Barley stripe disease resistant gene rdg2b and use thereof

By cloning and overexpressing the barley stripe disease resistance gene Rdg2b and utilizing the 35S promoter-driven transgenic technology, the technical problem of weak barley stripe disease resistance in existing technologies has been solved, achieving efficient and stable disease resistance breeding results.

CN122303295APending Publication Date: 2026-06-30GANSU AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610346682.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-20
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve barley's resistance to barley stripe disease. Traditional control methods suffer from significant environmental impact, complex operation, or unstable resistance, and lack sustainable intrinsic resistance breeding programs.

Method used

By cloning the barley stripe disease resistance gene Rdg2b, and using 35S strong promoter-driven transgenic technology to overexpress the Rdg2b gene in barley, its resistance to barley stripe disease was improved. The expression level was detected by real-time quantitative PCR and subcellular localization analysis was performed. Combined with Agrobacterium-mediated genetic transformation, highly resistant barley plants were obtained.

Benefits of technology

It significantly improved barley's resistance to barley stripe disease, shortened the breeding cycle, enhanced the genetic stability and breeding efficiency of disease resistance traits, and avoided the chain transmission of non-target traits in traditional hybridization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303295A_ABST
    Figure CN122303295A_ABST
Patent Text Reader

Abstract

This invention discloses a barley stripe disease resistance gene. Rdg2b This invention relates to the field of bioengineering technology and its applications. It describes the cloning of [specific species / organisms] from Ganbei No. 2 barley. Rdg2b The complete CDS segment of the gene was extracted, and an overexpression vector was constructed. Agrobacterium-mediated transformation was then performed to obtain overexpression-positive lines. Infection experiments with *Strombus striatum* showed that, compared to the wild type, [the expression was positive]. Rdg2b Overexpression lines showed significantly enhanced disease resistance. Real-time quantitative PCR analysis revealed that overexpression lines exhibited... Rdg2b Gene expression was significantly upregulated, confirming Rdg2b This invention positively regulates barley disease resistance. It provides important genetic resources for molecular breeding of barley for disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a barley stripe disease resistance gene. Rdg2b And its application in improving the disease resistance of barley plants. Background Technology

[0002] barley( Hordeum vulgare (L.) is an annual herbaceous plant belonging to the genus *Horse* of the Poaceae family, and is the world's fourth largest cereal crop. [1] Barley is not only used for brewing beer, but also has important value in the feed and food industries. [2] However, during barley production and cultivation, various diseases severely affect its yield and quality. Among them, the fungus *Sclerotium tsunei* (… Pyrenophora graminea Barley stripe disease, caused by barley stripes, is the most significant barley disease leading to a severe decline in barley yield and quality in recent years. [3] In years when barley stripe disease is prevalent, it can cause losses of more than 70% of barley yield. [4] To address the severe damage caused by seed stripe disease, control strategies include chemical control relying on fungicides, which, while fast-acting, easily leads to pathogen resistance and environmental residues; biological control using antagonistic bacteria, which, while environmentally friendly, is easily affected by field conditions; and physical control methods such as hot water soaking and radiation treatment, which can directly eliminate or inactivate seed-borne pathogens, but these require high technical skills and may negatively impact seed germination and vigor. [5-7] Compared to these external interventions, addressing the plant's intrinsic resistance by creating new varieties with durable resistance through molecular breeding techniques is a more fundamental and sustainable solution. [8] .

[0003] When pathogens interact with plants, they interfere with normal physiological processes and defense mechanisms by secreting small molecule effectors. [9] However, through the long-term co-evolution of plants and pathogens, plants have also developed diverse defense systems to cope with pathogen infection.

[10] Among these, effector-triggered immunity (ETI) is a highly efficient defense mechanism. When plant resistance proteins (R proteins) directly or indirectly recognize pathogen effectors, they induce systemic acquired resistance (SAR) by triggering hypersensitivity responses, reactive oxygen species release, and the expression of defense-related genes. This results in broad-spectrum resistance to a variety of pathogens. [11,12] .

[0004] Plant disease resistance genes regulate pathogen recognition and immune responses; activation of R proteins can effectively inhibit the spread of pathogens within the host. To date, researchers have cloned over 100 genes from various plants, including rice, wheat, barley, potato, and tomato. R Genes, and most R genes encode disease-resistant proteins containing NB-ARC structures. [13-15] Studies have shown that approximately 0.2% to 1.6% of genes in the plant genome are predicted to belong to the gene family encoding NB-ARC class disease resistance proteins. R Genes can participate in disease resistance processes through signaling pathways such as salicylic acid, jasmonic acid, and abscisic acid.

[16] Some NB-ARC disease resistance genes can also interact with transcription factors such as WRKY and MYB, or other functional proteins, to jointly regulate plant defense responses.

[17] .

[0005] Compared to traditional methods that utilize disease-resistant genes, genetic engineering techniques, through transgenic technology, can enable crops to acquire more comprehensive resistance coverage and more stable genetic characteristics.

[18] In particular, the use of overexpression technology to modify target disease-resistant genes can not only significantly improve crop disease resistance but also effectively broaden its resistance spectrum. These technological advantages are often difficult to achieve through traditional hybridization breeding and conventional improvement methods.

[19] Currently, in the field of agricultural biotechnology, developing disease-resistant crops based on gene cloning technology has become a key research direction. Breakthroughs in this technology will contribute innovative solutions to the sustainable control of crop diseases, reduce agricultural production losses, and have significant strategic importance for ensuring global food security.

[20] Barley disease resistance genes Rdg2b It encodes three core domains of a plant NLR (nucleotide-binding leucine-rich repeat sequence) disease resistance protein. However, we... Rdg2b There are no systematic reports on the functional analysis of genes involved in barley stripe disease resistance and their application in disease-resistant breeding. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the present invention provides a barley stripe disease resistance gene. Rdg2b and its applications, Rdg2b Genetically transformed barley with significantly increased gene overexpression Rdg2b The relative expression of genes was significantly increased, ROS accumulation was enhanced, and resistance to stripe disease was significantly improved. Rdg2b Genes play an important role in resistance to stripe disease. To solve the above-mentioned technical problems, the present invention adopts the following technical solution: 1. A gene for resistance to barley stripe disease Rdg2b The Rdg2b The complete full-length coding sequence of the gene's CDS is shown in SEQ ID No. 1.

[0007] 2. A barley Rdg2b protein with resistance to barley stripe disease, said Rdg2b protein as described in claim 1 with resistance to barley stripe disease. Rdg2b The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO: 2.

[0008] 3. A gene for resistance to barley stripe disease Rdg2b The method of obtaining the barley stripe disease resistance gene includes: (1) barley stripe disease resistance gene Rdg2b (2) The expansion; Rdg2b Bioinformatics analysis of the gene and its encoded protein; (3) Real-time quantitative PCR detection of the anti-stripe disease gene Rdg2b Methods for expressing levels; (4) Rdg2b Subcellular localization analysis of genes.

