Genetically engineered escherichia coli for synthesizing l-histidine and preparation method thereof

By performing multi-module genetic engineering on Escherichia coli W3110 and optimizing the fermentation process, the problems of insufficient supply of precursors and reducing power and product accumulation in the microbial fermentation production of L-histidine were solved, achieving efficient L-histidine synthesis and high sugar-acid conversion rate.

CN122278733APending Publication Date: 2026-06-26HENAN ZHONGYUAN YUZE BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610201634.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-11
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing microbial fermentation processes for producing L-histidine suffer from low yields and poor sugar-acid conversion rates due to insufficient supply of precursors and reducing power, high unnecessary metabolic consumption, and toxic accumulation of products within cells.

Method used

By performing multi-module genetic engineering on Escherichia coli W3110, including hisG gene site modification, ushA and nrdD gene deletion, zwf and gnd gene heterologous integration, pgi gene promoter replacement, and lysE gene heterologous integration, combined with optimized fermentation process, carbon metabolic flux was redirected, competitive pathways were blocked, and product efflux was enhanced.

Benefits of technology

It significantly improved the synthesis efficiency and sugar-acid conversion rate of L-histidine, reduced the toxicity of intracellular product accumulation, and achieved efficient L-histidine production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This application relates to the fields of bioengineering and fermentation technology, and discloses a genetically engineered *Escherichia coli* strain that synthesizes L-histidine and its preparation method. The engineered strain uses *Escherichia coli* W3110 as the starting strain and is modified... hisG Gene release from feedback inhibition; knockout ushA and nrdD Genes reduce precursor consumption; inactivation slyA Genes reduce energy waste; heterogeneous integration zwf and gnd Genes and replacement pgi The gene promoter redirects carbon flow to the pentose phosphate pathway, enhancing the supply of key precursors PRPP and reducing agent NADPH; introducing courtE Genes promote product efflux. Combined with an optimized fed-batch fermentation process, this invention effectively solves the problems of insufficient precursor supply, uneven energy distribution, and product inhibition through a systems metabolic engineering strategy, increasing L-histidine yield and sugar-acid conversion rate, making it suitable for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of bioengineering and fermentation technology, specifically to a genetically engineered Escherichia coli that synthesizes L-histidine and its preparation method. Background Technology

[0002] L-histidine, a semi-essential amino acid, has wide applications in the pharmaceutical, food additive, and feed industries. Currently, microbial fermentation has become the mainstream process for producing L-histidine, with *Escherichia coli* being widely used as the production chassis due to its clear genetic background and rapid growth rate. However, the biosynthetic pathway of L-histidine is lengthy and its metabolic regulation mechanism is complex, and achieving high-yield industrial production still faces many technical challenges.

[0003] In the metabolic engineering of L-histidine, the rational allocation of central carbon flux is one of the key bottlenecks limiting yield. L-histidine biosynthesis is highly dependent on the continuous supply of the precursor ribose-5-phosphate pyrophosphate (PRPP) and the reducing coenzyme NADPH, both primarily derived from the pentose phosphate pathway (PPP). However, in the natural metabolic network of *E. coli*, the vast majority of glucose carbon flux tends to be catabolized via glycolysis (EMP), resulting in a relatively low flux entering the PPP pathway. Consequently, the production rates of PRPP and NADPH cannot meet the demands of large-scale L-histidine synthesis. Although current research typically initiates the synthetic pathway by relieving the feedback inhibition of the key enzyme ATP phosphoribosyltransferase, without addressing the fundamental contradiction of insufficient upstream precursor supply, it is difficult to significantly improve synthetic efficiency.

[0004] Furthermore, intracellular bypass metabolic pathways and unnecessary physiological activities lead to the inefficient consumption of substances and energy, severely limiting the improvement of glucose-acid conversion rates. For example, endogenous nucleotide-degrading enzymes and reductases competitively consume metabolic intermediates and reducing power, while non-productive activities such as maintaining flagellar motility in bacteria dissipate a large amount of ATP energy. Existing modification strategies often focus on enzymatic modifications of the main synthetic pathway, neglecting the systematic optimization of whole-cell energy metabolism and resource allocation, thus preventing substrates from flowing to the target product to the maximum extent.

[0005] Meanwhile, as product concentration increases during fermentation, the accumulation of high intracellular L-histidine concentrations causes severe osmotic stress and metabolic toxicity, thereby inhibiting cell growth activity and productivity. Existing engineered strains typically lack efficient active efflux mechanisms, leading to intracellular product retention. This not only exacerbates feedback inhibition but also shortens the effective acid production cycle of fermentation, limiting further improvements in industrial production efficiency. Therefore, there is an urgent need to develop an engineered strain and its supporting fermentation process that can systematically address the issues of precursor supply, energy optimization, and product efflux. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a genetically engineered Escherichia coli for synthesizing L-histidine and its preparation method, which solves the problems of low yield and low sugar-acid conversion rate caused by insufficient supply of precursors and reducing power, high unnecessary metabolic consumption, and intracellular accumulation and toxicity of products in the existing microbial fermentation production of L-histidine.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a genetically engineered *Escherichia coli* strain that synthesizes L-histidine, employing the following technical solution: A genetically engineered *Escherichia coli* strain that synthesizes L-histidine, wherein the *E. coli* strain is *E. coli* W3110, and its genome contains the following genetic modifications: hisG Modification of gene loci, wherein the modification relieves the feedback inhibition of HisG protein; ushA Deletion of gene loci; nrdD Deletion of gene loci; zwf Genes and gnd Heterologous integration of genes; pgi Replacement of gene promoters; High School Heterologous integration of genes; slyA Gene inactivation.

[0009] By adopting the above technical solution, this invention enhances the synthesis capacity of L-histidine through the synergistic effect of multiple modules. Its specific mechanism of action includes the following aspects: Overcoming rate-limiting enzyme feedback inhibition: hisG The gene encodes ATP phosphoribosyltransferase, the first rate-limiting enzyme in the histidine biosynthesis pathway. By modifying this site, the allosteric binding site between the product L-histidine and the enzyme is disrupted, allowing the enzyme to maintain high catalytic activity even in the presence of high concentrations of histidine, thus ensuring the continuous operation of the biosynthesis pathway.

