A type of xylose-oxidizing achromobacterium and its application in matcha tea tree cultivation and quality improvement

By using Xylose-oxidizing Achromobacterium xylose in matcha production in combination with shading treatment, the problems of slow growth, low yield, and difficulty in quality control of tea trees in low light environment were solved. This achieved the effects of promoting tea tree growth, increasing the theanine content, and reducing the caffeine content, thereby improving the production efficiency and quality of matcha.

CN122303109APending Publication Date: 2026-06-30JIANGHAN UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGHAN UNIVERSITY
Filing Date
2026-06-02
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Current technologies lack specialized strains for low-light, shaded environments in matcha production, making it impossible to simultaneously promote tea tree growth, increase theanine content, and reduce caffeine content.

Method used

Xylose-oxidizing achromobacterium JHMC Fb2318 was used to promote the growth of tea trees under low light conditions and regulate the content of theanine and caffeine by foliar spraying combined with shading treatment.

Benefits of technology

It significantly improves tea tree root growth and chlorophyll content, increases fresh leaf yield and theanine content, reduces caffeine content, and enhances matcha quality and production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303109A_ABST
    Figure CN122303109A_ABST
Patent Text Reader

Abstract

This invention relates to the field of microbial technology, specifically to a xylose-oxidizing achromobacterium and its application in matcha tea cultivation and quality improvement. The xylose-oxidizing achromobacterium provided by this invention... Achromobacter xylosoxidans JHMC Fb2318, with accession number CCTCC NO:M 20251855 and accession date of August 19, 2025, shows that foliar spraying of this strain on tea trees during seedling cultivation and planting under low light and shading conditions can promote root formation and increase the survival rate of cuttings under low light conditions; increase the weight of 100 buds and the length of buds under low light conditions; increase the content of chlorophyll a, chlorophyll b, and total chlorophyll; and decrease the chlorophyll a / b ratio. It also increases the amino acid content and decreases the caffeine content in matcha made from tea trees, demonstrating its potential application in matcha production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial application technology. Specifically, this invention relates to a type of xylose-oxidizing achromobacterium and its application in the cultivation and quality improvement of matcha tea trees. Background Technology

[0002] The unique characteristics of matcha production: The Chinese National Standard for Matcha (GB / T34778—2017) defines matcha as: "a finely powdered tea product made from the leaves of tea trees grown under cover, which are steamed (or hot-air) to kill the green and then dried, and processed through grinding." Unlike traditional tea tree cultivation, the tea trees used for matcha production require shading before harvesting to ensure the fresh leaves develop high amino acid content, low caffeine content, and low bitterness. However, low light conditions (<1000 lx) significantly inhibit tea tree growth and reduce yield. Current production relies heavily on nitrogen fertilizers, which can easily lead to soil degradation and quality fluctuations.

[0003] Microbial agents can regulate plant growth and secondary metabolism, but current technologies lack specific functional strains for matcha grown in shaded, low-light conditions. Existing research on *Achromobacter xylose-oxidizing* mainly focuses on soil remediation, root growth promotion, and disease resistance, without addressing targeted regulation of tea quality. Xiang Chunzhu et al. reported that this bacterium has phosphorus-solubilizing ability in the rhizosphere of moso bamboo, but did not confirm its growth-promoting effect; Wang Zhuo et al. screened uranium-tolerant growth-promoting strains that can promote alfalfa growth, but did not address the regulation of plant secondary metabolism. Patent publications CN117586931A and CN106399166A disclose the growth-promoting and root-knot nematode-resistant effects of this bacterium on cucumber and pea, respectively, all involving root application and without mentioning its effects on secondary metabolism such as amino acids and caffeine. Patent publication CN119685220A discloses *Streptomyces cherriescens* which can increase theanine, but the strain type differs significantly from this invention, and it does not address the function of reducing caffeine. Patent publication number CN113716988A discloses a compound soil-improving organic fertilizer for tea trees containing xylose-oxidizing achromobacterium. It is applied as a soil base fertilizer. Its caffeine-reducing effect is the overall effect of the compound of multiple components, rather than the single function of a single strain. Moreover, this technology is not designed for the low-light shading scenario of matcha production, and cannot simultaneously achieve the effects of promoting growth in low light, increasing theanine and reducing caffeine.

