Molecular marker, primer pair, detection reagent and application closely linked with beef color brightness trait

Abstract

This invention belongs to the field of animal breeding technology, specifically relating to a molecular marker, primer pair, detection reagent, and application closely linked to the beef meat color brightness trait. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 exhibits a G / T polymorphism at position 217 bp. This molecular marker can be used to select cattle herds with high meat color brightness traits.

Description

Technical Field

[0001] This invention belongs to the field of animal breeding technology, specifically relating to a molecular marker, primer pair, detection reagent, and application that are closely linked to the color brightness trait of beef. Background Technology

[0002] Beef is rich in protein, iron, zinc, B vitamins, and essential polyunsaturated fatty acids, making it a high-quality source of nutrition for humans. With the rapid growth of per capita beef consumption in China, the domestic consumption gap is widening. This trend has spurred a growing demand for different cattle breeds and for high-quality and premium beef.

[0003] The L-value (or color brightness) is a core indicator for evaluating the lightness or darkness of beef surface. This indicator is precisely measured using a colorimeter, and its value directly impacts consumers' visual judgment of beef freshness and quality, making it a crucial sensory factor determining market acceptance. Industry experts generally believe that a moderate L-value (approximately 35-45) corresponds to a bright red color in beef, closely matching consumers' visual expectations of freshness. If the color brightness is too high (L-value > 45), the beef may appear pale, easily misinterpreted by consumers as oxidation, spoilage, or moisture loss. Conversely, if the color brightness is too low (L-value < 35), it often indicates excessive oxidation of myoglobin in the beef or improper handling during storage, significantly reducing market acceptance. Furthermore, high color brightness in beef is often accompanied by higher drip and cooking losses, reflecting a loose muscle tissue structure and poor water retention. This ultimately leads to dry, tough meat with reduced juiciness after cooking, severely impacting edibility. Therefore, breeding beef cattle breeds with meat color brightness within a suitable range has significant industrial value for improving the quality of beef products and meeting market consumption demands.

[0004] The growth and development characteristics of beef cattle, as well as meat quality traits such as meat color brightness, are quantitative traits, jointly regulated by multiple genes with small effects. For example, the ChREBP gene, a key gene regulating lipid and glucose metabolism, has been proven to have a significant association with the meat color brightness trait in beef. Meanwhile, in traditional animal breeding, relying solely on phenotypic selection suffers from significant problems such as low breeding efficiency and insufficient selection accuracy, making it difficult to meet the demands of the current high-quality development of the beef cattle breeding industry. Against this backdrop, applying candidate gene methods as genetic markers to the assisted selection stage of livestock breeding has become a key means to overcome breeding bottlenecks. This method can not only effectively improve breeding efficiency and accuracy but also help researchers to deeply analyze the genetic basis of beef cattle growth and meat quality traits.

[0005] Current research has identified distinct single nucleotide polymorphism (SNP) sites in genes such as PPARG and ChREBP. These SNPs can serve as genetic markers to optimize the balance between beef meat quality traits and fat content, and to regulate the oxidative stability of beef through improved storage techniques, aiming to achieve a dual improvement in both sensory quality and economic benefits. However, existing molecular markers are still insufficient to fully meet the practical needs of precise breeding for beef color brightness. Therefore, developing new molecular markers related to beef color brightness and exploring more gene loci and genetic patterns that regulate meat color brightness is of significant practical importance and application value for promoting the upgrading of beef cattle breeding technology, cultivating high-quality beef cattle breeds, and improving the overall development level of the beef industry. Therefore, this invention aims to provide a new molecular marker related to meat color brightness. Summary of the Invention

[0006] In view of the above technical problems, the present invention provides a molecular marker closely related to the color brightness trait of beef, which can be used to select and breed high-quality beef cattle.

