A chicken infectious bursal disease virus, egg yolk antibody and preparation method thereof

By isolating a novel chicken infectious bursal virus RD250723A-IBD strain and optimizing the preparation process, the problems of insufficient immunogenicity and high biosafety risk in existing technologies have been solved. This has enabled the preparation and improved stability of high-titer egg yolk antibodies, which have good preventive and therapeutic effects.

CN122326546APending Publication Date: 2026-07-03QINGDAO RUNDA BIOTECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-30
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing IBDV strains have insufficient immunogenicity, high biosafety risks and significant loss of antibody activity during egg yolk antibody preparation, and poor protective efficacy of existing vaccines due to incomplete sterilization during preparation and severe loss of antibody activity during purification.

Method used

A novel isolated infectious bursal virus strain, RD250723A-IBD, was provided. It was purified by continuous passage in SPF chicken embryos, and the immunized eggs were treated with quaternary ammonium salts and aldehyde disinfectants. The sedimentation treatment was carried out using polymeric flocculants and protein stabilizers, and the immunization program and purification process were optimized.

Benefits of technology

It significantly improved the titer and purity of egg yolk antibodies, reduced biosafety risks, and preserved antibody activity to the maximum extent. The egg yolk antibody titer reached 1:256, demonstrating good preventive and therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122326546A_ABST
    Figure CN122326546A_ABST
Patent Text Reader

Abstract

The present application relates to the field of microbiological technology, and particularly relates to a chicken infectious bursal disease virus, egg yolk antibody and a preparation method thereof. The chicken infectious bursal disease virus has a preservation number of CGMCC No. 46653. The strain is an independent new strain through VP2 gene sequencing and genetic evolution analysis. The present application also provides a method for preparing the egg yolk antibody by using the strain: immunizing hens by using an increasing dose immunization procedure to obtain immune hen eggs; disinfecting the immune hen eggs and separating egg yolk; extracting, settling and purifying the egg yolk to obtain the egg yolk antibody. In the method, a double disinfection system combining quaternary ammonium salt disinfectant and aldehyde disinfectant is used for disinfection; and a settling agent containing a high molecular flocculating agent and a protein stabilizer is added in the settling process. The titer of the egg yolk antibody prepared by the method can reach 1:256 or above, and the egg yolk antibody has good prevention and treatment effects on the chicken infectious bursal disease virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a chicken infectious bursal virus, egg yolk antibody, and a method for preparing the same. Background Technology

[0002] Infectious bursal disease in chickens (Infectious Bursal Disease, IBD) Infectious bursal disease (IBDV) is an acute, highly contagious infectious disease that primarily affects the bursa of Fabricius in chicks and young chickens, leading to severe immunosuppression and increased susceptibility to other pathogens. IBDV belongs to the family DiRNAviridae, and its genome consists of two segments, A and B. The VP2 protein is the virus's main protective antigen and a primary target for neutralizing antibodies. Because the IBDV genome is segmented RNA, it is prone to mutation and recombination, resulting in the continuous emergence of new variants and highly virulent strains. This reduces the protective efficacy of existing vaccines, causing significant economic losses to the poultry industry.

[0003] Yolk antibodies (Immunoglobulin of Yolk, IgY) Egg yolk antibodies are immunoglobulins formed in poultry through the transfer of serum antibodies into the yolk. They offer advantages such as high yield, low cost, and no species cross-reactivity. By immunizing laying hens with specific pathogens, large quantities of specific egg yolk antibodies can be extracted from their eggs for passive immunization and treatment of corresponding diseases. However, the titer and protective efficacy of egg yolk antibodies are highly dependent on the immunogenicity of the antigen used for immunization. Therefore, isolating and screening prevalent strains with good immunogenicity is crucial for the preparation of highly efficient and specific egg yolk antibodies.

[0004] In the existing technology, although there are reports on various IBDV strains and methods for preparing egg yolk antibodies, the following shortcomings still exist: (1) Existing strains do not provide good protection against currently prevalent variants; (2) During the preparation of egg yolk antibodies, the disinfection of the immunized eggs is not thorough, which poses a biosafety hazard; (3) The activity loss during antibody purification is significant, affecting the final titer.

[0005] Therefore, it is necessary to provide a strain of infectious bursal virus in chickens with good immunogenicity, and on this basis, to establish a corresponding method for preparing egg yolk antibodies in order to improve antibody titer, purity and stability, thereby meeting the needs of actual production applications.

[0006] The information disclosed in this background section is only intended to enhance the understanding of the background technology of this application and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] To address the problems of insufficient immunogenicity of IBDV strains, high biosafety risks in egg yolk antibody preparation processes, and significant loss of antibody activity in existing technologies, this invention provides a newly isolated chicken infectious bursal virus strain with good immunogenicity, and a method for preparing high-titer egg yolk antibodies using this virus strain.

