Use of peganine hydrochloride for the manufacture of a medicament for the treatment of Parkinson's disease

Abstract

This invention provides a kit comprising: (1) a pharmaceutical composition containing a therapeutically effective amount of eugenol hydrochloride and a pharmaceutically acceptable carrier; and (2) a detection reagent for detecting vasoactive intestinal peptide (VIP) mRNA and / or protein. This invention reveals for the first time that eugenol hydrochloride (HH) has a highly effective therapeutic effect on specific Parkinson's disease patients characterized by abnormally elevated VIP levels. The pharmaceutical composition and kit of this invention can specifically reduce the expression of pro-inflammatory VIP, thereby precisely intervening in the VIP-mediated microglial-related neuroinflammatory pathway, thus significantly treating Parkinson's disease and providing a novel targeted treatment option for the clinical intervention of Parkinson's disease.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to the use of camel pine alkaloid hydrochloride in the preparation of drugs for the treatment of Parkinson's disease. Background Technology

[0002] Parkinson's disease (PD) is the second leading cause of neurodegenerative disease worldwide, making it imperative to strengthen PD prevention and treatment efforts.

[0003] The pathophysiological mechanisms of Parkinson's disease (PD) are complex. Its typical pathological feature is the progressive loss of dopaminergic neurons in the substantia nigra pars compacta, the substantia nigra-striatal pathway, and the ventral tegmental area, subsequently affecting the limbic system and cerebral cortex. Another hallmark pathological change in PD is the formation of Lewy bodies, primarily composed of misfolded α-synuclein, in dopaminergic neurons of the substantia nigra in the midbrain. The pathogenesis of PD involves multiple factors, such as α-synuclein aggregation, oxidative stress, mitochondrial dysfunction, immunity, autophagy, neuroinflammation, and the gut-brain axis. However, the exact molecular processes behind the neurodegenerative changes remain unknown.

[0004] Currently, the main treatments for Parkinson's disease (PD) include medication and surgery. Medication is the first-line treatment, and current medications include levodopa / carbidopa, dopamine agonists, and anticholinergics. Levodopa dopamine replacement therapy remains the most effective treatment for relieving core motor symptoms in PD. Surgical treatments, such as deep brain stimulation, have a significant effect on improving motor symptoms, but cannot cure the disease. While current treatments can alleviate symptoms to some extent, the underlying causes of the disease are not fully understood, which limits the effectiveness of treatment and further development.

[0005] Therefore, there is an urgent need in this field to discover treatment strategies that can alter the course of the disease, based on a clear understanding of the underlying causes of PD. Summary of the Invention

[0006] The purpose of this invention is to provide a treatment strategy that can alter the course of Parkinson's disease, based on its pathogenesis and core causes. Specifically, it relates to the use of camel thorn alkaloid hydrochloride in the preparation of drugs for treating Parkinson's disease.

[0007] In a first aspect of the present invention, a kit is provided, the kit comprising: (1) A pharmaceutical composition comprising a therapeutically effective amount of camel pine hydrochloride and a pharmaceutically acceptable carrier; and (2) Detection reagents for detecting vasoactive intestinal peptide (VIP) mRNA and / or protein.

[0008] In another preferred embodiment, the kit further includes: (3) Label or instruction manual; Specifically, when the detection reagent detects a significant increase in the level of VIP mRNA and / or protein in the subject, it indicates that the drug composition is suitable for administration to the subject.

[0009] In another preferred embodiment, the significant increase refers to a significant increase in the level of VIP mRNA and / or protein C1 compared to the level C0 in normal subjects.

[0010] In another preferred embodiment, the significant increase refers to a C1 / C0 ratio ≥ 1.5, more preferably a C1 / C0 ratio ≥ 2, and even more preferably a C1 / C0 ratio ≥ 4.

[0011] In another preferred embodiment, the significant increase refers to a C1 / C0 ratio ≥3 in the substantia nigra sample, more preferably a C1 / C0 ratio ≥3.8.

[0012] In another preferred embodiment, the significant increase refers to a C1 / C0 ratio ≥30 in the microglia sample, more preferably a C1 / C0 ratio ≥38.9, even more preferably a C1 / C0 ratio ≥200, and most preferably a C1 / C0 ratio ≥289.

[0013] In another preferred embodiment, the levels of the VIP mRNA and / or protein are in samples selected from the group consisting of microglia, cerebrospinal fluid, substantia nigra, or combinations thereof.

[0014] In another preferred embodiment, the detection reagent is selected from the group consisting of primers, probes, antibodies, nucleic acid chips, protein chips, or combinations thereof.

[0015] In another preferred embodiment, the detection reagent includes an ELISA detection reagent.