[0007] The specific technical solution provided by this invention is as follows: In a first aspect, the present invention provides a molecular marker closely related to the color brightness trait of beef, the nucleotide sequence of which is shown in SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 has a G / T polymorphism at 217bp.

[0008] In a second aspect, the present invention provides a primer pair for specifically amplifying the molecular marker of claim 1, comprising a forward primer and a reverse primer. Forward primer: 5'-GAGCCAAACTTTTCCCCTCC-3'; Reverse primer: 5'-GCACCCAGAGAAAGAAATGC-3'.

[0009] In a third aspect, the present invention provides a detection reagent for detecting the molecular marker of claim 1, comprising the primer pair, premixed Taq enzyme, and deionized water.

[0010] In a fourth aspect, the present invention provides the application of the molecular marker, the primer pair, or the detection reagent in screening cattle with a high meat color brightness trait.

[0011] In a fifth aspect, the present invention provides a method for screening cattle with high meat color brightness, comprising the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2; The polymorphism of the amplification products was detected.

[0012] As a preferred embodiment of the present invention, the PCR reaction program is as follows: pre-denaturation at 94~95℃ for 5 min~5 min 30 s; denaturation at 94℃ for 30 s, annealing at 59~60℃ for 30~45 s, extension at 70~75℃ for 30~45 s, 30~40 cycles, and holding at 70~75℃ for 10 min.

[0013] As a preferred embodiment of the present invention, the PCR amplification system is 25 μL: 12.5 μL of 2×Taq PCR Master mix, 2 μL of DNA template, 1 μL each of upstream and downstream primers (100 ng / μL), and 8.5 μL of deionized water.

[0014] In a preferred embodiment of the present invention, the polymorphic sites were identified and genotyped using the Sanger sequencing method, and the resulting sequence is shown in SEQ ID NO. 1. The nucleotide sequence shows a G / T polymorphism at position 217. Combined with the meat quality trait, the individuals with the TT or GT genotype at this polymorphic site have a higher meat color brightness than the individuals with the GG genotype.

[0015] In a sixth aspect, the present invention provides the application of the molecular marker, the primer pair, or the detection reagent in bovine breeding.

[0016] In a preferred embodiment of the present invention, breeding refers to selecting cattle breeds with high meat color brightness, including the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair; The bases at the polymorphic sites of the amplification products were detected and genotyped. Individuals with the TT or GT genotypes were selected as breeding subjects.

[0017] In a preferred embodiment of the present invention, the cattle are Anhui East cattle, Anhui South cattle, Dabie Mountain cattle, Dongliushui cattle, or Jianghuai water buffalo.

[0018] More preferably, the cattle are Dabie Mountain cattle.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes DNA sequencing technology to analyze the DNA of five local cattle breeds in Anhui Province. ChREBP Polymorphic analysis of genes revealed that: ChREBP The SNP site g.37042G>T was detected at exon 1 of the gene. 。 Further, the least squares fitting linear model was applied to the Dabie Mountain cattle... ChREBP Association analysis between gene polymorphism sites and meat quality traits showed that:ChREBP The gene g.37042G>T locus was significantly correlated with flesh color brightness (L*), and the TT genotype was significantly higher than the GG genotype. P <0.01), the GT genotype was significantly higher than the GG genotype ( P <0.05), indicating that the g.37042G>T site can serve as a molecular marker for breeding cattle herds with high meat color brightness. Attached Figure Description

[0020] Figure 1 These are the results of genomic DNA extraction; Figures 2 - 5 They are ChREBP Results of PCR amplification products of the gene using 8 primer pairs, as measured by 1.5% agarose gel electrophoresis; Figure 6 yes ChREBP Gene sequencing analysis results. Detailed Implementation

[0021] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0022] Meat quality evaluation indicators include meat color, pH value, water-holding capacity, drip loss, and marbling. Among these, meat color is one of the important factors affecting the sales of fresh beef. Consumers usually regard bright red and cherry red beef as a sign of freshness. Therefore, meat color is a very important indicator for judging meat quality.