[0010] Redirecting center carbon metabolism flux: L-histidine synthesis is highly dependent on the precursor ribose-5-phosphate pyrophosphate (PRPP) and the reducing agent NADPH. This invention addresses this by replacing... pgi The promoter of the (glucose-6-phosphate isomerase) gene weakens the carbon flux in the glycolysis pathway; simultaneously, through heterologous integration... zwf (glucose-6-phosphate dehydrogenase) and gnd (6-phosphoglucose dehydrogenase) enhances the pentose phosphate pathway (PPP). This strategy directs more glucose carbon skeletons to the PPP pathway, thereby significantly increasing the intracellular supply of PRPP and NADPH.

[0011] Blocking competition and consumption pathways: ushA Encoding UDP-glycolytic enzyme and 5'-nucleotidase, nrdD Encodes anaerobic ribonucleotide reductase. (Deficit) ushA It reduces unnecessary degradation of metabolic intermediate nucleotides and also reduces the ineffective consumption of ATP in the UDP-glycan synthesis and hydrolysis cycle; [The text abruptly ends here, likely due to an incomplete sentence or missing information.] nrdD This modification blocks the competitive consumption of reducing power under microaerobic or anaerobic conditions. It reduces side reactions and concentrates metabolic resources on the synthesis of the desired product.

[0012] Global energy optimization (throttling strategy): slyA Genes are transcriptional regulators that control flagellar motility and certain virulence factors in E. coli. Through inactivation... slyA This inhibits flagellar formation and movement, thereby reducing the ATP consumption of the cell for movement. The saved ATP energy is redistributed for bacterial growth and the energy-intensive histidine synthesis process.

[0013] Enhanced product efflux: High School The gene encodes an amino acid efflux protein. By heterologously integrating this gene, intracellularly synthesized L-histidine can be actively pumped out of the cell. This not only reduces the concentration of the intracellular product and alleviates the osmotic toxicity of the product to the cell, but also further shifts the chemical equilibrium of the synthesis reaction toward product formation.

[0014] Preferably, the genetic modification specifically refers to: hisG The modification of the gene site involves replacing the wild-type gene with the nucleotide sequence shown in SEQ ID NO:1; ushA The deletion of the gene site is the deletion of the nucleotide sequence shown in SEQ ID NO:2; nrdD The deletion of the gene site is the deletion of the nucleotide sequence shown in SEQ ID NO:3; zwf Heterologous integration of the gene is the integration of a nucleotide sequence as shown in SEQ ID NO:4; gnd Heterologous integration of the gene is the integration of a nucleotide sequence as shown in SEQ ID NO:5; pgi The gene promoter is replaced by replacing the natural promoter sequence upstream of the pgi gene coding region shown in SEQ ID NO: 6, as shown in SEQ ID NO: 7, with the P gene sequence shown in SEQ ID NO: 8. fliA The promoter sequence; High School Heterologous integration of the gene is the integration of a nucleotide sequence as shown in SEQ ID NO: 9; slyA Gene inactivation is achieved by mutating the wild-type gene to a nucleotide sequence as shown in SEQ ID NO:10.

[0015] By employing the above technical solutions, the specific sequence design of each gene locus further optimized the modification effect. For example, SEQ ID NO:1 contains a specific point mutation that precisely disrupts the allosteric regulatory site without affecting the catalytic center; SEQ ID NO:8 shows P... fliA The promoter has flexible transcriptional strength, which can control the expression level of Pgi enzyme at a critical point that maintains basic cell growth but is insufficient to divert a large amount of carbon source; SEQ ID NO:4 and SEQ ID NO:5 use codon-optimized heterologous sequences, which have higher expression efficiency and enzyme stability in the host.

[0016] Preferably, the sequence shown in SEQ ID NO:1 contains a HisG protein coding sequence encoding the H232K and R250H double mutation; the sequence shown in SEQ ID NO:4 encodes a glucose-6-phosphate dehydrogenase from Corynebacterium glutamicum containing the A243T mutation; the sequence shown in SEQ ID NO:5 encodes a 6-phosphate gluconate dehydrogenase from Corynebacterium glutamicum containing the S361F mutation; and the sequence shown in SEQ ID NO:10 has a CAG mutation at codon 125 replaced by a TAA stop codon.

[0017] By employing the above technical approach, the mutation sites of key enzymes were identified. H232K and R250H are key amino acid residue variations that relieve HisG feedback inhibition; Zwf and Gnd enzymes from Corynebacterium glutamicum themselves have high catalytic activity, and specific point mutations further relieve their potential inhibitory regulation. slyA Specific nonsense mutations in genes (prematurely introducing a stop codon) ensure the complete loss of function of the regulatory factor, which is a stable and irreversible mode of inactivation.

[0018] Secondly, the present invention provides a method for preparing genetically engineered Escherichia coli that synthesizes L-histidine, using the following technical solution: A method for preparing genetically engineered *Escherichia coli* that synthesizes L-histidine, used to prepare the genetically engineered *Escherichia coli* described in the first aspect above, comprising the following steps: S1, inoculating the genetically engineered *Escherichia coli* into a seed culture medium for seed culture to obtain a seed liquid; S2, inoculating the seed liquid into a fermentation culture medium for fermentation culture, adding feed solution during fermentation, and collecting L-histidine from the fermentation broth; the fermentation culture medium contains the following components at the following concentrations: glucose 20.0-30.0 g / L, yeast extract 4.0-6.0 g / L, ammonium sulfate 5.0-7.0 g / L, potassium dihydrogen phosphate 6.0-8.0 g / L, magnesium sulfate heptahydrate 1.5-2.5 g / L, citric acid monohydrate 1.5-2.5 g / L, L-methionine 1.5-2.5 g / L, and ribose 5-phosphate 0.05-0.15 mM.

[0019] By adopting the above technical solution, the preparation method established by this invention is highly compatible with the metabolic characteristics of the engineered strain: Direct precursor enhancement: Adding a trace amount of 5-phosphate ribose directly to the fermentation medium can serve as a precursor for the salvage pathway, which can be taken up by the cells and directly enter the histidine synthesis pathway, relieving the pressure of intracellular de novo synthesis of PRPP and playing a priming effect.

[0020] Nitrogen source and cofactor balance: The high concentration of ammonium sulfate provides sufficient amino acid donors, and the appropriate amount of L-methionine meets the nitrogen metabolism and methylation modification requirements of the engineered strain during high-intensity amino acid synthesis.

