Triple-nanopcr detection method for nucleopolyhedrovirus, beauveria bassiana and nucleo-spodoptera litura microsporidia

By employing a triple nano-PCR detection method, combining specific primers and nano-PCR technology, the issues of synchronicity and sensitivity in the detection of silkworm pathogens have been resolved. This method enables efficient and accurate detection of silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus, and is suitable for the diagnosis of silkworm diseases.

CN122279073APending Publication Date: 2026-06-26GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGXI UNIV
Filing Date
2026-02-06
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing pathogen detection technologies for silkworms cannot efficiently, synchronously, and sensitively identify silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus, resulting in inaccurate test results and high costs, making it difficult to accurately diagnose single and mixed infections.

Method used

A triple nano-PCR detection method was adopted, which uses a specific primer set and nano-PCR technology in a single reaction system, combined with a thermostable single-stranded binding protein, tetramethylammonium chloride and graphene oxide, and optimizes primer concentration, enzyme dosage and annealing temperature to achieve simultaneous detection of three pathogens.

Benefits of technology

It enables efficient, simultaneous, specific, and highly sensitive detection of three pathogens, simplifies the operation process, improves detection efficiency and the reliability of results, and is suitable for rapid screening in production sites or laboratories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279073A_ABST
    Figure CN122279073A_ABST
Patent Text Reader

Abstract

This invention relates to a triple nano-PCR detection method for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus, belonging to the field of molecular diagnostic technology. Addressing the technical problem of existing silkworm disease diagnostic methods' inability to simultaneously, efficiently, and sensitively identify these three commonly mixed infection pathogens, this invention provides an integrated solution. The key technical points include extracting DNA from the sample to be tested, using this DNA as a template, performing nano-PCR amplification in the same reaction system using a specific primer set, and subsequently detecting the amplification products by agarose gel electrophoresis. The infection status of silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus is determined based on the specific bands at 733 bp, 230 bp, and 860 bp, respectively. This method is mainly used for the rapid, simultaneous diagnosis and identification of mixed infections of microsporidia, Beauveria bassiana, and hemorrhagic septicemia during silkworm rearing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a triple nano-PCR detection method for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus. Background Technology

[0002] In the silkworm farming industry, *Nosema bombycis*, *Beauveria bassiana*, and *Bombyx mori nucleopolyhedrovirus* (BmNPV) are three major pathogens that cause serious damage, leading to microsporidiasis, white muscardine disease, and hemorrhagic septicemia, respectively. These three diseases often occur concurrently or in combination during production, posing a continuous threat to cocoon yield and quality. Therefore, timely and accurate detection of these diseases is a prerequisite for effective prevention and control.

[0003] Currently, each of the detection technologies for these three pathogens has its limitations. Traditional morphological detection methods, such as microscopic examination of moths, are cumbersome, subjective, and have limited sensitivity, easily missing early or low-viral-load infections. Serological methods, such as ELISA, are relatively quick, but may suffer from insufficient specificity due to antibody cross-reactivity and are difficult to use for simultaneous detection of multiple pathogens. Conventional molecular detection techniques, such as conventional PCR, while highly specific, typically only detect one pathogen per reaction. In actual production, to comprehensively diagnose potential single or mixed infections, multiple independent PCR tests are often required on the same sample. This significantly increases reagent consumption, sample volume, and operation time, as well as detection costs and complexity.

[0004] Multiplex PCR, designed for simultaneous detection, faces unique technical challenges when applied to the three pathogens mentioned above. Because multiple pairs of specific primers need to be added simultaneously to a single reaction system, interactions may occur between different primers or between primers and different target templates, leading to primer dimers or non-specific amplification, thus interfering with target band recognition. More importantly, the copy numbers and amplification efficiencies of the target genes of different pathogens vary, easily resulting in amplification competition in multiplex reactions. This leads to a significant decrease in the sensitivity of detecting low concentrations of pathogen targets, or even complete undetectability, affecting the reliability of the detection results. Therefore, developing a detection method that can efficiently, simultaneously, and with high sensitivity identify these three key silkworm pathogens has always been a practical need and technical challenge in the field of silkworm disease diagnosis. Summary of the Invention

[0005] One object of the present invention is to solve at least the above-mentioned problems and to provide at least the advantages that will be described later.

[0006] Another objective of this invention is to provide a triple nano-PCR detection method for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus. This method can simultaneously, specifically, and sensitively detect the three pathogens in a single reaction system, effectively distinguishing between single and mixed infections, thus providing an efficient and reliable detection method for silkworm disease diagnosis.

[0007] To achieve these objectives and other advantages of the present invention, a triple nano-PCR detection method for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus is provided, comprising the following steps: 1) Extract DNA from the sample to be tested; 2) Using the DNA as a template, nano-PCR amplification was performed using primer sets Nb.C1-F and Nb.C1-R, primer sets Bb.L1-F and Bb.L1-R, and primer sets Bm.PY-F and Bm.PY-R; The nano-PCR amplification reaction system includes 2×Nano-qPCR buffer, Taq DNA polymerase, MgCl2, primer sets Nb.C1-F and Nb.C1-R, primer sets Bb.L1-F and Bb.L1-R, primer sets Bm.PY-F and Bm.PY-R, and DNA template; The reaction program for nano-PCR amplification includes denaturation at 95 °C for 10 s, annealing at 50-64 °C for 30 s, extension at 72 °C for 1 min, and 20-40 cycles. 3) The amplified products were detected by agarose gel electrophoresis. If a specific band of 733 bp appeared, the product was considered positive for *Bombyx mori* microsporidia; if a specific band of 230 bp appeared, the product was considered positive for *Beauveria bassiana*; and if a specific band of 860 bp appeared, the product was considered positive for nucleopolyhedrovirus. The nucleotide sequence of Nb.C1-F is shown in SEQ ID No.1: taacaagactatgacggataacg; The nucleotide sequence of Nb.C1-R is shown in SEQ ID No.2: cactacatctgtctaaatgaggg; The nucleotide sequence of Bb.L1-F is shown in SEQ ID No.3: ttctgtgaacctacctatcgtt; The nucleotide sequence of Bb.L1-R is shown in SEQ ID No.4: gattcactggattctgcaattc; The nucleotide sequence of Bm.PY-F is shown in SEQ ID No. 5: ggaaataataaccatctcgc; The nucleotide sequence of Bm.PY-R is shown in SEQ ID No. 6: aacgcacagaatctaacgct.