[0023] This invention provides a molecular marker closely related to the color brightness trait of beef. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The nucleotide sequence shown in SEQ ID NO.1 has a G / T polymorphism at 217bp.

[0024] Example 1 Anhui local breed cattle ChREBP Genetic diversity analysis 1. Test materials 1.1 Experimental Animals Using a random typical sampling method, a total of 286 individuals from five local cattle breeds in Anhui Province (Eastern Anhui cattle, Southern Anhui cattle, Dabie Mountain cattle, Dongliushui cattle, and Jianghuai water buffalo) were collected. Detailed information is shown in Table 1.

[0025] Table 1. Sample information of five local cattle breeds in Anhui Province 1.2 Preparation of main reagents and solutions (1) Main reagents Chloroform, isoamyl alcohol, double-distilled water (ddH2O), anhydrous ethanol, and ultrapure water (DI) were all provided by the university laboratory. DNA Marker (DL2000), 6x Loading Buffer, and 2×Taq PCR Master mix were purchased from Sangon Biotech (Shanghai) Co., Ltd.; agarose was purchased from Mona Biotechnology Co., Ltd.; nucleic acid staining agents were purchased from Savill Biotechnology Co., Ltd.; and the blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0026] (2) Preparation of reagents A: PBS buffer: NaCl 8g, KCl 0.2g, Na2HPO4•12H2O 3.58g, KH2PO4 0.27g, add ddH2O to bring the volume to 1L, adjust the pH to 7.4, autoclave, and store at 4℃.

[0027] B: 50×TAE: Take 242g of Tris and 100mL of 0.5mol / L EDTA and place them in a 1L beaker. Add 800mL of ddH2O to the beaker and stir well. Then add 57.1mL of glacial acetic acid solution and continue stirring. Finally, add enough deionized water until the total volume reaches 1L.

[0028] C: 1×TAE electrode buffer: 20mL 50×TAE, 980mL distilled water to a final volume of 1L.

[0029] D: 1.5% agarose gel electrophoresis: Add 1.5g agarose to 100mL of 1×TAE, heat in a micro furnace until melted, and let cool to a temperature that can be touched by hand. Then add 5µL of nucleic acid dye and mix well.

[0030] 1.3 Main Instruments The main instruments and equipment required for this invention are shown in Table 2 below.

[0031] Table 2 Main Instruments and Equipment 2. Test methods 2.1 Blood Sample Collection Blood samples were collected from the jugular veins of five local cattle breeds in Anhui Province and placed in E-DTA anticoagulant tubes. The tubes were then brought back to the laboratory with crushed ice in an insulated box and stored at -20°C for later use.

[0032] 2.2 Extraction of Genomic DNA Genomic DNA was extracted from the blood of 286 cattle using an animal blood genomic DNA extraction kit. The specific procedures were performed according to the kit's instructions.

[0033] 2.3 Genomic DNA Concentration and Purity Detection DNA concentration was detected using a Nanodrop One micro-volume spectrophotometer; the A concentration of pure DNA was... 260 A 280 The range is 1.7–1.9, and then its integrity is further verified. 2 μL of DNA template is mixed with 3 μL of 6× Loading Buffer, and the mixture is detected by 1.5% agarose gel electrophoresis. If it passes the test, it is stored at -20℃ for later use.

[0034] 2.4 Primer Design and Synthesis According to the cattle data published in the NCBI database ChREBP The gene sequence (ID: 788534) was used to design eight primer pairs (C1~C8) for the exon and some intron regions of the gene using Primerpremier 5.0 software. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and details are shown in Table 3.