[0009] 4. A gene for resistance to barley stripe disease Rdg2b The carrier construction method is characterized in that the method includes: (1) according to Rdg2b Gene design amplification primers, containing Rdg2b -F and Rdg2b -R, Rdg2b -F and Rdg2b -R sequence information such as Figure 1 As shown; (2) Extract total RNA from Ganbei No. 2 barley, reverse transcribe it into cDNA, and amplify it using the above-mentioned amplification primers with cDNA as a template to obtain Rdg2b Target fragment; (3) Select the restriction enzyme sites according to the pRI101-EGFP expression vector vector map. Sal I Enzyme digestion is performed at the restriction sites, and the digestion product is the same as that obtained in step (2). Rdg2b Target fragment connection transformation to obtain Rdg2b The gene subcellular localization vector pRI101-Rdg2b-EGFP; (4) respectively used Sma I and Spe I pair Rdg2b The target fragment and pWMB100 vector were digested with enzymes, ligated, and transformed to obtain... Rdg2b Gene overexpression vector pWMB100-Rdg2b.

[0010] 5. A gene for resistance to barley stripe disease Rdg2b Genetic transformation of barley embryos, to which the Rdg2b Gene overexpression vectors were used to transform barley embryos via Agrobacterium-mediated transformation to prepare transgenic positive lines. Transgenic plants were obtained, and positive plants were screened by PCR to obtain T2 generation overexpression lines.

[0011] 6. A gene for resistance to barley stripe diseaseRdg2b The transgenic positive barley plants exhibited significantly higher resistance to barley stripe disease than wild-type plants at the same time, specifically as follows: the transgenic positive lines showed milder disease symptoms on infected leaves, and the accumulation of hydrogen peroxide and the area of ​​dead cells were significantly reduced compared to wild-type plants at the same time.

[0012] 7. Overexpression Rdg2b The application of genes in enhancing resistance to barley stripe disease, the aforementioned Rdg2b The complete full-length coding sequence of the gene's CDS is shown in SEQ ID No. 1.

[0013] 8. Overexpression Rdg2b The application of genes in enhancing resistance to barley stripe disease, the aforementioned Rdg2b Genes play a key regulatory role in barley's resistance to barley stripe disease by inhibiting pathogen infection, maintaining barley plant height, maintaining photosynthetic function, and coordinating the growth-defense balance.

[0014] This invention provides a barley stripe disease resistance gene. Rdg2b Its application has the following beneficial effects: 1. This invention clones a disease-resistant gene from Ganbei No. 2 barley. Rdg2b The complete full-length coding segment of the CDS was used to improve barley's ability to defend against barley stripe disease, utilizing transgenic technology driven by the 35S strong promoter. Rdg2b The significant increase in gene expression levels resulted in a marked enhancement of the resistance of barley genetically transformed plants to barley stripe disease, yielding highly resistant barley plants and providing new gene resources for barley stripe disease resistance breeding.

[0015] 2. This invention provides a barley stripe disease resistance gene. Rdg2b Functional verification and application, utilizing strong promoter-driven transgenic technology to... Rdg2b Genetic transformation of barley plants Vlamingh using an overexpression vector of the gene revealed... Rdg2b Transgenic barley with significantly increased gene expression levels showed markedly enhanced resistance to barley stripe disease, and ROS accumulation was significantly increased after infection with the disease, demonstrating... Rdg2b Genes play an important role in resistance to stripe disease.

[0016] 3. This invention is based on Rdg2b Genetic engineering technology can directionally regulate the expression level of a gene, achieving efficient gene expression through overexpression vectors driven by strong promoters. This directly targets disease resistance traits without relying on complex genetic recombination and screening, shortening the breeding cycle. At the same time, it avoids the chain transmission of non-target traits in traditional hybridization, enabling precise introduction of disease resistance traits and improving the breeding efficiency and genetic stability of barley varieties resistant to barley stripe disease. Attached Figure Description

[0017] Figure 1 for Rdg2b A sequence diagram of a gene, where the underlined parts are the start and stop codons.

[0018] Figure 2 for Rdg2b A diagram of gene cloning and amplification.

[0019] Figure 3 for Rdg2b Gene bioinformatics analysis diagram. A: Rdg2b protein hydrophilicity / hydrophobicity prediction diagram; B: Rdg2b Predicted sequence signal peptide; C: Predicted transmembrane domain of Rdg2b protein; D: Predicted phosphorylation site of Rdg2b protein; E: Predicted secondary structure of Rdg2b protein; F: Predicted tertiary structure of Rdg2b protein.

[0020] Figure 4 Phylogenetic tree diagram of Rdg2b protein and its homologous proteins from other species.

[0021] Figure 5 Barley stripe blight infection at different stages of barley growth Rdg2b Gene expression pattern diagram.

[0022] Figure 6 Figure 1 shows the vector construction diagram. In Figure 2, A is a schematic diagram of the subcellular localization vector, B is a schematic diagram of the amplification of the pRI101-Rdg2b-EGFP target gene, C is a schematic diagram of the overexpression vector, and D is a schematic diagram of the amplification of the pWMB100-Rdg2b target gene. In Figure 2, M: DL15000+2000 Marker; 1-6: bacterial culture PCR amplification products; in Figure 2, M: DL15000+2000 Marker; 1-5: bacterial culture PCR amplification products.

[0023] Figure 7 for Rdg2b Subcellular localization map. Figure A is... Rdg2b Subcellular localization on Arabidopsis protoplasts; Figure B shows... Rdg2b Subcellular localization on tobacco leaf epidermal cells.

[0024] Figure 8 This diagram illustrates the genetic transformation of Vlamingh barley immature embryos mediated by Agrobacterium. A shows the immature embryo infection; B shows the selection medium culture; C shows the differentiation culture; D shows the rooting culture; and EG shows the transplanting of some seedlings.

[0025] Figure 9Figures show positive identification results for transgenic barley lines. Figure A shows the detection result from the PAT / Bar immunogold rapid test strip; WT: Vlamingh; Figures B and D show... Transgenic lines Rdg2b PCR detection diagram of gene fragments; B1-14, D1-11, D3-12: barley Transgenic plants; P: pWMB100 plasmid; WT: Vlamingh; H: C is In some transgenic barley lines Bar PCR detection image; M: DL2000 Marker; E: OE overexpression transformed line. -Rdg2b -1、OE -Rdg2b -2、OE -Rdg2b -3、OE -Rdg2b -4、OE -Rdg2b -5 and OE -Rdg2b -6 Rdg2b Relative gene expression levels.

[0026] Figure 10 Overexpression of barley stripe bacterium infection Rdg2b Statistical charts of disease incidence in barley strains. A shows the leaf phenotypes of each transgenic barley strain infected with *Barley stripe causal agent* and the DAB and trypan blue staining results; B shows the *Barley stripe causal agent* infection at different time points in each overexpression strain of barley. Rdg2b Relative gene expression level; C represents the relative fungal biomass of mycelium in barley overexpression strains infected with barley stripe worm at different time points; D represents the relative chlorophyll content (SPAD) in barley overexpression strains infected with barley stripe worm at different time points.

[0027] Figure 11 for Rdg2b Resistance identification and statistical analysis of barley plants overexpressed with *Barley stripe causal agent*. A shows the phenotype of each overexpression-transformed barley plant in pots 20 days after *Barley stripe causal agent* infection; B shows the incidence rate of *Barley stripe causal agent* infection in each overexpression-transformed barley plant; C shows the leaf phenotype and staining diagram of each overexpression-transformed barley plant after *Barley stripe causal agent* infection; D shows the plant phenotype of each overexpression-transformed barley plant after *Barley stripe causal agent* infection; E shows the disease index of each overexpression-transformed barley plant after *Barley stripe causal agent* infection; and F shows the plant height of each overexpression-transformed barley plant after *Barley stripe causal agent* infection. Specific implementation methods

[0028] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments of this invention are described in detail below. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0029] Example 1 This embodiment provides a gene for resistance to barley stripe disease. Rdg2b The characteristic is that the Rdg2b The complete full-length coding sequence of the gene's CDS is shown in SEQ ID No. 1. Rdg2b The gene encodes a protein whose amino acid sequence is shown in SEQ ID No. 2.