[0016] In another preferred embodiment, the detection described in (2) includes the steps of: Transcriptomic RNA-seq analysis was performed on the substantia nigra tissue of the treatment subjects; or real-time quantitative PCR (qPCR) detection was performed on the microglia of the treatment subjects.

[0017] In another preferred embodiment, the dosage of the pharmaceutical composition is 5 mg to 50 mg / kg / day, based on the mass of camel thorn hydrochloride.

[0018] In another preferred embodiment, the dosage of the pharmaceutical composition is 10 mg to 40 mg / kg / day, based on the mass of camel tarragon hydrochloride.

[0019] In another preferred embodiment, the dosage of the pharmaceutical composition is 10 mg / kg / day, 20 mg / kg / day, or 30 mg / kg / day, based on the mass of camel thorn hydrochloride.

[0020] In another preferred embodiment, the pharmaceutical composition is an oral formulation.

[0021] In another preferred embodiment, the oral formulation is selected from the group consisting of tablets, capsules, granules, or oral liquids.

[0022] In another preferred embodiment, the pharmaceutical composition is administered once or twice daily.

[0023] In a second aspect of the invention, the use of the kit described in the first aspect is provided for preparing a medicament for treating Parkinson's disease.

[0024] In another preferred embodiment, the kit treats Parkinson's disease by downregulating vasoactive intestinal peptides in a subject having one or more characteristics selected from the group consisting of: (1) The expression levels of vasoactive intestinal peptide (VIP) mRNA and / or protein in the substantia nigra are upregulated; (2) The expression levels of vasoactive intestinal peptide (VIP) mRNA and / or protein are upregulated in microglia in the cerebral cortex, midbrain and / or substantia nigra.

[0025] In another preferred embodiment, the subject is in a specific stage of the disease course characterized by elevated levels of vasoactive intestinal peptide (VIP) mRNA and / or protein due to Parkinson's disease.

[0026] In another preferred embodiment, the medicine box is suitable for mammals, preferably humans or non-human mammals.

[0027] In another preferred embodiment, the kit is used to downregulate the expression level or activity of endogenous vasoactive intestinal peptide (VIP).

[0028] In another preferred embodiment, the kit is used to reduce VIP expression in microglia of the central nervous system to alleviate neuroinflammation.

[0029] In another preferred embodiment, the cassette is used to promote the survival of dopaminergic neurons.

[0030] In another preferred embodiment, the medicine box is used in combination with another Parkinson's disease treatment drug.

[0031] In another preferred embodiment, the other Parkinson's disease treatment drug is selected from the group consisting of levodopa, dopamine receptor agonists, MAO-B inhibitors, or COMT inhibitors.

[0032] In another preferred embodiment, the medicine box is suitable for mammals.

[0033] In another preferred embodiment, the mammal is a human.

[0034] In a third aspect of the invention, a method for screening potential therapeutic agents for PD treatment is provided, comprising the steps of: (a) In the experimental group, microglia were cultured in the presence of the candidate compound; and in the blank control group, microglia were cultured under the same conditions as the experimental group but without the candidate compound. (b) The expression levels of endogenous VIP in microglia in the experimental group (V1) and in the blank group (V0) were measured and compared. Specifically, when the expression level V1 is significantly lower than the expression level V0, this suggests that the candidate compound is a potential therapeutic agent for PD treatment.

[0035] In another preferred embodiment, the microglia cultured in the experimental group and the blank control group described in step (a) are cells stably transduced by a Lenti-VIP overexpression vector containing a VIP gene expression cassette. The VIP gene expression cassette in the Lenti-VIP overexpression vector contains the VIP coding sequence shown in Sequence ID NO:1.

[0036] In another preferred embodiment, the Sequence ID NO:1 encoding sequence is as follows: atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattgacatgttgcaaaatgcattagctgaaaatgacacaccctattatgatgtatccagaaatgccaggcatgctgatg gagttttcaccagtgacttcagtaaactcttgggtcaactttctgccaaaaagtaccttgagtctcttatgggaaaacgtgttagcagtaacatctcagaagaccctgtaccagtcaaacgtcactcagatg cagtcttcactgacaactatacccgccttagaaaacaaatggctgtaaagaaatatttgaactcaattctgaatggaaagaggagcagtgagggagaatctcccgactttccagaagagttagaaaaatga.

[0037] In another preferred embodiment, step (a) further includes: culturing microglia in a positive control group under the same conditions as the experimental group, in the presence of a positive compound and in the absence of the candidate compound; In step (b), the expression level Vp of endogenous VIP in microglia in the positive control group was measured, and the expression level V1 was compared with the expression level Vp.

[0038] In another preferred embodiment, the positive compound is selected from the group consisting of: salsa hydrochloride, 20S-protopanaxadiol, swertiamarin, vitamin B12, or combinations thereof.

