Serum amyloid s aa single-domain antibody and preparation method and application thereof
By preparing a single-domain antibody against human serum amyloid protein (SAA), the problems of low-temperature storage and cold chain transportation required for existing antibodies have been solved, achieving stable preservation and transportation under relaxed conditions and reducing costs.
Patent Information
- Application Number
- CN202610600761.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-30
- Publication Date
- 2026-07-03
AI Technical Summary
Existing serum amyloid A (SAA) antibodies require low-temperature storage and cold chain transportation, resulting in high storage and transportation costs.
A single-domain antibody against human serum amyloid protein (SAA) was developed by immunizing striped bamboo sharks, constructing a recombinant phage vector, screening and purifying monoclonal antibodies, and preparing a detection kit.
Single-domain antibodies are stable in the range of room temperature to 50°C, reducing storage and transportation costs, and maintaining good biological activity in high-temperature environments.
Smart Images

Figure CN122325601A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological antibody technology, and particularly relates to serum amyloid protein SAA single-domain antibody, its preparation method and application. Background Technology
[0002] Serum amyloid A (SAA) is a precursor to tissue amyloid A, synthesized by the liver, and is an acute-phase reactive protein. In pathological states such as infection, inflammation, and tissue damage, serum A concentration can rise sharply within 4-6 hours, reaching 100 to 1000 times the normal value. Furthermore, due to the short half-life of serum A in the acute phase (approximately 50 minutes), changes in its levels can rapidly reflect changes in the disease condition, making it a sensitive indicator for monitoring inflammatory and non-infectious diseases and assessing the effectiveness of drug treatment.
[0003] Currently used diagnostic markers, such as C-reactive protein (CRP) and procalcitonin (PCT), suffer from poor sensitivity. Both increase in bacterial infections but show no significant response to viral infections. Furthermore, CRP and PCT have a slow reaction rate, typically showing a significant increase only 6-12 hours after infection. In contrast, the core clinical value of serum amyloid A lies in its high sensitivity to both viral and bacterial infections. Therefore, the combined detection of serum amyloid A with CRP and PCT has become an important strategy for differentiating between bacterial and non-bacterial infections and guiding antibiotic use to avoid overuse. In addition, serum amyloid A is also used to assess the activity of autoimmune diseases, cardiovascular event risk, tumor progression and prognosis, and organ transplant rejection. Based on its rapid diagnostic value, SAA testing is becoming another routine inflammatory diagnostic marker after complete blood count, CRP, and PCT.
[0004] Common methods for detecting serum amyloid A include chemiluminescence, fluorescence immunochromatography, latex turbidimetry, and colloidal gold methods. The core raw material for these immunological assays is monoclonal antibody. Currently, the antibodies used for detecting serum amyloid A are typically murine monoclonal antibodies, which require cryogenic storage. Short-term use requires storage at 2-8°C, while long-term storage requires storage below -20°C or lyophilization. These stringent storage requirements mean that the transportation of serum amyloid A antibodies necessitates a complete cold chain, resulting in stringent transportation conditions and high costs.
[0005] Single-domain antibodies, specifically variable new antibody (vNAR), originate from the variable region of cartilaginous fish heavy chain antibody IgNAR (immunoglobulin new antibody receptor). Compared to traditional monoclonal antibodies, the outstanding physicochemical stability is one of the important unique advantages of vNAR. Studies have confirmed that placing vNAR in an environment of 80-95°C or in a solution containing detergents has almost no impact on its antibody activity. The high stability of vNAR makes its transportation and storage conditions less demanding; transportation does not require a complete cold chain, and storage does not require ultra-low temperatures. Therefore, developing single-domain antibodies against serum amyloid A holds promise for solving the problems of current serum amyloid A antibodies requiring low-temperature storage, as well as the resulting stringent transportation and storage conditions and high costs. Summary of the Invention
[0006] To address the problems of existing serum amyloid protein (SAA) antibody storage requiring low temperatures, resulting in stringent transportation and preservation conditions and high costs, this invention provides a single-domain antibody against human serum amyloid protein (SAA), its preparation method, and its application.
[0007] The technical solution of the present invention is as follows: One of the objectives of this invention is to provide a single-domain antibody against serum amyloid protein (SAA), the encoding nucleotide sequence of which is shown in SEQ ID NO:1.
[0008] Furthermore, the amino acid sequence of the single-domain antibody against serum amyloid-SAA is shown in SEQ ID NO:2.