[0008] Preferably, in the reaction system, the amounts of primers Nb.Cl-F and Nb.Cl-R are each 8-12 pmol, the amounts of primers Bb.L1-F and Bb.L1-R are each 2-6 pmol, and the amounts of primer sets Bm.PY-F and Bm.PY-R are each 10-14 pmol; the amount of Taq DNA polymerase in the reaction system is 1.4-1.8 μL, and the amount of MgCl2 is 0.1-0.3 μL.

[0009] Preferably, the annealing temperature is 54-58 ℃; the number of cycles is 25-35.

[0010] Preferably, the reaction system for nano-PCR amplification also contains a heat-stable single-stranded binding protein at a concentration of 0.1-0.5 μg / μL.

[0011] By adding a thermostable single-stranded binding protein at a concentration of 0.1–0.5 μg / μL to the triplet nanoparticle PCR reaction system, the problem of lower amplification efficiency for long-fragment nucleopolyhedrovirus (BmNPV, 860 bp) compared to short-fragment (Bombyx mori microsporidia 733 bp and Beauveria bassiana 230 bp) due to limitations in template secondary structure and polymerase extension efficiency was solved. The thermostable single-stranded binding protein binds to the single-stranded DNA template, inhibits secondary structure formation, and reduces polymerase stagnation, thereby improving the persistence and fidelity of the long-fragment extension process. This balances the multiplex amplification efficiency, resulting in more uniform specific band brightness for the three pathogens, improving the detection sensitivity of BmNPV, avoiding the risk of missed detection due to differences in amplification efficiency, and enhancing the accuracy and repeatability of the detection results.

[0012] Preferably, tetramethylammonium chloride is added to the reaction system for nano-PCR amplification at a concentration of 20-60 mM.

[0013] By adding 20-60 mM tetramethylammonium chloride to the triple nanoparticle PCR reaction system, the problem of increased non-specific amplification background and decreased detection specificity caused by the addition of heat-stable single-stranded binding proteins was effectively solved. Tetramethylammonium chloride stabilizes the DNA double-stranded structure through ion shielding, promotes specific annealing of primers and templates, and reduces non-specific binding of primers to non-target sequences. Simultaneously, this component does not interfere with the enhancing effect of heat-stable single-stranded binding proteins on the amplification of long-fragment BmNPV. The addition of tetramethylammonium chloride significantly reduces the generation of non-specific bands, making the target band clearer and sharper. Therefore, while maintaining high sensitivity, it further improves the specificity and stability of the detection results, effectively avoiding the risk of misjudgment due to background interference.

[0014] Preferably, the reaction system for nano-PCR amplification also contains graphene oxide at a concentration of 1-5 μg / mL.

[0015] In multiplex PCR systems, when simultaneously amplifying different targets such as *Bombyx mori* microsporidia, *Beauveria bassiana*, and nucleopolyhedrovirus, the template concentrations of each pathogen may differ significantly. High-abundance templates gain a competitive advantage in key resources such as primers, nucleotides, and polymerases, thus inhibiting the effective amplification of low-abundance templates and increasing the risk of missed detection. The introduction of graphene oxide, with its abundant functional groups and large specific surface area, preferentially and reversibly adsorbs free single-stranded DNA molecules in the reaction system, such as excess primers, prematurely formed primer dimers, and non-specific amplification products. This process essentially temporarily removes some background noise that may interfere with the normal binding of polymerase to the target template, thereby relatively increasing the effective reactant concentration and enzyme activity space available for amplifying low-copy-number targets, bringing the amplification kinetics between targets of different abundances towards equilibrium. This allows the detection method to more stably detect three pathogens simultaneously in cases of mixed pathogen infection and uneven load, commonly found in real-world samples, improving the overall sensitivity and accuracy of the detection.

[0016] Preferably, before use, the graphene oxide is mixed and incubated with polyethylene glycol with a molecular weight of 2000-10000 to modify the surface of the graphene oxide with polyethylene glycol. After washing, the graphene oxide is then prepared into a solution with a concentration of 1-5 μg / mL and added to the reaction system.

[0017] Graphene oxide, due to its sheet-like structure, has the potential to adsorb key enzyme components in the reaction system, which may affect the polymerization efficiency. By introducing polyethylene glycol (PEG) molecular chains onto the surface of graphene oxide, its hydrophilic long chains form steric hindrance around the nanomaterial, effectively preventing direct contact between the active surface of graphene oxide and proteins, thereby reducing non-specific adsorption of core reaction components such as Taq DNA polymerase. This modification maintains the selective adsorption capacity of graphene oxide for free single-stranded DNA while preserving the stability of enzyme activity in the PCR reaction. By controlling the molecular weight of PEG and the modification reaction conditions, a composite material with uniform surface properties and stable performance can be obtained, thus ensuring the reliability of amplification efficiency in continuous operation of the multiplex nano-PCR detection system, enabling effective amplification of low-concentration pathogen targets even in the presence of high background templates.

[0018] Preferably, the steps for mixing and incubating graphene oxide with polyethylene glycol are as follows: A graphene oxide dispersion is mixed with a polyethylene glycol solution with a molecular weight of 2000-10000, so that the initial concentration of graphene oxide in the mixture is 10-50 μg / mL and the concentration of polyethylene glycol is 0.5-2.5 mg / mL; then, the mixture is continuously incubated with shaking for 2-4 h at a pH of 6.0-7.5 and a temperature of 45-60 ℃; after incubation, the supernatant is removed by centrifugation, and the precipitate is washed at least three times with Tris-HCl buffer at a pH of 7.0-8.0 to remove unbound free polyethylene glycol; finally, the obtained polyethylene glycol-modified graphene oxide is redispersed in nuclease-free water and brought to the desired concentration.

[0019] By precisely controlling the mixing concentration of graphene oxide and polyethylene glycol, the pH value of the reaction system, the temperature, and the dynamic incubation time, a stable and controllable interfacial environment was created for their bonding. This optimization process promoted a more uniform and robust bond between the polyethylene glycol molecular chains and the oxygen-containing functional groups on the surface of the graphene oxide sheets, thereby constructing a structurally stable surface-modified layer. Subsequent washing steps using a specific pH buffer effectively removed loosely attached or unbound free polyethylene glycol molecules, ensuring the purity and surface uniformity of the final product. Through this series of standardized preparation procedures, the obtained polyethylene glycol-modified graphene oxide exhibits consistent surface chemical properties, and its performance differences between different batches are effectively controlled. This ensures that its dual function of balancing amplification competition and protecting enzyme activity is stably and reproducibly achieved in multiple nano-PCR systems, ultimately improving the reliability and consistency of the overall detection method in multiple independent experiments.

[0020] The present invention has at least the following beneficial effects: First, this invention achieves simultaneous detection of three pathogens by using a set of specific primers for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus in a single reaction system, combined with nano-PCR technology. This avoids the need for multiple independent experiments, thereby significantly improving detection efficiency and saving samples and reagents.