[0030] Example 2 This embodiment provides a gene for resistance to barley stripe disease. Rdg2b Bioinformatics feature analysis methods include: 1. Obtaining the target gene fragment: according to Rdg2b Gene design amplification primers, containing qRT- Rdg2b -F and qRT- Rdg2b -R( Figure 1 RNA was extracted from leaf tissues of Ganbei No. 2 barley using a total RNA extraction kit. PCR amplification was performed using the reverse-transcribed cDNA as a template to obtain the amplification product. The specific PCR reaction system was: 25 μL 2×PhantaMax Buffer, 1 μL dNTP Mix, and 1 μL cDNA. Rdg2b -F and Rdg2b -R 1 μL each, 1 μL Phanta Max Super-FidelityDNA Polymerase (1U / μL), RNase Free Add to a final volume of 50 μL. The PCR amplification program was as follows: 95℃ for 30 s, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 2 min, 72℃ for 5 min, and stored at 4℃. This was for cDNA cloned from Ganbei No. 2 barley. Rdg2b The gene CDS fragment was detected by gel electrophoresis, and the result was consistent with the expected size. The amplified gel fragment, matching the target fragment size, was then excised and purified. This purified fragment was used for subsequent ligation into the enzyme digestion vector.

[0031]

[0032] 2. Barley stripe disease resistance gene Rdg2b Bioinformatics analysis of the protein cloned from Ganbei No. 2 barley. Rdg2b The CDS fragment of the gene was sequenced, and the sequencing results showed... Rdg2b The gene sequence is shown in SEQ ID NO: 1. The ORF Finder in the NCBI online tool was used to find... Rdg2b Open reading frames (ORFs) of the gene; amino acid sequence analysis using Expasy; physicochemical properties analysis of Rdg2b protein using ProtParam; prediction of Rdg2b protein signal peptide sequence using Signal P 5.0; prediction of protein phosphorylation sites using NetPhos-3.1; prediction of Rdg2b protein transmembrane regions using TMHMM; secondary structure analysis of Rdg2b protein using NPSA_SOPMA online method; subcellular localization prediction using DeepLoc 2.0; 3D modeling of Rdg2b protein using online protein modeling provided by the SWISS-MODEL website; prediction of Rdg2b protein functional domains using CD-search in the NCBI online tool; and the annotated Rdg2b and other RGAs homologous protein sequences from NCBI, including those from barley. Hordeum vulgare ADK47522.1 (NBS2-RDG2A), cultivated wheat Triticum aestivum XP_044366626.1 (RGA1), tufted wheat Dasypyrum villosum UBY07411.1 (NBS-LRR), Wild Erin Triticum dicoccoides XP_037419407.1 (RGA3), Jointed Wheat Aegilops tauschii XP_020149272.1 (RGA3), Two-spike short-stalked grass Brachypodium distachyon XP_003572474.3 (RGA4), Cultivated Rice Oryza sativa ALO70046.1 (NBS-LRR-like), wild rice Oryza brachyantha XP_006660348.2 (RGA4), Willow Branch Millet Panicum virgatum XP_039854912.1 (RGA2-like), Reed Phragmites australis XP_062191967.1 (RGA2-like), Ryegrass Lolium perenneThe sequences XP_051199546.1 (RGA2-like) and Sorghum bicolor XP_021321102.1 (RGA3) were aligned using Clustal W. A phylogenetic tree was constructed using the neighbor-joining method in MEGA 7.0 software with the Bootstrap replicates value set to 1000. Conserved domains were further identified by batch scanning of homologous protein sequences using NCBI CDD.

[0033] The results showed that the target fragment was successfully cloned, with a length of approximately 3453 bp. Figure 2 The Rdg2b protein has a complete open reading frame (ORF) and encodes 1150 amino acids. Online analysis using ProtParam showed that the Rdg2b protein has a relatively large molecular weight of 130.69 kDa, and its theoretical molecular formula is... The theoretical isoelectric point is 6.54; Rdg2b The gene encodes 1150 amino acids, composed of 20 different amino acids. It has a negative charge coefficient (Asp + Glu) of 149, a positive charge coefficient (Arg + Lys) of 144, a net charge of -5, and is prone to aggregation. The protein has an aliphatic index of 99.63 and an instability index of 46.45. With a threshold of 40, it is an unstable protein with a short half-life in vivo, suggesting that the Rdg2b protein may rapidly turn over via the ubiquitin-proteasome pathway. In terms of amino acid composition, leucine (Leu) is the most abundant amino acid in the protein sequence (14.4%), with its strongly hydrophobic side chain promoting α-helix formation. Glutamic acid (Glu) is the second most abundant (8.1%), followed by serine (Ser) at 8.0%. Tyrosine (Tyr), histidine (His), and tryptophan (Trp) are the least abundant, accounting for 2.0%, 1.8%, and 1.7% respectively. It also lacks pyrrolidone (Pyl) and selenocysteine ​​(Sec). The Rdg2b protein sequence features alternating hydrophilic and hydrophobic amino acids, with an average hydrophilicity of -0.163, indicating high solubility and classifying it as a hydrophilic-soluble protein. Figure 3 A); DeepLoc-2.0 subcellular localization prediction revealed that Rdg2b is mainly located in the cell membrane; Signal 5.0 analysis indicated that the probability of Rdg2b protein containing a signal peptide is very small, at 0.0029, predicting that the protein has no signal peptide. Figure 3 B); TMHMM 2.0 online protein sequence transmembrane region analysis showed that the Rdg2b protein had no obvious transmembrane helix, predicting that the protein is a non-transmembrane peripheral membrane protein. Figure 3C); Netphos-3.1 phosphorylation site prediction results showed that the Rdg2b protein has a total of 101 phosphorylation sites, namely 72 serine phosphorylation sites, 19 threonine phosphorylation sites, and 10 tyrosine phosphorylation sites. Figure 3 D); SOPMA secondary structure prediction analysis of the Rdg2b protein showed that... Rdg2b The secondary structure of the encoded protein mainly includes α-helices (641 aa) and random coils (429 aa), with extended coils (80 aa) accounting for a relatively small proportion (6.96%). There are no β-turn structures. The high-helix structure (55.74%) suggests that the protein has good local stability. The random coils (37.30%) suggest that the Rdg2b protein may contain inherent disordered regions, which could serve as enrichment regions for modifications such as phosphorylation and ubiquitination. Figure 3 E); SWISS-MODEL's homology modeling of this protein in the new software revealed that the template was NBS2-RDG2A (ID: E2FER6.1.A), with a sequence similarity of 86.77% and a GMQE score of 0.79. [[ID= F). An analysis of the evolutionary origin and phylogenetic relationships of the Rdg2b protein sequence revealed that, among the 12 selected grass species, barley Rdg2b and NBS-Rdg2a are evolutionarily related to common wheat. ​ XP_044366626.1 (RGA1) is most closely related. It is less closely related to *Sorghum bipinnatifida* XP_039854912.1 (RGA2-like), *Phragmites australis* XP_062191967.1 (RGA2-like), and *Sorghum sorghum* XP_021321102.1 (RGA3). ​ Meanwhile, the identification results of conserved domains in homologous protein sequences also clearly show that the Rx_N conserved domain and NB-ARC of RGAs proteins in various species are basically the core conserved modules of this type of disease-resistant protein, which are highly conserved in evolution and have relatively small changes; while the LRR domain, PLN03210 superfamily domain and LRR superfamily domain show more obvious differences in proteins of different species.