[0021] Phosphate buffering and metabolism: High concentrations of potassium dihydrogen phosphate not only serve as a phosphorus source in the synthesis of nucleotides and PRPP, but also construct a high-capacity buffer system, which is beneficial for maintaining pH homeostasis during fermentation.

[0022] Preferably, the seed culture medium is LB medium, which contains the following components at the following concentrations: 10.0 g / L tryptone, 5.0 g / L yeast extract, and 10.0 g / L sodium chloride.

[0023] By adopting the above technical solution, the seed culture stage uses nutrient-rich LB medium, in which tryptone and yeast extract provide sufficient readily available nitrogen, amino acids, and growth factors. This nutrient-rich environment can significantly shorten the lag phase of the strain, prompting the engineered bacteria to quickly initiate division and enter the logarithmic growth phase, thereby obtaining a seed culture with sufficient biomass and vigorous metabolic activity in a short time. This ensures that the bacteria can quickly adapt to the environment and start high-density culture after inoculation into the fermenter.

[0024] Preferably, the fermentation medium also contains a vitamin mixture and a trace element mixture. The vitamin mixture provides the following concentrations: vitamin B1, vitamin B3, vitamin B5, vitamin B12, and vitamin H, each at 1.5-2.5 mg / L. The trace element mixture provides the following concentrations: zinc chloride 2.4-3.6 mg / L, calcium chloride 2.4-3.6 mg / L, ammonium molybdate 3.6-4.4 mg / L, copper sulfate 3.6-4.4 mg / L, and cobalt chloride 3.6-4.4 mg / L. By adopting the above technical solution, the added B vitamins serve as coenzymes for various metabolic enzymes (e.g., biotin is a coenzyme for carboxylases), and the trace elements (e.g., zinc and cobalt) are the active centers of key metalloenzymes. This complete micronutrient supplementation prevents metabolic bottlenecks caused by micronutrient deficiency during high-density fermentation, ensuring the continuous production capacity of the engineered strain.

[0025] Preferably, in step S2, the fermentation process parameters are controlled as follows: fermentation temperature is controlled at 36-38℃; pH value is controlled at 6.5-7.0; dissolved oxygen is controlled at 20%-40%. By adopting the above technical solution, the mild temperature (36-38℃) is not only conducive to cell growth, but also conducive to maintaining heterologous protein expression (such as... Zwf , Gnd , High School The correct folding and soluble expression of ); the dissolved oxygen is controlled at a level of 20%-40%, which not only meets the energy demand of aerobic respiration, but also avoids the oxidative stress caused by excessive dissolved oxygen.

[0026] Preferably, the pH value is adjusted by adding 20%-25% w / v ammonia. By adopting the above technical solution, using ammonia to adjust the pH has a dual function: first, it neutralizes the organic acids produced during fermentation, maintaining a neutral environment; second, it continuously replenishes ammonium ions as a nitrogen source for histidine synthesis, thus achieving the coupling of pH control and substrate replenishment.

[0027] Preferably, in step S2, the feed solution is a glucose solution with a concentration of 500-800 g / L; the specific implementation of the fed-batch feeding is as follows: when the glucose concentration in the fermentation broth drops below 5.0 g / L, the feeding begins, and the glucose concentration in the fermentation broth is maintained at 0.1-5.0 g / L. By adopting the above technical solution and employing a restricted feeding strategy, residual sugar is controlled at a low level (0.1-5.0 g / L). This strategy effectively inhibits overflow metabolism (Crabtree effect), reduces the generation of the byproduct acetic acid, and prevents the toxic effects of acetic acid accumulation on cell growth, thereby achieving high cell density fermentation and maximizing the extension of the acid-producing period.

[0028] This invention provides a genetically engineered *Escherichia coli* strain for synthesizing L-histidine and its preparation method. It has the following beneficial effects: 1. This invention improves the synthesis efficiency of L-histidine by relieving the feedback inhibition of the rate-limiting enzyme HisG and reconfiguring the central carbon metabolic pathway. This is achieved by replacing... pgi The promoter moderately weakens glycolysis flux while heterologous integration. zwf and gnd The gene enhances the pentose phosphate pathway, directing more glucose carbon skeletons to the pentose phosphate pathway, which significantly increases the intracellular supply of key precursors 5-phosphoribose pyrophosphate (PRPP) and reducing agent NADPH required for the synthesis pathway. This overcomes the core bottleneck of insufficient carbon skeleton and reducing agent supply in L-histidine biosynthesis, thereby achieving increased yield.

[0029] 2. The engineered strain constructed in this invention significantly improves the efficiency of material and energy utilization through a systematic throttling strategy. In particular, the knockout of the encoding gene of the UshA protein, which has dual activities as a UDP-glycolytic enzyme and a 5'-nucleotidase, fundamentally blocks the ineffective hydrolysis cycle of intermediate metabolites nucleotides and glyconucleotides, significantly reducing the non-productive loss of precursor substances, thereby preserving more ATP energy and key precursors for L-histidine synthesis. Combined with the blocking of the reducing power competition pathway by the deletion of the nrdD gene and the inhibition of flagellar motility energy consumption by the inactivation of slyA, the limited metabolic resources of the cell are redirected to the biosynthesis of the target product to the maximum extent, significantly improving the sugar-acid conversion rate in the fermentation process.

[0030] 3. This invention, by introducing an exogenous transport mechanism and optimizing the fermentation process, ensures the steady state and continuous production capacity of the engineered strain under high-density fermentation conditions. The heterologously expressed LysE transporter enables the active efflux of L-histidine, reducing the osmolar toxicity and potential non-allosteric inhibition caused by the accumulation of high concentrations of intracellular products. Combined with a low residual sugar fed-batch strategy and the supplementation of specific trace elements and vitamins, the generation of the overflow metabolic byproduct acetic acid is inhibited, and the high activity of the metabolic enzyme system is maintained, enabling the strain to maintain a vigorous acid-producing capacity during long-cycle fermentation, ultimately obtaining a high concentration of L-histidine fermentation broth. Detailed Implementation

[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the embodiments and comparative examples. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0032] Preparation Examples 1-2: Preparation Example 1: Construction of CRISPR / Cas9 gene editing system target plasmids (pTarget series) This preparation example details the construction methods of eight recombinant pTarget plasmids used in subsequent gene editing steps. For each of the eight genetic modification sites involved in this invention, sgRNA expression plasmids containing specific target sequences (Spacer, N20 sequence) were designed.