[0004] In summary, there are currently no suitable microbial strains for preparing microbial fertilizers specifically for low-light cultivation of tea trees used as raw materials for matcha, which can promote growth and regulate the content of theanine and caffeine through foliar spraying. This invention aims to fill the aforementioned technological gap. Summary of the Invention

[0005] This invention provides a xylose-oxidizing achromobacterium JHMC Fb2318 with a low-light-promoting effect on tea plant growth, which was deposited on August 19, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Hubei, China; accession number CCTCC NO: M 20251855; its classification name is... Achromobacter xylosoxidans JHMCFb2318.

[0006] This invention also provides the application of Xylose-oxidizing achromobacterium JHMC Fb2318 in matcha tea tree cultivation and quality improvement, especially its application in matcha raw material production, including the following steps: 1) Colonies of *Achromobacter xylose oxidizing* strain JHMC Fb2318, in its vigorous growth phase, were inoculated into NB liquid medium and cultured at 28°C and 180 rpm for 48 h on a shaker to prepare a bacterial suspension. The JHMC Fb2318 bacterial concentration in the suspension was adjusted to 1 × 10⁻⁶. 6 -1×10 8 CFU / mL.

[0007] 2) Before shading the tea trees, spray the bacterial suspension prepared in step 1) onto the tea tree leaves, spraying 2-3 times in total, with a spraying frequency of once every 5-7 days.

[0008] 3) After spraying, immediately use shade netting to shade the tea seedlings. The shading rate for tea seedlings used for seedling cultivation should be 50%-60%; the shading rate for tea trees used for matcha raw material production should be 85%-90%, and the shading treatment should last for no less than 15 days.

[0009] 4) Harvest fresh leaves within 3 hours after the shading ends to obtain matcha raw materials for matcha preparation.

[0010] The above applications include: 1. Promoting root growth of tea cuttings under low light and improving survival rate; 2. Increasing fresh leaf yield, 100-bud weight, and new shoot length under low light; 3. Increasing chlorophyll a, chlorophyll b, and total chlorophyll, and decreasing chlorophyll a / b; 4. Significantly increasing the theanine content of matcha; 5. Significantly reducing the caffeine content of matcha.

[0011] Low light shading conditions are light conditions below 1000 lx.

[0012] The methods for achieving low-light shading conditions include using artificial covering, natural conditions, or artificial light sources; the artificial covering includes straw mats, straw, shade nets, nylon nets, and / or greenhouse films; the natural conditions include forest environments, intercropping or relay cropping with other plants; the artificial light sources include artificial climate chambers, plant cultivation boxes, and / or the lighting systems within plant factories.

[0013] Finally, this invention also provides a tea plant growth regulator containing *Achromobacterium xylose oxidizing* JHMC Fb2318, wherein the bacterial count of JHMC Fb2318 is 1×10⁻⁶. 6 -1×10 8 CFU / mL.

[0014] Compared with the prior art, the advantages and beneficial effects of the present invention are: The *Achromobacterium xylose oxidizing* JHMC Fb2318 isolated and screened in this invention can significantly improve root growth and survival rate of tea cuttings; significantly increase the weight of 100 buds, shoot length, chlorophyll a, and chlorophyll b content of tea trees after shading treatment, and reduce the chlorophyll a / b ratio; and significantly increase the amino acid content and reduce the caffeine content in matcha products. By applying it via foliar spray, it can directionally regulate the growth and quality metabolism of tea trees under low-light shading conditions. This method is suitable for the covered cultivation of tea trees used as raw materials for matcha, effectively solving problems such as weak growth, low yield, and difficulty in quality control under low-light conditions, and has good application prospects. It also helps reduce the amount of chemical fertilizers used in tea gardens for matcha raw materials, improves matcha production efficiency, and enhances the flavor and quality of matcha. Attached Figure Description

[0015] Figure 1 Morphological identification of Xylose-oxidizing achromobacter JHMC Fb2318 Figure 1 In the diagram, A represents the colony morphology of this bacterium on NA solid medium. Figure 1 B in the diagram represents a Gram staining pattern; Figure 2 Molecular biological identification and phylogenetic tree of Xylose-oxidizing Achromobacterium JHMC Fb2318 in Example 1; Figure 3 This describes the promoting effect of spraying three types of xylose-oxidizing achromobacterium on tea tree growth under low light conditions in Example 3. Figure 3 A, B, C, and D in the figure are CK, JHMC Fb2318, CGMCC.8828, and CGMCC.8512, respectively. Detailed Implementation

[0016] The preparation and application processes of the product of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can clearly understand the present invention. However, it should be understood that the following embodiments should not be construed in any way as limiting the scope of protection claimed in the claims of this application.