[0021] Secondly, by precisely optimizing primer concentration, enzyme dosage, magnesium ion level, annealing temperature, and cycling parameters, and by introducing components such as thermostable single-chain binding protein and tetramethylammonium chloride, this invention effectively inhibits non-specific amplification and primer dimer formation, thereby improving the detection capability and reliability of low-load pathogens in complex sample backgrounds.

[0022] Third, the integrated detection scheme of this invention simplifies the operation process while ensuring high specificity, making it more suitable for rapid screening of silkworm diseases and diagnosis of mixed infections in production sites or laboratories.

[0023] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0024] Figure 1 Electrophoresis diagram showing the optimized amount of Taq DNA polymerase in the triple nano-PCR detection method; Figure 2 Electrophoresis diagram showing the optimized MgCl2 dosage in the triple nano-PCR detection method; Figure 3 Electrophoresis diagram for the optimized annealing temperature in the triple nano-PCR detection method; Figure 4 Electrophoresis diagram showing the optimized number of cycles in the triple nano-PCR detection method; Figure 5 Electrophoresis diagrams showing the optimized primer dosage in the triple nano-PCR detection method, where A, B, C, and D represent the results of staged optimization. Figure 6 Electrophoresis image used to validate the specificity of the triple nano-PCR detection method; Figure 7 Electrophoresis diagram for sensitivity validation of the triple nano-PCR detection method; Figure 8 Electrophoresis diagram for repeatability verification of the triple nano-PCR detection method; Figure 9 The electrophoresis diagram is a concordance verification image of the triple nano-PCR detection method, showing its detection results on positive samples of silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus. Detailed Implementation

[0025] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0026] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0027] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0028] Experiment 1: Establishment of a triple PCR method for detecting silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus. 1.1 Materials and Reagents Primer design: Primers designed for the BmNPV polyhedrin gene are shown in Table 1 below.

[0029] Table 1 1.2 Experimental Methods and Results 1.2.1 Construction of pMD-BmNPV plasmid and optimization of reaction system: Construction of pMD-BmNPV plasmid: The construction of the pMD-BmNPV positive plasmid first involved amplification of the target fragment using PCR technology. Specifically, using the genomic DNA of the silkworm nucleopolyhedrovirus as a template, specific primers designed for the polyhedrin gene were used for amplification to obtain the target fragment. Subsequently, the PCR product was subjected to agarose gel electrophoresis, and the target band was excised and recovered, completing the purification of the DNA fragment. Next, the purified PCR product was ligated with the pMD18-T vector in a ligase system at 16 °C. The ligation product was then transformed into DH5α competent cells, and the plasmid was introduced into the cells using a heat shock method. The transformed bacterial culture was then plated on LB agar containing ampicillin for selection culture. After single colonies grew on the plates, colonies were picked for expansion culture, and positive clones were preliminarily identified by bacterial PCR. Finally, plasmids were extracted from the PCR-positive bacterial cultures, and the extracted recombinant plasmids were sent to a sequencing company for sequencing. The constructed plasmid sequence was confirmed to be correct through comparative analysis, thus successfully obtaining the recombinant positive plasmid pMD-BmNPV for subsequent experiments.

[0030] The target fragments of the genomes of silkworm microsporidia and Beauveria bassiana were amplified using primers Nb.C1-F / R and Bb.L1-F / R, recovered from gel, ligated into the pMD18-T vector, transformed into DH5α competent cells, screened for positive clones and sequenced to verify, and obtained recombinant plasmids pMD-Nb and pMD-Bb.

[0031] Optimization of annealing temperature: Recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were used as DNA templates. A gradient experimental design was employed to optimize the PCR annealing temperature parameters, establishing a temperature gradient range of 50-64℃. Thermal cycling reaction conditions were set at 2℃ intervals, resulting in a total of 8 gradient parameters for systematic optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Rapid TaqMaster Mix, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and final volume adjusted with ddH2O. The reaction program was set as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, followed by gradient annealing for 15 s, and extension at 72 ℃ for 15 s, for a total of 35 cycles; and a final extension at 72 ℃ for 5 min. Verification was performed by 1.2% agarose gel electrophoresis. The electrophoresis results showed that the target bands amplified in lane 4 were all bright, indicating that 56 ℃ was the optimal annealing temperature.

[0032] Cycle number optimization: Recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were used as DNA templates. The number of cycles was set to 20-40 cycles, with each 5 cycles representing a gradient, for a total of 5 gradients for optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Rapid Taq Master Mix, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O to a final volume. The reaction program was set as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 56 ℃ annealing for 15 s, 72 ℃ extension for 15 s, with the set number of cycles; 72 ℃ extension for 5 min. Verification was performed by 1.2% agarose gel electrophoresis. Electrophoresis results showed that the target bands amplified in lane 4 were all clearly visible. However, the amplification brightness of two target bands was relatively dark, which may be due to the amount of template or the different amplification efficiencies for different fragment sizes. Overall, 35 cycles were considered the optimal number of cycles.

[0033] Primer dosage optimization: To establish a triplet PCR detection system, the dosage of three sets of primers (Nb.C1-F / R, Bb.L1-F / R, and Bm.PY-F / R) was systematically optimized using recombinant positive plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV as templates. The reaction system (25 μL) consisted of: 12.5 μL of 2×Rapid Taq Master Mix, each primer added at the set concentration, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O to a final volume of 25 μL. The PCR program was as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 56 ℃ annealing for 15 s, 72 ℃ extension for 15 s, for a total of 35 cycles; and a final extension at 72 ℃ for 5 min. All amplification results were analyzed by 1.2% agarose gel electrophoresis.

[0034] The optimization process is carried out in four stages: Three primer pairs were used in equal amounts, and tests were conducted in 2 pmol increments within the range of 2–14 pmol. The results showed that the band brightness was optimal when each primer was used at 6 pmol.

[0035] With Bb.L1-F / R and Bm.PY-F / R fixed at 6 pmol, Nb.Cl-F / R was optimized using a gradient (2-20 pmol). The results showed that when the Nb.Cl-F / R dosage was 10 pmol, the three bands exhibited uniform and clear brightness.

[0036] With Nb.C1-F / R fixed at 10 pmol and Bb.L1-F / R at 6 pmol, Bm.PY-F / R was optimized using a gradient (2-20 pmol). The results showed that the amplification effect of each target fragment was optimal when the amount of Bm.PY-F / R was 12 pmol.

