A probiotic composition for preventing and / or treating vaginal infections and diseases related thereto and uses thereof
Through the optimization of probiotic compositions, the combination of *Lactobacillus curvatureii*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum* has solved the problems of resistance and poor efficacy of existing VVC treatments, achieving effective inhibition of *Candida albicans* and reduction of inflammation.
Patent Information
- Application Number
- CN202411982746.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2026-07-03
Smart Images

Figure CN122326422A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine. Specifically, this invention relates to a probiotic composition for the prevention and / or treatment of vaginal infections and related diseases, and its uses. Background Technology
[0002] With economic development and improved living standards, the incidence of female reproductive tract diseases is increasing, especially vaginitis, which seriously affects women's health and quality of life.
[0003] Among vaginal infections, vulvovaginal candidiasis (VVC) is relatively common. Studies have found that approximately 78% of women will experience one infection in their lifetime, 65% will have three or fewer annual episodes, and 35% will have four or more annual episodes. VVC typically manifests as vulvar itching, burning, painful urination, and cottage cheese-like vaginal discharge, impacting quality of life.
[0004] VVC is typically treated with azole and polyene antifungal drugs, such as metronidazole suppositories. However, long-term use of these drugs has led to phenotypic changes and mutations in virulence factors in Candida albicans, resulting in increased infections with non-white Candida albicans and resistance to traditional treatments. Lactobacillus can be used as adjunctive therapy in combination with azole drugs, but there is currently a lack of evidence to support its effectiveness as a monotherapy for VVC. Summary of the Invention
[0005] To address the above problems, the present invention aims to provide a probiotic composition for the prevention and / or treatment of vaginal infections and related diseases, and its uses. The probiotic composition of the present invention achieves better efficacy in treating vaginal infections, especially VVC, compared to single probiotic strains and positive control drugs such as metronidazole suppositories, clotrimazole suppositories, and diclofenac sodium.
[0006] The above-mentioned objective of the present invention is achieved by providing the following technical solution:
[0007] In a first aspect, the present invention provides a probiotic composition for the prevention and / or treatment of vaginal infections and related diseases, comprising Lactobacillus curvatureii, Lactobacillus janniae, Lactobacillus gasseri, Lactobacillus plantarum, and Lactobacillus fermentum.
[0008] According to some embodiments of the present invention, the active ingredients of the probiotic composition consist of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum*.
[0009] According to some embodiments of the present invention, the ratio of viable counts of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum* in the probiotic composition is (0.01-100):(0.01-100):(0.01-100):1:(0.01-100), preferably (0.1-100):(0.1-100):(0.1-100):1:(0.01-100).
[0010] According to some embodiments of the present invention, the total viable count in the probiotic composition is not less than 2.8 × 10⁻⁶. 6 CFU / g, preferably 2.8 × 10⁻⁶ 7 Up to 8.2×10 10 CFU / g.
[0011] Preferably, the viable count of each single strain in the probiotic composition is not less than 2.0 × 10⁻⁶. 5 CFU / g, preferably 2.0 × 10⁻⁶ 6 Up to 2.0×10 10 CFU / g.
[0012] According to some embodiments of the present invention, the molecular marker gene of *Lactobacillus plantarum* has a nucleotide sequence selected from one of the following:
[0013] (1) The nucleotide sequence shown in SEQ ID NO: 1;
[0014] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 1;
[0015] (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 1.
[0016] Preferably, the molecular marker gene of *Lactobacillus plantarum* has a nucleotide sequence as shown in SEQ ID NO: 1, or its nucleotide sequence is as shown in SEQ ID NO: 1.
[0017] Preferably, the strain preservation number of the *Lactobacillus plantarum* is CGMCC No. 26502.
[0018] According to some embodiments of the present invention, the molecular marker gene of the fermenting *Lactobacillus mucilaginosus* has a nucleotide sequence selected from one of the following:
[0019] (1) The nucleotide sequence shown in SEQ ID NO: 2;
[0020] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 2;
[0021] (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 2.
[0022] Preferably, the molecular marker gene of the fermenting Lactobacillus mucinus has a nucleotide sequence as shown in SEQ ID NO: 2, or its nucleotide sequence is as shown in SEQ ID NO: 2.
[0023] Preferably, the strain preservation number of the fermenting *Lactobacillus mucinus* is CGMCC No. 26501.
[0024] According to some embodiments of the present invention, the molecular marker gene of the *Lactobacillus curvature* has a nucleotide sequence selected from one of the following:
[0025] (1) The nucleotide sequence shown in SEQ ID NO: 3;
[0026] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 3;
[0027] (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 3.
[0028] Preferably, the molecular marker gene of the *Lactobacillus curvature* has a nucleotide sequence as shown in SEQ ID NO: 3, or its nucleotide sequence is as shown in SEQ ID NO: 3.
[0029] Preferably, the strain preservation number of the *Lactobacillus curvatureensis* is CGMCC No. 26503.
[0030] According to some embodiments of the present invention, the molecular marker gene of *Lactobacillus japonicus* has a nucleotide sequence selected from one of the following:
[0031] (1) The nucleotide sequence shown in SEQ ID NO: 4;
[0032] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 4;
[0033] (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 4.