[0017] The culture medium used in the examples is: NA medium (beef extract peptone agar): 5g beef extract, 10g peptone, 5g NaCl, 20g agar, 1L water, pH 7.2-7.4; sterilize at 121℃ for 30min.

[0018] NB liquid medium (beef extract peptone liquid medium): 5g beef extract, 10g peptone, 5g NaCl, 1L water, pH 7.2-7.4; sterilize at 121℃ for 30min.

[0019] Example 1: Isolation and Identification of Xylose-oxidizing Achromobacterium JHMC Fb2318 The inventors collected rhizosphere soil samples from healthy cowpea plants in Qijialing Village, Lukou Town, Huangzhou District, Huanggang City, Hubei Province. 5g of soil sample was placed in an Erlenmeyer flask containing 100 mL of sterile water and shaken at 180 r / min for 30 min at 30℃. Then, 1 mL of the soil suspension was placed in a test tube containing 9 mL of sterile water and shaken well. This process was repeated three times. 100 μL of the liquid was then spread on NA medium and cultured at 30℃ for 48 h. Strains with different morphologies were then picked, purified, numbered, and cultured.

[0020] The purified strain was subjected to tests to determine its characteristics, including inorganic phosphorus solubilization, siderophore production, and IAA production. Based on a comprehensive evaluation of these indicators, a strain was selected that produced siderophores and IAA, with an IAA production of 13.12 μg / mL after 7 days. The inventors named this strain JHMC Fb2318, and its colony morphology on NA medium is as follows. Figure 1 As shown. The molecular biological identification results and phylogenetic tree of *Achromobacter xylose oxidizing* JHMC Fb2318 are as follows. Figure 2 As shown.

[0021] JHMC Fb2318 strain was cultured in NB medium. DNA was extracted from the bacterial culture using a bacterial DNA extraction kit. The 16S rDNA gene of the strain was then sequenced by PCR using universal primers for bacterial 16S rDNA: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACCTTGTTACGACTT). PCR amplification was performed in a 50 μL reaction system: 25 μL 2×mix, 2 μL DNA template, 2 μL primer 27F, 2 μL primer 1492R, and 19 μL dd H2O. PCR reaction conditions were: 95℃ for 2.5 min, one cycle; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 10 min. PCR products were detected by 1.0% agarose gel electrophoresis. The PCR amplification products were sent to Tianyi Huayu Genome Research Center for sequencing, and the 16S rDNA gene sequence of strain JHMC Fb2318 was obtained as follows: The obtained 16S rRNA sequence was submitted to the NCBI nucleic acid database for homology comparison and identified as *Achromobacter xylose oxidizing*. Achromobacter xylosoxidans ).

[0022] Example 2: Effects of Xylose-oxidizing Achromobacterium JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on the growth and survival rate of tea cuttings. The experiment was conducted at the matcha production base in Jindun Village, Dawu County, Xiaogan City, Hubei Province. The matcha raw material tea tree variety was Longjing 43, and the cuttings were current-year branches. The mother branches used for cutting were over 25 cm in length and 3-5 mm in stem diameter. The tested bacterial strains were: *Achromobacterium xyloseoxidans* JHMC Fb2318 (isolated in Example 1), *Achromobacterium xyloseoxidans* CGMCC.8828 (a strain of *Achromobacterium xyloseoxidans* and its application in removing heavy metal ions, 201410085503.3), and CGMCC.8512 (a biological agent for purifying arsenic-contaminated soil, 201711025945.9); all were purchased from the China General Microbiological Culture Collection Center. Cuttings were taken from cuttings with one mature leaf and one plump axillary bud, with a smooth cut and the lower cut bevel parallel to the leaf surface.

[0023] Cuttings: Before planting, thoroughly water the seedbed. After 2-3 hours, once the water has seeped in, the cuttings are ready for use. Plant the cuttings 7-10 cm apart in rows and 2 cm apart at intervals. After planting, compact the soil around the cuttings to ensure close contact between the cuttings and the soil. Water immediately after planting and provide shade as needed, depending on the weather.

[0024] Xylose-oxidizing colorless bacteria spraying treatment: On the day the cuttings are shaded, spray the leaves of the cuttings with a sprayer at a distance of 10-20 cm from the top of the cuttings at a concentration of 10. 7 The bacterial suspension of Achromobacterium xylose oxidizing JHMC Fb2318 (CFU / mL) was applied twice, with the same mass of tap water as the control (CK). Immediately after spraying, the area was covered with black high-density polyethylene shade netting (50% shading rate). The low-light shading condition was 650 lx.

