A SNP molecular marker related to yak body weight traits and application thereof

Abstract

This invention discloses a SNP molecular marker associated with yak weight traits and its application, belonging to the field of molecular biology detection technology. The SNP molecular marker is located at position 140175923 on chromosome 2 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1, with base G or C at position 301. Yaks with the CC genotype have significantly higher body weights than those with the GG and CG genotypes (P<0.05). The corresponding trait can be rapidly identified using PCR and gene sequencing, and can be used for marker-assisted breeding of yaks, without being limited by yak breed or age. Therefore, in production, individuals with the CC genotype at this locus can be preferentially selected as parents for large-scale breeding, greatly accelerating the accuracy and effectiveness of yak weight trait selection and improving the economic benefits of yak farming.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a SNP molecular marker associated with yak weight traits and its application. Background Technology

[0002] Yaks are mainly concentrated in the Qinghai-Tibet Plateau and surrounding high-altitude, cold regions. They are the only cattle breed capable of generating economic benefits from pasture resources in these areas, providing local herders with the vast majority of their production and livelihood resources. This is of great significance to the economic development of Tibetan areas and the improvement of herders' living standards. Studies have shown that yaks on the Qinghai-Tibet Plateau are characterized by small weight, slow growth rate, and an early growth inflection point. Therefore, protecting and developing yak genetic resources, improving yak growth performance, and promoting the development of the yak industry are of great importance.

[0003] Single nucleotide polymorphisms (SNPs), often referred to as third-generation DNA genetic markers, are polymorphisms caused by the substitution of a single nucleotide in the genome sequence. They offer advantages such as high distribution density, stable heritability, and the ability to be analyzed automatically. Substitution refers to the substitution between purine bases (A and G) and pyrimidine bases (T and C). SNPs appearing in coding regions can affect gene function, leading to changes in biological traits, and thus can serve as biomarkers associated with certain traits. SNP analysis is widely used in livestock research and can serve as a potential molecular marker to assist in livestock breeding, thereby improving livestock production and reproductive performance.

[0004] The calcitonin receptor-like gene (CALCRL) is a G protein-coupled neuropeptide receptor. The CALCRL gene encodes a CLR receptor that combines with different RAMP proteins to form receptor complexes with diverse functions, widely participating in key physiological activities such as angiogenesis and lymphangiogenesis, blood pressure regulation, cell proliferation, and apoptosis. Its mediated CGRP and AM signaling pathways play a central role not only in maintaining cardiovascular homeostasis but also in embryonic development. By screening individuals with superior CALCRL genotypes, it is possible to assist in breeding yak breeds with better body weight traits, thereby improving the economic benefits of yak farming. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to yak weight traits and its application, in order to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an SNP molecular marker related to the weight trait of yaks. The SNP molecular marker is located at position 140175923 on chromosome 2 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1. The 301st base of the nucleotide sequence is G or C.

[0007] The second technical solution of the present invention is a primer pair for detecting the SNP molecular marker, the primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer being shown in SEQ ID NO.3.

[0008] The third technical solution of the present invention is a kit for detecting SNP molecular markers related to yak weight traits, wherein the kit contains the primer pair.

[0009] The fourth technical solution of the present invention is a method for detecting SNP molecular markers related to yak weight traits, comprising the following steps: (1) Extracting yak genomic DNA; (2) Using the primer pair or the kit, the genomic DNA is amplified by PCR to obtain the amplification product; (3) Sequencing the amplified product to determine the base type at position 301 of the sequence shown in SEQ ID NO.1, thereby determining the genotype of the yak individual at the SNP molecular marker site.

[0010] The fifth technical solution of the present invention involves the application of the SNP molecular marker, the primer pair, or the reagent kit, wherein the application is any one of the following: (1) Application in detecting body weight traits in yaks; (2) Application in early selection of yak weight traits; (3) Application in molecular marker-assisted breeding of yak weight traits.

[0011] The sixth technical solution of the present invention is a method for breeding yak breeds with excellent weight traits, comprising the following steps: detecting the genotype of the SNP molecular marker in an individual yak; if the genotype is CC, the individual yak is determined to be an individual with excellent weight traits and is selected for use as breeding material.