[0034] Preferably, the molecular marker gene of the Lactobacillus janniae has a nucleotide sequence as shown in SEQ ID NO: 4, or its nucleotide sequence is as shown in SEQ ID NO: 4.
[0035] Preferably, the strain preservation number of the Lactobacillus janniae is CGMCC No. 26505.
[0036] According to some embodiments of the present invention, the molecular marker gene of the *Lactobacillus gasseri* has a nucleotide sequence selected from one of the following:
[0037] (1) The nucleotide sequence shown in SEQ ID NO: 5;
[0038] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 5;
[0039] (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 5.
[0040] Preferably, the molecular marker gene of the Lactobacillus gasseri has a nucleotide sequence as shown in SEQ ID NO: 5, or a nucleotide sequence as shown in SEQ ID NO: 5.
[0041] Preferably, the strain preservation number of the Lactobacillus gasseri is CGMCC No. 26504.
[0042] In a second aspect, the present invention provides a microbial preparation for the prevention and / or treatment of vaginal infections and related diseases, comprising the probiotic composition according to the first aspect of the present invention.
[0043] According to some embodiments of the present invention, the active ingredient of the microbial preparation is composed of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum*.
[0044] According to some embodiments of the present invention, the microbial preparation further comprises pharmaceutically acceptable excipients.
[0045] According to some embodiments of the present invention, the microbial preparation is a powder, suppository, tablet, capsule, granule, emulsion, or powder in a capsule.
[0046] Thirdly, the present invention provides a pharmaceutical composition for the prevention and / or treatment of vaginal infections and related diseases, the pharmaceutical composition comprising a probiotic composition according to the first aspect of the present invention or a microbial preparation according to the second aspect of the present invention, as well as other antimicrobial agents.
[0047] Fourthly, the present invention provides the use of the probiotic composition according to the first aspect of the invention or the microbial preparation according to the second aspect of the invention in the preparation of a medicament for the prevention and / or treatment of vaginal infections and related diseases.
[0048] Preferably, the vaginal infection and related diseases are vulvovaginal candidiasis.
[0049] The present invention has at least the following beneficial effects:
[0050] The probiotic composition provided by this invention has achieved better results in treating vaginal infections, especially VVC, compared to single probiotic strains and positive control drugs such as metronidazole suppositories, clotrimazole suppositories, and tinidazole suppositories.
[0051] The present invention has demonstrated through clinical strain validation experiments that the probiotic composition of the present invention has a strong inhibitory effect on different clinical strains of Candida albicans.
[0052] This invention demonstrates through in vivo experiments on mice that the probiotic composition of this invention is more effective than clotrimazole suppositories in reducing TNF-α in infected mouse vaginal tissue, and its inhibition rate against Candida albicans in infected mouse vaginal tissue can reach a level comparable to clotrimazole suppositories at certain doses. Attached Figure Description
[0053] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0054] Figure 1 This shows the CA (Candida albicans ATCC 10231) load in the vaginal irrigation fluid of VVC model mice in the animal efficacy experiment of single bacteria and composition in Example 1; among which, compared with the NC group, #### P < 0.0001; compared with group M, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
[0055] Figure 2 This shows the CA load in the vaginal irrigation fluid of VVC model mice during the composition ratio screening experiment of Example 1; among them, compared with the NC group, ### P < 0.001; compared with group M, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
[0056] Figure 3 This shows the CA load in the vaginal irrigation fluid of VVC model mice during the composition ratio optimization experiment of Example 1; among them, compared with the NC group, #### P < 0.0001; compared with group M, ****P < 0.0001.
[0057] Figure 4 This study demonstrates the effects of different drug administration groups on inflammatory factors in the vaginal tissue of VVC model mice; among them, the blank control group was compared with the model group. # P < 0.05 ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0058] Figure 5 This study showed the effect of different drug administration groups on the Candida albicans bacterial load in VVC model mice; among them, the difference between the blank control group and the model group was statistically significant (P < 0.05). ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0059] Figure 6 The effects of different drug administration groups on the pathological scores of mouse vaginal tissue were shown; among them, the difference between the blank control group and the model group was #P<0.05. ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0060] Figure 7 Representative pathological images (200X) of vaginal tissue from each group of mice are shown. Detailed Implementation
[0061] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.
[0062] The *Lactobacillus curvatureii* HY1467 (CGMCC No. 26503), *Lactobacillus janniae* HY1335 (CGMCC No. 26505), *Lactobacillus gasseri* HY1124 (CGMCC No. 26504), *Lactobacillus plantarum* HY2946 (CGMCC No. 26502), *Lactobacillus fermentum* HY757 (CGMCC No. 26501), and *Canidia albicans* ATCC 10231 (CA) used in the following examples can all be purchased.