[0009] The method for preparing a single-domain antibody against serum amyloid protein (SAA) in this invention specifically includes the following steps: S1. Recombinant protein of human serum amyloid protein (SAA) was used to immunize striped bamboo sharks with subcutaneous antigen injection. S2. Multiple immunizations were performed. After immunization, the spleen of the immunized shark was dissected and total RNA was extracted and reverse transcribed into cDNA. Using cDNA as a template, the vNAR fragment of the striped bamboo shark was amplified. The vNAR gene fragment was ligated with the phage vector pComb3XSS to construct a recombinant phage vector. S3. After electroporating the recombinant phage vector into TG-1 competent cells, VCS-M13 helper phage was used for infection to construct a primary phage antibody library. S4. Immunotubes were coated with recombinant human serum amyloid protein (SAA) for antibody screening. After multiple rounds of affinity panning and enrichment of the phage antibody library, positive monoclonal antibodies were screened to identify the monoclonal antibody with the highest positive value. The vNAR encoding gene sequence was obtained by gene sequencing. S5. Construct a recombinant expression vector from the gene sequence of the monoclonal antibody and express the antibody protein; collect the purified antibody protein through affinity purification.
[0010] Furthermore, the single-domain antibody against serum amyloid protein (SAA) was used to prepare a detection kit for serum amyloid protein.
[0011] The present invention provides a detection kit comprising the above-mentioned single-domain antibody against serum amyloid protein (SAA); The test kit is any one of the following: a kit for auxiliary diagnosis of viral infection, a kit for differential diagnosis of bacterial and viral infection, a kit for assessing inflammatory activity, a kit for early screening of infectious diseases in children, a kit for differential diagnosis of the etiology of respiratory tract infection, a kit for monitoring postoperative infection, a kit for judging the activity of autoimmune diseases and whether there is a concurrent infection, a kit for monitoring the infection risk of cancer patients, a kit for dynamic evaluation of the effect of infection treatment, a kit for assessing the risk of cardiovascular inflammation, a kit for preliminary differentiation of post-transplant infection and rejection, and a kit for prognostic judgment of infectious diseases.
[0012] Furthermore, the detection kit also includes a coated plate, serum amyloid A standard, HRP-labeled rabbit anti-shark IgNAR antibody, chromogenic substrate, PBST washing buffer, stop solution: 2 mol / L sulfuric acid solution, sealing film, and self-sealing bag.
[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: The single-domain antibody against serum amyloid-3 (SAA) provided by this invention exhibits excellent stability within a temperature range of room to 50°C, and can be stably stored for a long time under these conditions. This characteristic significantly reduces the difficulty of antibody storage and effectively saves costs in storage and transportation. At the same time, the single-domain antibody against SAA can maintain good biological activity even at high temperatures, which allows the detection kit with it as the core component to be stored and transported under more relaxed conditions, thereby reducing the overall application cost of the kit. Attached Figure Description
[0014] Figure 1 The SDS-PAGE electrophoresis results of the serum amyloid protein SAA single-domain antibody provided in the embodiments of the present invention; Figure 2The results of the detection of serum amyloid A single-domain antibody binding to human serum amyloid A provided in the embodiments of the present invention; Figure 3 The results of a comparative antibody activity test between the serum amyloid SAA single-domain antibody and the murine monoclonal antibody of serum amyloid A provided in the embodiments of the present invention after 14 days of storage at 37°C. Figure 4 The SDS-PAGE electrophoresis results of the serum amyloid SAA single-domain antibody and the murine monoclonal antibody of serum amyloid A provided in the embodiments of the present invention after storage at 50°C for 14 days; Figure 5 The results of a comparative antibody activity test between the serum amyloid SAA single-domain antibody and the murine monoclonal antibody of serum amyloid A provided in the embodiments of the present invention after 14 days of storage at 50°C. Detailed Implementation
[0015] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The embodiments are only used to explain the present invention and do not constitute any limitation on the present invention. Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0016] Example 1 This embodiment provides the screening and preparation of single-domain antibodies against serum amyloid protein (SAA), specifically including the following steps: (1) Construction of phage antibody library 100 μg of recombinant serum amyloid protein SAA was mixed with an equal volume (100 μL) of immune adjuvant and emulsified. This mixture was then administered subcutaneously to striped bamboo sharks at multiple sites for a total of six immunizations, with each immunization spaced 14 days apart. After immunization, blood was collected from the sharks via tail vein sampling. Peripheral blood lymphocytes were obtained by horizontal centrifugation using Percoll solutions with concentration gradients of 34%–51%. IgNAR-positive B cells were then isolated from the peripheral blood lymphocytes using flow cytometry with an antibody labeled with Cy5.5, a heavy chain antibody against striped bamboo sharks. Subsequently, serum amyloid protein SAA labeled with FITC was used again for flow cytometry to isolate serum amyloid protein SAA-targeted IgNAR-positive B cells from the IgNAR-positive B cells.