[0037] With Nb.Cl-F / R fixed at 10 pmol and Bm.PY-F / R at 12 pmol, gradient optimization of Bb.L1-F / R was performed (2-20 pmol). The results showed that when the amount of Bb.L1-F / R was 4 pmol, the brightness of each target band was uniform and clear.

[0038] In summary, the optimal primer amounts for this triplet PCR system were determined to be: 10 pmol each for Nb.C1-F / R, 12 pmol each for Bm.PY-F / R, and 4 pmol each for Bb.L1-F / R.

[0039] Specificity test: To verify the specificity of the triple PCR detection method, optimized reaction conditions were used. DNA samples from silkworm microsporidia, Beauveria bassiana, silkworm nucleopolyhedrovirus, silkworm cytoplasmic polyhedrovirus, Leptospirosis septicemia, and healthy silkworms were used as templates, with nucleic acid-free water as a blank control for PCR amplification. The specific reaction system (25 μL) is as follows: 12.5 μL of 2×Rapid Taq Master Mix, 10 μmol / L each of Nb.C1-F and Nb.C1-R, 4 μmol / L each of Bb.L1-F and Bb.L1-R, 12 μmol / L each of Bm.PY-F and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O to a final volume. The reaction program was set as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 56 ℃ annealing for 15 s, 72 ℃ extension for 15 s, for a total of 35 cycles; 72 ℃ extension for 5 min. The results showed that the target fragments of 733 bp, 230 bp, and 860 bp were amplified against silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus, respectively. However, no amplification bands were observed against silkworm cytoplasmic polyhedrovirus, Beauveria bassiana, healthy silkworm DNA, and the blank control, indicating that the detection method has good specificity.

[0040] Sensitivity assay: Recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were accurately quantified using ultraviolet spectrophotometry. The measured concentrations were 63.7 ng / μL, 67 ng / μL, and 67.2 ng / μL, respectively. After molecular copy number conversion, the corresponding plasmid concentrations were 1.70 × 10⁻⁶. 10 copies / μL, 2.09×10 10 copies / μL and 1.73×10 10 The recombinant plasmids were serially diluted 10-fold using nuclease-free water. Each dilution was used as a template for triplet PCR sensitivity verification experiments. The reaction system and cycling parameters were strictly set according to the specificity test. Verification was performed by 1.2% agarose gel electrophoresis. The results showed that the minimum copy number for amplification of positive plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV was 1.70 × 10⁻⁶ copies / μL. 5 copies / μL, 2.09×10 7 copies / μL and 1.73×10 4 The results, obtained using copies / μL, show that this method has good sensitivity. Experiment 2: Establishment of a triple nano-PCR detection method 1.1 Materials and Reagents Same as Example 3, but with the addition of Bm.PY-F / R primers.

[0041] 1.2 Experimental Methods and Results 1.2.1 Optimization of the reaction system Taq DNA polymerase dosage optimization: Using recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV as templates, the Taq DNA polymerase dosage was set to 0.2-2 μL, with each 0.2 μL increment representing a gradient, for a total of 10 gradients for optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Nano-qPCR buffer, the set Taq DNA polymerase dosage, 1.2 μL of 25 mM MgCl2, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and final volume adjusted with ddH2O. The reaction program was set as follows: 95 ℃ denaturation for 10 s, 52 ℃ annealing for 30 s, 72 ℃ extension for 1 min, for a total of 35 cycles. Verification was performed by 1.2% agarose gel electrophoresis. The results are as follows: Figure 1 If the target bands in lane 8 are all bright, then 1.6 μL is the optimal dosage for TaKaRa Taq. M: DNA molecular weight standard; 1–10: 0.2–1 μL; 11: negative control.

[0042] MgCl2 dosage optimization: Using recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV as templates, the dosage of 25mM MgCl2 was set to 0.2-1.8 μL, with each 0.2 μL gradient representing a total of 9 gradients for optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Nano-qPCR buffer, 1.6 μL of Taq DNA polymerase, 25mM MgCl2 dosage settings, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O for final volume adjustment. The reaction program was set as follows: denaturation at 95 °C for 10 s, annealing at 52 °C for 30 s, and extension at 72 °C for 1 min, for a total of 35 cycles. The results were verified by 1.2% agarose gel electrophoresis. The results are as follows... Figure 2 As shown, the target bands amplified in lane 1 were all bright, while the pMD-Bb bands in lanes 1 and lanes 5-9 all showed impurities. Therefore, 0.2 μL was selected as the optimal amount of 25 mM MgCl2.

[0043] Annealing temperature optimization: Recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were used as DNA templates. A gradient experimental design was employed to optimize the PCR annealing temperature parameters, establishing a temperature gradient range of 50-64 ℃. Thermal cycling conditions were set at 2 ℃ intervals, resulting in a total of 8 gradient parameters for systematic optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Nano-qPCR buffer, 1.6 μL of Taq DNA polymerase, 0.2 μL of 25mM MgCl2, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and final volume with ddH2O. The reaction program was set as follows: denaturation at 95 ℃ for 10 s, annealing at a temperature gradient for 30 s, extension at 72 ℃ for 1 min, for a total of 35 cycles. Verification was performed by 1.2% agarose gel electrophoresis. The results showed that the target bands amplified in lane 4 were all bright, indicating that 56 ℃ was the optimal annealing temperature. Figure 3 M: DNA molecular weight standard; 1-8: 50-64℃; 9: negative control.

[0044] Cycle number optimization: Using recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV as templates, the number of cycles was set to 20-40 cycles, with each 5 cycles representing a gradient, for a total of 5 gradients for optimization. The specific reaction system (25 μL) was as follows: 12.5 μL of 2×Nano-qPCR buffer, 1.6 μL of Taq DNA polymerase, 0.2 μL of 25mM MgCl2, 10 μmol / L each of Nb.C1-F, Nb.C1-R, Bb.L1-F, Bb.L1-R, Bm.PY-F, and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O for final volume. The reaction program was set as follows: denaturation at 95 ℃ for 10 s, annealing at a temperature gradient for 30 s, extension at 72 ℃ for 1 min, and the number of cycles was set. Verification was performed by 1.2% agarose gel electrophoresis. The results showed that the target bands amplified in lane 3 were all bright and without dragging, indicating that 30 cycles was the optimal number of cycles. Figure 4 M: DNA molecular weight standard; 1-5: 20-40 cycles; 6: negative control.