[0025] Determination of the effects of xylose-oxidizing achromobacterium on root growth and survival rate of tea cuttings: 90 days after cutting, tea cuttings were carefully dug up, and the roots were gently rinsed with clean water to remove soil (avoiding root damage). The roots were then laid flat on a transparent plate of a scanner. The average root diameter, average root length, and average number of roots with a length ≥ 0.3 mm were measured, and the survival rate of the cuttings was calculated.

[0026] Table 1. Effects of Xylose-oxidizing achromobacterium JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on the root system and survival rate of tea cuttings. deal with Average root length (cm) Average root diameter (mm) Average number of roots Cuttings survival rate (%) CK 1.83 ± 0.04 c 0.48 ± 0.02 c 12.03 ± 1.16 c 78.10 ± 1.92 c JHMC Fb2318 2.08 ± 0.10 a 0.56 ± 0.03 a 15.84 ± 1.64 a 85.23 ± 3.58 a CGMCC.8828 1.88 ± 0.06 bc 0.42 ± 0.01 c 14.83 ± 1.80 b 81.53 ± 6.57 b CGMCC.8512 1.97 ± 0.12 b 0.52 ± 0.02 b 14.77 ± 1.02 b 80.16 ± 2.09 b Note: Different lowercase letters indicate significant differences at the P<0.05 level according to Duncan's new multiple range test.

[0027] Table 1 shows that, compared with the control (CK), spraying with JHMC Fb2318 strain significantly increased the average root length, average root diameter, and average number of roots in tea cuttings, with increases of approximately 13.67%, 16.67%, and 31.67%, respectively, demonstrating a significant growth-promoting effect and a substantial increase in the survival rate of cuttings (by 9.13%). The JHMC Fb2318 strain treatment was superior to CGMCC.8828 and CGMCC.8512 in terms of average root length, average root diameter, average number of roots, and cutting survival rate.

[0028] Example 3: Effects of Xylose-oxidizing Achromobacterium JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on tea tree growth and chlorophyll content under low light conditions. The experiment was conducted at the matcha production base in Jindun Village, Dawu County, Xiaogan City, Hubei Province. The tea tree variety used as the raw material for the matcha was Longjing 43. The test strains were the same as in Example 2.

[0029] Xylose-oxidizing Achromobacterium oxysporum spraying treatment: Select a 1 m wide tea row. When the tea trees have 70%-80% one bud and two leaves, spray with a sprayer at a distance of 20-30 cm from the leaf canopy surface of the tea trees at a concentration of 10. 7 CFU / mL of *Achromobacterium xylose oxidizing* JHMCFb2318 bacterial suspension was applied twice, with an equal mass of tap water as a control (CK). Shading was provided using a black high-density polyethylene shade net (85% shading rate), approximately 30 cm above the tea canopy, for 21 days; the low-light shading condition was 650 lx. The promoting effects of the three *Achromobacterium xylose oxidizing* strains on tea tree growth under low-light conditions are as follows: Figure 3 As shown.

[0030] Determination of the growth-promoting effect of Xylose-oxidizing Achromobacterium on tea trees: Fresh leaves of equal tenderness were picked from tea trees on April 28, 2025, with the picking standard being one bud and four leaves. A 1 m... 2Sampling racks were used for collection. Fresh weight was measured immediately after harvest and converted to yield (kg / mu). Simultaneously, the weight of 100 tea buds and the length of new shoots were measured, with each indicator repeated three times. Chlorophyll was measured using a 95% acetone-ethanol (2:1 volume ratio) solution. Samples were extracted in the dark at room temperature for 30 minutes, followed by absorbance measurement using a UV spectrophotometer. The concentrations of chlorophyll a, chlorophyll b, and total chlorophyll were determined according to Arnon's formula.