[0034] Example 3 This embodiment provides a barley stripe disease resistance gene. ​ Methods for analyzing the expression characteristics include: Total RNA was extracted from barley embryos infected with *QWC* on days 7, 14, and 18 of *Ganpi 2*, *Vlamingh*, and *Alexis* varieties. The RNA was then analyzed using the Primer-Blast module from the NCBI website. ​ Specific primer qRT- ​ -F and qRT-​ -R, with barley ​ This is an internal reference gene. RNA was extracted and reverse transcribed to synthesize cDNA. The Super RealPre Mix Plus real-time quantitative PCR method was used to analyze the cDNA in samples treated with different methods. ​ The relative expression levels of genes were detected to analyze the relative expression levels of different barley varieties at different time points after infection with barley stripe rot. The qRT-PCR reaction system included 10 μL 2X SuperReal PreMix Plus (SYBR Green), 0.4 μL 50X ROX ReferenceDye, 0.6 μL each of primers, 1 μL cDNA, and 7.4 μL RNase-Free. Using the gene expression level of barley immature embryos infected with the weakly pathogenic strain Spg14 of *Strombus streakus* as a control, three biological replicates were set up for each sample. The experimental results were obtained through... The relative expression levels in different samples were calculated using the method, and the differences were analyzed for significance using SPSS 20.0.

[0035] Its expression pattern under *Strombus streak* infection was analyzed using qRT-PCR system. ​ ). ​ It exhibited rapid, strong, and sustained inducible expression characteristics in the disease-resistant variety Ganpi 2 (GP2). Following infection by the highly pathogenic strain QWC, ​ Gene expression was significantly induced to 6.2 times that of the control on day 7, and reached its peak on day 14, rising sharply to 15.6 times that of the control. Although it declined somewhat by day 18, it still remained at a high level of 8.7 times. ​ In the disease-resistant variety Ganpi 2 (GP2), it exhibited rapid, strong, and sustained inducible expression characteristics, indicating that day 14 after pathogen infection was the most effective time for induction. ​ The critical period for peak gene expression response. In susceptible varieties (Vlamingh) and highly susceptible varieties (Alexis). ​ The gene expression was severely defective. In Vlamingh, the expression pattern showed weak induction on day 14, with an expression level less than 14% of that in Ganpi No. 2 on day 14. Expression levels were also low on days 7 and 18. It is speculated that day 14 after barley is infected with Barley stripe rot is a critical stage for the interaction between the fungus and the host barley. ​ Gene expression patterns are positively correlated with barley disease resistance.

[0036] Example 4 This embodiment provides a barley stripe disease resistance gene. ​ The carrier construction methods include: 1. Using cDNA from Ganbei No. 2 barley as a template, PCR amplification was performed. ​ Genetic analysis and gel electrophoresis revealed a 3453 bp fragment. Sequencing was performed after transformation with *E. coli* and restriction endonucleases. ​ I digested the pRI101-EGFP vector plasmid with enzyme I, and then combined the digestion product with... ​ The fragments were ligated and transformed into E. coli to complete the construction. ​ The subcellular localization vector pRI101-Rdg2b-EGFP ( ​ A).

[0037] 2. Using cDNA from Ganbei No. 2 barley as a template, according to ​ The gene CDS sequence and the restriction enzyme site information of the pWMB100 overexpression vector were respectively used... ​ I and ​ I pair ​ The target fragment and the pWMB100 vector were digested with enzymes. The digested products were ligated into the pWMB100 vector and transformed into *E. coli*. Transformants were picked for PCR amplification and product detection, followed by ligation and transformation to obtain... ​ Gene overexpression vector pWMB100-Rdg2b ( ​ C).

[0038] The results showed that using cDNA from Ganbei No. 2 barley as a template, the target gene was amplified using subcellular localization and overexpression primers, respectively, and the amplification products were recovered using the Tiangen universal DNA agarose gel extraction kit. The target gene, subcellular localization vector pRI101-EGFP, and overexpression vector pWMB100 were digested at 37℃. Then, the target gene was ligated into the corresponding vectors after incubation overnight at 16℃, ultimately completing the subcellular localization vector pRI101-Rdg2b-EGFP (…). ​ Construction of B) and pWMB100-Rdg2b overexpression vector ( ​ D).

[0039] Example 5 This embodiment provides a barley stripe disease resistance gene. ​ Subcellular localization methods include: 1. Harvest healthy Arabidopsis leaves at the 5-6 leaf stage, wash with sterile water, and cut into thin strips. Soak the leaf tissue in 5-10 mL of enzymatic hydrolysis solution. After enzymatic digestion, centrifuge the filtrate. Wash with W5 solution and centrifuge again. Resuspend the protoplasts in 500 μL MMG solution for microscopic examination. Take 200 μL of protoplast suspension + 10 μL of pRI101-Rdg2b-EGFP plasmid, and PEG4000 solution equal to the sum of the volumes of DNA and protoplasts. Observe and photograph the Arabidopsis protoplasts after incubation in W5 solution using a laser confocal microscope. 2. Using an empty vector expressing the GFP gene as a control, perform the same steps as described above. Using a disposable syringe (without the needle), aspirate pRI101-Rdg2b... - EGFP Agrobacterium bacterial suspension and pRI101-EGFP empty vector infection solution were slowly injected into the lower epidermal tissue of tobacco leaves. After injection, the leaves were sprayed with water to maintain moisture, sealed in bags, and incubated in the dark overnight. After 24 hours, they were transferred to normal light conditions and incubated for 36-48 hours. The labeled leaves were then prepared into temporary slides. Finally, the GFP expression signal was observed using a laser confocal fluorescence microscope with the excitation wavelength set to 488 nm. An empty vector expressing the GFP gene was used as a positive control, and the same procedure was followed.

[0040] The results showed that after extracting plasmids from suitable bacterial cultures and transforming them into Agrobacterium competent cells GV3101, Arabidopsis protoplasts were transformed. Green fluorescence signals were observed under a laser confocal microscope. In Arabidopsis protoplasts, the fluorescence signal of the control vector pRI101-EGFP was distributed throughout the entire cell, while the green fluorescence signal of the recombinant vector was stronger on the cell membrane, indicating that Rdg2b is mainly localized on the Arabidopsis cell membrane. ​ A). Further, the Agrobacterium-mediated recombinant vector was injected into the lower epidermis of *N. benthamiana* leaves using the Agrobacterium infection method. After 24 h of dark culture and 24 h of light culture, fluorescence signals were observed using a laser confocal microscope. The fluorescence signal of the control vector pRI101-EGFP was distributed in the nucleus, cytoplasm, and cell membrane of tobacco cells, while the fluorescence signal of the recombinant vector containing pRI101-Rdg2b-EGFP was mainly distributed on the cell membrane. ​ B).