[0035] Table 3 Anhui Local Cattle Breeds ChREBP Gene primer information Note: E: Exon; i: Intron 2.5 PCR Amplification and Sequencing The PCR amplification system consisted of 25 μL: 12.5 μL of 2×Taq PCR Master mix, 2 μL of DNA template, 1 μL each of forward and reverse primers (100 ng / μL), and 8.5 μL of deionized water. The amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing for 30 s (annealing temperatures see Table 3), 72℃ extension for 30 s, for 35 cycles; and a final extension at 72℃ for 10 min. The product was stored at 4℃ for later use. PCR products were detected by 1.5% agarose gel electrophoresis. Products that passed the electrophoresis were sent to General Biosystems (Anhui) Co., Ltd. for sequencing.

[0036] 3. Data Analysis 3.1 Genotype frequency and allele frequency Genotype frequency = Number of individuals with a genotype / Total number of individuals in the population being tested Allele frequency = (a specific allele in a population) / (all alleles) Pi=[2(ii)+(ij1)+(ij2)+…+(ijn)] / 2N Pi: Frequency of the i-th allele; i: Homozygous multiple allele i1, j2, ..., jn: the first to nth alleles co-occurring with i.

[0037] 3.2 Hardy-Weinberg equilibrium test Hardy-Weinberg equilibrium is the state of genotype frequencies of two alleles from two autosomal loci after random mating in an infinitely large population.

[0038] x 2 = ∑ Where: Ei represents the theoretical value, Oi represents the actual observed value, and n represents the number of alleles.

[0039] 3.3. Genetic homozygosity Ho ) Ho This indicates the homozygosity of a specific allele in a population. The formula for calculation is:

[0040] H0 = ∑ 1 (pi)2 Where Pi is the frequency of the i-th allele, and n is the number of alleles at a certain locus.

[0041] 3.4. Heterozygosity He ) He The proportion of a group that is heterozygous at a particular seat is used to measure the information content of the labeling method. The calculation formula is:

[0042] He = 1 − ∑ 1 (pi)2 Where Pi is the frequency of the i-th allele, and n is the number of alleles at a certain locus.

[0043] 3.5 Effective number of alleles Ne ) Ne It is also an indicator reflecting the magnitude of genetic variation in a population, expressed as the reciprocal of homozygosity. If alleles are more evenly distributed in a population, the effective number of alleles will be closer to the actual number of alleles detected.

[0044] In the formula: i is the i-th allele; pi is the frequency of the i-th allele; n is the number of alleles.

[0045] 3.6. Polymorphic information content ( PIC ) Polymorphism Information Content PIC The value is calculated based on the frequency of its allele in a population, indicating the level of polymorphism at the locus.

[0046] pIC = 1 − ∑ 1 pi2 − ∑ ∑=i+1 2pi2 pj2 In the formula: pi and pj are the frequencies of the i-th and j-th alleles, respectively; n is the number of alleles. Generally, when PIC When the value is >0.5, it indicates high polymorphism; when it is <0.25, it indicates high polymorphism. PIC When the value is less than 0.5, it indicates moderate polymorphism. PIC When the value is less than 0.25, it indicates low-degree polymorphism.

[0047] 3.7 Data Analysis Software Sequencing results were compared with reference sequences using DNAman software to screen for SNP sites. The peak plots of the sequencing results were then analyzed using Chromas software to further validate the screened SNP sites.

[0048] 4. Results and Analysis 4.1 Genomic DNA Quality Testing The quality of the extracted genomic DNA was measured using a NanoDrop One ultra-micro spectrophotometer, and its ratio A was determined. 260 / A 280 The values ​​were within the range of 1.7 to 1.9. Further analysis was performed using 1.5% agarose gel electrophoresis. The electrophoresis results are shown in Figure 1. The bands were bright and clear, without tailing, and the band integrity was good. These results indicate that the extracted DNA quality meets the requirements for subsequent experiments.