[0033] First, specific primers were designed for each target gene site. The primer design principle was to introduce a 20 bp specific target sequence upstream of the sgRNA scaffold sequence of the pTarget plasmid template. Using the empty pTarget plasmid as a template, reverse PCR amplification was performed using high-fidelity DNA polymerase. The PCR reaction volume was 50 μL, containing 20 nmol of template plasmid, 0.4 μmol each of upstream and downstream primers, 25 μL of 2× high-fidelity PCR premix, and the remainder being deionized water. The PCR reaction program was set as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 2.5 min, for a total of 30 cycles; and a final extension at 72°C for 10 min. The PCR product was digested with DpnI restriction endonuclease at 37°C for 1 h to remove methylated template plasmid, and then the product was purified and recovered. The recovered linearized DNA fragments were circularized and ligated using Exnase II recombinase at 37°C for 30 minutes. The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing 50 mg / L spectinomycin hydrochloride, incubated overnight at 37°C. Single clones were randomly selected for sequencing verification. Plasmids whose sequencing results completely matched the designed sequence were considered successfully constructed recombinant plasmids. The eight constructed recombinant plasmids were named: pTarget- hisG (targeted) hisG Gene), pTarget- ushA (targeted) ushA Gene), pTarget- nrdD (targeted) nrdD Gene), pTarget- zwf (targeted) zwf Insertion site), pTarget- gnd (targeted) gnd Insertion site), pTarget- pgi (targeted) pgi (startup sub-region), pTarget- High School (targeted) High School Insertion site) and pTarget- slyA (targeted) slyA Gene).

[0034] Preparation Example 2: Preparation of Donor DNA Fragments for Homologous Recombination This preparation example details the method for preparing linear donor DNA fragments used in the subsequent 8 steps of gene editing. All donor DNA was prepared using fusion PCR (Overlap Extension PCR) technology, with a structure of upstream homologous arm-insertion / mutation sequence-downstream homologous arm or upstream homologous arm-downstream homologous arm (for gene knockout).

[0035] First, using E. coli W3110 genomic DNA as a template, homologous arm fragments of approximately 500 bp upstream and downstream of each target site were amplified using specific primers. Simultaneously, heterologous or mutant gene fragments were obtained through whole-genome synthesis as intermediate insertion fragments. Specifically, for HisG de-repression modification, the sequence shown in SEQ ID NO:1 was used as the intermediate fragment, and... hisG Donor-HisG was prepared by fusing upstream and downstream homologous arms at the site; for UshA and NrdD knockout, direct fusion was performed. ushA and nrdD Donor-UshA and Donor-NrdD were prepared by flanking homologous arms of the gene, without introducing foreign sequences in the middle. For Zwf introduction, the optimized and mutated gene sequences shown in SEQ ID NO:4 were used as the intermediate fragment and fused with the homologous arm of the genome integration site to prepare Donor-Zwf. For Gnd introduction, the optimized and mutated gene sequences shown in SEQ ID NO:5 were used as the intermediate fragment and fused with the homologous arm of the genome integration site to prepare Donor-Gnd. For Pgi promoter substitution, the Pgi sequence shown in SEQ ID NO:8 was used as the intermediate fragment. fliA The promoter sequence is an intermediate segment, and... pgi Donor-Pgi was prepared by fusing the homologous arms of the gene coding region start and upstream adjacent sequences; for LysE introduction, the sequence shown in SEQ ID NO:9 was used as the intermediate fragment and fused with the homologous arm of the genome integration site to prepare Donor-LysE; for SlyA inactivation, the gene fragment containing the early stop codon shown in SEQ ID NO:10 was used as the intermediate fragment and fused with... slyA Flanking sequences were fused to obtain Donor-SlyA. The fusion PCR reaction volume was 50 μL, containing 20 nmol of each fragment template, 0.4 μmol of each of the outermost forward and reverse primers, and 25 μL of 2× high-fidelity PCR premix. The reaction program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension (calculated at 1 kb / min), for a total of 35 cycles; 72°C extension for 10 min. After confirming the correct band size by agarose gel electrophoresis, the PCR products were purified by gel extraction, and the concentration was determined before storage at -20°C for later use.

[0036] Examples 1-4: Example 1: This example provides a genetically engineered Escherichia coli (named L-histidine) that synthesizes L-histidine. E. The construction method of coliHis-Opt includes the following steps: First, the plasmid pCas, containing a temperature-sensitive replicon and the Cas9 protein expression cassette, was transformed into Escherichia coli W3110 competent cells. The starting strain containing the pCas plasmid was then screened on LB plates containing 50 mg / L kanamycin sulfate at 30°C.

[0037] Next, using the pTarget series plasmids constructed in Preparation Example 1 and the DonorDNA series fragments prepared in Preparation Example 2, eight rounds of gene editing operations were performed in the following order: In the first round, using pTarget- hisG And Donor-HisG, will bring the wild-type genome hisG The gene was replaced with the sequence shown in SEQ ID NO:1 (containing H232K and R250H mutations); in the second round, pTarget- ushA And Donor-UshA, knockout genome represented by SEQ ID NO:2 ushA Gene sequence; third round, using pTarget- nrdD And Donor-NrdD, knockout genome represented by SEQ ID NO:3 nrdD Gene sequence; fourth round, using pTarget- zwf And Donor-Zwf, integrated into the genome as shown in SEQ ID NO:4 zwf Gene expression cassettes; fifth round, using pTarget- gnd And Donor-Gnd, integrated into the genome as shown in SEQ ID NO:5 gnd Gene expression cassettes; sixth round, using pTarget- pgi And Donor-Pgi, in the genome pgi The original promoter sequence (SEQ ID NO: 7) upstream of the gene (coding region as shown in SEQ ID NO: 6) is replaced with the P sequence shown in SEQ ID NO: 8. fliA Starter sequence; Round 7, using pTarget- High School And Donor-LysE, integrated into the genome as shown in SEQ ID NO:9 High School Gene expression cassettes; Round 8, using pTarget- slyA And Donor-SlyA, will include the genome slyA The gene mutation is the sequence shown in SEQ ID NO:10.