[0041] Example 6 This embodiment provides a barley stripe disease resistance gene. ​ Genetic transformation methods for barley embryos include: 1. Transform Agrobacterium tumefaciens using the pWMB100-Rdg2b vector. The specific steps are as follows: (1) Agrobacterium C58C1 strain was added to 4 mL of LB liquid medium containing Rif and Gen and cultured at 180 rpm and 28°C for 36-40 h. Escherichia coli containing the target vector pWMB100-Rdg2b was cultured in 4 mL of LB liquid medium containing Kana at 225 rpm and 37°C for 12-16 h. (2) Take 100 μL of pWMB100-Rdg2b Escherichia coli and add it to a 1.5 ml centrifuge tube. Mix well. Take 100 μL each of Agrobacterium C58C1 and helper bacteria PRK2013 and add them to a 1.5 ml centrifuge tube as controls. Centrifuge at 4000 rpm for 3 min to collect the bacterial cells. (3) Completely remove the supernatant, add 50 μL of LB medium, and resuspend the bacterial cells; take the resuspended bacterial cells and drop them onto the surface of an antibiotic-free LBA medium plate. Do not shake the plate, so that the bacterial cells clump together. After the plate dries, seal it and incubate at 28°C for 16-24 h. (4) Take a small amount of bacterial cells from the bacterial cluster with the inoculation needle and streak them on LB solid medium containing Rif, Gen and Kana. Streak one target strain and one control strain on each plate and incubate in the dark at 28°C for 36-48 h.

[0042] (5) Positive clones were amplified by PCR and then detected by 1% agarose gel electrophoresis. Single clones containing positive bands were selected for sequencing.

[0043] 2. Agrobacterium-mediated genetic transformation of barley immature embryos and acquisition of transgenic lines (1) Agrobacterium activation ① Four days before infection, take 10 μL or 50 μL of Agrobacterium tumefaciens C58C1 bacterial culture containing the pWMB100-Rdg2b overexpression vector stored at -80℃ and spread it evenly on YEP solid medium containing 50 mg / L Kana and 25 mg / L Rif. Incubate in the dark at 28℃ for 2 days. ② Pick a single colony and place it in 10 mL of YEP liquid medium containing the corresponding antibiotic, and incubate overnight in a shaker at 200 rpm and 28°C in the dark until turbidity is reached; ③ Collect Agrobacterium cells by centrifugation at 3500 rpm for 10 min at room temperature, discard the supernatant, and resuspend in MS resuspension buffer at pH 6.0; (2) Sampling and infection of immature embryos ① Vlamingh barley was planted in batches as recipient material, and immature barley grains were collected about 14 days after flowering and pollination. ② Sterilize by shaking with 70% ethanol and 15% sodium hypochlorite for 1 min and 15 min respectively, and finally wash with sterile water 4-5 times. ③ Under a microscope, use a scalpel to peel off the barley seed coat, carefully peel off the whole barley embryo with sharp tweezers, mix it with Agrobacterium resuspension and infect for 10 min, then lay it neatly on AS basic co-culture medium with the scutellum facing up, seal with sealing film, and co-culture at 25℃ in the dark for 2 days. (3) Induction and differentiation culture of resistant callus ① After co-culturing for 2 days, the immature embryos were transferred to the first screening medium WLS-P5 (PPT 5 mg / L, Cb 400 mg / L, Cef 100 mg / L) and cultured in the dark at 23℃-25℃ for 14 days to induce callus tissue. ② Observe the callus growth for about two weeks, then transfer the callus tissue to the second selection medium WLS-P10 (PPT 10 mg / L, Cb 400 mg / L) and culture in the dark at 25°C for about 21 days.

[0044] ③ After three weeks of co-culture, the callus tissue was transferred to differentiation medium WLSZ-P5 (MS medium, PPT 5 mg / L) and cultured at 25°C under light for 2 weeks.

[0045] (4) Rooting culture ① Transplant barley sprouts with shoot lengths of 0.5 cm to 2 cm into MSF-P5 rooting medium (MS medium, PPT 5 mg L-1, IBA 0.5 mg L-1) and culture them at 25℃ for 14-21 days under 16 h light and 8 h dark conditions.

[0046] ② Once the seedlings have developed well, remove the sealing film from the seedlings (about 10 cm tall) that have 3 or 4 true leaves and well-developed root systems and allow them to harden off in the natural environment for 3 days.

[0047] ③ After 3 days, carefully remove the seedlings with tweezers, remove any residual culture medium from the roots, transplant the seedlings into flowerpots filled with nutrient soil, and place them in an artificial climate chamber at 25℃ with 16 hours of light and 8 hours of darkness until maturity, watering at regular intervals. During this period, pick 2 to 3 young barley leaves, mark them, and temporarily store them in a -80℃ freezer for DNA extraction and positive detection.

[0048] The results showed that the constructed pWMB100-Rdg2b recombinant vector was introduced into Agrobacterium tumefaciens strain C58C1 and then into Vlamingh barley immature embryo callus via Agrobacterium-mediated overexpression genetic transformation. After co-culture ( ​ A) Screening and cultivation ( ​ B) Callus induction and differentiation culture ( ​ C) Rooting culture ( ​ D) Transplanting after hardening off (​ In stages E and F, the pWMB100-Rdg2b overexpression vector was introduced. Genetically modified barley plants.

[0049] Example 7 This embodiment provides a ​ Methods for identifying barley plants with overexpressing genes include: 1. ​ Molecular detection of DNA levels in overexpression lines Using barley genomic DNA as a template, PCR amplification was performed using specific primers for transformation seedlings. The amplification products were analyzed by 1% agarose gel electrophoresis to determine whether the target gene had been successfully transferred. The results verified by genomic PCR were then analyzed. The positive-positive strains were planted in pots with a nutrient soil:vermiculite (1:1) and harvested. Substitute seeds. Identification. ​ The primer sequences for gene amplification are as follows: ​ -F: ACCATCGTCAACCACTACATCG, ​ -R: GCTGCCAGAAACCCACGTCATG, amplified fragment length is 462bp. Suitable for identification. Positive strains were harvested individually and planted in the experimental field in April 2025, with one strain per row. During the seedling stage, 1-2 barley leaves were collected from each plant, flash-frozen in liquid nitrogen for DNA extraction, utilizing the promoter- ​ Further identification using gene PCR detection methods and Positive transgenic plants, harvested Seeds of positive strains. Detection primers: UBI1899-F: TTAGCCCTGCCTTCATACGCT. ​ -965-R: CTTGCTTGCTTCGACAT; The PCR reaction system consisted of: 1 μL DNA template, 1 μL each of F and R primers, 10 μL of 2×Rapid Taq Master Mix, and sterile ddH2O to a final volume of 20 μL. After centrifugation, RCR amplification was performed using the following program: 94℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles from denaturation to extension, followed by a 10-min extension at 72℃, and finally storage at 16℃. 5 μL of the PCR product was analyzed by 1% agarose gel electrophoresis and sent to a biotechnology company for sequencing.

[0050] 2. PAT / Bar Immunogold Rapid Test Strip Detection The PAT / Bar immunogold rapid test strip is mainly used for rapid and qualitative detection of the presence of specific herbicide-resistant transgenic PAT / Bar proteins in plant samples. Therefore, before performing PCR testing, the PAT / Bar immunogold rapid test strip is used to detect PAT / Bar protein expression. First, a 1 cm leaf is taken from the transgenic plant and placed into a 1.5 mL centrifuge tube. The leaf is then crushed completely using a grinding rod. 0.4 mL of phosphate buffer is added, and the end of the test strip marked with the indicator arrow is immersed in the buffer. The strip is allowed to stand for 2-5 minutes, and the results are then observed.