[0031] Table 2. Effects of Xylose-oxidizing achromobacterium JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on fresh bud yield, 100-bud weight, new shoot length, and leaf chlorophyll content of tea plants under low light conditions. deal with Fresh leaf yield (kg / mu) Weight of 100 sprouts (g) New shoot length (cm) Chlorophyll a (mg / g) Chlorophyll b (mg / g) Chlorophyll a / b CK 169.75 ± 10.86 c 61.93 ± 3.70 c 8.73 ± 0.19 c 2.01 ± 0.02 b 2.55 ± 0.12 c 0.79 ± 0.03 a JHMC Fb2318 209.69 ± 12.52 a 75.47 ± 4.10 a 9.23 ± 0.09 a 2.18 ± 0.02 a 3.11 ± 0.07 a 0.70 ± 0.01 b CGMCC.8828 178.53 ± 8.34 b 71.45 ± 2.45 b 9.03 ± 0.23 b 2.16 ± 0.01 a 3.12 ± 0.11 a 0.69 ± 0.10 b CGMCC.8512 185.42 ± 13.23 b 70.41 ± 3.99 b 9.09 ± 0.13 b 2.04 ± 0.03 b 3.05 ± 0.12 b 0.67 ± 0.05 b Note: Different lowercase letters indicate significant differences at the P<0.05 level according to Duncan's new multiple range test.

[0032] Table 2 shows that, compared with the control (CK), spraying with strain JHMC Fb2318 significantly increased the yield of fresh leaves, the weight of 100 buds, and the length of new shoots in tea plants under low light conditions, with increases of 23.53%, 21.86%, and 5.73%, respectively, demonstrating a significant growth-promoting effect. Furthermore, spraying with strain JHMC Fb2318 increased the content of chlorophyll a and chlorophyll b in fresh leaves, resulting in a darker green color. The increase in chlorophyll b content was 21.96%, higher than the increase in chlorophyll a content (8.46%), while the chlorophyll a / b ratio decreased by 11.39%, indicating an enhanced ability of the plant to utilize light energy. Strains CGMCC.8828 and CGMCC.8512 also had a certain promoting effect on the chlorophyll content of tea leaves, but their effects were weaker than those of the JHMC Fb2318 treatment, especially in key indicators such as the weight of 100 buds, the length of new shoots, and the yield of fresh leaves per acre.

[0033] Example 4: Effects of strains JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on theanine and caffeine content. To verify the specificity of the JHMC Fb2318 strain in regulating the content of theanine and caffeine, the xylose-oxidizing Achromobacterium strains CGMCC.8828 and CGMCC.8512, which are closely related to this strain, were selected as controls for comparative experiments, as follows: The experimental location, tea tree variety, and shading conditions were kept consistent with those in Example 2. The standard for picking fresh leaves was one bud and four leaves, and matcha was prepared after picking.

[0034] Test strain: Same as in Example 2.

[0035] Matcha preparation: Fresh leaves → naturally spread out indoors for 2 hours → steam fixation (using a 47 cm diameter steamer, fixation for about 100 seconds) → cooling and heat dissipation → initial drying (110 ℃, 15 min) → stem and impurity removal → final drying (80 ℃, 40 min) → ball milling → matcha (D 90 (≤18 μm) Theanine content determination: The determination of theanine in tea was performed according to the standard "High Performance Liquid Chromatography (HPLC) for the Determination of Theanine in Tea" (GB / T23193-2017). 1.0 g of matcha sample was weighed into a 200 mL beaker, and 100 mL of boiling distilled water was added. The mixture was placed in a 100℃ water bath for 30 min, filtered, and the filtrate was transferred to a 100 mL volumetric flask. After cooling, the filtrate was diluted to the mark with distilled water and mixed well. The mixture was filtered through a 0.45 μm aqueous filter membrane and then analyzed by high performance liquid chromatography (HPLC). The chromatograph was an Agilent 1260. Flow rate: 0.5 mL / min; column temperature: 35℃; injection volume: 10 μL; detection wavelength: 210 nm; elution conditions: gradient elution; mobile phase A: 100% pure water; mobile phase B: 100% acetonitrile.

[0036] Caffeine content determination: Refer to GB / T8312-2013 "Determination of Caffeine in Tea". Weigh 1.0 g of matcha sample into a 500 mL flask, add 4.5 g of magnesium oxide and 300 mL of boiling water, heat in a boiling water bath, and extract for 20 min (shaking every 5 min). Immediately after extraction, filter under reduced pressure while hot. Transfer the filtrate to a 500 mL volumetric flask, cool, and dilute to the mark with water. Mix well. Take a portion of the test solution and filter through a 0.45 μm aqueous phase filter membrane for analysis. The chromatograph was an Agilent 1260. Flow rate: 0.5 mL / min, column temperature: 40℃, injection volume: 10 μL, detection wavelength: UV detector, wavelength 280 nm; mobile phase: 30% methanol.