[0063] Upon identification, the nucleotide sequence shown in SEQ ID NO: 1 was confirmed as a specific nucleotide sequence marker for *Lactobacillus plantarum* HY2946. After multiple sequencing and alignment tests, the homology range between the molecular marker nucleotide sequence of *Lactobacillus plantarum* HY2946 and the nucleotide sequence shown in SEQ ID NO: 1 was determined. Specifically, the molecular marker nucleotide sequence of *Lactobacillus plantarum* HY2946 exhibits at least 97%, 98%, 99%, or higher homology with the nucleotide sequence shown in SEQ ID NO: 1 (for sequencing and identification methods, please refer to the examples in the applicant's previous patent application 202410369860.6).
[0064] (SEQ ID NO: 1).
[0065] The nucleotide sequence shown in SEQ ID NO: 2 was identified as a specific nucleotide sequence marker for *Lactobacillus fermentum* HY757. Multiple sequencing and alignment tests determined the homology range between the nucleotide sequence of the molecular marker for *Lactobacillus fermentum* HY757 and the nucleotide sequence shown in SEQ ID NO: 2. Specifically, the nucleotide sequence of the molecular marker for *Lactobacillus fermentum* HY757 exhibits at least 97%, 98%, 99%, or higher homology with the nucleotide sequence shown in SEQ ID NO: 2 (for sequencing and identification methods, please refer to the examples in the applicant's previous patent application 202410088916.0).
[0066] CAAGAAAGGCCAGCGGATTGTATGGAACCCGACCATTAAGAGCGGGAAGAATCAGATTCCTATTAAGAAAGTCGCGATTAACAATGGGGTTAACATCACGCCAAAGAAGTCTCTTACATCCACAACTGGCAA AATAACATTACCGATGCTAGGATACAAGAGCCTCAACTACCAGGTAAGGGTAAATGGCAAAAATGTCTCGTACACAATCAATGGTTTGTACCTTGCTATCCATCAACATCATCTCAGTCGTTCGGACGT (SEQ ID NO: 2).
[0067] The nucleotide sequence shown in SEQ ID NO: 3 was identified as a specific nucleotide sequence marker for *Lactobacillus curvature* HY1467. Multiple sequencing and alignment tests determined the homology range between the molecular marker of *Lactobacillus curvature* HY1467 and the nucleotide sequence shown in SEQ ID NO: 3. Specifically, the nucleotide sequence of the molecular marker of *Lactobacillus curvature* HY1467 has at least 97%, 98%, 99%, or higher homology with the nucleotide sequence shown in SEQ ID NO: 3 (for sequencing and identification methods, please refer to the examples in the applicant's previous patent application 202410069354.5).
[0068] (SEQ ID NO: 3)
[0069] Upon identification, the nucleotide sequence shown in SEQ ID NO: 4 was confirmed to be a specific nucleotide sequence marker for *Lactobacillus japonicus* HY1335. Multiple sequencing and alignment tests determined the homology range between the molecular marker of *Lactobacillus japonicus* HY1335 and the nucleotide sequence shown in SEQ ID NO: 4. Specifically, the nucleotide sequence of the molecular marker of *Lactobacillus japonicus* HY1335 exhibits at least 97%, 98%, 99%, or higher homology with the nucleotide sequence shown in SEQ ID NO: 4 (for sequencing and identification methods, please refer to the examples in the applicant's previous patent application 202410071896.6).
[0070] GGATCGGGTAATGGCACCAATATAATAAATGATAAAGTTAAAATTCCAACCGGTGCTTTTCAGTCTAAACAATGCAAACTGAAAATTGCAAAGTAAATAATCAGATGTTGGATAAAACTGAAGTAACAAATTCTACTAAAAATTCTTCTACACTAAATGTGGAAAATTCCAAGACTGCTGAT TTGTCGAGATTTGATTACTCTTTATATACAAAAAAAGTAAAGAGTTTTGAATTTAGAAATTCAGATAATAACGATGTAATTAGAACAGTAATATTAAACAAACCTACCGGTGTTGAAACTGTAACTATGACTTTGAATGTTAGCTGCTTAAAAGGGAGAAAGCATCAGCATCAATCGCAC (SEQ IDNO: 4)
[0071] Upon identification, the nucleotide sequence shown in SEQ ID NO: 5 was confirmed to be a specific nucleotide sequence marker for Lactobacillus gasseri HY1124. Multiple sequencing and alignment tests determined the homology range between the molecular marker of Lactobacillus gasseri HY1124 and the nucleotide sequence shown in SEQ ID NO: 5. Specifically, the nucleotide sequence of the molecular marker of Lactobacillus gasseri HY1124 exhibits at least 97%, 98%, 99%, or higher homology with the nucleotide sequence shown in SEQ ID NO: 5 (for sequencing and identification methods, please refer to the examples in the applicant's previous patent application 202410073451.1).
[0072] (SEQ ID NO: 5)
[0073] In addition, the positive control drugs, metronidazole suppositories and clotrimazole suppositories, used in the following examples both contain the antibacterial active ingredient clotrimazole.
[0074] Example 1: VVC Efficacy Verification Experiment
[0075] 1. Animal efficacy experiments of single bacteria and combinations
[0076] 1.1 Experimental Methods
[0077] 1.1.1 Laboratory animals
[0078] Healthy SPF-grade Balb / c mice, female, 6-8 weeks old, were used.