[0039] In another preferred embodiment, the positive compound includes camel pine alkaloid hydrochloride.

[0040] In another preferred embodiment, the phrase "expression level V1 is significantly lower than expression level V0" means that the ratio of V0 / V1 is ≥1.6, more preferably ≥2.3, and even more preferably ≥5.8.

[0041] In another preferred embodiment, the microglia are VIP fluorescent reporter cell lines overexpressing VIP.

[0042] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0043] Figure 1 The expression of VIP in the substantia nigra of an MPTP-induced Parkinson's disease mouse model and the KEGG pathway enrichment analysis are shown.

[0044] Figure 2 The image shows the substantia nigra, freshly isolated microglia from mouse brain tissue, and MTP in an MPTP-induced Parkinson's disease mouse model. + Induced expression of VIP in the microglia cell line HMC3; among which Figure 2 A represents the VIP mRNA expression level in the substantia nigra region of mice treated with MPTP. Figure 2 B represents the VIP mRNA expression level in microglia of the MPTP model group. Figure 2 C stands for MPP + VIP mRNA expression levels in the treated BV2 cell line. Figure 2 D stands for MPP + VIP mRNA expression level in the treated HMC3 cell line.

[0045] Figure 3 It showed that VIP overexpression induced a decrease in the survival rate of the microglia cell line HMC3; Figure 3 A is a microscopic image of mcherry fluorescent protein in cell line HMC3. Figure 3 B represents the mRNA expression level of VIP in Lenti-VIP group cells. Figure 3 C represents the level of VIP protein in the cell supernatant of the Lenti-VIP group. Figure 3 D represents the data on cell proliferation activity assessed using the CCK-8 colorimetric method.

[0046] Figure 4 The expression of VIP drove the activation of HMC3 pro-inflammatory factors. qPCR was used to detect TNF-α in the VIP-overexpressing group and the control group. Figure 4 A), IL-1β Figure 4 C) and IL-8 ( Figure 4 B) Levels of inflammatory factors.

[0047] Figure 5 This demonstrates the screening of drugs that reduce VIP from a library of traditional Chinese medicine monomers using stable HMC3 cells overexpressing VIP and red fluorescent protein; among them, Figure 5The fluorescence intensity of candidate drug treatment groups A, 5B, 5C, and 5D was increased compared to the control group; Figure 5 There was no difference between the E candidate drug treatment group and the control group; Figure 5 F, Figure 5 G, Figure 5 The H candidate drug treatment group showed a decrease in fluorescence intensity compared to the control group; Figure 5 I. To observe the effect of candidate small molecule compounds on the fluorescence intensity of VIP overexpression using fluorescence microscopy.

[0048] Figure 6 Camel oleracea alkaloid HH showed that it reduced VIP levels and promoted neuronal cell survival; among which, Figure 6 A is MPP + Induced VIP mRNA expression levels in HMC3 cells Figure 6 B represents the VIP mRNA expression level in HMC3 cells overexpressing VIP treated with camel thorn alkaloid HH. Figure 6 C stands for MPP + Viability of neurons co-cultured with treated HMC3 cell supernatant and supernatant of VIP-overexpressing HMC3 cells and SH-SY5Y neurons.

[0049] Figure 7 The study showed that camel thorn alkaloid HH effectively improved motor dysfunction and increased the survival of dopamine neurons in PD mice; among which, Figure 7 A represents the results of behavioral experiments on mouse rotarods and pole climbing. Figure 7 B represents the immunofluorescence assay result. Figure 7 C represents the number of TH-positive cells in the substantia nigra region of mice. Detailed Implementation

[0050] Through extensive and in-depth research and numerous experimental screenings, the inventors unexpectedly discovered for the first time that camel tarragon hydrochloride (HH) has a highly effective therapeutic effect on specific Parkinson's disease patients characterized by abnormally elevated levels of the vasoactive intestinal peptide (VIP). This invention provides drugs and kits for the corresponding treatment of Parkinson's disease. Experiments show that HH can specifically reduce the expression of pro-inflammatory VIP, thereby precisely intervening in the VIP-mediated microglial-related neuroinflammatory pathway, thus significantly treating Parkinson's disease. This effect is particularly suitable for patients in specific pathological stages of Parkinson's disease progression where the endogenous VIP system is in a compensatory abnormally elevated state, or for patients with abnormally elevated VIP levels, thus providing a new, clearly targeted strategy for the treatment of PD. Based on this, the inventors completed this invention.

[0051] Vasoactive intestinal peptides Vasoactive intestinal peptide (VIP) is a peptide composed of 28 amino acids. It was initially isolated from the duodenum of pigs and was later found in endocrine cells as well as in the central and peripheral nervous systems.