[0038] The specific procedures for each round of editing are as follows: Electrocompetent cells containing the pCas plasmid are prepared (induced by L-arabinose), co-transformed with the corresponding pTarget plasmid (100 nm) and Donor DNA (400 nm), and then revived at 30°C after electroporation and plated on plates containing kanamycin sulfate and spectinomycin hydrochloride for screening; after positive clones are verified by colony PCR and sequencing, they are first cultured in LB broth containing IPTG at 30°C to eliminate the pTarget plasmid before proceeding to the next round of transformation; after completing the 8th round of editing and eliminating the pTarget plasmid, the strain is cultured overnight at 42°C in antibiotic-free LB broth to eliminate the pCas plasmid, ultimately obtaining an engineered strain without plasmid residue. E.coli His-Opt.

[0039] Example 2: This example provides an engineered bacterium constructed using Example 1. E.coli The method for producing L-histidine by His-Opt fermentation includes the following steps: First, seed culture was prepared by inoculating the engineered bacteria into a 100 mL seed culture medium and then shaking it to obtain the seed culture. The seed culture medium was LB medium, with the following concentrations: tryptone 10.0 g / L, yeast extract 5.0 g / L, sodium chloride 10.0 g / L, and water as the solvent. The medium was cultured at 37°C and 220 rpm for 12 hours until the OD600 was approximately 3.0. Subsequently, the culture was carried out in a 5L fermenter. The seed culture was transferred at a 10% (v / v) inoculation rate into a fermenter containing 2.5L of fermentation medium. The fermentation medium formula was as follows: glucose 25 g / L, yeast extract 5 g / L, ammonium sulfate 6 g / L, potassium dihydrogen phosphate 7 g / L, magnesium sulfate heptahydrate 2 g / L, citric acid monohydrate 2 g / L, L-methionine 2 g / L, ribose 5-phosphate 0.1 mmol, a vitamin mixture (VB1, VB3, VB5, VB12, and VH each 2 mg / L), and a trace element mixture 2 mL / L. During fermentation, the temperature was maintained at 37°C throughout; the pH was maintained at 6.8 by automatically adding 25% ammonia; and dissolved oxygen was maintained at approximately 30% by cascade control of the stirring speed (200-800 rpm) and aeration rate (1-3 vvm). The feeding strategy is as follows: when the glucose concentration in the fermentation broth drops below 5.0 g / L, a glucose solution with a concentration of 600 g / L is fed in. The feeding control program maintains the glucose concentration in the fermentation broth between 0.1 and 5.0 g / L. The fermentation cycle is 60 hours.

[0040] Example 3: This example provides an engineered bacterium constructed using Example 1. E.coli A method for producing L-histidine by His-Opt fermentation, using fermentation parameter variant A, includes the following steps: First, the seed culture was prepared using the same method as in Example 2. Then, a 5L fermenter was used for cultivation. The seed culture was transferred at a 10% inoculum rate into a fermenter containing 2.5L of fermentation medium. In this example, the initial formulation of the fermentation medium was adjusted as follows: glucose 20 g / L, yeast extract 4 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 6 g / L, magnesium sulfate heptahydrate 1.5 g / L, citric acid monohydrate 1.5 g / L, L-methionine 1.5 g / L, ribose 5-phosphate 0.05 mmol, and the remaining vitamins and trace elements were the same as in Example 2. During fermentation, the temperature was maintained at 37°C throughout; the pH was maintained at 6.5 by automatically adding 25% ammonia; and dissolved oxygen was maintained above 20%. The feeding strategy was as follows: when the glucose concentration in the fermentation broth dropped below 5.0 g / L, a 500 g / L glucose solution was fed in, and the glucose concentration in the fermentation broth was maintained between 0.1 and 5.0 g / L through a feeding control program. The fermentation cycle is 72 hours.

[0041] Example 4: This example provides an engineered bacterium constructed using Example 1. E.coli A method for producing L-histidine by His-Opt fermentation, using fermentation parameter variant B, includes the following steps: First, the seed culture was prepared using the same method as in Example 2. Then, a 5L fermenter was used for cultivation. The seed culture was transferred at a 10% inoculum to a fermenter containing 2.5L of fermentation medium. In this example, the initial formulation of the fermentation medium was adjusted as follows: glucose 30 g / L, yeast extract 6 g / L, ammonium sulfate 7 g / L, potassium dihydrogen phosphate 8 g / L, magnesium sulfate heptahydrate 2.5 g / L, citric acid monohydrate 2.5 g / L, L-methionine 2.5 g / L, ribose 5-phosphate 0.15 mmol, and the remaining vitamins and trace elements were the same as in Example 2. During fermentation, the temperature was maintained at 37°C throughout; the pH was maintained at 7.0 by automatically adding 25% ammonia; and dissolved oxygen was maintained above 30%. The feeding strategy was as follows: when the glucose concentration in the fermentation broth dropped below 5.0 g / L, a glucose solution with a concentration of 800 g / L was fed in, and the glucose concentration in the fermentation broth was maintained between 0.1 and 5.0 g / L through a feeding control program. The fermentation cycle is 48 hours.

[0042] Comparative Examples 1-5: Comparative Example 1: Compared with Example 2, the difference is that the strain used was Escherichia coli W3110 (wild type), without any genetic engineering modification, and the other fermentation process parameters were the same.

[0043] Comparative Example 2: The difference from Example 2 is that the strain used (named...) E.coli His-Base only completed the first round of gene editing steps in Example 1 (i.e., only the mutated gene was replaced). hisG (The gene) was not subjected to subsequent second to eighth rounds of gene editing operations; all other aspects were the same.

[0044] Comparative Example 3: The difference compared to Example 2 is that the strain used (named...) E.coli His-NoPPP was constructed without the fourth, fifth, and sixth rounds of gene editing operations described in Example 1. That is, this strain did not introduce... zwf and gnd Genes, and pgi The promoter remains the natural wild type, while the rest of the genotypes are modified. hisG , ushA , nrdD , High School , slyA All parameters were retained, and the fermentation process parameters were the same.

[0045] Comparative Example 4: The difference compared to Example 2 is that the strain used (named...) E.coli His-NoSave omitted the second, third, and eighth rounds of gene editing operations described in Example 1 during its construction. This means the strain retained the naturally occurring genes in its genome. ushA , nrdD and slyA The gene (not knocked out or inactivated) was retained, and all other genotype modifications were preserved, with the same fermentation process parameters.

