Burkholderia litoralis and application thereof in antagonizing aspergillus flavus
By using Burkholderia lagoon to degrade aflatoxin B1, the problems of low efficiency in removing AFB1 and food safety in existing technologies have been solved, achieving a highly efficient and safe food detoxification effect.
Patent Information
- Application Number
- CN202610728946.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-26
- Publication Date
- 2026-06-30
AI Technical Summary
Existing physical and chemical methods for removing aflatoxin A (AFB1) suffer from low efficiency, high cost, or harm to food quality and safety, and there is a lack of efficient and safe microbial detoxification methods.
A bacterial suspension prepared using Burkholderia stagnalis was mixed with food samples containing aflatoxin and incubated under specific conditions to achieve the degradation of AFB1 and antagonism of aflatoxin.
It achieves efficient degradation of AFB1 and inhibition of Aspergillus flavus, with a degradation rate of 86.5%, which is harmless to food safety and does not affect food quality.
Smart Images

Figure CN122303105A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Burkholderia lagoon and its application in antagonizing Aspergillus flavus. Background Technology
[0002] Aflatoxins are a class of secondary metabolites primarily produced by fungi such as *Aspergillus flavus* and *Aspergillus parasiticus*. Structurally, these toxins are structural analogs composed of difuran rings and coumarin. Aflatoxins are extremely teratogenic, carcinogenic, and mutagenic, and widely contaminate agricultural products and foods such as peanuts, corn, cottonseed, rice, dried fruits, and milk. More than twenty types of aflatoxins have been identified, among which aflatoxin B1 (AFB1) has the widest distribution and the strongest toxicity, and is classified as a Group IA carcinogen by the International Agency for Research on Cancer (IARC) of the World Health Organization.
[0003] Currently, commonly used methods for AFB1 removal are mainly physical and chemical methods. Physical methods include sorting, rinsing, high-temperature heating, radiation, and solvent extraction. These methods are either labor-intensive and inefficient, or they may damage the nutritional components of agricultural products. Chemical methods utilize oxidants, sodium hydroxide, and other chemical reagents to react with the toxin, reducing its concentration. However, these methods have significant limitations. Many reagents can harm the skin, eyes, and respiratory tract of operators, and chemical residues are difficult to remove, affecting the quality and safety of agricultural products and food. Microbial detoxification has become a research hotspot in recent years. This method mainly uses bacteria, fungi, and other microorganisms and their metabolites to remove AFB1 contamination from food. This detoxification method is non-contaminated with raw materials, highly specific, and avoids the regeneration of toxins. It has advantages such as mild degradation conditions, strong specificity, and high detoxification efficiency, making it a highly efficient and safe detoxification method. Different microorganisms have significantly different detoxification efficiencies. Therefore, developing a strain with high detoxification efficiency that can both efficiently degrade aflatoxin and antagonize the growth of Aspergillus flavus is of great significance and value. Summary of the Invention
[0004] This invention provides a strain of Burkholderia stagnalis, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38387.
[0005] This invention provides the application of the above-mentioned Burkholderia lagoon in the degradation of aflatoxin; the aflatoxin is aflatoxin B1.
[0006] The present invention provides an aflatoxin degradation formulation containing the aforementioned Burkholderia lagoon bacteria.
[0007] This invention provides a method for the degradation of aflatoxin, comprising the following steps: Burkholderia lagoon bacterial culture was mixed with a sample containing aflatoxin and incubated at 37 °C to degrade the aflatoxin in the sample.
[0008] In the above-mentioned aflatoxin degradation method, the aflatoxin is aflatoxin B1.
[0009] In the above-mentioned aflatoxin degradation method, the concentration of the Burkholderia lagoon bacterial solution is at least 3.2 × 10⁻⁶. 8 cfu / mL.
[0010] In the above-mentioned aflatoxin degradation method, the Burkholderia lagoon bacterial culture is prepared by the following method: Burkholderia lagoon was inoculated into LB liquid fermentation medium and cultured on a shaker at 37°C to obtain Burkholderia lagoon bacterial culture.
[0011] The formulation of the above LB liquid fermentation medium is as follows: 10 g tryptone, 5 g yeast extract, 10 g NaCl, pH 7.0.
[0012] In the above-mentioned aflatoxin degradation method, the sample is at least one of peanuts, corn, rice, wheat, millet, oats, beans, and nuts.
[0013] The present invention also provides the application of the above-mentioned Burkholderia lagoon in antagonizing Aspergillus flavus.
[0014] The present invention also provides an Aspergillus antagonist, wherein the antagonist contains the aforementioned Burkholderia lagoon.
[0015] The present invention also provides a method for antagonizing aflatoxin, the steps of which are as follows: Burkholderia lagoon bacterial culture was mixed with a sample containing Aspergillus flavus and incubated at 37 °C to achieve antagonism of Aspergillus flavus in the sample.