[0052] In the progressive course of Parkinson's disease (PD), according to the Braak staging system, Lewy pathology first appears in areas such as the medulla oblongata and olfactory bulb, at which point patients may only exhibit non-motor symptoms such as decreased sense of smell or constipation. As the disease progresses, the pathological changes spread upwards to the substantia nigra pars compacta of the midbrain, leading to a significant loss of dopaminergic neurons and thus triggering typical motor symptoms (such as resting tremor and bradykinesia). In the middle and late stages of the disease, the pathology further spreads to the limbic system and neocortex, resulting in complex clinical manifestations such as cognitive impairment and psychiatric symptoms.

[0053] Microglia are the smallest glial cells and form the first and most important immune defense in the central nervous system. Activation of microglia has a dual effect on neurons: moderate activation can provide neuroprotection and repair; however, excessive activation can release toxic substances, trigger neuroinflammation, and thus damage or even kill neurons. This shift from protection to damage is a key link in the development of neurodegenerative diseases.

[0054] The Parkinson's disease (PD) pathological stimulation model described in this invention has one or more of the following characteristics: (1) Upregulation of vasoactive intestinal peptide mRNA expression in substantia nigra; (2) VIP mRNA expression is upregulated in microglia.

[0055] Preferably, it has one or more of the following features: (1) The expression of vasoactive intestinal peptide mRNA in the substantia nigra was upregulated by 1.8-4 times compared with the control group; (2) VIP mRNA expression in microglia was upregulated by more than 45 times compared with the control group.

[0056] In this invention, experimental verification revealed that the VIP level in human microglia (HMC3) was reduced by using 1-methyl-4-phenylpyridine iodide (MPP). + After modeling treatment, the levels of inflammatory factors such as TNF-α, IL-1β and IL-8 were also increased in HMC3 cells that overexpressed VIP, indicating that VIP has a pro-inflammatory effect in microglia.

[0057] The camel vesicant hydrochloride (HH) of this invention is specifically targeted at the period or subject with abnormally elevated endogenous VIP. When VIP is excessively or disorderedly elevated due to pathological stimulation, the application of HH can accurately and effectively downregulate the endogenous vasoactive intestinal peptide in the subject, thereby achieving the effect of improving PD.

[0058] Camel pine alkaloid hydrochloride Harmine Hydrochloride (HH), also known as Harmine Hydrochloride, is an indole alkaloid isolated from the ethanol extract of camel nut roots. Its core structure is a β-carboline alkaloid, and its chemical structural formula is as follows: In this invention, based on in-depth research on the neuroinflammatory mechanism in Parkinson's disease, it is revealed that HH exerts its unique pharmacological effect by specifically downregulating endogenous vasoactive intestinal peptide (VIP), intervening in the VIP-mediated pro-inflammatory microglial circuit, thereby providing a new strategy with a clear mechanism of action for the treatment of Parkinson's disease.

[0059] The main advantages of this invention include: 1. This invention reveals that inhibiting VIP may serve as a novel target for the treatment of Parkinson's disease, providing a theoretical basis for the development of new drugs.

[0060] 2. In this invention, the provided camel pine alkaloid hydrochloride, as a pharmaceutically active substance, can target and inhibit VIP-driven neuroinflammation originating from microglia, opening up new avenues for developing therapeutic strategies that can delay the progression of PD disease.

[0061] 3. The drugs or kits of the present invention are particularly suitable for PD patients in a specific pathological stage where endogenous VIP is abnormally elevated in the progression of Parkinson's disease or for PD patients with abnormally elevated endogenous VIP, thereby providing a new strategy with clear targeting for the treatment of PD.

[0062] 4. When used in conjunction with reagents for detecting vasoactive intestinal peptide (VIP) protein or mRNA, appropriate medications (i.e., camel pine hydrochloride) can be administered more precisely to patients with PD who are in a specific pathological stage of compensatory abnormal elevation of endogenous VIP or who have abnormally elevated endogenous VIP, thereby achieving better treatment results with fewer side effects.

[0063] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0064] Experimental methods 1. Cell Culture and Model Construction 1.1 Cell lines and culture conditions Human microglia cell line HMC3 was cultured in DMEM medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) at 37°C in a 5% CO2 incubator. Cells were passaged after digestion with 0.25% trypsin-EDTA when the cell density reached 80%-90%.

[0065] 1.2 MPP + Induced neuroinflammation model HMC3 cells in logarithmic growth phase were seeded in 6-well plates (5 × 10⁻⁶ cells / well). 5 / hole), after adhering to the wall, replace with one containing 1.5 mm MPP. + Fresh (Sigma, D048) culture medium was used for continuous treatment for 24 hours. The control group was treated with an equal volume of PBS.