[0046] Comparative Example 5: The difference compared to Example 2 is that the strain used (named...) E.coli His-NoExp omitted the seventh round of gene editing in Example 1 during its construction. That is, no exogenous material was introduced into this strain. High School The genes were modified, and all other genotype modifications were retained, with the same fermentation process parameters.

[0047] Test Example 1-2: Test Example 1: Genotyping Verification of Engineered Strains Experimental instructions and procedures: This test case aims to validate the engineered strain obtained in Example 1 at the molecular level. E.coli The accuracy of His-Opt genome modification was assessed. The experiment employed colony PCR amplification combined with Sanger sequencing.

[0048] The specific steps are as follows: Pick out the items separated by the lines. E.coli His-Opt single colonies were resuspended in 50 μL of sterile deionized water and thermally lysed at 98°C for 10 minutes. The supernatant was then centrifuged and used as a template for PCR. This targeted 8 genetic modification sites ( hisG , ushA , nrdD , zwf , gnd , pgi , High School , slyA Specific validation primers were designed for each sample. The design principle for the validation primers was that the primer binding site was located on the genomic sequence outside the homologous recombination region to ensure that the amplified band could contain the complete modified region. Genomic DNA of the starting strain W3110 was used as a control template for synchronous amplification.

[0049] The PCR reaction system used was a 25 μL system containing 2×TaqMasterMix and 0.4 μmol each of forward and reverse primers. The amplification program was set as follows: 95°C pre-denaturation for 3 minutes; 30 cycles (95°C for 15 seconds, 56°C for 15 seconds, extension at 72°C, with the extension time set at 1 kb / min based on the amplified fragment length); and 72°C extension for 5 minutes. PCR products were separated by 1.0% agarose gel electrophoresis, and the band size was observed and recorded. Subsequently, the purified PCR products were sent to a sequencing company for Sanger sequencing, and the sequencing results were compared with the pre-defined mutant sequences (SEQ ID NO: 1 to SEQ ID NO: 10).

[0050] Test results: Table 1. Engineered Strains E.coli Summary of PCR validation and sequencing results for each His-Opt gene locus

[0051] Results analysis: Table 1 shows that engineered strains E.coli His-Opt yielded the expected PCR amplification bands at all target sites. For gene knockout sites ( ushA and nrdD The amplified band of the His-Opt strain was smaller than that of the starting strain W3110. The difference in band size was consistent with the length of the knockout fragment, indicating that the competing pathway gene had been physically removed from the genome.

[0052] For gene integration and substitution sites ( zwf , gnd , High School and hisG His-Opt strains exhibit characteristic size changes in amplification bands (e.g., the introduction of...). trc (Fragment growth caused by promoters or foreign genes), sequencing results confirmed the presence of designed point mutations (such as H232K / R250H in HisG) and codon-optimized foreign gene sequences. Specifically, for slyAAlthough the amplified band size was consistent with that of the wild type, the sequencing peak diagram clearly showed a specific base mutation at codon 125, forming a premature stop codon.

[0053] Based on the molecular biological evidence above, the engineered strain constructed in Example 1 has successfully integrated all designed metabolic modification modules at the genome level. This precise genotypic reconstruction lays the genetic foundation for phenotypic high L-histidine production: by removing... ushA / nrdD Reduced precursor consumption, through zwf / gnd The introduction and pgi Promoter replacement redirects carbon flux, through hisG The mutation relieved the feedback inhibition and utilized High School Product efflux was achieved. Genotyping validation results confirmed the physical implementation of the metabolic flux redirection strategy in the engineered strain.

[0054] Test Example 2: Comparative Test of Fermentation Performance Experimental instructions and procedures: This test case aims to evaluate the effects of different genotypes of engineered strains and different fermentation process conditions on L-histidine synthesis performance. The experiment was divided into an experimental group (corresponding to Examples 2 to 4) and a control group (corresponding to Comparative Examples 1 to 5).

[0055] The experiment was conducted in parallel in a 5L fermenter equipped with a fully automated control system.

[0056] The fermentation of the control group (Comparative Examples 1 to 5) strains was carried out using the preferred process parameters described in Example 2 (temperature 37 degrees Celsius, pH 6.8, dissolved oxygen-related feeding) to ensure that the single variable was the difference in strain genotype.

[0057] The experimental groups correspond to the strains and specific process parameter combinations described in Examples 2, 3, and 4, respectively.

[0058] The specific operating steps are as follows: After activation culture with seed culture, each group of bacterial strains was inoculated into a fermenter. Samples were taken every 4 hours during fermentation. The optical density (OD600) of the fermentation broth was measured after sampling to characterize the bacterial biomass. The supernatant was collected after centrifugation, and the L-histidine and residual sugar concentrations were determined using high-performance liquid chromatography (HPLC). Fermentation was terminated when the L-histidine concentration in the fermentation broth no longer increased or the bacteria entered the death phase, and the fermentation cycle was recorded. Based on the fermentation endpoint data, the sugar-acid conversion rate (total product mass / total glucose consumed) was calculated. Each experiment was repeated three times, and the arithmetic mean was taken as the final recorded data.

[0059] Test results: Table 2. Summary of L-histidine fermentation performance test data under different strains and process conditions

[0060] Results analysis: The data in Table 2 reveal the hierarchical contribution and synergistic effect of metabolic engineering strategies on L-histidine synthesis efficiency.

[0061] First, the differences between Comparative Example 1 and Comparative Example 2 confirm that relieving the feedback inhibition of the key enzyme HisG is a prerequisite for initiating excessive L-histidine synthesis. The wild-type strain hardly accumulated any product, while the His-Base strain with only the HisG mutation increased the yield to 18.4 g / L, indicating that the rate-limiting step was initially activated, but the yield remained low due to limitations in precursor supply and energy metabolism.

[0062] Secondly, a comparison between Comparative Example 3 (His-NoPPP) and Example 2 showed that the absence of the pentose phosphate pathway (PPP) enhancement module resulted in a yield decrease of approximately 46%, with the conversion rate dropping from 26.4% to 18.2%. This indicates that the introduction of a heterologous source... zwf / gnd and replace pgi The promoter successfully redirected carbon flux from the glycolysis pathway to the PPP pathway, increasing the supply of PRPP (ribose-5-phosphate pyrophosphate), a key precursor required for histidine synthesis, and the reducing agent NADPH. Without this module, insufficient carbon skeleton supply becomes the main limiting factor.