[0017] Total RNA was extracted from antigen-targeting IgNAR-positive B cells and reverse transcribed into cDNA. Using cDNA as a template, two rounds of PCR reactions were performed using a combination of PCR amplification primers. The PCR products were then purified to obtain the purified vNAR gene fragment.
[0018] The primer sequences are shown below: First-round forward primer: ATGAATATTTTKTTGYTTRCGKKCCTTTTAD First-round reverse primer: TTMTGKGCMGGATYTARCAATGTCG Second-round forward primer 1: GCATGGGTTGAGCAATCACG Second-round reverse primer 1: TTTCACTGTTAGAAAAGTGCC Second-round forward primer 2: CAACGGGTTGAACAAACACC; Second-round reverse primer 2: TTTGCCAGGTTTCACAGTCAG; The purified vNAR gene fragment was inserted into the phage vector pComb3XSS to construct a recombinant phage vector, which was then transformed into a new phage vector via electroporation. E coli XL1-Blue cells were coated onto 2-year-old cells. Amp+ Culture medium, incubated overnight at 37°C; collect plaques, and take 100 μL for serial dilution and spread on 2YT. Amp+ The culture medium was incubated overnight at 37°C, and the colony count was statistically analyzed. The calculated size of the constructed antibody library was 1.53 x 10⁻⁶. 8 CFU / mL, 50 single clones were randomly sequenced, and the vNAR gene fragment insertion positivity rate was 100%.
[0019] Transformed E. coli was infected using helper phage VCS-M13 (multiple of infection 20:1). After infection, the phage antibody supernatant was obtained by centrifugation, PEG6000 / NaCl solution was added, the mixture was mixed, and centrifuged again. The precipitate was collected, resuspended in PBS, and the phage antibody library, i.e., the primary antibody library, was obtained.
[0020] (2) Antibody screening Recombinant serum amyloid-A (SAA) protein (5 μg) was coated onto immunotubes and incubated overnight at 4°C. The next day, after blocking with 5% skim emulsion, 2 mL of the prepared phage antibody was added to the immunotubes and incubated for 2 h. After thorough washing, Glycine-HCl (pH=2.0) was added to the immunotubes for elution for 15 min, followed by neutralization with 0.2 mL of Tris-HCl (pH=9.0) to adjust the pH to approximately 7.2. Then, [the following was added]... E coliXL1-Blue bacterial culture was mixed and transferred to 50 mL centrifuge tubes, and cultured at 37℃ and 150 rpm for 1 h with shaking. The precipitate was collected by centrifugation at 4000 rpm, resuspended, and spread on SOC plates containing ampicillin and tetracycline. The bacterial cells on the plates were scraped off the next day for the next round of screening. Affinity screening was performed in 3 rounds, with the same steps as the first round. The coating amount of the antigen peptide was decreased in each round, from 2 µg to 1 µg. After 3 rounds of screening, a tertiary antibody library was obtained.
[0021] Subsequently, Phage ELISA was used to screen for antigen-positive recombinant antibodies. The specific method is summarized as follows: 80 single clones were randomly selected from a plate spread with bacterial culture from a tertiary library and inoculated into a 96-well plate, labeled the Master Plate, and incubated overnight with shaking; another 96-well plate was then inoculated with 0.4 mL of a solution containing 1 x 10⁻⁶ cells / well. 10 pfu VCS-M13 helper phage 2xYTG amp+tet+kana+ Add culture medium to each well; take 50 μL of culture medium from each well of the Master Plate and add it to the corresponding well, labeling it P1 plate. After shaking and incubating for 2 h, centrifuge, discard the supernatant, and add 0.4 mL of 2×YT to each well. amp+tet+kana+ Culture medium, shake and incubate overnight; the next day, centrifuge and collect the supernatant for testing; Coat a 96-well ELISA plate with recombinant serum amyloid-A (SAA) protein (100 ng / well) overnight at 4°C. The next day, after blocking with 5% skim milk solution, add the phage antibody supernatant obtained in the previous step and incubate at room temperature for 2 h. After thorough washing, add enzyme-labeled secondary antibody Anti-M13-HRP and incubate at room temperature for 1 h. After thorough washing, add TBM chromogenic solution, let stand for 10 min for color development, add stop solution, and use an ELISA reader to measure the color at OD. 450 Reading value, with experimental group OD 450 The criterion for selection was that the value was more than twice that of the negative control group. The best positive single clone was selected and sequenced. After eliminating duplicates, the SN-02 positive clone was obtained. Its amino acid sequence is shown in SEQ ID NO.2 and the corresponding coding nucleotide sequence is shown in SEQ ID NO.1. Finally, the vNAR gene fragment of SN-02 was cloned into the PET28a expression vector; the recombinant vector was transformed into BL21 competent cells, and after screening for positive strains, they were inoculated into cells containing LB. kana+ Culture medium, shake and incubate until OD 600To reach a concentration of 1.0, IPTG solution was added to a final concentration of 1 mmol / L, and expression was induced by shaking for 6 h. After induction, the bacterial cells were collected by centrifugation, sonicated, and the supernatant was collected after centrifugation. The antibody protein was purified using the conventional His-Tag affinity chromatography method, and the purified antibody protein was collected to obtain the single-domain antibody SN-02 against serum amyloid protein (SAA). The results of SDS-PAGE electrophoresis are shown below. Figure 1 As shown.