[0066] 1.3 Construction of VIP-overexpressing cells HMC3 cells were infected with the Lenti-VIP overexpression vector (pLVX-IRES-mcherry) and the empty vector control (Lenti-NC). The mcherry expression rate was observed under a fluorescence microscope 48 hours later. The overexpression VIP (OE VIP) plasmid sequence is shown in Sequence ID NO:1 (Sequence ID NO: M36634.1, Range 1: 67 to 579): atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattgacatgttgcaaaatgcattagctgaaaatgacacaccctattatgatgtatccagaaatgccaggcatgctgatggagt tttcaccagtgacttcagtaaactcttgggtcaactttctgccaaaaagtaccttgagtctcttatgggaaaacgtgttagcagtaacatctcagaagaccctgtaccagtcaaacgtcactcagatgc agtcttcactgacaactatacccgccttagaaaacaaatggctgtaaagaaatatttgaactcaattctgaatggaaagaggagcagtgagggagaatctcccgactttccagaagagttagaaaaatga HMC3 cells expressing the mcherry fluorescent protein (mcherry expression rate > 90%) were selected as VIP fluorescent reporter cell lines.

[0067] 2. Drug Screening and Processing 2.1 Screening using a fluorescence reporter system VIP fluorescent reporter cells were seeded in 96-well black-walled plates (1×10⁻⁶ cells / well). 4 Cells were attached to wells and then incubated at 37°C for 24 hours. Fluorescence intensity (excitation wavelength 585 nm, emission wavelength 610 nm) was measured using a Varioskan LUX microplate reader (Thermo Fisher).

[0068] 2.2 Processing of individual Chinese medicinal herbs MPP + After treating HMC3 cells with (1.5 mM) for 24 h, HH or other candidate Chinese medicine monomers (such as Swertiamarin, SWE) obtained through screening were added to HMC3 cells and treated again for 24 h.

[0069] 3. Molecular biological detection 3.1 Cell viability assay (CCK-8 assay) Lenti-VIP and control group cells were seeded in 96-well plates (5 × 10⁶ cells / well). 3 Cells were incubated in wells ( / well) for 2 hours after cell adhesion, and then incubated with CCK-8 reagent. The absorbance (OD value) was measured at 450 nm using a microplate reader. Cell viability was calculated as (experimental group OD / control group OD) × 100%.

[0070] 3.2 Real-time quantitative PCR (qPCR) Total RNA was extracted from cells using the TRIzol method (Invitrogen) and detected using a Roche 480 real-time quantitative PCR instrument.

[0071] 4. Animal models 4.1 Constructing a mouse model of subacute Parkinson's disease C57BL / 6J male mice were randomly divided into a normal control group, an MPTP group, an MPTP+HH-10mg / kg group, an MPTP+HH-20mg / kg group, and an MPTP+HH-30mg / kg group. The mice in each HH group were administered the drug via alternating intraperitoneal injection and gavage. Among them, (1) Parkinson's disease model group: eight-week-old C57BL / 6J wild-type male mice were injected intraperitoneally once a day for 5 consecutive days at a concentration of 30mg / kg MPTP-HCl (dissolved in physiological saline), for a total of 5 times; (2) the control group was injected with the same amount of physiological saline; (3) Camelthorn alkaloid hydrochloride treatment group (HH group): after the establishment of the model group, i.e. after the last injection of MPTP, different concentrations of HH were administered via intraperitoneal injection and gavage (once a day) until the samples were collected, for a total of 21 days.

[0072] 4.2 Behavioral Science: Rotating Rod Experiment Mouse rotarod fatigue testing was performed. The rotation speed was set to 30 r / min, starting from 0 rpm and accelerating to 30 rpm for 5 minutes. The duration of movement on the rotarod was recorded, and the average value was taken from three tests, with each test 1 minute apart. To ensure experimental stability, mice were trained on the rotarod three times before MPTP injection, and the time for each mouse was recorded three times before data collection. 4.3 Behavioral Science: Pole Climbing Experiment The pole climbing test was used to assess the motor coordination and agility of mice. The experimental setup consisted of a rough-surfaced vertical pole with a diameter of about 1 cm and a height of about 50 cm, with a circular platform with a diameter of about 1 cm placed at the top of the pole as the starting position for the mice.

[0073] Before the formal test, the mice underwent three consecutive days of acclimatization training to familiarize them with the behavior of autonomously climbing from the top platform to the bottom of the pole. During the test, the mice were placed headfirst on the top platform, and the time required for the mouse to climb completely down and have all four paws touch the bottom of the pole was recorded. Each mouse was tested three times, and the average score was taken as its pole climbing score.