[0045] Primer dosage optimization: To establish a triple nano-PCR detection system, recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were used as templates, and the dosage of the three primer sets (Nb.C1-F / R, Bb.L1-F / R, and Bm.PY-F / R) was systematically optimized. The reaction system (25 μL) consisted of: 12.5 μL of 2×Nano-qPCR buffer, 1.6 μL of Taq DNA polymerase, 0.2 μL of 25 mM MgCl2, each primer added at the set concentration, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and ddH2O to a final volume of 25 μL. The PCR program was set as follows: denaturation at 95 ℃ for 10 s, annealing at a set temperature gradient for 30 s, extension at 72 ℃ for 1 min, for a total of 30 cycles. All amplification results were verified by 1.2% agarose gel electrophoresis.

[0046] The optimization process is carried out in four stages in sequence: 1. Preliminary equal-volume optimization: The three primer pairs were set to the same amount, and tests were conducted in 2 pmol increments within the range of 2–12 pmol. Results showed that the band brightness was optimal when each primer was used at 4 pmol (lane 2). Figure 5 A). Figure 5 In A, M: DNA molecular weight standard; 1~6: 2~12 pmol; 7: negative control.

[0047] 2. Optimization of Nb.Cl-F / R dosage: With Bb.L1-F / R and Bm.PY-F / R dosages fixed at 4 pmol, Nb.Cl-F / R was optimized using a gradient (2–20 pmol). Results showed that when the Nb.Cl-F / R dosage was 10 pmol (lane 5), the target bands were uniformly bright and clear. Figure 5 B). Figure 5 In B, M: DNA molecular weight standard; 1~10: primers Bb.L1-F, Bb.L1-R, Bm.PY-F and Bm.PY-R are used at 4 pmol, primers Nb.C1-F and Nb.C1-R are used at 2~20 pmol; 11: negative control.

[0048] 3. Optimization of Bm.PY-F / R dosage: With Nb.C1-F / R fixed at 10 pmol and Bb.L1-F / R at 4 pmol, Bm.PY-F / R was optimized using a gradient (2-20 pmol). Results showed that a Bm.PY-F / R dosage of 12 pmol (lane 6) resulted in the best pMD-BmNPV amplification effect, with uniform brightness of each target band. Figure 5 C). Figure 5In C, M: DNA molecular weight standard; 1-10: Nb.C1-F and Nb.C1-R primers used at 10 pmol, Bb.L1-F and Bb.L1-R primers used at 4 pmol; Bm.PY-F and Bm.PY-R primers used at 2-20 pmol; 11: negative control.

[0049] 4. Optimization of Bb.L1-F / R dosage: With Nb.C1-F / R fixed at 10 pmol and Bm.PY-F / R at 12 pmol, the Bb.L1-F / R dosage was optimized using a gradient (2-16 pmol). Results showed that when the Bb.L1-F / R dosage was 4 pmol (lane 2), the pMD-Bb amplification bands were clear, and the brightness of each target fragment was uniform. Figure 5 D). Figure 5 In D, M: DNA molecular weight standard; 1~10: Nb.C1-F and Nb.C1-R primers used at 10 pmol, Bm.PY-F and Bm.PY-R primers used at 12 pmol; Bb.L1-F and Bb.L1-R primers used at 2-16 pmol; 11: negative control.

[0050] In summary, the optimal primer amounts for this triple nano-PCR system were determined to be: 10 pmol each for Nb.C1-F / R, 12 pmol each for Bm.PY-F / R, and 4 pmol each for Bb.L1-F / R.

[0051] Specificity test: Following the triplet PCR procedure, the specific reaction system (25 μL) was as follows: 12.5 μL 2×Nano-qPCR buffer, 1.6 μL Taq DNA polymerase, 0.2 μL 25mM MgCl2, 10 μmol / L each of Nb.C1-F and Nb.C1-R, 4 μmol / L each of Bb.L1-F and Bb.L1-R, 12 μmol / L each of Bm.PY-F and Bm.PY-R, 1 μL each of pMD-Nb, pMD-Bb, and pMD-BmNPV, and final volume with ddH2O. The reaction program was set as follows: 95 ℃ denaturation for 10 s, gradient annealing for 30 s, and extension at 72 ℃ for 1 min, for a total of 30 cycles. Verification was performed by 1.2% agarose gel electrophoresis. The results showed that the target fragments of 733 bp, 230 bp, and 860 bp were amplified from *Bombyx mori* microsporidia, *Beauveria bassiana*, and nucleopolyhedrovirus, respectively. However, no amplification bands were observed from *Bombyx mori* cytoplasmic polyhedrovirus, *Bacillus septicemia*, healthy silkworm DNA, and the blank control. This indicates that the detection method has good specificity. Figure 6M: DNA molecular quality standard; 1: Silkworm microsporidia; 2: Beauveria bassiana; 3: Silkworm nucleopolyhedrovirus; 4: Silkworm cytoplasmic polyhedrovirus; 5: Lepidobacterium septicemia; 6: DNA of healthy silkworms; 7: Negative control.

[0052] Sensitivity assay: Recombinant plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV were serially diluted 10-fold with nucleic acid-free water. The results showed that the minimum copy number for amplification of positive plasmids pMD-Nb, pMD-Bb, and pMD-BmNPV was 1.70 × 10⁻⁶. 4 copies / μL, 2.09×10 6 copies / μL and 1.73×10 3 The copies / μL ratio was 10-fold higher than that of conventional triple PCR detection methods. (See...) Figure 7 M: DNA molecular weight standard; 1~11: 1×10¹⁰~1×10⁰ copies / μL; 12: negative control.

[0053] Repeatability test: Each recombinant plasmid was diluted to 7.0 ng / μL, 3.5 ng / μL, and 1.7 ng / μL with nucleic acid-free water. Triple nanoPCR repeatability tests were performed using plasmid DNA at each dilution as templates, with each concentration repeated three times. Verification was performed by 1.2% agarose gel electrophoresis. Results showed that the bands at each concentration were clear and bright, indicating good repeatability. Figure 8 M: DNA molecular weight standard; P: positive control; N: negative control; 1-3: plasmid DNA concentration of 7.0 ng / μL; 4-6: plasmid DNA concentration of 3.5 ng / μL; 7-9: plasmid DNA concentration of 1.7 ng / μL.

[0054] Concordance Rate Validation: The optimized dual nano-PCR detection method was used to validate the concordance rate of laboratory-preserved positive samples of *Bombyx mori* microsporidia, *Beauveria bassiana*, and nucleopolyhedrovirus. Thirty samples were selected for each pathogen. The concordance rate of dual nano-PCR was validated using 30 positive DNA samples from each pathogen as templates. Results showed that the dual nano-PCR detection method exhibited good amplification for each pathogen, with a concordance rate of 100%. (See attached table). Figure 9 In Figure A, M: DNA molecular quality standard; P: positive control; N: negative control; 1–22: nucleopolyhedrovirus positive DNA samples. In Figure B, M: DNA molecular quality standard; P: positive control; N: negative control; 1–22: silkworm microsporidia positive DNA samples. In Figure C, M: DNA molecular quality standard; P: positive control; N: negative control; 1–22: Beauveria bassiana positive DNA samples.

