the attached image. Figure 1 As shown.
[0044] The steps for constructing the ZFP595 transgenic vector are as follows:
[0045] ① Fragment amplification: The DNA fragment ZFP595 was amplified from the synthetic plasmid, and the DNA fragment IRES-tdTomato was amplified from other plasmids containing IRES-tdTomato.
[0046] ② Fragment recovery: The PCR products were recovered by gel electrophoresis and purified using the Omega Gel Purification and Recovery Kit (catalog number: D2500-01), and the concentration was determined.
[0047] ③ Ligation and Transformation: The amplified DNA fragments of Zfp595 and IRES-tdTomato were ligated into the linearized R26-CAG-LSL-MCS-WPRE-polyA vector using Takara Infusion ligase and DH5α competent cells. The transformed strains were plated on Amp resistant plates and incubated overnight at 37°C.
[0048] ④ Cloning Identification: After transformation, single clones were selected for culture, and plasmids (Omega, catalog number: D6945-01) were extracted using a plasmid microextraction method. To verify the correctness of the constructed vector, the plasmid was digested with SacII for single-enzyme verification. The results showed four bands at 10127bp, 6379bp, 3663bp, and 528bp, consistent with the theoretical results. See details below. Figure 3 Confirm the correct cloned plasmid.
[0049] ⑤ Sequencing verification: After identifying the correct positive clone, the bacterial culture or plasmid is sequenced for verification.
[0050] ⑥ Plasmid extraction: Obtain a sufficient amount of high-purity transgenic plasmid.
[0051] Among them, the plasmid map of the ZFP595 homologous recombination vector is as follows: Figure 2 As shown.
[0052] (2) Prokaryotic microinjection of transgenic vector
[0053] Cas9 mRNA, gRNA, and transgenic plasmid were injected into the nucleus of C57BL / 6 mouse zygote cells, and the homologous recombinant plasmid of the target gene was introduced into the pronucleus of the recipient mouse zygote via pronuclear microinjection, allowing it to integrate with the mouse genome. As the cells continue to divide, each cell will carry the fragment, and the finally constructed ZFP595 transgenic mouse can overexpress the ZFP595 protein under the action of Cre recombinase.
[0054] (3) Identification of ZFP595 transgenic positive mice
[0055] F0 generation mice were obtained through microinjection. Genomic DNA was extracted from the tails of these mice, and their genotypes were identified by PCR. The identification protocol is as follows: Figure 4 As shown, a 3.4 kb fragment should be amplified from the 5' arm homologous recombination-positive genome, and a 5.1 kb fragment from the negative genome; a 3.6 kb fragment should be amplified from the 3' arm homologous recombination-positive genome, and a 6.5 kb fragment from the negative genome. The F0 generation mouse with positive homologous recombination in both arms is mouse number 2. The electrophoresis results for long-fragment PCR identification are shown below. Figure 5 As shown, the numbers represent the F0 generation mouse numbers, wt represents the wild-type control, and M represents the 1 kb DNA marker.
[0056] The 5' arm homologous recombination primers are:
[0057] Forward I (SEQ ID NO: 3): GCCGGGCCTCGTCGTCTG;
[0058] Reverse II (SEQ ID NO: 4): TGAGGGCAATCTGGGAAGGTT.
[0059] The 3' arm homologous recombination primers are:
[0060] Forward III (SEQ ID NO: 5): GGGGGAGGGGAGTGTTGC;
[0061] Reverse IV (SEQ ID NO: 6): TTCTTCCTGCCTGCCTTCTGTGAC.
[0062] The reaction system for two-arm homologous recombination PCR identification is detailed in Table 1, where KOD-Multi&Epi- is TOYOBO Code No: KME-101. The reaction conditions for two-arm homologous recombination PCR are detailed in Table 2.