[0022] Example 2 Performance of single-domain antibodies against serum amyloid-acid (SAA) screened and prepared according to the method in Example 1. (1) Detection of single-domain antibody binding to human serum amyloid A Recombinant serum amyloid-associated protein (SAA) was transferred to a PVDF membrane via wet transfer after SDS-PAGE electrophoresis. The membrane was blocked with 5% skim milk solution for 1 h. The single-domain antibody SN-02 (antibody concentration: 1 μg / mL) for serum amyloid-associated protein (SAA) prepared in Example 1 was added, and the membrane was incubated at 37°C for 1 h. After thorough washing, enzyme-labeled rabbit anti-squalane vNAR secondary antibody was added, and the membrane was incubated at 37°C for 45 min. After thorough washing, chemiluminescent solution was sprayed onto the membrane, and color development was performed using a chemiluminescent gel imaging system. The results are as follows: Figure 2 As shown: a single band is present at approximately 21 kDa, indicating that the single-domain antibody SN-02 for serum amyloid SAA can specifically recognize serum amyloid SAA.
[0023] (2) Analysis of the detection range of single-domain antibody against human serum amyloid A. Serum amyloid-associated protein (SAA) solutions at concentrations of 10 mg / L, 20 mg / L, 50 mg / L, 100 mg / L, 500 mg / L, 1000 mg / L, 2000 mg / mL, and 5000 mg / mL were prepared. Each solution was coated onto a 96-well ELISA plate (100 μL per well) and incubated overnight at 4°C. The next day, after blocking with 5% skim milk solution, a single-domain antibody SN-02 solution of serum amyloid-associated protein (SAA) (concentration: 1 μg / mL) was added, and the plate was incubated at 37°C for 1 h. After thorough washing, enzyme-labeled rabbit anti-squalane secondary antibody was added, and the plate was incubated at 37°C for 45 min. After thorough washing, chromogenic substrate was added, and the plate was incubated in the dark for 10 min. Stop solution was then added. The plate was then analyzed using an ELISA reader at OD500. 450 Reading value, with experimental group OD 450 A value more than twice that of the control group was considered positive; the results are shown in Table 1: Table 1. Detection range of single-domain antibody SN-02 for serum amyloid protein (SAA)
[0024] OD of all serum amyloid A concentration samples 450 Values higher than the control group OD 450 More than twice the normal value. More importantly, in the blood of a healthy person, the serum level of serum amyloid-acid (SAA) is about 10 mg / L, but it rises sharply after inflammation or infection, with an increase of hundreds of times.
[0025] In this embodiment, when the concentration of serum amyloid protein (SAA) increased significantly (from 10 mg / L to 1000, 2000, and 5000 mg / mL), its OD... 450 The value subsequently increased significantly. This demonstrates that the single-domain antibody SN-02 meets the standards for human testing in terms of its detection range.
[0026] (3) Stability test of serum amyloid-SAA single-domain antibody at 37°C The single-domain antibody SN-02 against serum amyloid-beta-associated protein (SAA) and a commercial monoclonal antibody against SAA (mouse antibody) were placed in an incubator at 37°C for 14 days. Using ELISA, the changes in the binding activity of the single-domain antibody SN-02 and the commercial antibody against serum amyloid-beta-associated protein (SAA) were detected, with the frozen and 37°C-stored antibodies used as primary antibodies, respectively. The OD generated was detected using the antibody not stored at 37°C. 450 The value is A control The OD generated by antibodies stored at 37°C for different numbers of days was detected. 450 The value is A Test The corresponding blank control is A. Blank The formula for calculating the amount of antibody activity loss is [(A)]. control -A Blank1 )-(A Test -A Blank2 ) 】 / (A control -A Blank1 )}; the result is as follows Figure 3 As shown, after being placed at 37°C for 3 days, the activity of commercial antibodies decreased by 37%±6.1%, after 7 days it decreased by 60%±8.2%, and after 10 days it was basically inactivated; in contrast, the single-domain antibody SN-02 provided by the present invention did not show a significant decrease in antibody activity after being placed at 37°C for 14 days.