[0055] Example 1: A triple nanoPCR detection method for silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus (BmNPV). First, DNA was extracted from the samples to be tested. 200 mg of various sample tissues were taken, ground into powder with liquid nitrogen, and transferred to a 1.5 mL centrifuge tube. 500 μL of lysis buffer was added, and the mixture was incubated in a 65 ℃ water bath for 30 min, inverting and mixing 3 times during the process. Then, 500 μL of chloroform was added, vortexed for 15 s, and centrifuged at 12000 rpm for 8 min. The supernatant was transferred to a new centrifuge tube, an equal volume of isopropanol was added, and the mixture was allowed to stand at -20 ℃ for 40 min. The supernatant was then discarded after centrifugation at 12000 rpm for 10 min. The precipitate was washed twice with 75% ethanol, centrifuged at 12000 rpm for 3 min each time, and the precipitate was dried. 50 μL of nuclease-free water was added to dissolve the DNA. The DNA purity was detected by UV spectrophotometer and stored at -20 ℃ for later use. Next, a triple nano-PCR amplification reaction solution was prepared, with a total volume of 25 μL. This solution included 12.5 μL of 2×Nano-qPCR buffer, 1.6 μL of Taq DNA polymerase, 10 pmol each of primers Nb.C1-F and Nb.C1-R, 4 pmol each of primers Bb.L1-F and Bb.L1-R, 12 pmol each of primers Bm.PY-F and Bm.PY-R, and 2 μL of DNA template. The remaining volume was brought to 25 μL with nuclease-free water. The amplification reaction program was then set as follows: denaturation at 95 °C for 10 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min, for a total of 30 cycles. After each cycle, a final extension at 72 °C for 7 min was performed. After amplification, the product was detected. A 1.2% agarose gel containing nucleic acid dye was prepared. 6 μL of PCR amplification product was mixed with 1 μL of Loading Buffer and added to the gel well. Using DL2000 DNA Marker as a reference, electrophoresis was performed at 120 V for 35 min. Finally, the bands were observed and recorded under a UV gel imaging system.

[0056] Experimental results showed that the method had good specificity. Only the positive samples of silkworm microsporidia showed a specific band of 733 bp, the positive samples of Beauveria bassiana showed a specific band of 230 bp, and the positive samples of nucleopolyhedrovirus showed a specific band of 860 bp. No amplification bands were found in healthy silkworm, BmCPV, and SM samples.

[0057] Example 2: The difference from Example 1 is that the reaction system of nano-PCR amplification also contains a heat-stable single-stranded binding protein (Beyotime) at a concentration of 0.25 μg / μL.

[0058] Adding a thermostable single-stranded binding protein at a concentration of 0.25 μg / μL to the triple nanoparticle PCR reaction system resolved the issue in Example 1 where the amplification efficiency of the long-fragment nucleopolyhedrovirus (BmNPV, 860 bp) was lower than that of the short-fragment (Bombyx mori microsporidia 733 bp, Beauveria bassiana 230 bp) due to limitations in template secondary structure and polymerase elongation efficiency. This resulted in more uniform brightness of the specific bands for the three pathogens, avoiding the relatively dim BmNPV bands observed in Example 1. Simultaneously, by inhibiting the formation of single-stranded DNA template secondary structure and reducing polymerase stagnation, this protein improved the persistence and fidelity of long-fragment elongation, making the detection sensitivity for BmNPV in this example higher than the 1.73 × 10⁻⁶ in Example 2. 3 The number of copies / μL was further increased, compared with that of silkworm microsporidia (1.70×10⁻⁶). 4 copies / μL), Beauveria bassiana (2.09×10) 6 The detection sensitivity gradient of (copies / μL) is more reasonable, the multiplex amplification efficiency is significantly balanced, and the band clarity and consistency of each concentration gradient (7.0 ng / μL, 3.5 ng / μL, 1.7 ng / μL) in the repeatability test are better than those in Example 1, which effectively reduces the risk of missed detection due to differences in amplification efficiency and further ensures the accuracy of the detection results of each pathogen in mixed infection samples.

[0059] Example 3: The difference from Example 2 is that tetramethylammonium chloride with a concentration of 40 mM was added to the reaction system of nano-PCR amplification.

[0060] The introduction of 40 mM tetramethylammonium chloride resolved the non-specific amplification issue that might have arisen in Example 2 due to the addition of a thermostable single-stranded binding protein. In Example 2, when detecting low-concentration recombinant plasmid samples (a mixture of pMD-Nb, pMD-Bb, and pMD-BmNPV templates at 1.7 ng / μL), agarose gel electrophoresis showed 1-2 weak extraneous bands near the target bands (Bombyx mori microsporidia 733 bp, Beauveria bassiana 230 bp, and nucleopolyhedrovirus 860 bp). In contrast, this example showed no non-specific bands in samples of the same concentration, with improved target band clarity and sharper band edges. Simultaneously, tetramethylammonium chloride stabilized the DNA double-strand structure through ion shielding, without interfering with the amplification enhancement effect of the thermostable single-stranded binding protein on long-fragment BmNPV—the limit of detection for BmNPV in this example remained equivalent to 1.73 × 10⁻⁶ in Example 3. 3 copies / μL, for silkworm microsporidia (1.70×10⁻⁶ copies / μL). 4 copies / μL), Beauveria bassiana (2.09×10) 6The detection limit (copies / μL) remained stable, ensuring that the sensitivity was not affected. In the specificity test, this embodiment showed no amplification signal for non-target pathogens such as Bombyx mori polyhedrosis virus (BmCPV) and septicemia malariae (SM), maintaining a 100% concordance rate. In the repeatability test, this embodiment showed no banding or extraneous banding for the amplified plasmid DNA at concentration gradients of 7.0 ng / μL, 3.5 ng / μL, and 1.7 ng / μL, improving the stability of the detection results. It is particularly suitable for the accurate identification of low-load mixed infection samples in production, effectively reducing the risk of misjudgment due to non-specific background.

[0061] Example 4: The difference from Example 3 is that the reaction system for nano-PCR amplification also contains graphene oxide at a concentration of 3 μg / mL. The specific addition method is as follows: Graphene oxide powder was dispersed in nuclease-free water and sonicated to ensure thorough dispersion, preparing a stock solution with a concentration of 30 μg / mL. Before performing triplet nano-PCR, this stock solution was added to the reaction system at a volume ratio to achieve a final graphene oxide concentration of 3 μg / mL.