[0063] Table 1. Two-arm homologous recombination PCR reaction system:
[0064]
[0065] Table 2. Reaction conditions for two-arm homologous recombination PCR:
[0066]
[0067] (4) Screening of ZFP595 transgenic positive mice
[0068] F0 generation positive mice (number 2) were crossed with wild-type C57BL / 6J mice to obtain F1 generation mice. Genotyping of F1 generation mice was performed by PCR and sequencing. The PCR identification strategy and methods for F1 generation mice were the same as those for F0 generation mice. The electrophoresis results of PCR identification of the 5' and 3' homologous arms of F1 generation mice are shown below. Figure 6 As shown, the numbers represent the F1 generation mouse numbers, wt represents the wild-type control, and M represents the 1kb DNA marker. The mice identified as positive by PCR were: numbers 1, 2, 4, 7, and 8. These five mice were then sequenced, and sequencing confirmed that all were positive. Sequencing of the PCR products from the F1 generation positive mice involved four sequencing reactions. The regions corresponding to the sequencing reactions are shown below. Figure 4 As shown. The 5' homologous arm identification and PCR product sequencing involved two sequencing reactions, labeled 1 and 2 respectively. The 3' homologous arm identification and PCR product sequencing also involved two sequencing reactions, labeled 3 and 4 respectively. Then, the F1 generation positive mice were repeatedly backcrossed with C57BL / 6J wild-type mice. Positive mice were screened by PCR. After three consecutive generations of backcrossing, the mouse DNA levels were stable, thus identifying the ZFP595 transgenic mouse stably inheriting flux.
[0069] (5) Identification of conditional overexpression in ZFP595 transgenic positive mice
[0070] Obtain ZFP595-OE F / F CD8a-Cre + / - Hybrid mice, using ZFP595-OE F / - Mice and purchased CD8a-Cre + / -Mice were mated to obtain offspring mice. After collecting the genome from the mouse tails, the offspring mice were identified and screened using PCR. The resulting hybrid mice, ZFP595-OE, were found to carry both ZFP595 heterozygotes and Cre heterozygotes. F / - CD8a-Cre + / - Then ZFP595-OE F / - CD8a-Cre + / - Mice and ZFP595-OE F / - Mice were mated to obtain offspring mice. After collecting the tails and extracting the genome, mice homozygous for ZFP595 and heterozygous for Cre were identified and screened using PCR, namely ZFP595-OE mice. F / F CD8a-Cre + / - Mice and ZFP595 homozygous mice, namely ZFP595-OE F / F In the subsequent mating and breeding process of the aforementioned mice, the mouse genotype can be identified using short-fragment PCR. A schematic diagram of ZFP595 PCR primer identification is shown below. Figure 7 As shown, wild-type mice only amplified a 967bp band at (P1, P2), while (P3, P4) showed no band. Heterozygous mice amplified a 967bp band at (P1, P2), and a 410bp band at (P3, P4). Homozygous mice showed no band at (P1, P2), but a 410bp band at (P3, P4). The electrophoresis results for short fragment PCR identification are as follows. Figure 8 As shown, He is a heterozygous mouse ZFP595. F / - WT represents the wild-type control; left M is a 1 kb DNA marker; right M is a DL2000 DNA marker. CD8a-Cre + / - The mice used were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. The PCR primers were F1 (SEQ ID NO: 7): CTTTGGGTGACATCATATCCTCAC, R1 (SEQ ID NO: 8): TGTTGTTCAGCTTGCACCAGG, F2 (SEQ ID NO: 9): CCTCTCTCCTGACTACTCCCAGTC, and R2 (SEQ ID NO: 10): GAGCCAAGAGCATCCTTGCGA. The mice could not be determined to be homozygous. Mice that amplified 338bp and 378bp bands were CD8a-Cre mice, while mice without amplified bands were wild-type mice.
[0071] The primers for ZFP595 are as follows:
[0072] Forward P1 (SEQ ID NO: 11): TCAGATTCTTTTATAGGGGACACA;
[0073] Reverse P2 (SEQ ID NO: 12): TAAAGGCCACTCAATGCTCACTAA;
[0074] Forward P3 (SEQ ID NO: 13): CACATTGCCAAAAGACGGCA;
[0075] Reverse P4 (SEQ ID NO: 14): GTCTTCCGTTTTCCATCATCCC.
[0076] The reaction system for ZFP595 short fragment PCR identification is detailed in Table 3, where the 2xRapid Taq Master Mix is Vazyme Code No: P222. The reaction conditions for ZFP595 short fragment PCR are detailed in Table 4.