[0049] 4.2 Anhui Local Cattle Breeds ChREBP Genetic diversity analysis 4.2.1 ChREBP Quality detection of gene PCR amplification products ChREBP The results of agarose gel electrophoresis of the gene PCR amplification products are shown in the figure. Figures 2 - 5 Amplification ChREBP The eight primer pairs for the gene showed good specificity, no dimers, and the amplified bands were bright, clear, and single, with the fragment size meeting expectations, allowing for direct sequencing.

[0050] 4.2.2、ChREBP Gene sequencing results analysis The expanded population of five local Anhui cattle breeds ChREBP Sequencing of partial exons of the gene will ChREBP The gene sequencing results were compared with the bovine sequence published by NCBI. As shown in Figure 6, the identified SNP site is g.37042G>T at exon 1.

[0051] The nucleotide sequence containing the molecular marker of the above SNP site is shown in SEQ ID NO.1: GGCGTATTGACTGTTAATATAAGC CCGCCCCGTCTGCTCCCGCGCGGCCCTGAGGCCCCGCCCCCTCCAGCGACCTATCGCGGCTGGAGGGCGGGGCTATGCTAACAAGCGTGCGGGCGGGCATATGCTAATGAGCCGGTCTGGCCACACGGGTTGCGCCTGCTGCTGACCCTTG AGCCCAGGCTAGGCGGCGGCGGCGATGACCATGGCCGGGGCSCTGGCGGGTCTGGTCGCTGGGCTTGCAAGGCCCGCGGGTCGTCCCCAGCCCGGATTCGGACTCAGACACAGACTCGGATGGACCCGAATACCCGGCGCAGCGCGGTGGG CTGCTCTCGCTCGCAGGTCATCCACAGCGGTTCACTTCATGGTGTCGTCGCCGCACAGCGACTCACTGACCCGGCGGCGCGACCAGGAAGGTGTCCCTGGGGCACGCCGACTTCGGGCCGCGCAGCATCGACCCCACACTCACCCGCCTGTTT CGAGTGCATGAGCCTGGCCTACAGGTGAGGGCGGCTCCGGAGCCGACAGCCTCGGCCCTCTCACGGCGGGACCTCGCTCTGGGGCTCCCGGCCAACCCACTCGGCCCCAAGCCTTGGTCCGTGCTGTTCTCAGAGACTCGGGCCACATCCTG GATCCCTTCTTCTCCTCCAC , where S is a base G or a base T.

[0052] 4.2.3 Anhui Local Cattle Breeds ChREBP Population genetic structure analysis of genes (1) ChREBP Genetic polymorphism analysis of exon 1 Five local cattle breeds in AnhuiChREBP Gene and genotype frequencies at exon 1 variant sites were analyzed (Table 4). At the g.37042G>T site, three genotypes were identified: GG, GT, and TT. The TT genotype was not detected in the buffalo population. Gene and genotype frequencies differed among different cattle breeds. In the three common cattle populations, the GT genotype was slightly more frequent than the GG and TT genotypes, making it the dominant genotype. In the Dabie Mountain cattle population, the frequencies of the GG and GT genotypes were the same, both at 0.34. Among the two buffalo breeds, GT was the dominant genotype in the Jianghuai buffalo population, while GG was the dominant genotype in the Dongliu buffalo population. In all five cattle breeds, the G allele frequency was higher than the T allele frequency, making it the dominant allele.

[0053] Ne, Ho, He, PIC, and Hardy-Weinberg equilibrium were calculated based on gene and genotype frequencies (Table 5). At the g.37042G>T locus, the highest Ne value (2.000) was observed in the Wannan cattle population. The homozygosity and heterozygosity were similar in Wannan and Dabieshan cattle, while the other three populations showed higher homozygosity than heterozygosity. In terms of polymorphism information content, all five cattle breeds exhibited moderate polymorphism (0.25 < 0.05). PIC <0.5. According to the chi-square test, the Anhui East cattle, Anhui South cattle, and Dongliushui cattle are in Hardy-Weinberg equilibrium ( P >0.05), the Dabie Mountain cattle population is in a Hardy-Weinberg imbalance ( P <0.05, indicating that the Jianghuai water buffalo population is in a state of extreme Hardy-Weinberg imbalance ( ). P <0.01).