[0012] Based on the above technical solution, the present invention has the following technical effects: This invention analyzes the correlation between locus genotypes and yak weight traits, identifying SNP loci associated with this trait. The SNP molecular marker is located at position 140175923 on chromosome 2 of the yak reference genome Bosgu_v3.0 EuroPean Nucleotide Archive accession number GCA_005887515.1, with a mutation of G or C. Based on genotyping, individual yak genotypes are classified into GG, CG, and CC. Yaks with genotype CC have significantly higher body weights than those with genotypes GG and CG (P<0.05). The corresponding trait can be rapidly identified using PCR and gene sequencing, enabling marker-assisted breeding of yaks without limitations on breed or age. Therefore, individuals with the CC genotype at this locus can be preferentially selected as parents for large-scale breeding, significantly accelerating the accuracy and effectiveness of yak weight trait selection and improving the economic benefits of yak farming. Attached Figure Description

[0013] Figure 1 These are sequencing peak diagrams for three genotypes in this embodiment of the invention. Wherein, a represents the GG genotype, b represents the CG genotype, and c represents the CC genotype. Detailed Implementation

[0014] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0015] This invention provides a SNP molecular marker associated with the weight trait of yaks. The SNP molecular marker is located at position 140175923 on chromosome 2 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1. The 301st base of this nucleotide sequence is G or C.

[0016] In some specific implementations, the yak reference genome version containing the SNP molecular marker is Bosgu_v3.0, and the European Nucleotide Archive accession number is GCA_005887515.1.

[0017] In some specific implementations, the SNP molecular markers include genotypes GG, CG, and CC.

[0018] This invention also provides a primer pair for detecting the SNP molecular marker, the primer pair including an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0019] This invention also provides a kit for detecting SNP molecular markers associated with yak weight traits, the kit comprising the primer pair.

[0020] This invention also provides a method for detecting SNP molecular markers related to yak weight traits, comprising the following steps: (1) Extracting yak genomic DNA; (2) Using the primer pair or the kit, the genomic DNA is amplified by PCR to obtain the amplification product; (3) Sequencing the amplified product to determine the base type at position 301 of the sequence shown in SEQ ID NO.1, thereby determining the genotype of the yak individual at the SNP molecular marker site.

[0021] In some specific implementation schemes, the PCR amplification reaction system is as follows: 12.5 μL of 2× Taq PCR Mix, 1 μL of DNA template, 1 μL each of upstream and downstream primers, and 9.5 μL of enzyme-free sterile water. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 5 min.

[0022] This invention also provides the application of the SNP molecular marker, the primer pair, or the kit, wherein the application is any one of the following: (1) Application in detecting body weight traits in yaks; (2) Application in early selection of yak weight traits; (3) Application in molecular marker-assisted breeding of yak weight traits.

[0023] In some specific implementations, the application is as follows: detecting the genotype of the SNP molecular marker in yak individuals, where the body weight of yak individuals with genotype CC is significantly higher than that of individuals with genotypes GG and CG.

[0024] This invention also provides a method for breeding yak breeds with excellent weight traits, comprising the following steps: detecting the genotype of the SNP molecular marker in an individual yak; if the genotype is CC, then the individual yak is determined to be an individual with excellent weight traits and is selected for use as breeding material.

[0025] This invention utilizes multiple primer pairs designed sequentially to amplify yak DNA via PCR on the CALCRL gene fragment (SEQ ID NO.1), followed by gene sequencing. Genotyping analysis of the target fragment amplified by one primer pair (SEQ ID NO.2 and SEQ ID NO.3) revealed a single SNP site with three genotypes. Analysis using MEGA 11.0 and BioEdit software identified the SNP site located at nucleotide 301 of the SEQ ID NO.1 fragment. Further analysis using SPSS 25.0 software revealed the correlation between the genotype of the mutation site and growth traits in individual yaks, showing that yaks with genotype CC had significantly higher body weights than those with genotypes GG and CG (P<0.05).