[0063] Furthermore, in comparison 4 (His-NoSave), the competing pathway was preserved ( ushA , nrdD ) and exercise consumption ( slyA In the case of [example 2], the cell biomass (OD600) and conversion rate were both lower than in Example 2. The data indicate that knocking out nucleotide degradation and reduction pathways, as well as blocking flagellar motility-related transcriptional regulation, effectively reduced the inefficient consumption of ATP and metabolic intermediates. The higher biomass and conversion rate in Example 2 confirm that the saved metabolic resources were reallocated for cell growth and product synthesis.

[0064] Furthermore, Comparative Example 5 (His-NoExp) exhibited a lower final yield (38.6 g / L) and a shorter effective fermentation period (growth ceased after 42 hours). This was due to the lack of a LysE efflux pump, resulting in high intracellular concentrations of L-histidine that produced toxicity and triggered non-allosteric feedback regulation, inhibiting cellular metabolic activity. Example 2, by enhancing efflux, maintained intracellular homeostasis and prolonged the acidogenic period.

[0065] Finally, the data from Examples 2, 3, and 4 show that the engineered strain constructed in this invention... E.coliHis-Opt maintained high production performance within the set process parameter range. Example 2 demonstrated the best overall performance, indicating that the specific temperature control and feeding strategy was best matched to the metabolic characteristics of the strain, achieving the optimal balance between carbon flux in biomass synthesis and product synthesis.

[0066] In summary, the efficient synthesis of L-histidine depends on a systematic metabolic remodeling across four dimensions: deinhibition, enhanced precursor supply (PPP flow), optimized energy allocation (throttling), and product efflux. None of these can be omitted.

[0067] Appendix: hisG Sequence (shown as SEQ ID NO:1): ATGACAGACAACACTCGTTTACGCATAGCTATGCAGAAATCCGGCCGTTTAAGTGATGACTCACGCGAATTGCTGGCGCGCTGTGGCATTAAAATTAATCTTCACACCCAGCGCCTGATCGCGATGGCAGAAAACATGCCGATTGATATTCTGCGCGTGCGTGACGACGACATTCCCGGTCTGGTAATGGATGGCGTGGTAGACCTTGGGATTATCGGCGAAAACGTGCTGGAAGAAGAGCTGCTTAACCGCCGCGCCCAGGGTGAAGATCCACGCTACTTTACCCTGCGTCGTCTGGATTTCGGCGGCTGTCGTCTTTCGCTGGCAACGCCGGTTGATGAAGCCTGGGACGGTCCGCTCTCCTTAAACGGTAAACGTATCGCCACCTCTTATCCTCACCTGCTCAAGCGTTATCTCGACCAGAAAGGCATCTCTTTTAAATCCTGCTTACTGAACGGTTCTGTTGAAGTCGCCCCGCGTGCCGGACTGGCGGATGCGATTTGCGATCTGGTTTCCACCGGTGCCACGCTGGAAGCTAACGGCCTGCGCGAAGTCGAAGTTATCTATCGCTCGAAAGCCTGCCTGATTCAACGCGATGGCGAAATGGAAGAATCCAAACAGCAACTGATCGACAAACTGCTGACCCGTATTCAGGGTGTGATCCAGGCGCGCGAATCAAAATACATCATGATGAAGGCACCGACCGAACGTCTGGATGAAGTCATCGCCCTGCTGCCAGGTGCCGAACATCCAACTATTCTGCCGCTGGCGGGTGACCAACAGCGCGTAGCGATGCACATGGTCAGCAGCGAAACCCTGTTCTGGGAAACCATGGAAAAACTGAAAGCGCTGGGTGCCAGTTCAATTCTGGTCCTGCCGATTGAGAAGATGATGGAGTGA。

[0068] ushA Sequence (shown as SEQ ID NO: 2):

[0069] nrdD Sequence (as shown in SEQ ID NO:3):

[0070] zwf Sequence (as shown in SEQ ID NO:4):

[0071] gnd Sequence (as shown in SEQ ID NO:5):

[0072] pgi Sequence (as shown in SEQ ID NO:6):

[0073] pgi Promoter sequence (as shown in SEQ ID NO:7): ACATTACGCTAACGGCACTAAAACCATCACATTTTCTGTGACTGGCGCTACAATCTTCCAAAGTCACAATTCTCAAAATCAGAA.

[0074] fliA Promoter sequence (as shown in SEQ ID NO:8): ACCCCTCATTTCACCCACTAATCGTCCGATTAAAAACCCTGCAGAAACGGATAATCATGCCGATAACTCATATAACGCAGGGCTGTTTATC.

[0075] High School Sequence (as shown in SEQ ID NO:9): ATGGTGATCATGGAAATCTTCATTACCGGTCTGCTGCTGGGTGCGAGCTTTTACCTGCCGATCGGCCGTCGGAATGTCTGGTGATTAAACAGGAAATTAAGCGCGAAGGCTTGATTGCGGTTCTGCTGCGCGTGTTGAATTTCTGCGTCTGTTCTGTTTCATCGCCGGCACCTTGGGCATCGATCTGCTGAGCAATGCGGCGCCGATCGTGCTCGATATTATGCGCTGGGGCGGCATCGCTTACCTGTTATGGTTTGCCGTCATGGCAGCGAAAGACGCCATGACCAACAAGGTGGAAGCGCCGCAGATCATTGAAGAAACCGAACCGACCGTGCCCGATGACACGCCTTTGGGCGGTTTCGGCGGTGCGCACCTGACGCGCAACCGGGTCGCGGTGGAAGTGAGCGTCGATAAGCAGCGGGTTTGGGTAAAGCCCATGTTGATGGCAATCGTGCTGACCTGGTTGAACCCGAATGCGTATTTGGACGCGTTTGTGTTTATCGGCGGCGTCGGCGCGCAATACGGCGACACCGGTCGGTGGATTTTCGCCGCTGGCGCGTTTGCGGCGAAGCCTGATCTGGTTCCCGCTGGTGGGTTTCGGCGCAGCAGCATTGTCACGCCCGCTGTGCAGCCCCAAGGTGTGGCGCTGGATCAACGTCGTCGTGGCAGTTGTGATGACCGCATTGGCCATCAAACTGATGTTGATGGGTTAA。