[0016] In the above-mentioned Aspergillus antagonism method, the concentration of the Burkholderia lagoon bacterial solution is at least 3.2 × 10⁻⁶. 8 cfu / mL.
[0017] In the above-mentioned Aspergillus antagonism method, the Burkholderia lagoon bacterial culture is prepared by the following method: Burkholderia lagoon was inoculated into LB liquid fermentation medium and cultured on a shaker at 37°C to obtain Burkholderia lagoon bacterial culture.
[0018] The formulation of the above LB liquid fermentation medium is as follows: 10 g tryptone, 5 g yeast extract, 10 g NaCl, pH 7.0.
[0019] In the above-mentioned aflatoxin antagonism method, the sample is at least one of peanuts, corn, rice, wheat, millet, oats, beans, and nuts.
[0020] The beneficial effects of this invention are as follows: This invention develops a Burkholderia lagoon strain that can both inhibit the growth of Aspergillus flavus and efficiently degrade aflatoxin B1, thus showing good application prospects and value in the field of food production safety technology. Attached Figure Description
[0021] Figure 1 This is a flat plate confrontation experiment.
[0022] Figure 2 The colony morphology of strain G10 is shown.
[0023] Figure 3 This is the phylogenetic tree of strain G10.
[0024] Figure 4 The image shows the effect of strain G10 on inhibiting the growth of Aspergillus flavus in peanut shells; where A is the experimental group and B is the control group.
[0025] Figure 5 The image shows the effect of strain G10 on inhibiting the growth of Aspergillus flavus in corn kernels; where A is the experimental group and B is the control group. Detailed Implementation
[0026] The materials used in the following experiments of this invention are as follows: Peanuts were Huayu 917, provided by the Shandong Peanut Research Institute; corn was Ludan 510, purchased from the Qingdao Wholesale Market. Aspergillus flavus strain 3357 was provided by Professor He Zhumei of Sun Yat-sen University. Soil samples were taken from peanut fields in Feixian County, at a depth of 0–5 cm, and stored at 4 ℃ for later use. Luria-bertan (LB) broth was from Beijing Luqiao Technology Co., Ltd. DNA reagent kits were from Tiangen Biotech Co., Ltd.
[0027] Other materials used in this invention, unless otherwise stated, are commercially available. Other terms used in this invention, unless otherwise specified, generally have the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and not intended to limit the scope of the invention in any way.
[0028] I. Isolation and Identification of Microbial Strains Soil samples were collected from Feixian County, Linyi City in June 2020. 1 g of soil was suspended in 10 mL of sterile water in a clean bench, and the suspension was prepared by shaking and dilution. This suspension was then diluted 100-fold with sterile distilled water. 100 μL of the suspension was spread onto LB agar plates and incubated at 28°C for 3 days, resulting in multiple colonies. Based on color and morphology, the samples were purified by streak plating three times, yielding 98 bacterial strains. The purified strains were numbered and subjected to confrontation culture with activated Aspergillus flavus at 28°C in the dark for 5 days. The results showed that strain G10 exhibited a significant confrontation effect. Figure 1 As shown, it exhibits significant inhibitory and antagonistic effects against Aspergillus flavus. Therefore, strain G10 was selected for further testing.
[0029] Morphological characteristics: The colonies of strain G10, after being cultured on LB plates at 28°C for 48 h, were round, milky yellow, and translucent. Figure 2 As shown, the colony diameter is 1-2 mm, which is consistent with the morphological characteristics of Burkholderia.
[0030] Biological characteristics: Gram staining is negative.
[0031] Genetic analysis: Genomic DNA was extracted from strain G10 using a DNA kit and amplified by PCR using universal primers for the 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT). The resulting gene sequence was 1441 bp.
[0032] 16S rRNA: Based on sequence homology comparison with standard strains in the EzTaxon-e server database, the 16S rRNA gene of strain G10 is similar to that of the standard strain Burkholderia stagnalis LMG 28156. T The 16S rRNA gene showed 99.93% homology. A phylogenetic tree was then constructed using MEGA-X software, such as... Figure 3 As shown.
[0033] Based on the aforementioned morphological, biological, physiological, biochemical, and genetic characteristics, strain G10 was ultimately identified as *Burkholderia stagnalis*. This bacterium was deposited on April 24, 2026, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 38387.
[0034] II. Aflatoxin B1 Degradation Test Dissolve 1 mg of aflatoxin B1 (AFB1) standard in 20 mL of chromatographic grade methanol to prepare an AFB1 stock solution with a concentration of 50 ppm. Take 0.5 mL of AFB1 (50 ppm) and add 4.5 mL of chromatographic grade methanol to prepare an AFB1 working stock solution with a concentration of 5000 ppb.
[0035] Strain G10 was inoculated into LB liquid fermentation medium (g / L): 10 g tryptone, 5 g yeast extract, 10 g NaCl, pH 7.0, and cultured on a shaker at 37°C for 2 days to obtain G10 bacterial culture with a concentration of 3.2 × 10⁻⁶. 8 cfu / mL.