[0079] 1.1.2 Experimental Grouping
[0080] After adaptive culture, animals were randomly divided into four main groups: blank control group (NC), model group (M), positive control group (double 5mg, double 30mg, and DJS), and experimental group. The double 5mg group served as a positive control using 5mg metronidazole suppositories; the double 30mg group served as a positive control using 30mg metronidazole suppositories; and the DJS group (Dingjunsheng, Inner Mongolia Shuangqi Pharmaceutical Co., Ltd.) served as a positive control. The experimental group was further divided into single-strain treatment groups using different probiotics (1467, 1335, 1124, 2946, 757) and a pentabiotic combination treatment group (T1). Among them, 1467 was treated with Lactobacillus curvaturei HY1467 as a single strain; 1335 was treated with Lactobacillus janniae HY1335 as a single strain; 1124 was treated with Lactobacillus gasseri HY1124 as a single strain; 2946 was treated with Lactobacillus plantarum HY2946 as a single strain; 757 was treated with Lactobacillus fermentum HY757 as a single strain; T1 was treated with a pentabiotic combination, namely A+B+C+D+E (A, B, C, D, E represent Lactobacillus curvaturei HY1467, Lactobacillus janniae HY1335, Lactobacillus gasseri HY1124, Lactobacillus plantarum HY2946, and Lactobacillus fermentum HY757, respectively).
[0081] 1.1.3 Animal Experiments
[0082] Except for the blank control group mice, the other groups of mice (model group, positive control group, experimental group animals) were treated as follows: from D-3 (i.e. 3 days before modeling) to D-1, estradiol benzoate injection was injected subcutaneously every day, and the vagina was pretreated with cefuroxime sodium + levofloxacin hydrochloride antibiotic solution. From D0 to D2, CA (15µL / mouse) was continuously administered to induce modeling. From day 3 to day 7 after modeling, the model group (M) received no drug treatment; the double 5mg and double 30mg groups were treated with 5mg / animal and 30mg / animal metronidazole suppositories, respectively. The DJS group (Lactobacillus delbrueckii (Dingjunsheng)), the experimental groups 1467, 1335, 1124, 2946, 757, and the T1 group (where the live bacteria count ratio of 1467: 1335: 1124: 2946: 757 was 1: 1: 1: 1: 1) were treated with 5×10 7CFU / animal, administered continuously for 5 days. On days 2 and 5, animals in the model group, positive control group, and experimental group were subcutaneously injected with estradiol benzoate injection once each. On day 8, the vagina was irrigated, and the diluted irrigating solution was spread on Candida albicans identification medium (chromogenic medium). After incubation at 37°C for 48 hours, the number of green colonies on the culture dishes was observed and counted. One-way ANOVA was performed using GraphPadPrism 5 software, with P < 0.05 considered statistically significant.
[0083] 1.2 Experimental Results
[0084] Experimental results are as follows Figure 1 As shown, the treatment effects of the five single bacteria on VVC model mice varied. Group 1335 did not show a significant difference in the reduction of pathogenic bacteria load in the model mice, groups 1124 and 2946 only showed a significant reduction in Candida albicans (P < 0.05), and group 1467 showed a highly significant reduction (P < 0.01). The pentabiotic T1 group showed a significantly better reduction in Candida albicans content in vaginal irrigation fluid after treatment (P < 0.0001) than the five single bacteria groups. Moreover, the pentabiotic group was more effective than the probiotic positive drug DJS group, the bactericidal positive drug 5mg metronidazole suppository, and 30mg metronidazole suppository in reducing the content of pathogenic bacteria.
[0085] 2. Composition ratio screening
[0086] 2.1 Experimental Methods
[0087] 2.1.1 Laboratory animals
[0088] The selection of laboratory animals is the same as in 1.1.1.
[0089] 2.1.2 Experimental Grouping
[0090] The treatment of the blank control group (NC) and the model group (M) was the same as in 1.1.3. The composition of the pentabiotics and the dosage of the drugs in the experimental group are shown in the table below.
[0091] Table 1. Composition of the five-strain bacteria and dosage in different experimental groups
[0092]
[0093] Note: A, B, C, D, and E represent *Lactobacillus curvatureii* HY1467, *Lactobacillus japonicus* HY1335, *Lactobacillus gasseri* HY1124, *Lactobacillus plantarum* HY2946, and *Lactobacillus fermentum* HY757, respectively. 6, 7, and 8 represent viable bacterial counts of 1.0 × 10⁻⁶. 6 CFU / each, 1.0×10 7 CFU / each, 1.0×10 8CFU / each.
[0094] 2.1.3 Animal Experiments
[0095] The modeling and administration methods were the same as in 1.1.3. Different pentavalent bacterial combinations were administered for 5 consecutive days during the treatment. One-way ANOVA was performed using GraphPad Prism 5 software, with P < 0.05 considered statistically significant.
[0096] 2.2 Experimental Results
[0097] Depend on Figure 2 The experimental results show that different pentavalent bacterial combinations can reduce the pathogenic CA in animals, that is, they have the effect of treating VVC. Among them, P1 and P4 groups reached a significant level (P<0.05), P6 group reached a highly significant level (P<0.01), and T1, P3, P5, P7 and P2 groups reached a higher significant level (T1, P3, P5 and P7 groups P<0.001, P2 group P<0.0001). Among them, the pentavalent bacterial combination in P2 group has the best therapeutic effect on VVC.