[0074] 4.4 Immunofluorescence Mice were fixed in PBS and 4% paraformaldehyde after cardiac perfusion. The whole brain was then post-fixed in 4% paraformaldehyde overnight and dehydrated using a sucrose gradient. Coronal sections of brain tissue with a thickness of 30 μm were prepared using a cryostat and stored at -80°C for later use.

[0075] For tyrosine hydroxylase (TH) immunofluorescence staining, the slides were warmed, washed with PBS, blocked with blocking solution, and then incubated with TH direct-labeled antibody at room temperature for 2 hours. After washing again, the slides were mounted with anti-fluorescence quenching mounting medium containing DAPI. Finally, the slides were observed and images were acquired under a fluorescence microscope.

[0076] 4.5 Isolation of microglia and sorting with magnetic beads Cerebral cortex and midbrain tissue were collected from adult mice. The experimental animals were divided into a normal control group (CON) and an MPTP model group. The dissected tissues were minced and enzymatically digested with a dissociation solution, then incubated at 37°C. The reaction was then terminated by adding an inhibitor. Single-cell suspensions were prepared by low-speed centrifugation and mechanical pipetting, washed, and filtered through a 37 µm cell filter.

[0077] Cells were resuspended in pre-chilled MojoSort™ Buffer and incubated on ice with a mixture of biotinylated antibodies and streptavidin nanobeads. Cells were then placed in a magnetic rack for magnetic sorting, and the sorting was repeated to improve purity, ultimately yielding microglia from the cerebral cortex and midbrain regions of 3-year-old mice derived from the CON group and MPTP model group.

[0078] Example 1: Expression of the VIP gene in the substantia nigra 1.1 Expression profile analysis of VIP gene in substantia nigra tissue in a Parkinson's disease model Transcriptomic analysis of the substantia nigra revealed significant enrichment of the neuroactive ligand-receptor interaction (NRV) signaling pathway. Descriptive analysis based on transcriptomic sequencing data showed a clear upregulation trend of VIP mRNA in the substantia nigra of an MPTP-induced Parkinson's disease model, as shown in the results below. Figure 1 As shown.

[0079] In the substantia nigra, the FPKM values ​​in the PD model group (0.13735, 0.093574) were consistently higher than those in the control group (0.058725, 0.047997), with a mean value 2.16 times that of the control group. This suggests that endogenous VIP may play an important role in Parkinson's disease.

[0080] 1.2 VIP expression was significantly upregulated in the Parkinson's disease model. To clarify the regulatory role of VIP in PD, the inventors conducted investigations in both in vivo and in vitro models.

[0081] In in vivo animal experiments, a PD mouse model was established using MPTP treatment. Real-time quantitative PCR (qPCR) analysis of the substantia nigra (SN) tissue revealed that, compared to the control group, the expression of VIP mRNA in the substantia nigra region of the MPTP-treated mice was significantly upregulated. Figure 2 A).

[0082] Given the important role of microglia in PD-related neuroinflammatory responses, this suggests that VIP may be involved in regulating immune and inflammatory processes. To further clarify the changing trends of VIP in glial cells, the inventors isolated microglia from the cerebral cortex and midbrain regions of adult mice and performed qPCR detection. The results showed that, compared with the control group, VIP mRNA expression in microglia of the MPTP model group was also significantly increased (…). Figure 2 B), and its trend is consistent with the results in the substantia nigra.

[0083] Next, in the in vitro experiments, MPP was used. + (1.5 mM, 24 h) induced human microglia HMC3 and mouse microglia BV2. qPCR analysis showed that, compared with the control group, MPP + There was no significant difference in VIP mRNA expression levels in the treated BV2 cell lines. Figure 2 C), while MPP + The expression level of VIP mRNA in the treated HMC3 cell line was significantly upregulated by approximately 300-fold. Figure 2 D). This suggests that under pathological stimulation, endogenous VIP in HMC3 of microglia is significantly upregulated.

[0084] The above results indicate that, in both animal and cell models, pathological stimulation by PD can lead to a sharp increase in VIP expression in microglia.

[0085] 1.3 Overexpression of VIP induces decreased microglial cell survival. To clarify the role of VIP in the regulation of neuroinflammation in Parkinson's disease, the inventors obtained HMC3 microglia in the empty vector negative control group (Lenti-NC) (NC group) and VIP-overexpressing cells (Lenti-VIP) (OE group) using lentiviral stable transfection and flow cytometry sorting. HMC3 cells expressing mcherry fluorescent protein (mcherry expression rate >90%) were selected as the VIP fluorescent reporter cell line. Figure 3 A). Then, the expression level of VIP was detected by qPCR and ELISA.