[0051] 3. Detection of transgenic strains ​ Gene expression level Real-time quantitative PCR (qRT-PCR) was performed using Tiangen SuperReal PreMix Plus (SYBR Green) to determine the levels of transgenic strains. ​ Gene expression levels. Reverse transcribed cDNA was used as the template for qRT-PCR. The reaction mixture consisted of 10 μL of 2×SuperReal PreMix Plus (SYBR Green), 0.4 μL of 50×ROX Reference Dye, 0.6 μL each of F and R primers, and 1 μL of cDNA. RT-qPCR was performed using a 7.4 μL, total 20 μL reaction system. Vlamingh barley infected with barley stripe scab was then subjected to the reaction. ​ Gene expression level was set to 1, and the following was used: Method for calculating the genetically modified strains ​ Relative gene expression level, used ​ coding region specific primers, ​ See internal reference gene primers ​ .

[0052] The results showed that the PAT / Bar immunogold rapid test strip was used to detect ( ​ A) ​ Gene-specific PCR screening and covering vector promoter and ​ PCR verification and sequencing confirmation of the gene coding regions ultimately yielded 12 genes that were stably integrated with exogenous genes at the DNA level. Positive strains ( ​ (B, C, D). Further quantitative PCR experiments confirmed the presence of the expression in the six overexpression lines. ​ Gene expression was significantly increased, with expression levels varying folds from 5.2 to 26.5 times that of the wild type. ​ E). Among them, strain OE- ​ -2 and OE- ​-4 ​ The upregulation was most significant, with relative expression levels increasing to 26.5-fold and 18.1-fold compared to the wild type, respectively; strain ​ -OE-1 and ​ The expression levels of -OE-6 were 9.3-fold and 7.1-fold higher than those of the wild type, respectively; the transformant strains ​ -OE-3 and ​ The expression levels of -OE-5 were 5.5-fold and 5.2-fold higher than those of the wild type, respectively. Based on the combined results of DNA and PAT / Bar test strip analysis, six genes were ultimately identified. ​ Overexpression of barley strain OE- ​ -1、OE- ​ -2、OE- ​ -3、OE- ​ -4、OE- ​ -5、OE- ​ -6.

[0053] Example 8 This embodiment provides a barley ​ Methods for verifying the disease resistance function of genes include: 1. In vitro inoculation of barley stripe pathogen exist At the 4-5 leaf stage of overexpressing barley lines and wild-type plants, mycelial discs (0.5 cm in diameter) containing culture medium were collected from the QWC strain of barley stripe causal agent, activated and cultured on PDA plates for 7 days. The mycelial discs were then tightly adhered, fungal-side down, to the second to third leaf from the base of each line. The discs were sealed in resealable bags and cultured at 25°C in an artificial climate chamber with alternating light and dark periods of 12 h each. RNA was extracted from 5 cm leaf segments infected with the pathogen at 3, 5, and 7 days post-infection. Real-time quantitative PCR was used to detect RNA levels in the transgenic lines after infection. ​ Gene expression levels, using Methods for calculating the relative proportions of Vlamingh barley strains at different time points of Vlamingh barley infection. ​ The relative expression level. During the sampling process, three leaf segments from three infected sites were selected for each strain to form a sample, and three replicates were set up for each strain.

[0054] 2. Fungal biomass determination Total DNA was extracted from 5 cm leaf segments at three different infection time points (3, 5, and 7 days) from the inoculated *Barley stripe causal agent* QWC. Real-time quantitative PCR was used to perform quantitative PCR analysis at the DNA level to determine the biomass of *Barley stripe causal agent*. The *Barley stripe causal agent* ITS sequence was amplified using ITS1 and ITS4, based on the pathogen's ribosomal RNA. Simultaneously, barley housekeeping genes were used... ​As an internal control, the content of barley material in the samples was standardized. ITS of barley stripe pathogen and barley were obtained separately by qPCR. HvActin The Ct value is calculated using the formula: relative biomass. The DNA abundance of *Barley Stripe Pathogen* in each sample was calculated. To compare the differences in disease resistance between different transgenic lines and the wild-type control, wild-type control samples at the same time point were used as a benchmark. The method involved calculating the change in the biomass of *Strombus spp.* relative to the control for each transgenic line. Three leaf segments from three infected sites were selected as a sample for each line, and three replicates were set up for each line.

[0055] 3. Trypan blue staining On day 10 after leaves were infected with QWC (Quercus acutissima var. chinensis), leaf segments from different transgenic lines were harvested. The leaves were stained using trypan blue and DAB staining methods to observe the infection status of each transgenic line. The trypan blue staining procedure was as follows: Staining was performed using trypan blue solution (0.5 mg / mL, 1.0 mL glycerol, 1.0 mL lactic acid, 1.0 mL Tris-balanced phenol, and 1.0 mL deionized water). Decolorization was carried out in a shaker at 90 r / min with 2.5 g / mL chloral hydrate for 48-96 h. Once the blue dye had completely faded and the leaves were nearly transparent, the leaves were removed, and the staining results were photographed. Three leaves were taken from each treatment, and three leaf segments approximately 5 cm long from the infected area were cut from each leaf. All experiments were repeated three times, with Vlamingh barley, which was also treated with QWC infection, used as a control.

[0056] 4. DAB staining The DAB staining method for barley leaves was as follows: DAB concentration was 1 mg / mL (pH 3.8), and the destaining solution was 95% ethanol. Infected barley leaves were placed in centrifuge tubes, the dye solution was added to submerge the leaves, and the tubes were incubated at room temperature in the dark for 5-6 hours. The dye solution was then removed, and 95% ethanol solution was added. The tubes were then incubated at 100℃ for 2-3 minutes until the healthy parts of the leaves turned white. The solution in the tubes was removed, and 95% ethanol solution was added again. The tubes were then stained overnight in a rotating shaker, with the destaining buffer changed once according to the degree of destaining. After the leaves were completely destaining, they were removed, and the staining results were photographed and recorded. Three leaves were taken from each treatment, and three leaf segments of approximately 5 cm from the diseased area were cut from each leaf for three replicates. Vlamingh barley treated with QWC bacteria was used as a control.

[0057] 5. Determination of relative chlorophyll content To determine the relative chlorophyll content of diseased leaves of transgenic barley lines infected with the scab fungus QWC, the relative chlorophyll content of the same part of the leaves of different transgenic barley lines was measured using a chlorophyll meter 10 days after QWC infection. Leaves of wild-type Vlamingh barley infected with QWC were used as a control. Three leaves were measured each time.

[0058] The results showed that, compared with wild-type Vlamingh barley plants, different Rdg2b Gene expression levels and varying degrees of resistance to stripe disease on leaves were observed in transgenic lines with overexpression of genes. Figure 10 Specifically, it manifests as follows: 1. Real-time quantitative PCR was used to detect the presence of *Strombus streakus* in different transgenic lines at different time points (days 3, 7, and 10) after infection. Rdg2b Gene expression dynamics. Results showed that *Strombus streakus* infection significantly induced gene expression in all transgenic lines. Rdg2b Upregulation of gene expression ( Figure 10 B). Compared to the wild type, on day 3 after inoculation, the six transgenic lines showed [significant differences]. Rdg2b The relative expression levels of all three cells were elevated to varying degrees, with OE- Rdg2b The expression level of OE-2 was most significantly upregulated, with a relative expression level 12.1 times that of wild type. Additionally, OE- Rdg2b -1、OE- Rdg2b -3、OE- Rdg2b -4、OE- Rdg2b -5 and OE- Rdg2b -6 Rdg2b The relative gene expression levels were 9.5, 7.1, 10.2, 6.4, and 4.7 times that of the wild type, respectively. By day 7 of inoculation, the expression levels of each line slightly decreased, and the expression levels of each transgenic line... Rdg2b The relative expression levels of the gene were 5.2, 8.1, 2.4, 4.1, 2.9, and 1.9 times that of the wild type, respectively. On day 10 after inoculation, the relative expression levels of each transgenic line continued to decrease, but were still significantly higher than those of the wild type, at 2.5, 3.7, 2.1, 2.3, 2.5, and 1.6 times that of the wild type, respectively.