[0098] 3. Composition ratio optimization
[0099] 3.1 Experimental Methods
[0100] 3.1.1 Laboratory animals
[0101] The selection of laboratory animals is the same as in 1.1.1.
[0102] 3.1.2 Experimental Grouping
[0103] The concentrations of Lactobacillus curvaturei HY1467, Lactobacillus janniae HY1335, and Lactobacillus gasseri HY1124 in the pentabiotic formulation were adjusted to further determine the composition of the pentabiotic.
[0104] The treatment of the blank control group (NC) and the model group (M) was the same as in 2.1.3. The composition of the pentabiotics and the dosage of the drugs in the experimental group are shown in the table below.
[0105] Table 2. Composition of the five-strain bacteria and dosage in different experimental groups
[0106]
[0107] Note: A, B, C, D, and E represent *Lactobacillus curvatureii* HY1467, *Lactobacillus japonicus* HY1335, *Lactobacillus gasseri* HY1124, *Lactobacillus plantarum* HY2946, and *Lactobacillus fermentum* HY757, respectively. 6, 7, and 8 represent the number of viable bacteria administered (1.0 × 10⁻⁶). 6 CFU / each, 1.0×10 7 CFU / each, 1.0×108 CFU / each.
[0108] 3.1.3 Animal Experiments
[0109] The modeling and administration methods were the same as in 1.1.3. Different pentavalent bacterial combinations were administered for 5 consecutive days during the treatment. One-way ANOVA was performed using GraphPad Prism 5 software, with P < 0.05 considered statistically significant.
[0110] 3.2 Experimental Results
[0111] Depend on Figure 3 The experimental results show that the five-strain combination in Table 2 has a statistically significant therapeutic effect on VVC mouse model compared with the model group (P < 0.0001).
[0112] The data above show that the five-strain combination in Table 2 has achieved good therapeutic effects in the treatment of VVC.
[0113] Combination Figure 2 and Figure 3 It can be seen that when the ratio of viable counts of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum* is (0.1-100):(0.1-100):(0.1-100):1:(0.01-100), different combinations of the five strains all have a significant effect on reducing the pathogenic bacteria CA in animals.
[0114] 4. Clinical strain validation experiment
[0115] 4.1 In vitro experiments
[0116] 4.1.1 Experimental Methods
[0117] Forty clinical strains of *Candida albicans* collected over the past 2-3 years (provided by the Pharmacological Evaluation Research Center of Shanghai Pharmaceutical Industry Research Institute Co., Ltd.) were used. Corresponding standard strains were selected as quality control strains, and the minimum inhibitory concentration (MIC) was determined using the micro-broth dilution method (ELISA plate). The test strains HY1467, HY1335, HY1124, HY2946, and HY757 were prepared into suspensions with a concentration equivalent to a 0.5 McFarland turbidity standard using the direct suspension method. The suspensions were mixed in a viable cell ratio of 10:10:10:1:10 and centrifuged. The supernatant was discarded, and the suspensions were resuspended in 1 mL of MRS medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) to prepare the test strains at a concentration of 1.0 × 10⁻⁶. 9CFU / mL was diluted with MRS medium to different concentrations for later use. After mixing with Candida albicans, the 96-well plate was co-cultured in an anaerobic environment at 37°C for 24 h. Then, the bacterial suspension was diluted 1000 times with PBS buffer, mixed well, and 10 μL was spread on Candida albicans chromogenic solid medium and incubated at 37°C for 24 h. After 24 h, the number of Candida albicans was counted, with Candida albicans cultured alone serving as a control.
[0118] 4.1.2 Experimental Results
[0119] Different concentrations of the five-strain test sample were co-treated with *Candida albicans* for 24 hours. The growth of *Candida albicans* was then detected by plate testing. The growth inhibition rate of the test sample against *Candida albicans* was calculated, and the drug concentration range that inhibited 90% bacterial growth was used as the MIC value of the test sample against *Candida albicans* (see table below). The MIC values (total concentration of the five strains, hereinafter the same) of the test sample against different clinical strains of *Candida albicans* were <10. 3 CFU / mL-10 8 CFU / mL.
[0120] Table 3. MIC values of the test samples against different Candida albicans species.
[0121]
[0122]
[0123] Based on the distribution of MIC values of 40 Candida albicans strains, the total viable cell concentration of the test sample was within 10... 5 At CFU / mL, more than 80% of Candida albicans strains were inhibited (see table below), indicating that the pentavalent strain has a strong inhibitory effect on different clinical strains of Candida albicans.
[0124] Table 4. MIC50 and MIC90 values of the test sample against Candida albicans.