[0086] Consistent results from qPCR and ELISA assays indicated that, compared to the control group, the mRNA expression level of VIP in the Lenti-VIP group was significantly lower. Figure 3 B) and the level of VIP protein in its cell supernatant ( Figure 3 C) were all significantly upregulated, which also proves that VIP overexpression cells were successfully constructed.

[0087] Cell proliferation activity was assessed using the CCK-8 colorimetric assay system. Figure 3 D) The results showed that, compared with the control group, the cell survival rate in the Lenti-VIP group was significantly reduced, suggesting that overexpression of VIP can induce or promote microglia death. This result provides key experimental evidence for further elucidating the pro-inflammatory role of VIP in PD, namely, the abnormal increase of endogenous VIP in microglia leads to microglia death and accelerates the progression of PD.

[0088] 1.4 Overexpression of VIP drives the activation of pro-inflammatory factors in microglia To investigate the inflammatory level of HMC3 after VIP overexpression, the expression levels of cellular inflammatory factors were detected by qPCR.

[0089] Experimental results showed that, compared with the control group, overexpression of VIP significantly upregulated the pro-inflammatory cytokine TNF-α ( ). Figure 4 A), IL-1β Figure 4 C) and IL-8 ( Figure 4 B) mRNA expression level ( P <0.05). This suggests that abnormally elevated VIP in microglia can exert its pro-inflammatory effect by upregulating key pro-inflammatory mediators TNF-α, IL-1β, and IL-8, thereby promoting the progression of PD.

[0090] Example 2: Screening for compounds that inhibit VIP expression from a library of traditional Chinese medicine monomers Based on the constructed VIP fluorescent reporter cell line, this invention utilizes a Varioskan LUX multifunctional microplate reader (excitation wavelength 585 nm, emission wavelength 610 nm) for high-throughput drug screening, with results as follows: Figure 5 As shown.

[0091] Among the more than 190 compounds screened, quantitative analysis revealed that four compounds, including 20S-protopanaxadiol, Swertiamarin, Vitamin B12, and HH, could significantly reduce fluorescence intensity. Figure 5 AH)( P <0.05), suggesting that the candidate drug may exert its effect by targeting and regulating VIP.

[0092] Studies of other common Chinese herbal monomers have revealed differences in their classic mechanisms of action compared to the specific findings of this experiment. For example, Figure 5 Benzoylpaeoniflorin in B is known to have anti-inflammatory, immunomodulatory and neuroprotective effects; however, in the model system of this invention, it did not reduce fluorescence intensity, but rather significantly increased it.

[0093] Similarly, sodium ferulate, a potent antioxidant, has been documented as a neuroprotective agent for the prevention and treatment of Parkinson's disease (PD). However, its therapeutic mechanism primarily involves potent antioxidant activity and activation of the Nrf2 pathway. The screening results of this invention, however, showed that this compound did not reduce fluorescence intensity, suggesting that it has no effect on VIP.

[0094] The results of this invention indicate that although known neuroprotective agents such as benzoylpaeoniflorin and sodium ferulate may exert their anti-Parkinson's disease effects through classical pathways such as antioxidation and anti-inflammation, their mechanism of action does not depend on the regulation of endogenous vasoactive intestinal peptide (VIP) levels. In other words, the therapeutic effects of these compounds are not achieved by regulating the VIP pathway.

[0095] In stark contrast, this invention has discovered a class of PD therapeutic agents with different mechanisms of action, including (20S)-protopanaxadiol, swertiamarin, vitamin B12, and compound HH. Among these, compound HH stands out, its core mechanism being the effective reduction of VIP levels. Through this unique pharmacological pathway, HH aims to directly intervene in the pathological processes such as neuroinflammation mediated by endogenous VIP, thus providing a new approach to the treatment of Parkinson's disease that differs from traditional neuroprotective strategies.

[0096] Further fluorescence microscopy observations provided direct evidence for this: the fluorescence intensity of the HH-treated group was significantly reduced ( Figure 5I). In this reporter system, the fluorescence signal intensity is positively correlated with the intracellular VIP expression level; therefore, a decrease in fluorescence intensity indirectly reflects the downregulation of the VIP pathway by the drug.

[0097] Based on this, HH was identified as a key candidate compound for subsequent research. This discovery not only elucidates its unique mechanism of action but also lays an important experimental foundation for the development of specific small molecule inhibitors targeting VIP.

[0098] Example 3: Pharmacological effects of camel thorn alkaloid hydrochloride in in vivo and in vitro models. 3.1 HH promotes neuronal survival by reducing VIP expression in microglia. Based on the VIP inhibitor candidate compound HH obtained through screening using a fluorescence reporter system, this invention further establishes MPP + Functional validation was performed on induced HMC3 cells (1.5 mM, 24h treatment) and HMC3 cells overexpressing VIP.