[0027] The above results indicate that the single-domain antibody SN-02 against serum amyloid-acid (SAA) prepared in this invention has good storage stability at 37°C.
[0028] (4) Stability test of serum amyloid-SAA single-domain antibody at 50°C Commercial monoclonal antibodies and the serum amyloid-associated protein (SAA) single-domain antibody prepared in this invention were placed at 50°C for 14 days, and antibody degradation was detected by Coomassie brilliant blue staining; the results are as follows. Figure 4 As shown, the staining of the light and heavy chains of commercial monoclonal antibodies gradually weakens over time; in contrast, the single-domain antibody SN-02 provided by this invention maintains clear bands from day 0 to day 14.
[0029] Simultaneously, ELISA was used to detect the remaining antibody activity after being stored at 50°C for 14 days; the results are as follows. Figure 5 As shown, after being placed at 50°C for 3 days, the activity of commercial mouse antibodies decreased by 56%±11.2%, and after 7 days, the antibodies were basically inactivated. In contrast, the single-domain antibody SN-02 provided by this invention did not have any effect on antibody activity when placed at 50°C for 10 days; after 14 days, the antibody activity only decreased to 87%±6.3%.
[0030] In summary, the single-domain antibody SN-02 against serum amyloid protein SAA provided by this invention still exhibits good stability at 50°C.
[0031] Example 3 This embodiment uses a single-domain antibody against serum amyloid protein (SAA) to prepare a kit for detecting serum amyloid protein, including but not limited to: kits for monitoring systemic inflammatory response syndrome; kits for monitoring the activity of inflammatory diseases (such as kits for assessing the activity of rheumatoid arthritis, kits for monitoring the activity of systemic lupus erythematosus, etc.); kits for predicting surgical and traumatic complications (such as kits for monitoring postoperative infection, kits for early warning of infection in patients with multiple trauma, etc.); kits for the diagnosis and prognosis of sepsis (such as kits for early diagnosis of sepsis, kits for monitoring the treatment process of sepsis, etc.); kits for guiding antibiotic use; kits for monitoring the efficacy of antibiotic treatment; kits for differential diagnosis of secondary infections in cancer patients; kits for differential diagnosis of infections in autoimmune diseases; and kits for detecting respiratory infections, etc.
[0032] Comparative Examples Table 2 provides a basic overview of two commonly used serum amyloid A products on the market.
[0033] Table 2. Basic information on two murine monoclonal antibodies against serum amyloid A.
[0034] As shown in Table 2, existing serum amyloid A antibodies require low-temperature storage. Short-term use requires storage at 2-8℃, while long-term storage requires storage below -20℃ or freeze-drying. The storage conditions are quite demanding, which means that the transportation of serum amyloid A antibodies requires a complete cold chain. The transportation conditions for antibodies are stringent, and the transportation costs are high.
[0035] The serum amyloid A single-domain antibody SN-02 provided by this invention exhibits good stability at both 37°C and 50°C. Therefore, the serum amyloid A single-domain antibody provided by this invention can be stored for a long time at room temperature to higher temperatures, which significantly reduces the difficulty of antibody storage and effectively reduces transportation and storage costs.
[0036] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A single-domain antibody against serum amyloid protein (SAA), characterized in that, The encoding nucleotide sequence of the single-domain antibody is shown in SEQ ID NO:
1.
2. The single-domain antibody against serum amyloid protein (SAA) as described in claim 1, characterized in that, The amino acid sequence of the single-domain antibody is shown in SEQ ID NO:
2.
3. The use of the single-domain antibody against serum amyloid protein (SAA) as described in claim 1 or 2 in the preparation of a kit for detecting serum amyloid protein.
4. A test kit, characterized in that, A single-domain antibody comprising serum amyloid protein SAA as described in claim 1 or 2.
5. The detection kit as described in claim 4, characterized in that, It also includes a coated plate, serum amyloid A standard, HRP-labeled rabbit anti-shark IgNAR antibody, chromogenic substrate, PBST washing buffer, stop solution: 2 mol / L sulfuric acid solution, sealing film, and self-sealing bag.