[0059] 2. Six transgenic barley lines and wild-type barley were inoculated using an in vitro leaf inoculation method. Ten days after inoculation, it was clearly observed that the infected parts of the leaves of wild-type barley showed severe disease, while the six overexpressing lines showed significantly less disease. Rdg2b The disease symptoms on the leaves of the strain were significantly milder than those of the wild type. Figure 10A). Further analysis was conducted using trypan blue staining to assess cell death and DAB staining to observe reactive oxygen species (ROS) accumulation. Results showed that compared to wild-type infected leaves, the transgenic lines exhibited a deeper and more extensive blue area, while the diseased areas on the leaves of each transgenic line showed lighter and more localized staining. This suggests that the transgenic lines were overexpressing different strains of the rhizopathia after infection. Rdg2b The transgenic cells showed significantly less cell death than the wild-type control group; DAB staining results indicated that ROS accumulation at the diseased sites in the leaves of the transgenic lines was relatively low and scattered, while ROS accumulation in the leaves of the wild-type lines was more concentrated and significantly stronger. Figure 10 A).

[0060] 3. Relative fungal biomass analysis showed that, at different infection time points, the biomass of *Strombus stripe* in each transgenic line was significantly lower than that of the wild type. P <0.05)( Figure 10 C), specifically, in the early stage of *Strombus stripe* infection (day 3), the biomass of the pathogen in each transgenic line decreased significantly compared to the wild type by 71.01%, 77.34%, 55.96%, 76.24%, 67.06%, and 53.05%, respectively. P <0.05); By day 7 of infection, the relative pathogen biomass of each transgenic line had increased slightly but remained at a low level, namely 55.08%, 37.17%, 76.73%, 44.91%, 40.52%, and 52.52% for the wild type. P <0.05); as the infection process of the stripe worm continued until the 10th day, the relative fungal biomass of each strain increased, to 68.03%, 60.86%, 80.70%, 53.82%, 79.78%, and 70.17%, respectively. P <0.05%, but still lower than wild-type. The overall trend indicates that overexpression increases with prolonged in vitro inoculation time. Rdg2b The relative biomass of *Strombus streakus* in the gene-producing strains gradually increased, reaching its peak on day 10, but its value remained lower than that of the wild-type control. This indicates... Rdg2b Overexpression of the drug significantly inhibited the infection, colonization, and cell expansion of *Strombus streakus* in plant tissues, and this inhibitory effect was particularly pronounced in the early stages of infection.

[0061] 4. After inoculation with the stripe pathogen, the chlorophyll content of all strains showed a gradual decreasing trend over time, but the transgenic strains as a whole showed a stronger ability to maintain chlorophyll content than the wild type. Figure 10 D). On the 3rd day, during the early stage of infection, except for OE- Rdg2b -5 and OE- Rdg2b Except for line -6, the SPAD values ​​of the other four transgenic lines were all higher than that of the wild type (29.97), with OE- Rdg2b -4 is 34.20 and OE- Rdg2bThe SPAD value of -2 was particularly significant at 33.17, indicating that most overexpressing lines showed a certain physiological homeostatic advantage in the early stages of pathogen infection. As the infection progressed to day 7, the SPAD value of the wild-type line decreased significantly to 24.80, while that of the transgenic lines, except for OE- Rdg2b Except for OE (23.40), which was slightly lower than WT, all other strains were higher than WT, with OE- Rdg2b -3 (31.07) and OE- Rdg2b -2 (29.27) maintained a relatively high chlorophyll level, indicating that the photosynthetic system of the transgenic lines was relatively less damaged in the mid-infection stage. By day 10 of infection, the SPAD value of the wild-type line further decreased to 16.07, and the leaves showed obvious chlorosis; in contrast, although the SPAD values ​​of all transgenic lines also showed a decreasing trend, they were still significantly higher than WT, with OE- Rdg2b -2 (25.67), OE- Rdg2b -4 (24.87) and OE- Rdg2b The maintenance effect of -1 (23.73) was the most prominent, being 1.60 times, 1.55 times, and 1.48 times that of WT, respectively.

[0062] Example 8 This example provides an overexpression Rdg2b Applications of genes include: 1. Statistics on disease resistance of transgenic lines After inoculating highly pathogenic strain QWC of barley stripe causal agent onto PDA medium and allowing it to grow for 7 days, an artificial inoculation and infection experiment was conducted using the "sandwich method" on wild-type Vlamingh barley seeds that had been pre-sterilized with 70% ethanol and 5% sodium hypochlorite, as well as seeds from six transgenic barley lines. The incidence rate of different transgenic barley lines was statistically analyzed. Each PDA plate contained 30 seeds of transgenic barley lines for the infection experiment, with the same number of seeds placed on a blank PDA medium as an untreated control. Three biological replicates were set up for each experiment. After inoculating the seeds in a 6℃ dark incubator for 20 days, each treatment seed was planted in a separate pot and grown in an artificial climate chamber with alternating light and dark periods of 12 h each. At day 21, the disease was assessed based on the yellow stripe symptom on the leaves. The length of lesions in each treatment group was recorded, and the incidence rate and disease index (DI) were calculated and statistically analyzed. Incidence rate (%) = 100 × number of infected plants / total number of planted plants, with the average value taken from the three biological replicates.

[0063] The results show that: by analyzing OE- Rdg2b -1、OE- Rdg2b -2 and OE- Rdg2b -4 Three transgenic lines with good in vitro resistance and the wild type (WT) were artificially inoculated using the "sandwich" method, and transplanted into pots 20 days after inoculation. Figure 11A) Statistical analysis of disease incidence. Analysis showed that wild-type plants exhibited disease incidence rates of 54.55%, 61.54%, and 66.67% in three independent trials, indicating high susceptibility to persistent infection with *Strombus stripe*. In contrast, the disease incidence rates of all transgenic lines were significantly lower, with OE- Rdg2b The incidence rate of -1 was 7.47%; OE- Rdg2b The incidence rate of -2 was 10.65%; OE- Rdg2b The incidence rate of -4 was 20.13% ( Figure 11 B). The incidence rate of all transgenic lines was significantly lower than that of the wild type, with OE- Rdg2b -1 and OE- Rdg2b The resistance of strain -2 was particularly outstanding. The disease indices of each strain were 1.49, 2.96 and 6.21, respectively, which were significantly lower than those of the wild type (51.25). Figure 11 E). Combining trypan blue and DAB staining analysis of diseased leaves, trypan blue staining showed that wild-type plants had large areas of deeply stained necrotic areas in their leaves, while transgenic lines, especially OE- Rdg2b -1 and OE- Rdg2b -2 The necrotic area was significantly reduced, indicating that pathogen spread was significantly inhibited. DAB staining results were similar; ROS accumulation was more concentrated and pronounced in wild-type leaves, while ROS accumulation at the diseased sites of transgenic lines was relatively less and more scattered. Figure 11 C).