[0076] slyA Sequence (as shown in SEQ ID NO: 10): TTGGAATCGCCACTAGGTTCTGATCTGGCACGGTTGGTGCGCATATGGCGTGCTCTGATAGACCATCGCCTGAAACCGCTGGAGTTAACACAAACCCATTGGGTTACGTTACACAATATCCATCAGTTACCTCCAGACCAGTCGCAAATTCAACTGGCAAAAGCGATTGGCATCGAGCAGCCATCACTGGTCCGTACTCTGGACCAACTGGAAGAAAAAGGGTTAATTTCGCGTCAAACTTGTGCCAGCGATCGTCGGGCTAAACGTATTAAACTGACGGAAAAGGCAGAGCCGCTGATCAGCGAAATGGAAGCTGTTATTAACAAAACCCGCGCGGAAATATTACATGGCATCTCCGCAGAGGAACTGGAGTAA( )CTGATTACGCTCATCGCAAAACTTGAGCATAATATCATTGAGTTACAGGCCAAAGGGTGA。

Claims

1. A genetically engineered *Escherichia coli* strain that synthesizes L-histidine, characterized in that, The *E. coli* strain described is *E. coli* W3110, whose genome contains the following genetic modifications: hisG Modification of the gene locus, which relieves the feedback inhibition of the HisG protein; ushA Deletion of gene loci; nrdD Deletion of gene loci; zwf Genes and gnd Heterologous integration of genes; pgi Replacement of gene promoters; lysE Heterologous integration of genes; slyA Gene inactivation.

2. The genetically engineered *Escherichia coli* strain for synthesizing L-histidine according to claim 1, characterized in that, The genetic modification specifically refers to: The hisG The modification of the gene locus involves replacing the wild-type gene with a nucleotide sequence as shown in SEQ ID NO:1; The ushA The deletion of a gene site is the deletion of a nucleotide sequence as shown in SEQ ID NO:2; The nrdD The deletion of a gene locus is the deletion of a nucleotide sequence as shown in SEQ ID NO:3; The zwf Heterologous integration of genes involves the integration of nucleotide sequences as shown in SEQ ID NO:4; The gnd Heterologous integration of genes is the integration of nucleotide sequences as shown in SEQ ID NO:5; The pgi The gene promoter will be replaced as shown in SEQ ID NO:6 pgi The natural promoter sequence upstream of the gene coding region, as shown in SEQ ID NO:7, is replaced with the P sequence shown in SEQ ID NO:

8. fliA Promoter sequence; The lysE Heterologous integration of genes is the integration of nucleotide sequences as shown in SEQ ID NO:9; The slyA Gene inactivation is achieved by mutating the wild-type gene to a nucleotide sequence as shown in SEQ ID NO:

10.

3. The genetically engineered *Escherichia coli* strain for synthesizing L-histidine according to claim 2, characterized in that, The sequence shown in SEQ ID NO:1 contains a HisG protein coding sequence encoding the H232K and R250H double mutation; The sequence shown in SEQ ID NO:4 encodes a glucose-6-phosphate dehydrogenase derived from Corynebacterium glutamicum containing the A243T mutation; The sequence shown in SEQ ID NO:5 encodes a Corynebacterium glutamicum-derived 6-phosphoglucate dehydrogenase containing the S361F mutation; The sequence shown in SEQ ID NO:10 is mutated from CAG to TAA stop codon at codon position 125.

4. A method for preparing genetically engineered *Escherichia coli* that synthesizes L-histidine, characterized in that, The method for preparing a genetically engineered *Escherichia coli* strain capable of synthesizing L-histidine as described in any one of claims 1-3 is characterized by comprising the following steps: S1. The genetically engineered Escherichia coli is inoculated into a seed culture medium for seed culture to obtain a seed solution; S2. The seed liquid is inoculated into a fermentation medium for fermentation culture, and feed solution is added during the fermentation process. L-histidine in the fermentation broth is collected. The fermentation medium contains the following components at the following concentrations: glucose 20.0-30.0 g / L, yeast extract 4.0-6.0 g / L, ammonium sulfate 5.0-7.0 g / L, potassium dihydrogen phosphate 6.0-8.0 g / L, magnesium sulfate heptahydrate 1.5-2.5 g / L, citric acid monohydrate 1.5-2.5 g / L, L-methionine 1.5-2.5 g / L, and ribose 5-phosphate 0.05-0.15 mM.

5. The method for preparing genetically engineered Escherichia coli that synthesizes L-histidine according to claim 4, characterized in that, The seed culture medium is LB medium, which contains the following components at the following concentrations: tryptone 10.0 g / L, yeast extract 5.0 g / L, and sodium chloride 10.0 g / L.

6. The method for preparing genetically engineered Escherichia coli that synthesizes L-histidine according to claim 4, characterized in that, The fermentation medium also contains a vitamin mixture and a trace element mixture; The vitamin mixture provides the following concentrations of components: vitamin B1, vitamin B3, vitamin B5, vitamin B12, and vitamin H, each at 1.5-2.5 mg / L; The trace element mixture provides the following concentrations of components: zinc chloride 2.4-3.6 mg / L, calcium chloride 2.4-3.6 mg / L, ammonium molybdate 3.6-4.4 mg / L, copper sulfate 3.6-4.4 mg / L, and cobalt chloride 3.6-4.4 mg / L.

7. The method for preparing genetically engineered Escherichia coli that synthesizes L-histidine according to claim 4, characterized in that, In step S2, the process parameters for the fermentation culture are controlled as follows: Fermentation temperature should be controlled between 36.0-38.0℃; The pH value should be controlled between 6.5 and 7.0; Dissolved oxygen should be controlled between 20% and 40%.

8. The method for preparing genetically engineered Escherichia coli that synthesizes L-histidine according to claim 4, characterized in that, The pH value was adjusted by adding 20%-25% w / v of ammonia.

9. The method for preparing genetically engineered Escherichia coli that synthesizes L-histidine according to claim 4, characterized in that, In step S2, the feed solution is a glucose solution with a concentration of 500-800 g / L; The specific implementation method of the feed-in method is as follows: when the glucose concentration in the fermentation broth drops below 5.0 g / L, feed-in is started, and the glucose concentration in the fermentation broth is controlled to be maintained between 0.1 and 5.0 g / L.

10. The method for preparing genetically engineered Escherichia coli for synthesizing L-histidine according to claim 4, characterized in that, In step S1, the conditions for seed culture are as follows: Incubate at 37℃ and 200-240 rpm for 10-14 hours until the bacterial OD600 reaches 2.0-4.0.