[0062] This embodiment introduces graphene oxide into the optimized system of Example 3, aiming to further address the competitive inhibition (amplification competition) caused by high-concentration templates on low-concentration templates when there are orders-of-magnitude differences in the concentrations of the three pathogen DNA templates. Graphene oxide, with its large specific surface area and abundant surface functional groups, can selectively adsorb free single-stranded DNA in the reaction system, such as excess primers, primer dimers, and non-specific amplification products. This effect reduces the competitive binding of these non-target sequences to Taq DNA polymerase and their occupation of reaction space, thereby relatively improving the amplification efficiency of low-copy-number templates and making the amplification kinetics of each target in multiplex reactions more balanced.

[0063] Example 5: The difference from Example 4 is that the graphene oxide added to the nano-PCR amplification reaction system is graphene oxide modified with polyethylene glycol (PEG), and its final concentration in the reaction system is also 3 μg / mL.

[0064] The preparation steps of polyethylene glycol-modified graphene oxide are as follows: 1. Mix the aqueous dispersion of graphene oxide (initial concentration 50 μg / mL) with a polyethylene glycol (PEG-6000) solution with a molecular weight of 6000, so that the concentration of graphene oxide in the mixture is 30 μg / mL and the concentration of polyethylene glycol is 1.5 mg / mL.

[0065] 2. Place the mixture in a 55 ℃ water bath and incubate with shaking for 3 h at a pH of 7.0.

[0066] 3. After incubation, centrifuge at 12,000 rpm for 15 min and carefully remove the supernatant. Resuspend the precipitate in Tris-HCl buffer (10 mM) at pH 7.5 and wash by centrifugation. Repeat this process three times to completely remove unbound free polyethylene glycol molecules.

[0067] 4. The final polyethylene glycol-modified graphene oxide precipitate was redispersed in nuclease-free water, and the volume was adjusted to prepare a stock solution with a concentration of 30 μg / mL. The stock solution was stored at 4 °C for later use.

[0068] Triple nanoPCR detection For triple nano-PCR detection, the above-mentioned stock solution was added to the reaction system at the specified volume ratio to achieve a final concentration of 3 μg / mL for polyethylene glycol-modified graphene oxide. The other components of the reaction system (including the thermostable single-stranded binding protein and tetramethylammonium chloride) and the amplification procedure remained consistent with those in Example 4.

[0069] For mixed infection samples (Beauveria bassiana template concentration of 2.09 × 10⁻⁶), 8 The silkworm microsporidia template concentration was 1.70 × 10⁻⁶ copies / μL. 4 The concentration of the nucleopolyhedrovirus template was 1.73 × 10⁻⁶ copies / μL. 3 Triple nano-PCR was performed using copies / μL. The gray values ​​of the target bands in the electrophoresis images were measured using image analysis software (such as ImageJ). After background correction, the results are shown in Table 2 below.

[0070] Table 2 Table 2 shows that, compared to Example 3 (basic optimized system), Example 4 (with added graphene oxide, GO) significantly enhanced the amplification signals of low-concentration targets *Bombyx mori* microsporidia (Nb) and nucleopolyhedrovirus (BmNPV). The average gray values ​​of the bands increased from 580 AU to 4150 AU and from 95 AU to 2880 AU, respectively. This confirms that graphene oxide effectively alleviated the amplification competition caused by high-concentration *Beauveria bassiana* template (Bb), bringing the amplification of each target in the multiplex reaction to a more balanced state and solving the problem of missed detection of low-load pathogens. However, the detection results of Example 4 showed significant fluctuations, with relatively high standard deviations for the gray values ​​of low-concentration targets (913 for Nb and 864 for BmNPV), suggesting that unmodified graphene oxide may have a potential impact on the stability of the system. Example 5 (with polyethylene glycol-modified graphene oxide, PEG-GO) fully inherits the signal enhancement capabilities for low-concentration targets (Nb up to 4300 AU, BmNPV up to 3000 AU) of Example 4, while fundamentally improving the repeatability of detection results. The standard deviation of the gray values ​​of each target band is significantly reduced (Nb = 258, BmNPV = 180, Bb = 775), and the coefficient of variation is much lower than that of Examples 3 and 4. This demonstrates that the polyethylene glycol modification layer effectively shields the non-specific adsorption of key enzyme components by graphene oxide, greatly improving the stability and batch-to-batch reproducibility of the detection system while maintaining excellent amplification competitive balance, thus enabling more reliable and consistent simultaneous detection of mixed infection samples with significantly different loads.

[0071] Application example: Application of triple nanoPCR based on extraction-free direct amplification technology in rapid on-site disease screening of silkworms. This application example is based on the highly sensitive and stable triple nano-PCR detection system established in Example 5 of this invention. Combined with a simple and rapid sample pretreatment method, it enables the direct and simultaneous detection of three important pathogens in different silkworm disease samples, providing a practical solution for rapid on-site disease diagnosis.

[0072] Application methods 1. Sample pretreatment (DNA extraction-free) Experimental materials: silkworms and silkworm excrement that were confirmed to be free from silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus infection, as well as silkworms and silkworm excrement that were confirmed to be infected with silkworm microsporidia, Beauveria bassiana, and nucleopolyhedrovirus.

[0073] Depending on the sample type, the test materials are processed using the following methods: A. Treatment of silkworm blood and tissue fluid: Gently puncture the body wall of the freshly dead silkworm with a sterile needle tip, and collect the flowing blood and tissue fluid into a sterile 1.5 mL centrifuge tube using a micropipette.

[0074] Place the collected liquid in a water bath and boil at 100°C for 5 minutes.

[0075] Centrifuge at 10,000 rpm for 10 minutes.

[0076] Carefully aspirate the supernatant and use it directly as a template for PCR amplification.

[0077] B. Silkworm excrement treatment: Place 5-10 mg of silkworm excrement into a sterile 50 mL centrifuge tube.

[0078] Add an equal volume of alkaline lysis buffer (a solution containing 0.1 M NaOH and 0.01 M EDTA).

[0079] After vortexing, place in a 37 ℃ shaker or constant temperature mixer and incubate for 10 minutes.

[0080] Centrifuge at 10,000 rpm for 10 minutes.

[0081] Carefully aspirate the supernatant and use it directly as a template for PCR amplification.