[0064] Simultaneously, by statistically comparing the height of inoculated transgenic lines with that of wild-type lines, the overexpression of transgenic lines was analyzed. Rdg2b Does it affect the growth performance of barley under barley stripe disease stress? Figure 11 D). Compared to the uninoculated control (Mock) wild-type plant height of 31.18 cm, the inoculated wild-type (WT) plant height decreased to 15.25 cm, a reduction of 51.1%, exhibiting typical growth retardation caused by the disease. In contrast, the transgenic lines maintained a higher plant height level after inoculation, OE- Rdg2b -1、OE- Rdg2b -2 and OE- Rdg2b The average plant heights of the -4 groups were 22.50 cm, 17.85 cm, and 19.88 cm, respectively, representing decreases of 27.8%, 42.8%, and 36.2% compared to their respective uninoculated controls, and all were significantly higher than those of the inoculated wild type. P <0.05)( Figure 11 F). Among them, OE- Rdg2b -1 showed the least decrease in plant height after inoculation, consistent with the strongest disease resistance observed in the incidence statistics of this strain.

[0065] Indicates overexpression Rdg2bThe gene can systematically enhance barley's resistance to barley stripe disease. Under both in vitro and pot conditions, it significantly inhibits the spread of the stripe pathogen, reduces the incidence rate, maintains high chlorophyll content and plant height, and alleviates the physiological inhibition caused by the disease. It is believed that... Rdg2b Genes may play a key regulatory role in barley resistance to barley stripe disease by inhibiting pathogen infection, maintaining photosynthetic function, and coordinating the growth-defense balance.

[0066] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

[0067] References: [1] Chen Xiaojing, Chen He, Chen Jian, et al. Discussion on the significance and utilization value of promoting barley production [J]. Barley Science, 2003, (3): 7-9. [2] Bothmer R V. Genetic diversity for quantitatively inherited agronomic and malting quality traits. Development Plant Genetics andBreeding, 2003, (7): 201-226. [3] Porta PA, Delogu G, Vannacci G. Pyrenophora graminea on winterbarley seed: Effect on disease incidence and yield losses[J]. Journal ofPhytopathology, 2010, 117(1): 26-33. [4] Xu Congjian. Analysis of the damage and integrated control technology of barley stripe disease. Agricultural Technology Service, 2015, 32(2):88-90. [5] Wang Shujie, Zhai Dechang, Zhao Jinzhi, et al. Common diseases of barley and their control measures. Agricultural Science and Technology Communications, 2004, (11): 32-33. [6] Jiang Chunyi, Shen Shulong, Shen Tianhui, et al. Causes and control measures of severe outbreaks of barley stripe disease in 1996 and 1997 [J]. Hubei Plant Protection, 1998, (3): 16. [7] Porta-Puglia A, Delogu G, Vannacci G. Pyrenophora gramineaonwinter barley seed: effect on disease incidence and yield losses[J]. Journal of Phytopathology, 1986, 117(1): 26-33. [8] Jones JDG, Dangl J L. The plant immune system. Nature, 2006,444(7117): 323-329. [9] Li Xin, Wen Xiangyu, Zheng Jingyuan, et al. Research progress on the role of microbial effector proteins in plant-microbe interactions [J]. Molecular Plant Breeding, 2023, 21(8): 2608-2617.

[10] Li W, Deng Y, Ning Y et al. Exploiting Broad-Spectrum DiseaseResistance in Crops: From Molecular Dissection to Breeding. Annual Review ofPlant Biology, 2020, 71: 575-603.

[11] Giraldo MC, Valent B. Filamentous plant pathogen effectors inaction. Nature Reviews Microbiology, 2013, 11(11), 800-814.

[12] Jacob F, Vernaldi S, Maekawa T. Evolution and conservation ofplant NLR functions. Frontiers in Immunology, 2013, 4: 1-16.

[13] Cesari S, Bernoux M, Moncuquet P, Kroj T, and Dodds P N. A novelconserved mechanism for plant NLR protein pairs: the “integrated decoy” hypothesis. Front Plant Sci , 2014, 5: 606.

[14] Hu Yuci, Yao Liping, Zhang Tong, et al. Encoding of NB-ARC domain in yellow-haired strawberry FnCN Gene and promoter cloning and FnCN Gene expression analysis [J]. Journal of Plant Resources and Environment, 2020, 29(4): 1-10.

[15] Yin Ling, Fang Hui, Huang Yu, et al. Research progress on the domains of TIR-NB-LRR type disease resistance genes in plants [J]. Guangxi Plants, 2017, 37(2): 186-190.

[16] Jacob F, Vernaldi S, Maekawa T. Evolution and conservation ofplant NLR functions. Frontiers in Immunology, 2013, 4:1-16.

[17] Yu Yang, Jia Zhaodong, Ma Peiyong, et al. Research progress on the function of WRKY transcription factors in plant disease resistance response [J]. Molecular Plant Breeding, 2018, 16(21): 7009-7020.

[18] Bhalla PL, Ottenhof HH, Singh M B. Wheat transformation-anupdate of recent progress[J]. Euphytica, 2006, 149(3): 353-366.

[19] Su WB, Xu MY, Radani Y, et al. Technological development and application of plant genetic transformation[J]. Int J Mol Sci, 2023, 24(13):10646.

[20] Lowe K, Wu E, Wang N, et al. Morphogenic regulators Baby boom and Wuschel improve monocot transformation[J]. Plant Cell, 2016, 28(9): 1998-2015.

Claims

1. The use of overexpression of the Rdg2b gene to increase the resistance of barley to net blotch, characterized in that The Rdg2b The full-length coding sequence of the CDS of the gene is shown as SEQ ID No.

1.

2. The overexpression of claim 1 Rdg2b application in increasing the resistance of barley plants to stripe disease, characterized in that The Rdg2b The gene plays a key regulatory role in the process of barley resistance to stripe disease by inhibiting pathogen infection, maintaining barley height growth, maintaining photosynthetic function, and coordinating growth-defense balance.

3. A protein associated with barley stripe disease resistance, characterized in that The protein is a protein as shown in (a) or (b) below: (a) a protein with an amino acid sequence as shown in SEQ ID NO. 2; (b) a derived protein with an amino acid sequence as shown in SEQ ID NO. 2 after substitution, deletion or addition of one or more amino acid residues, and still having the function of resisting stripe disease of barley.

4. A nucleic acid molecule encoding the protein of claim 3. The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1, or is a nucleotide sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO. 1 and encoding a protein having the function of resisting stripe disease of barley.

5. Biomaterial comprising the nucleic acid molecule of claim 3, characterized in that The biological material is an expression cassette, a vector or a host cell.

6. A method of increasing the resistance of barley to stripe disease, characterised by The method comprises the following steps: The method comprises the following steps:

7. A method of constructing a recombinant vector for overexpression of the nucleic acid molecule of claim 4, comprising (1) amplifying the target fragment: using the cDNA of Ganbi No. 2 barley as a template, and using a primer pair to perform PCR amplification to obtain a target fragment with a nucleotide sequence as shown in SEQ ID NO. 1; (2) constructing a recombinant vector: connecting the target fragment obtained in step (a) with a linearized vector to obtain a recombinant overexpression vector. Sma 8. The method of claim 7, wherein, The linearized vector in step (2) is the pWMB100 vector linearized with Spe I and ​ I double digested linearized pWMB100 vector, the recombinant overexpression vector is pWMB100-Rdg2b.