[0037] The results of the theanine and caffeine content measurements are shown in Table 3.

[0038] Table 3. Effects of Xylose-oxidizing achromobacterium JHMC Fb2318, CGMCC.8828, and CGMCC.8512 on the theanine and caffeine content in matcha. deal with Theanine content (mg / g) Caffeine content (mg / g) Changes in theanine content (%) Changes in caffeine content (%) CK 45.62±2.08 c 32.51±1.05 a 0 0 JHMC Fb2318 59.37±1.96 a 24.70±1.09 b 30.14 -24.02 CGMCC.8828 51.32±2.01 b 30.66±1.50 a 12.49 -5.69 CGMCC.8512 49.35±2.15 b 32.25±1.95 a 8.18 -0.79 Note: Different lowercase letters indicate significant differences at the P<0.05 level according to Duncan's new multiple range test.

[0039] The results showed that spraying with xylose-oxidizing achromobacterium CGMCC.8828 and CGMCC.8512 increased the theanine content of matcha by 12.49% and 8.18%, respectively, and decreased the caffeine content by 5.69% and 0.79%, respectively. However, the strain JHMC Fb2318 (CCTCC NO: M 20251855) of this invention significantly increased the theanine content of tea trees (30.14% higher than CK) and significantly decreased the caffeine content of tea trees (24.02% lower than CK). Its regulatory effect on theanine and caffeine was significantly better than the above closely related strains of the same genus.

[0040] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; such modifications or equivalent substitutions will not cause the corresponding technical solutions to deviate from the core spirit and protection scope of the present invention.

Claims

1. A wood-oxidizing Achromobacter xylosoxidans JHMC Fb2318, characterized in that, The wood-yellowing bacterium JHMCFb2318 is preserved in the China Center for Type Culture Collection, the address of the preservation unit is: China, Wuhan, Wuhan University; the preservation date is August 19, 2025, the preservation number is CCTCC NO: M 20251855; and the classification name is Achromobacter xylosoxidans JHMC Fb2318.

2. The use of Achromobacter xylosoxidans JHMC Fb2318 according to claim 1 in tea tree planting and quality improvement for matcha production.

3. Use according to claim 2, wherein the compound is ###0002### The use is foliar spraying in weak light shading conditions in tea tree planting.

4. Use according to claim 3, characterized in that, The weak light shading condition is a light condition lower than 1000 lx.

5. Use according to claim 3, characterized in that, The weak light shading condition is achieved by using artificial covering, using natural conditions and / or using artificial light source; the artificial covering includes grass mat, straw, sunshade net, nylon net and / or greenhouse film; the natural conditions include under-forest environment, intercropping or relay cropping with other plants; the artificial light source includes artificial climate chamber, plant incubator and / or facility light system in plant factory.

6. Use according to claim 3 or 4 or 5, characterized in that, The weak light shading condition is specifically that the shading rate of tea seedlings for seedling raising is 50%-60%; the shading rate of tea trees for matcha raw material production is 85%-90%, and the shading treatment is not less than 15 days.

7. Use according to claim 6, characterized in that, The foliar spraying specific steps are: before the tea tree is shaded, the JHMC Fb2318 active bacteria liquid with the bacteria content of 1×10 6 -1×10 8 CFU / mL is sprayed on the leaves, the spraying times are 2-3 times, and the spraying frequency is once every 5-7 days.

8. A bio-pesticide comprising the Achromobacter xylosoxidans JHMC Fb2318 as claimed in claim 1, characterized in that, The biological preparation includes growth regulator, foliar fertilizer, bacteria-containing liquid and / or growth promoter for tea tree.

9. The biological preparation of claim 8, wherein, The bacterial content of JHMC Fb2318 in the said biological preparation is 1 x 10 6 -1 x 10 8 CFU / mL.

10. The use of the biological agent according to claim 8 or 9 in the cultivation and quality improvement of matcha tea tree, characterized by, The use is in matcha raw material production.

Citation Information

Patent Citations

  • A strain of Achromobacter xylosoxidans and its application in removing heavy metal ions

    CN103937704B

  • Achromobacter xylosoxidans for preventing and treating plant root-knot nematode and application of achromobacter xylosoxidans

    CN106399166A

  • A biological agent for purifying arsenic-contaminated soil

    CN107794051B

  • Soil improvement type tea tree organic fertilizer

    CN113716988A

  • Achromobacter xylosoxidans IVF-WK240 and application thereof

    CN117586931A