[0026] Example 1 SNP site identification (1) Yak sample collection This invention uses the Tianzhu White Yak breed as the testing subject, collecting blood samples from 536 Tianzhu White Yaks in Xiamiaoergou Village, Dachaigou Town, Tianzhu Tibetan Autonomous County, Wuwei City, Gansu Province. Growth performance of the Tianzhu White Yaks was measured, including weight, height, body length, and chest circumference. 4ml of blood was collected from the jugular vein using EDTA anticoagulant blood collection tubes and stored at -20℃.

[0027] (2) Isolation, extraction and purification of genomic DNA Genomic DNA was extracted from blood samples of Tianzhu white yaks using the TIANamP Blood Genomic DNA Kit; DNA quality and concentration were determined by 1.5% agarose gel electrophoresis and Thermo Scientific Nano DroP 2000c.

[0028] (3) Primer design and screening Based on the CALCRL gene of Tianzhu white yak published by Ensemble (accession number: ENSBGRG00000003080), multiple primer pairs were designed on its DNA sequence using Primer 5.0 software. PCR amplification was performed on Tianzhu white yak DNA samples, and the gene sequencing results were analyzed. A pair of primers containing an SNP site was selected, and its primer sequence information is as follows: F: 5'-TGACTTTTCCCTTTCTTTTGCCT-3' (SEQ ID NO. 2); R: 5'-CCAGCCACTGTTTTGTCCAGT-3' (SEQ ID NO. 3).

[0029] (4) PCR amplification of the target gene fragment The PCR reaction system consisted of 25 μL: 12.5 μL of 2× Taq PCR Mix, 1 μL of DNA template (100 ng / μL), 1 μL each of upstream and downstream primers (10 μmol / L), and 9.5 μL of enzyme-free sterile water.

[0030] PCR amplification program: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 30 cycles; 72 ℃ extension for 5 min, cooling at 4 ℃. After amplification, the amplification products were detected by electrophoresis on a 1.5% agarose gel.

[0031] (5) Gene sequencing The PCR reaction solution, after passing the tests, was sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional Sanger sequencing. The amplified target sequence is shown in SEQ ID NO.1, with the SNP site located at position 301 of the sequence shown in SEQ ID NO.1. The sequencing peak diagram at the mutation site is shown below. Figure 1 As shown.

[0032] SEQ ID NO.1: CTTATCTATATGACTTTTCCCTTTCTTTTTGCCTCCACATACACACACACACACCTTTATCCTTCAGTTTTTTTTTCAGAGAATTGAGTAATTTTAAGTTCATTGAAATTATTGATCATTTTCTATTATCATCAGTGGTGTAAAT ATGATTTTAATTTGTATTGAATAATATTATTAATATTTCTTTGAAAATTGAGAAATATAAAAATCAACAATTTTTATTTGTTGAAATCTAGTAAAATTCTAACTCAAGACACAATCATTTTAACATTAAATATCTCTCAGAAACTGTTGTCTA GAATAAATGTACATGAATATATTTATAATGATGTAATAACCACAGTATTTAAGCAAAACTAAAGAACATGATTTTAATACACATGAAAAGCCACATACACAAAAGCAAAAATGTTTTCTGGCTACATATGTGTTTGTTGAACTCACTGGAC AAACAGTGGCTGGGAAAGTACAATTCAATCTGTGATCCCTTTAAAATTGGGAGTGATTCCAATTTGATGAAATAAGAAAGGGGAGTAGGGGATATGAAAAGTTTGAAAAATGTTTTTCCAGTGGCATTTTACTTCATTGCTAACCTTAAT.

[0033] Note: The underlined positions are SNP sites.

[0034] Example 2 Correlation between different genotypes of SNP molecular marker sites and growth traits (1) Genotyping All individuals underwent steps (4) and (5) of Example 1 to determine their specific genotypes based on gene sequencing results. Three genotypes were detected in the test population, and the genotype frequencies and allele frequencies are shown in Table 1.

[0035] Table 1. Genotypes and allele frequencies of the CALCRL gene SNP loci in Tianzhu white yaks.