[0054] Table 4 Anhui Local Cattle Breeds ChREBP Gene frequency of exon 1 and genotype Table 5 Anhui Local Cattle Breeds ChREBP Genetic variation parameters of exon 1 Example 2 Dabie Mountain cattle ChREBP Correlation analysis between gene polymorphism and meat quality 1. Experimental Materials and Methods 1.1 Sample Collection Fifty-six healthy, disease-free Dabie Mountain cattle aged 24-30 months and of similar weight (from Jiuhong Agricultural Comprehensive Development Co., Ltd., Taihu County, Anqing City) were selected for fattening. Feeding was prohibited for 24 hours prior to slaughter, and a sanitary inspection was conducted, with 10 mL of blood collected. After slaughter, 500 g of the longissimus dorsi muscle from the 12th-13th thoracic vertebrae was removed, washed with physiological saline to remove blood, and stored at -20℃ for later use.

[0055] 1.2 Determination of Beef Quality Flesh color: After exposing the collected longissimus dorsi muscle cross-section to air for oxygenation for 40 minutes, the color difference was measured using a Canon CR-S400w handheld colorimeter. The brightness (L*), redness (a*), and yellowness (b*) of the longissimus dorsi muscle were measured. Each sample was measured 3 times, and the average value of the data was taken for analysis.

[0056] Crude fat: The fat content of the longissimus dorsi muscle of Dabie Mountain cattle was determined by Soxhlet extraction according to GB / T5009.6—2003 "Determination of fat in food".

[0057] Drip loss: Remove the surrounding muscle membrane from the meat sample and cut it into pieces approximately 5cm × 3cm × 2cm along the muscle fiber direction. Take 3 pieces from each meat sample and record the weight (m1). Bend a wire into a hook shape, hook one end, and place it in an air-filled plastic bag to prevent it from falling and from contacting the plastic bag. Hang the meat sample in a refrigerator at 4°C for 24 hours. Afterward, remove the plastic bag, gently wipe away the juices on the surface of the meat sample with filter paper, and weigh it again (m2). Drip loss is expressed as the percentage reduction in the initial weight of the meat sample. Calculate using the following formula:

[0058] Drip loss (%) = (m1-m2) / m1×100%.

[0059] Cooking loss: After removing connective tissue and fat from the muscle surface, cut it into slices approximately 2 cm thick and weigh them (recorded as W1). Place the meat slices in a heat-resistant vacuum bag and insert a thermometer to the center of the muscle. Seal the bag tightly to prevent contact with the outside environment. Then, place the heat-resistant vacuum bag in a constant temperature water bath at 80°C and heat until the core temperature of the meat sample reaches 70°C. Then remove the meat sample from the water bath and allow it to cool naturally at room temperature. Afterward, gently absorb the surface moisture with absorbent paper and weigh it (recorded as W2). Calculation formula:

[0060] Cooking loss (%) = (W1 - W2) / W1 x 100% pH: Insert the pH meter electrode into the meat sample and perform three repeated measurements on each meat sample. Then calculate the average of these three measurements as the pH value of the meat sample.

[0061] Shear force: The meat sample was placed in a water bath preheated to 80°C and heated until the temperature at the center of the sample reached 70°C. The sample was then removed and allowed to cool to room temperature. Ten cylindrical samples, each 1.27 cm in diameter, were extracted from the meat sample along the muscle fiber direction. Shear force was tested on these samples using a tenderness tester, and the average shear force value was calculated.