[0036] Take 1.96 mL of G10 bacterial culture and place it in a 10 mL sample tube. Add 40 μL of AFB1 working stock solution to a final concentration of 100 ppb. Mix by inversion and incubate at 37 °C for 72 h. Then centrifuge at 8000 rpm for 5 min to obtain the supernatant, which is recorded as the experimental group solution. Add 40 μL of AFB1 working stock solution to 1.96 mL of uninoculated culture medium as the control group solution.
[0037] The AFB1 content in the experimental and control groups was detected using an aflatoxin B1 ELISA kit, and the degradation effect of strain G10 on AFB1 was calculated.
[0038] The test results are as follows: The AFB1 content in the experimental group was 13.4 ppb, while the AFB1 content in the control group was 99.6 ppb. Calculations showed that strain G10 exhibited the best degradation effect on AFB1 under conditions of 37 ℃ and 72 h, with a degradation rate of 86.5%.
[0039] III. Aspergillus Inhibition Test 1. Aspergillus inhibition test of peanuts in shells Select intact Huayu 917 peanuts with shells, disinfect them with 1% NaClO solution, and then inoculate them with 0.8 mL of Aspergillus flavus spore suspension (3×10⁻⁶). 6 (cfu / mL). Then add 0.8 mL of fermentation broth from strain G10. Incubate at 28 ℃ in the dark, and observe and record the mycelial growth on the pods. Use an appropriate amount of sterile water as a blank control.
[0040] 2. Aspergillus inhibition test in maize Sterilize corn kernels with 1% NaClO solution, then rinse three times with sterile water. Place 10 corn kernels in a sterile petri dish and inoculate with 0.2 mL of Aspergillus flavus spore suspension (3 × 10⁻⁶). 6 (cfu / mL). Then add 0.2 mL of fermentation broth from strain G10. Incubate at 28 ℃ in the dark and observe the bacterial growth on the corn kernels. Use an appropriate amount of sterile water as a blank control.
[0041] The test results are as follows Figure 4 and Figure 5 As shown: The growth status of peanut inoculated with strain G10 and Aspergillus fermentation broth is as follows: Figure 4 As shown in the figure, in the control group, four peanuts with shells had Aspergillus flavus coverage exceeding 80%, and two peanuts with shells had Aspergillus flavus coverage exceeding 60%; in the experimental group, one peanut with shells had Aspergillus flavus coverage exceeding 70%, two peanuts with shells had Aspergillus flavus coverage exceeding 30%, and three peanuts with shells had Aspergillus flavus coverage exceeding 20%. The Aspergillus flavus growth coverage in the control group was significantly greater than that in the experimental group, indicating that the fermentation broth of strain G10 has an inhibitory effect on Aspergillus flavus and can antagonize Aspergillus flavus growth on peanuts with shells.
[0042] Figure 5 The figure shows the growth of corn kernels after inoculation with fermentation broths from two different bacteria. As can be seen from the figure, in the control group, two corn kernels had Aspergillus flavus coverage exceeding 40%, and two kernels had coverage exceeding 20%. In the experimental group, only one corn kernel had Aspergillus flavus coverage exceeding 20%. The experimental group had fewer corn kernels with Aspergillus flavus growth than the control group, and the coverage rate of Aspergillus flavus in the experimental group was also lower. This indicates that the fermentation broth of strain G10 has an antagonistic effect on the growth of Aspergillus flavus in corn kernels.
[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A strain of Burkholderia stagnalis, characterized by, The strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38387.
2. The use of Burkholderia lagoonii according to claim 1 in the preparation of formulations antagonizing Aspergillus flavus.
3. An aflatoxin antagonist, characterized in that, The antagonist contains Burkholderia lagoonii as described in claim 1.
4. A method for antagonizing Aspergillus flavus, characterized in that, The steps are as follows: The bacterial culture of Burkholderia lagoon described in claim 1 was mixed with a sample containing Aspergillus flavus and incubated at 37 °C to achieve antagonism of Aspergillus flavus in the sample.
5. The method for antagonizing Aspergillus flavus according to claim 4, characterized in that, The concentration of the Burkholderia lagoon bacterial solution is at least 3.2 × 10⁻⁶. 8 cfu / mL.
6. The method for antagonizing Aspergillus flavus according to claim 4, characterized in that, The Burkholderia lagoon bacterial culture was prepared by the following method: Burkholderia lagoon was inoculated into LB liquid fermentation medium and cultured on a shaker at 37°C to obtain Burkholderia lagoon bacterial culture.
7. The method for antagonizing Aspergillus flavus according to claim 6, characterized in that, The formulation of the LB liquid fermentation medium is as follows: 10 g tryptone, 5 g yeast extract, 10 g NaCl, pH 7.
0.
8. The method for antagonizing Aspergillus flavus according to claim 4, characterized in that, The sample is at least one of peanuts, corn, rice, wheat, millet, oats, beans, and nuts.