[0125]
[0126] 4.2 In vivo experiments
[0127] 4.2.1 Experimental Methods
[0128] Model establishment: Balb / c mice were randomly divided into 6 groups, including a blank control group, a model group, low-, medium-, and high-dose pentavalent bacteria groups, and a positive control group (clotrimazole suppositories). Except for the model group, each group contained 13 mice, and the model group contained 16 mice. Six days before infection with *Candida albicans* (Day-6), all mice except the blank control group received subcutaneous injections of estradiol benzoate (2.5 mg / kg) once daily for 5 days. From Day-3 to Day+3, mice received intraperitoneal injections of dexamethasone sodium phosphate once daily for 7 days to lower the body's immune level and make the animals more susceptible to *Candida albicans*. Subsequently, on Day 0 and Day+1, mice underwent vaginal infection twice consecutively (one strain of *Candida albicans*, strain 0307009, with strong resistance to antifungal drugs, was selected from the above 40 strains for animal modeling).
[0129] Administration: Ten animals were selected from each of the following groups: blank control group, model group, low-, medium-, and high-dose pentavalent bacteria groups, and positive control group. After vaginal infection, administration began on Day 3. The low-, medium-, and high-dose pentavalent bacteria groups received different doses of the test sample, once daily, 20 μL each time, for 5 consecutive days. The positive control group received clotrimazole suppositories, once daily, for 5 consecutive days.
[0130] Dosage: The pentavalent bacteria dosage groups (HY1467: HY1335: HY1124: HY2946: HY757) were all composed in a ratio of 10: 10:10: 1:10, with 10 8 CFU was concentrated in 20 μL of physiological saline to determine the high-dose group's viable bacterial count. The high-dose group was diluted 100 times to determine the medium-dose group, and the medium-dose group was diluted 100 times to determine the low-dose group. The administration volume for each group was 20 μL per mouse. Positive control group: One clotrimazole suppository was placed in a plastic tube and dissolved in a water bath at 50°C. The melted solution was then injected into a 2 mm inner diameter tubing approximately 0.60 meters long. After the solution cooled and solidified, the tubing was divided into 1 cm units for each dose. Based on the conversion between human and mouse body surface area, a 0.1 cm length per mouse clotrimazole suppository was administered.
[0131] Indicator detection (1) -- Inflammatory factor detection: On Day 8, the experimental endpoint, a portion of vaginal tissue was homogenized from mice, with 10 mice in each group, and the content of TNF-α was detected.
[0132] Index detection (2) -- Bacterial load of vaginal irrigation fluid: 24 hours after the last administration, 50 μL of sterile PBS was injected into the vagina of 10 mice in each group. After gently blowing and 3 times, the PBS irrigation fluid (about 30 μL) was aspirated. The irrigation fluid was then diluted with sterile PBS and spread on the Candida albicans identification medium (chromogenic medium). After incubation at 37°C overnight, the number of colonies on the culture dish was observed and counted.
[0133] Inhibition rate (%) = (1 - average vaginal colony count in the treatment group (10)) 4 CFU / mL) / Average vaginal colony count in the model group (10) 4 CFU / mL) × 100%
[0134] Indicator detection (3) -- Vaginal pathological tissue: 24 hours after the last administration, vaginal tissue was taken from 10 mice in each group after rinsing their vaginas. The tissue was fixed with 4% formaldehyde, embedded in paraffin, sectioned, stained with HE, and then pathologically observed.
[0135] Analysis of variance was performed on the data for each group.
[0136] 4.2.2 Experimental Results
[0137] 4.2.2.1 Indicator Detection (1) -- Inflammatory Factors
[0138] The changes in inflammatory factors in mouse vaginal tissue homogenate at the experimental endpoint are shown in the table below. Figure 4 As shown.
[0139] Table 5. Effects of different drug administrations on inflammatory factors in vaginal tissue of VVC model mice.
[0140]
[0141] Note: ±SEM, n=10, comparison between blank control group and model group, #P<0.05, ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0142] TNF-α detection data showed that, compared with the blank control group, TNF-α in the vaginal tissue of mice in the model group was significantly increased (P<0.001); compared with the model group, TNF-α in the vaginal tissue of mice in each dose group of the pentabiotic was reduced, and the difference was statistically significant (P<0.001). There was a certain dose-response relationship among low, medium and high doses. The effect of each dose of pentabiotic on reducing TNF-α was better than that of the positive drug clotrimazole suppository group.
[0143] 4.2.2.2 Index detection (2) --- Bacterial load in vaginal irrigation fluid
[0144] Twenty-four hours after the last administration, mice in each group were dissected, and vaginal irrigation fluid was diluted 1:100 and plated onto Candida albicans staining plates. The experimental results are shown in the table below. Figure 5 As shown.
[0145] Table 6. Effects of different drug administration groups on the Candida albicans bacterial load in VVC model mice.
[0146]
[0147] Note: ±SEM, n=10, comparison between blank control group and model group, #P<0.05, ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0148] The experimental results showed that the bacterial count in the vaginal lavage fluid of the model group mice was significantly higher than that of the blank control group (P < 0.001). The bacterial count in the vaginal lavage fluid of mice in each dose group of the pentabiotic was significantly reduced compared with that of the model group (P < 0.001), and there was a certain dose-response relationship. Among them, the inhibition rate of the high dose group reached 92.07%, and the antibacterial effect was comparable to that of the clotrimazole suppository group.