[0082] 2. Triple nano-PCR detection Preparation of the reaction system (25 μL total system): 2× Nano-qPCR buffer: 12.5 μL; Taq DNA polymerase: 1.6 μL; 25 mM MgCl2: 0.2 μL; Primers Nb.C1-F / Nb.C1-R (10 μmol / L each): 1 μL each (final concentration 10 pmol each); Primers Bb.L1-F / Bb.L1-R (4 μmol / L each): 1 μL each (final concentration 4 pmol each); Primers Bm.PY-F / Bm.PY-R (12 μmol / L each): 1 μL each (final concentration 12 pmol each); Polyethylene glycol-modified graphene oxide (PEG-GO) stock solution: Add an appropriate amount to make its final concentration in the reaction system 3 μg / mL.

[0083] Heat-stable single-chain binding protein (SSB): Add an appropriate amount to achieve a final concentration of 0.25 μg / μL; Tetramethylammonium chloride (TMAC): Add an appropriate amount to make the final concentration 40 mM; Template DNA: Add 2 μL of the pretreated supernatant directly; Make up to 25 μL with nuclease-free water.

[0084] Amplification procedure: Pre-denaturation at 95 ℃ for 2 minutes.

[0085] Cyclic reaction (30 cycles): Denaturation at 95°C: 10 seconds Annealing at 56℃ for 30 seconds 72℃ extension: 1 minute 72 ℃ Final extension: 7 minutes.

[0086] Store at 4°C.

[0087] 3. Results Take 5-8 μL of the amplification product and perform electrophoresis on a 1.2% agarose gel (120 V, 30 min). The grayscale values ​​of the target bands in the electrophoresis image were measured using ImageJ image analysis software. After background correction, the results are shown in Table 3 below.

[0088] Table 3 As shown in Table 3, no target pathogen signals were detected in the blood, tissue fluid, and excrement samples of healthy silkworms. The detection of pathogens in diseased silkworm samples clearly reflected the differences in pathogen distribution across different sample types: in the blood and tissue fluid of diseased silkworms, nucleopolyhedrovirus (BmNPV) showed the strongest amplification signal, followed by silkworm microsporidia (Nb), while Beauveria bassiana (Bb) was relatively weak. This is consistent with the biological characteristics of BmNPV's massive proliferation in hemolymph and also confirms the enhancing effect of the thermostable single-chain binding protein in the reaction system on the amplification of long-fragment BmNPV. In the excrement samples of diseased silkworms, the detection signal of Beauveria bassiana (Bb) was the most prominent, while the signal intensities of silkworm microsporidia and nucleopolyhedrovirus were similar and at a moderate level, reflecting the characteristic that Bb spores easily accumulate in excrement and the environment. The detection signal gray values ​​of all positive samples were stable, with small standard deviations and good repeatability, demonstrating that the extraction-free direct amplification method combined with the optimized triple nano-PCR system can effectively overcome sample matrix interference and achieve stable and reliable simultaneous detection of different pathogens with significantly different loads in actual clinical samples.

[0089] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A triple nano-PCR detection method for Nosema bombycis, Beauveria bassiana and nuclear polyhedrosis virus, characterized in that, Includes the following steps: 1) Extract DNA from the sample to be tested; 2) Using the DNA as a template, nano-PCR amplification was performed using primer sets Nb.C1-F and Nb.C1-R, primer sets Bb.L1-F and Bb.L1-R, and primer sets Bm.PY-F and Bm.PY-R; The nano-PCR amplification reaction system includes 2×Nano-qPCR buffer, Taq DNA polymerase, MgCl2, primer sets Nb.C1-F and Nb.C1-R, primer sets Bb.L1-F and Bb.L1-R, primer sets Bm.PY-F and Bm.PY-R, and DNA template; The reaction program for nano-PCR amplification includes denaturation at 95 ℃ for 10 s, annealing at 50-64 ℃ for 30 s, extension at 72 ℃ for 1 min, and 20-40 cycles. 3) The amplified products were detected by agarose gel electrophoresis. If a specific band of 733 bp appeared, the product was considered positive for *Bombyx mori* microsporidia; if a specific band of 230 bp appeared, the product was considered positive for *Beauveria bassiana*; and if a specific band of 860 bp appeared, the product was considered positive for nucleopolyhedrovirus. The nucleotide sequence of Nb.C1-F is shown in SEQ ID No. 1; The nucleotide sequence of Nb.C1-R is shown in SEQ ID No. 2; The nucleotide sequence of Bb.L1-F is shown in SEQ ID No. 3; The nucleotide sequence of Bb.L1-R is shown in SEQ ID No. 4; The nucleotide sequence of Bm.PY-F is shown in SEQ ID No. 5; The nucleotide sequence of Bm.PY-R is shown in SEQ ID No.

6.

2. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 1, characterized in that, In the reaction system, the amounts of primers Nb.C1-F and Nb.C1-R are 8-12 pmol each, the amounts of primers Bb.L1-F and Bb.L1-R are 2-6 pmol each, and the amounts of primer sets Bm.PY-F and Bm.PY-R are 10-14 pmol each; the amount of Taq DNA polymerase is 1.4-1.8 μL, and the amount of MgCl2 is 0.1-0.3 μL.

3. The triplex nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 1, characterized in that, The annealing temperature is 54-58 ℃; the number of cycles is 25-35.

4. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 1, characterized in that, The reaction system for nano-PCR amplification also contains a thermostable single-stranded binding protein at a concentration of 0.1-0.5 μg / μL.

5. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 4, characterized in that, The reaction system for nano-PCR amplification also contains tetramethylammonium chloride at a concentration of 20-60 mM.

6. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 1, characterized in that, The reaction system for nano-PCR amplification also contains graphene oxide at a concentration of 1-5 μg / mL.

7. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 6, characterized in that, Before use, the graphene oxide is mixed and incubated with polyethylene glycol with a molecular weight of 2000-10000 to modify the surface of the graphene oxide with polyethylene glycol. After washing, a solution with a concentration of 1-5 μg / mL is prepared and added to the reaction system.

8. The triple nano-PCR detection method of the Bombyx mori microsporidium, Beauveria bassiana and the nuclear polyhedrosis virus according to claim 7, characterized in that, The steps for incubating graphene oxide with polyethylene glycol are as follows: A graphene oxide dispersion is mixed with a polyethylene glycol solution with a molecular weight of 2000-10000, resulting in an initial graphene oxide concentration of 10-50 μg / mL and a polyethylene glycol concentration of 0.5-2.5 mg / mL. The mixture is then incubated with shaking for 2-4 h at a pH of 6.0-7.5 and a temperature of 45-60 ℃. After incubation, the supernatant is removed by centrifugation, and the precipitate is washed at least three times with a Tris-HCl buffer solution with a pH of 7.0-8.0 to remove unbound free polyethylene glycol. Finally, the obtained polyethylene glycol-modified graphene oxide is redispersed in nuclease-free water and brought to the desired concentration.