[0062] Water loss rate: Cut the meat sample into 2cm pieces, and use a circular sampler to extract a portion of the meat sample from the center of each piece. Weigh this portion of the meat sample and record it as W1. Then wrap it in gauze. Next, place the wrapped meat sample between two layers of filter paper (36 layers in total), place the meat sample on a pressure gauge, apply a pressure of 25kg for 5 minutes, and then remove the pressure. Then weigh the meat sample again and record it as W2. The difference between the weight before pressure (W1) and the weight after pressure (W2) is the water loss weight of the meat sample. Calculation formula:

[0063] Water loss rate (%) = (W1-W2) / W1 ×100%.

[0064] 2. Data Analysis 2.1 Statistical Analysis Model The GLM (General Linear Model) procedure in SAS software, combined with the least squares analysis of variance model, was used to compare the differences in meat quality trait indicators among different genotypes.

[0065] Significance tests and multiple comparisons were performed on the meat quality traits among different genotypes, and the results are presented as mean ± standard deviation.

[0066] The statistical model is as follows: Yij=μ+GENi+GROj+eij Yij represents the phenotypic value of an individual for a certain trait; μ represents the population mean; GENi represents the genotype effect; GROj represents the group effect; and eij represents the random error.

[0067] 3. Results and Analysis Using SAS software to analyze the cattle of the Dabie Mountains ChREBP Association analysis was performed between genotypes at polymorphic sites and nine indicators of Dabie Mountain cattle, including intramuscular fat, shear force, drip loss, pH, and water-holding capacity (Table 6). The results showed that the g.37042G>T site was significantly correlated with meat color brightness (L*), and the TT genotype was significantly higher than the GG genotype. P <0.01), the GT genotype was significantly higher than the GG genotype ( P <0.05).

[0068] Table 6 ChREBP Association analysis of gene SNPs and the quality of beef from Dabie Mountain Note: For comparisons of different genotypes at the same locus, different lowercase letters in the data headings indicate significant differences. P <0.05, different capital letters indicate highly significant differences ( P <0.01).

[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A molecular marker closely related to the color brightness trait of beef, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The nucleotide sequence shown in SEQ ID NO.1 has a G / T polymorphism at 217 bp. Individuals with the TT or GT genotype at this site have a higher flesh color brightness than individuals with the GG genotype.

2. A primer pair for specifically amplifying the molecular marker of claim 1, characterized in that, It includes forward primers and reverse primers; Forward primer: 5'-GAGCCAAACTTTTCCCCTCC-3'; Reverse primer: 5'-GCACCCAGAGAAAGAAATGC-3'.

3. A detection reagent for detecting the molecular marker of claim 1, characterized in that, It includes the primer pair as described in claim 2, premixed Taq enzyme, and deionized water.

4. The use of the molecular marker of claim 1, the primer pair of claim 2, or the detection reagent of claim 3 in screening cattle with high meat color brightness.

5. A method for screening cattle with high meat color brightness, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2; The polymorphism of the amplification products was detected.

6. The method according to claim 5, characterized in that, The polymorphic sites were identified and genotyped using Sanger sequencing. Individuals with the TT or GT genotypes had a brighter flesh color than individuals with the GG genotype.

7. The method according to claim 5, characterized in that, The PCR reaction program was as follows: 94~95℃ pre-denaturation for 5 min~5 min 30 s; 94℃ denaturation for 30 s, 59~60℃ annealing for 30~45 s, 70~75℃ extension for 30~45 s, 30~40 cycles, and 70~75℃ hold for 10 min.

8. The application of the molecular marker of claim 1, the primer pair of claim 2, or the detection reagent of claim 3 in bovine breeding.

9. The application according to claim 8, characterized in that, Breeding refers to the selection of cattle breeds with high meat color brightness, including the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2; The bases at the polymorphic sites of the amplification products were detected and genotyped. Individuals with the TT or GT genotypes were selected as breeding subjects.

10. The method according to claim 9, characterized in that, The beef cattle mentioned are Anhui East cattle, Anhui South cattle, Dabie Mountain cattle, Dongliu River cattle, or Jianghuai water cattle.

Images