[0149] 4.2.2.3 Indicator Detection (3) -- Vaginal Pathological Tissue
[0150] The pathological scores of vaginal tissue sections from each group of animals are shown in the table below. Figure 6 As shown.
[0151] Table 7. Effects of different drug administrations on the pathological scores of mouse vaginal tissue.
[0152]
[0153] Note: ±SEM, n=10, comparison between blank control group and model group, #P<0.05, ## P < 0.01, ### P < 0.001; *P < 0.05, **P < 0.01, ***P < 0.001 between each treatment group and the model group.
[0154] The experimental results showed that, compared with the blank control group, the vaginal histopathological score of the model group was significantly increased (P<0.001); the pathological scores of all treatment groups were reduced, among which the medium and high dose groups of the pentabiotic and the clotrimazole suppository group were significantly reduced compared with the model group (P<0.05).
[0155] Representative pathological images of vaginal tissue from each group of mice are shown below. Figure 7 As shown.
[0156] Blank control group: The vaginal mucosal epithelium was thick, with no obvious necrosis or inflammatory cell infiltration; the connective tissue of the lamina propria was regularly arranged, with no obvious edema or inflammatory cell infiltration.
[0157] Model group: The vaginal mucosal epithelium was thick, with a large number of granulocytes scattered on the surface of the mucosal epithelium. A small number of epithelial cells were necrotic, with condensed, deeply stained, fragmented, or dissolved nuclei. The lamina propria was moderately edematous, the connective tissue was loosely arranged, the capillaries were dilated, and there was a large number of granulocytes infiltrating.
[0158] Low-dose group of pentabiotics: The vaginal mucosal epithelium is thick, with a large number of granulocytes scattered on the surface of the mucosal epithelium. A small number of epithelial cells are necrotic, with condensed, deeply stained, fragmented, or dissolved nuclei. The lamina propria is severely edematous, the connective tissue is loosely arranged, capillaries are dilated, and there is a large number of granulocyte infiltrations.
[0159] In the medium-dose group of the five-strain bacteria: the vaginal mucosal epithelium was thick, and a large number of granulocytes were scattered on the surface of the mucosal epithelium; the lamina propria was slightly edematous, the connective tissue was loosely arranged, the capillaries were dilated, and a small number of granulocytes were infiltrated.
[0160] High-dose group of pentabiotics: The vaginal mucosal epithelium was thick, and a small number of granulocytes were scattered on the surface of the mucosal epithelium; the lamina propria was slightly edematous, the connective tissue was loosely arranged, the capillaries were dilated, and a small number of granulocytes were infiltrated.
[0161] Clotrimazole suppository group: The vaginal mucosal epithelium is thick, and a small number of granulocytes are scattered on the surface of the mucosal epithelium; the lamina propria is severely edematous, the connective tissue is loosely arranged, the capillaries are dilated, and there is a lot of granulocyte infiltration.
[0162] This demonstrates that the pentavalent bacteria exhibit therapeutic potential for VVC and shows a certain dose-response relationship.
[0163] 5. Antibacterial experiment of co-culturing five strains of bacteria
[0164] 5.1 Experimental Methods
[0165] (1) Preparation of working bacterial suspension: The five-component bacterial composition mixed in equal proportions was centrifuged at 5000 rpm for 10 min at 4℃. After discarding the supernatant, 500 μL of fresh BHIS medium (purchased from Oxoid) was added to each tube for resuspending, so that the final concentration of the five-component bacterial composition reached 1×10⁻⁶. 9 CFU / mL.
[0166] (2) Co-culture of pathogenic bacteria and lactobacillus: Using blank BHIS medium as a negative control, take CA glycerol tubes and inoculate 380 μL of CA into a conical flask containing 38 mL of BHIS medium at a 1% inoculation ratio as a positive control. Place 380 μL of CA and 380 μL of pentabiotic bacterial solution into a conical flask containing 38 mL of BHIS medium at a 1% inoculation ratio, gently shake the bacterial solution, and incubate at 37℃ in an anaerobic workstation.
[0167] (3) Viable count of CA co-culture with pentavalent bacteria: Viable count of CA at 0 h was performed using the plate count method. At 5 h and 20 h of culture, the positive control and co-culture bacterial solutions were gently mixed and viable count of CA was performed using Candida chromogenic medium (Chromagar, France).
[0168] One strain from each of the five bacterial species was randomly selected to form a pentad composition for co-culture antibacterial experiments. The strain information is shown in Table 8.
[0169] Table 8. Strain Information
[0170]
[0171]
[0172] Note: The strains in the table above were obtained by the inventors from samples collected from examples of prior patent applications (application numbers: 202410088916.0, 202410369860.6, 202410069354.5, 202410071896.6, and 202410073451.1).
[0173] 1.2 Experimental Results
[0174] High-throughput screening experiments revealed that any five-strain combination exhibited good inhibitory effects against CA, with an inhibition rate exceeding 90%.
[0175] The above descriptions are merely several exemplary embodiments of the present invention and are not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any equivalent or related embodiments obtained by those skilled in the art through some modifications or variations made to the above-disclosed technical content without departing from the scope of the present invention are within the scope of the present invention.