[0099] qPCR testing showed that in MPP + Under stimulation conditions, the expression level of VIP mRNA in cells of the HH intervention group was significantly lower than that in the model group, and the VIP expression level in microglia overexpressing VIP was also significantly reduced after HH treatment. Figure 6 (AB), which is consistent with the screening results of the fluorescence reporter system. This finding further confirms that HH can significantly inhibit VIP in the cell model, suggesting that it can exert its anti-inflammatory effect by downregulating VIP expression.

[0100] Furthermore, the present invention respectively uses MPP + Supernatant from treated HMC3 cells and supernatant from VIP-overexpressing HMC3 cells were co-cultured with SH-SY5Y neuronal cells. Results showed that both conditions significantly reduced neuronal cell viability. Figure 6 C).

[0101] These results indicate that HH can promote neuronal survival by reducing the expression of VIP in microglia, providing experimental evidence for its potential role as a neuroprotective agent.

[0102] 3.2 HH may effectively improve motor dysfunction in Parkinson's disease mice and protect dopamine neurons by inhibiting VIP expression. To further investigate the role of HH in a mouse model of Parkinson's disease, an MPTP-induced PD model was constructed in C57BL / 6J mice. Different doses of HH were administered (10 mg / kg, 20 mg / kg, and 30 mg / kg) to systematically evaluate the protective effect of this compound on dopamine neurons and its effect on motor behavior. During the experiment, rotarod and pole-climbing behaviors were performed on mice 21 days after model establishment to assess their motor coordination and balance abilities. Simultaneously, immunofluorescence was used to detect changes in the number of dopamine-positive neurons in the substantia nigra of the midbrain to clarify the drug's intervention effect on PD.

[0103] The results of the rotarod and pole climbing behavioral experiments showed that, compared with the model group, HH treatment significantly improved the motor coordination ability of PD mice in rotarod and pole climbing. P <0.05)( Figure 7 A); Immunofluorescence results showed that, compared with the model group, the number of TH-positive cells in the substantia nigra region significantly increased after HH treatment. P <0.05)( Figure 7 (BC). The above results indicate that HH can improve motor dysfunction in PD model mice and has a protective effect on dopamine neurons, ultimately alleviating PD.

[0104] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A reagent kit, characterized in that, The kit includes: (1) A pharmaceutical composition comprising a therapeutically effective amount of camel pine hydrochloride and a pharmaceutically acceptable carrier; and (2) Detection reagents for detecting vasoactive intestinal peptide (VIP) mRNA and / or protein.

2. The kit according to claim 1, characterized in that, The detection described in (2) includes the following steps: Transcriptomic RNA-seq analysis was performed on the substantia nigra tissue of the treatment subjects; or real-time quantitative PCR (qPCR) detection was performed on the microglia of the treatment subjects.

3. The kit according to claim 1, characterized in that, The dosage of the pharmaceutical composition is 5 mg-50 mg / kg / day, based on the mass of camel thorn hydrochloride.

4. The use of the kit according to claim 1, characterized in that, Used to prepare medicine boxes for treating Parkinson's disease.

5. The use as described in claim 4, characterized in that, The medication kit treats Parkinson's disease by downregulating vasoactive intestinal peptides in the body of a subject who has one or more characteristics selected from the group consisting of: (1) The expression levels of vasoactive intestinal peptide (VIP) mRNA and / or protein in the substantia nigra are upregulated; (2) The expression levels of vasoactive intestinal peptide (VIP) mRNA and / or protein are upregulated in microglia in the cerebral cortex, midbrain and / or substantia nigra.

6. The use as described in claim 4, characterized in that, The kit is used to downregulate the expression level or activity of endogenous vasoactive intestinal peptide (VIP).

7. The use as described in claim 4, characterized in that, The kit is used to reduce VIP expression in microglia of the central nervous system and alleviate neuroinflammation.

8. The use as described in claim 4, characterized in that, The medicine box is used in combination with another Parkinson's disease treatment drug.

9. The use as described in claim 8, characterized in that, Another Parkinson's disease treatment drug is selected from the group consisting of: levodopa, dopamine receptor agonists, MAO-B inhibitors, or COMT inhibitors.

10. A method for screening potential therapeutic agents for PD, characterized in that, Including the following steps: (a) In the experimental group, microglia were cultured in the presence of the candidate compound; and in the blank control group, microglia were cultured under the same conditions as the experimental group but without the candidate compound. (b) The expression levels of endogenous VIP in microglia in the experimental group (V1) and in microglia in the blank group (V0) were measured and compared. Specifically, when the expression level V1 is significantly lower than the expression level V0, this suggests that the candidate compound is a potential therapeutic agent for PD treatment.

Images