[0036] Genotyping of blood DNA samples from 536 Tianzhu white yaks using PCR and gene sequencing revealed three genotypes at the CALCRL gene SNP molecular marker site: homozygous GG, heterozygous CG, and homozygous CC. The frequencies of the three genotypes were 0.440 (GG), 0.453 (CG), and 0.106 (CC).

[0037] (2) Association analysis between SNP genotype and growth trait phenotypic values To determine whether the SNP marker prepared in this invention is related to the difference in body weight trait of Tianzhu white yak, least squares statistical correlation analysis was performed on the three genotypes of the SNP locus at position 301 on the fragment of SEQ ID NO.1 and the phenotypic values ​​of body weight, body height, body length, and chest circumference of Tianzhu white yak using SPSS 25.0 software. The association between the genotype of this SNP locus and the growth trait was calculated, and the results are shown in Table 2.

[0038] Table 2. Association analysis of CALCRL gene polymorphism and growth traits in Tianzhu white yak.

[0039] The model used is as follows: Y j =μ+G j +e j ; where Y j G represents the observed growth trait value. j The genetic effect of genotype j; μ e represents the overall mean of each trait; j This indicates the random residual effect. Differences between groups were tested using LSD multiple comparisons, and the results are expressed as Mean ± SD.

[0040] Note: Different lowercase superscript letters indicate significant differences (P<0.05), and * indicates significant differences (P<0.05).

[0041] Table 2 shows that the polymorphism at locus 140175923 on chromosome 2 of Tianzhu white yaks is significantly correlated with body weight (P<0.05). Among them, the body weight of Tianzhu white yaks with genotype CC is significantly higher than that of individuals with genotypes GG and CG (P<0.05).

[0042] This embodiment identified a SNP marker significantly associated with the body weight trait of Tianzhu White Yaks. Therefore, selecting individuals with the dominant genotype will help improve the body weight trait in Tianzhu White Yaks. The mutation site of this invention can serve as a potential genetic marker for improving the weight and egg production performance of Tianzhu White Yaks and can be used for auxiliary selection of Tianzhu White Yaks.

[0043] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A SNP molecular marker associated with yak body weight trait, characterized in that, The SNP molecular marker is located at position 140175923 on chromosome 2 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1, with the 301st base of the nucleotide sequence being G or C.

2. The SNP molecular marker according to claim 1, characterized in that, The yak reference genome version for the SNP molecular marker is Bosgu_v3.0, and the European Nucleotide Archive accession number is GCA_005887515.

1.

3. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular markers include genotypes GG, CG, and CC.

4. A primer pair for detecting the SNP molecular marker according to any one of claims 1-3, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

5. A kit for detecting SNP molecular markers associated with yak weight traits, characterized in that, The kit contains the primer pair as described in claim 4.

6. A method for detecting SNP molecular markers associated with yak weight traits, characterized in that, Includes the following steps: (1) Extracting yak genomic DNA; (2) Using the primer pair of claim 3 or the kit of claim 4, the genomic DNA is amplified by PCR to obtain the amplification product; (3) Sequencing the amplified product to determine the base type at position 301 of the sequence shown in SEQ ID NO.1, thereby determining the genotype of the yak individual at the SNP molecular marker site.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system was as follows: 12.5 μL of 2× Taq PCRMix, 1 μL of DNA template, 1 μL each of upstream and downstream primers, and 9.5 μL of enzyme-free sterile water. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 5 min.

8. The application of the SNP molecular marker according to any one of claims 1-3, the primer pair according to claim 4, or the kit according to claim 5, characterized in that, The application is any one of the following: (1) Application in detecting body weight traits in yaks; (2) Application in early selection of yak weight traits; (3) Application in molecular marker-assisted breeding of yak weight traits.

9. The application according to claim 8, characterized in that, The application is to detect the genotype of the SNP molecular marker described in any one of claims 1-3 in individual yaks, wherein the body weight of yak individuals with genotype CC is significantly higher than that of individuals with genotypes GG and CG.

10. A method for breeding yak breeds with superior weight traits, characterized in that, Includes the following steps: The genotype of the SNP molecular marker described in any one of claims 1-3 is detected in an individual yak. ​​If the genotype is CC, the individual yak is determined to be an individual with excellent weight traits and is selected for use as breeding material.

Images