Claims
1. A probiotic composition for the prevention and / or treatment of vaginal infections and related diseases, comprising Lactobacillus curvatureii, Lactobacillus janniae, Lactobacillus gasseri, Lactobacillus plantarum, and Lactobacillus fermentum.
2. The probiotic composition according to claim 1, wherein, The active ingredients of the probiotic composition consist of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum*.
3. The probiotic composition according to claim 1 or 2, wherein, The ratio of viable counts of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum* in the probiotic composition is (0.01-100):(0.01-100):(0.01-100):1:(0.01-100), preferably (0.1-100):(0.1-100):(0.1-100):1:(0.01-100).
4. The probiotic composition according to any one of claims 1 to 3, wherein, The total number of viable bacteria in the probiotic composition is not less than 2.8 x 10 6 CFU / g, preferably 2.8 x 10 7 to 8.2 x 10 10 CFU / g; Preferably, the viable count of each single strain in the probiotic composition is not less than 2.0 × 10⁻⁶. 5 CFU / g, preferably 2.0 × 10⁻⁶ 6 Up to 2.0×10 10 CFU / g.
5. The probiotic composition according to any one of claims 1 to 4, wherein, The molecular marker gene of *Lactobacillus plantarum* has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 1; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 1; (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 1; More preferably, the molecular marker gene of *Lactobacillus plantarum* has a nucleotide sequence as shown in SEQ ID NO: 1, or its nucleotide sequence is as shown in SEQ ID NO: 1; More preferably, the strain preservation number of the *Lactobacillus plantarum* is CGMCC No. 26502; Preferably, the molecular marker gene of the fermenting *Lactobacillus mucinus* has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 2; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 2; (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 2; More preferably, the molecular marker gene sequence of the fermenting *Lactobacillus mucinus* has a nucleotide sequence as shown in SEQ ID NO: 2, or its nucleotide sequence is as shown in SEQ ID NO: 2; More preferably, the strain preservation number of the fermenting *Lactobacillus mucinus* is CGMCC No. 26501; Preferably, the molecular marker gene of the *Lactobacillus curvature* has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 3; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 3; (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 3; More preferably, the molecular marker gene sequence of the *Lactobacillus curvature* has a nucleotide sequence as shown in SEQ ID NO: 3, or its nucleotide sequence is as shown in SEQ ID NO: 3; More preferably, the strain preservation number of the *Lactobacillus curvatureensis* is CGMCC No. 26503; Preferably, the molecular marker gene of the *Lactobacillus japonicus* has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO:4; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 4; (3) A nucleotide sequence obtained by substituting, deleting or inserting one or more nucleotides, such as 1, 2, 3, 4, 5 or more nucleotides, in the nucleotide sequence shown in SEQ ID NO: 4; More preferably, the molecular marker gene sequence of the *Lactobacillus janniae* has a nucleotide sequence as shown in SEQ ID NO: 4, or its nucleotide sequence is as shown in SEQ ID NO: 4; More preferably, the strain preservation number of the *Lactobacillus japonicus* is CGMCC No. 26505; Preferably, the molecular marker gene of the *Lactobacillus gasseri* has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO:5; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology to the nucleotide sequence shown in SEQ ID NO: 5; (3) The nucleotide sequence shown in SEQ ID NO: 5 has one or more, for example, 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions; More preferably, the molecular marker gene sequence of the Lactobacillus gasseri has a nucleotide sequence as shown in SEQ ID NO: 5, or a nucleotide sequence as shown in SEQ ID NO: 5; More preferably, the strain preservation number of the Lactobacillus gasseri is CGMCC No. 26504.
6. A microbial preparation for the prevention and / or treatment of vaginal infections and related diseases, comprising a probiotic composition according to any one of claims 1 to 5.
7. The microbial preparation according to claim 6, wherein, The active ingredients of the microbial preparation consist of *Lactobacillus curvaturei*, *Lactobacillus janniae*, *Lactobacillus gasseri*, *Lactobacillus plantarum*, and *Lactobacillus fermentum*.
8. The microbial preparation according to claim 6 or 7, wherein, The microbial preparation also contains pharmaceutically acceptable excipients; Preferably, the microbial preparation is a powder, suppository, tablet, capsule, granule, emulsion, or powder inside a capsule.
9. A pharmaceutical composition for the prevention and / or treatment of vaginal infections and related diseases, said pharmaceutical composition comprising a probiotic composition according to any one of claims 1 to 5 or a microbial preparation according to any one of claims 6 to 8, and other antimicrobial agents.
10. Use of the probiotic composition according to any one of claims 1 to 5 or the microbial preparation according to any one of claims 6 to 8 in the preparation of a medicament for the prevention and / or treatment of vaginal infections and related diseases; Preferably, the vaginal infection and related diseases are vulvovaginal candidiasis.
Citation Information
Patent Citations
Lactobacillus crispatus and use thereof
CN120330074A
Lactobacillus jensenii and application thereof
CN120330075A
Lactobacillus gasseri and application thereof
CN120330076A
Lactobacillus mucilaginosus and application thereof
CN120349909A
Plant lactobacillus and application thereof
CN120719040A