[0077] Table 3 ZFP595 short fragment PCR reaction system:
[0078]
[0079] Table 4. ZFP595 short fragment PCR reaction conditions:
[0080]
[0081] (6) Application of conditional overexpression in ZFP595 transgenic positive mice
[0082] CD8a is a glycoprotein on the surface of T lymphocytes, belonging to the leukocyte differentiation antigens, and is mainly expressed in cytotoxic CD8+. + On T cells. CD8 + T cells, once activated, can specifically kill infected cells or tumor cells. ZFP595-OE cells were obtained through mating and screening using the methods described above. F / F CD8a-Cre + / - The mouse theory in CD8 + Specific overexpression in T cells ( Figure 9 To verify the cytotoxic effects of ZFP595 on CD8 cells... + Overexpression on T cells was successful; in this example, CD8 was extracted from mouse spleen. + T cells were then lysed to extract proteins, which were then analyzed using Western blot. Figure 10 The ZFP595 shown is in ZFP595-OE F / F CD8a-Cre + / - mouse CD8 +Significant overexpression in T cells indicates the presence of CD8 in cytotoxic cells. + Transgenic mice with specific overexpression of ZFP595 on T cells were successfully constructed. Notably, CD8... + Transgenic mice that specifically overexpress ZFP595 on T cells are one application example of this invention. If combined with Cre from other tissues or cells, more transgenic mice that specifically overexpress ZFP595 can be obtained.
[0083] In summary, the construction method of the present invention can achieve conditional overexpression of ZFP595 in mice, and can be used as a mouse model for various diseases such as cancer, neurodegenerative diseases, and immune disorders.
[0084] Compared with the prior art, the present invention achieves the following technical effects:
[0085] This invention is the first to obtain a new transgenic mouse strain that overexpresses ZFP595 throughout the body, providing a research model tool for studying the gene function of ZFP595 in diseases of various organ systems throughout the body.
[0086] This invention provides the first transgenic mouse model overexpressing ZFP595, offering a new strategy for preparing drugs to prevent or treat tumors and immune-related diseases.
[0087] This invention obtains ZFP595 transgenic mice overexpressing in different tissues or cells by hybridizing with different Cre mice. Specifically, when the flux region is present, transcription terminates at polyA in the flux region, and the target gene is not expressed; only lacZ is expressed. After mating a mouse carrying the ZFP595 gene with a tissue-specific Cre mouse, the Cre recombinase specifically excises the sequence between two aligned loxp sites on the same chromosome. At this time, the original lacZ and Neo are cleaved, thereby initiating the specific expression of ZFP595. Mice overexpressing ZFP595 in specific tissues or cells can be obtained by mating with tissue-specific Cre mice, and the integration and expression of the exogenous fragment can be determined by PCR.
[0088] This invention inserts the target fragment into a transcriptionally active region and uses the systemically highly expressed promoter CAGpromoter to enhance the expression of the target gene ZFP595, significantly increasing the probability of obtaining first-generation mice with positive target gene expression. The ZFP595 transgene conditionally overexpressing mouse model constructed using the specific recombinase system Cre-loxp can be applied to almost all ZFP595-related diseases, such as various cancers, neurodegenerative diseases, and immunology.
[0089] The foregoing description illustrates and describes several preferred embodiments of the invention. However, as previously stated, it should be understood that the invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the inventive concept described herein through the foregoing teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the invention should be within the protection scope of the appended claims.
Claims
1. A method for constructing a conditional overexpression ZFP595 transgenic mouse model, characterized in that, Includes the following steps: A homologous recombination vector containing the ZFP595 gene was constructed. This vector contains a 3.3 kb 5' homologous arm, CAG-LSL-Zfp595-HA-IRES-tdTomato-Wpre-pA, and a 3.3 kb 3' homologous arm. Cas9 mRNA, gRNA and the homologous recombination vector were microinjected into recipient mouse zygotes to obtain F0 generation mice, which were then identified. The F0 generation mice that were identified as positive were mated with wild-type mice and backcrossed to obtain a mouse model that conditionally overexpresses ZFP595.
2. The construction method according to claim 1, characterized in that, The ZFP595 gene sequence is SEQ ID NO:
1.
3. The construction method according to claim 1, characterized in that, The gRNA sequence is SEQ ID NO:
2.
4. The construction method according to claim 1, characterized in that, The identification method used was long-fragment PCR.
5. The construction method according to claim 4, characterized in that, The primer sequences used in the long fragment PCR method are SEQ ID NO: 3 to SEQ ID NO:
6.
6. The application of the construction method according to any one of claims 1-5 in specific overexpression in different tissues, organs, and cells, characterized in that, The mouse model constructed by the above method was hybridized with the corresponding Cre mouse.