[0008] The technical solution of this invention is as follows: In a first aspect, the present invention provides a chicken infectious bursal disease virus, named chicken infectious bursal disease virus. (Infectious bursal disease virus) RD250723A-IBD was deposited on October 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 46653.

[0009] Preferably, the method for isolating the virus includes: aseptically collecting bursal tissue from infected chickens with infectious bursal virus, adding it to sterile PBS solution at a ratio of 1:1.8-2 (W / V), grinding and repeatedly freezing and thawing, centrifuging to collect the supernatant, filtering it through a filter membrane, and then amplifying and purifying it through continuous passage in SPF chicken embryos to obtain the virus strain.

[0010] In a second aspect, the present invention provides the use of the above-described infectious bursal disease virus in the preparation of yolk antibodies for the prevention or treatment of infectious bursal disease in chickens.

[0011] Thirdly, the present invention provides a method for preparing egg yolk antibodies against infectious bursal virus in chickens, comprising the following steps: (1) An inactivated antigen was prepared using the infectious bursa of Fabricius of chickens as described in claim 1; (2) Immunize laying hens with the inactivated antigen to obtain immunized eggs; (3) Disinfect the immunized eggs and separate the yolks; (4) Extract, settle and purify the egg yolk to obtain egg yolk antibody.

[0012] Preferably, in step (2), immunization is performed using an incremental dose method, and the interval between the last immunization is longer than the interval between the previous immunizations.

[0013] More preferably, the interval between the previous immunization is 10 to 20 days, and the interval between the last immunization is 25 to 35 days.

[0014] Preferably, the disinfection treatment in step (3) includes treatment with quaternary ammonium salt disinfectants and treatment with aldehyde disinfectants.

[0015] More preferably, the quaternary ammonium salt disinfectant is benzalkonium chloride, and the aldehyde disinfectant is glutaraldehyde.

[0016] Preferably, a settling agent containing a polymeric flocculant and a protein stabilizer is added during the settling process in step (4).

[0017] More preferably, the polymeric flocculant is polyvinylpyrrolidone, and the protein stabilizer is trehalose.

[0018] More preferably, the pH is adjusted to 5.8–6.2 using organic acids during the sedimentation process, and sedimentation is carried out at 0–10°C.

[0019] Preferably, the preparation of the virus inactivation antigen includes: propagating the chicken infectious bursal virus RD250723A-IBD strain and then mixing it with formaldehyde solution for inactivation treatment.

[0020] Preferably, the immunization is performed in four doses, with the immunization dose increasing progressively with each dose.

[0021] Preferably, the extraction, sedimentation and purification process further includes a defatting step using polyethylene glycol or octanoic acid.

[0022] Fourthly, the present invention provides an egg yolk antibody against infectious bursal virus in chickens prepared by any of the foregoing methods. The beneficial effects achieved by the present invention are as follows: 1. The infectious bursal virus RD250723A-IBD strain (CGMCC No.46653) provided by this invention is a newly isolated epidemic strain. Genetic evolution analysis shows that it differs from known reference strains, has good representativeness and immunogenicity, and can be used as an excellent seed virus for antigen production. 2. The preparation method of the present invention uses an incremental dosage method for immunization, and the interval between the last immunization is longer than the interval between the previous immunizations. This optimized immunization procedure can effectively induce the proliferation of memory B cells and the maturation of antibody affinity, and significantly improve the titer of egg yolk antibodies. 3. This invention uses a combination of quaternary ammonium salt disinfectant and aldehyde disinfectant for the disinfection of immunized eggs, which overcomes the sterilization dead spots that may exist in single disinfection methods, significantly reduces the biosafety risks in the process of treating immunized eggs, and ensures a sterile environment for subsequent operations. 4. In the sedimentation process, the present invention adds a sedimentation agent containing a polymeric flocculant and a protein stabilizer. The polymeric flocculant can effectively promote the sedimentation of impurities, and the protein stabilizer can protect the conformational integrity of the antibody. The two work synergistically to improve the purity while maximizing the preservation of antibody activity. 5. The egg yolk antibody prepared using the strain and optimized process of this invention has a titer of 1:256 or higher as detected by agar diffusion test, and animal challenge protection test has proven that it has good preventive and therapeutic effects. Attached Figure Description

[0023] Figure 1 This is an electrophoresis image of the PCR amplification product of the chicken infectious bursal virus RD250723A-IBD strain of the present invention. Lane 1: marker; Lanes 2-3: chicken infectious bursal virus RD250723A-IBD; Lane 4: IBD negative control.

[0024] Figure 2 This is a genetic evolution diagram of the chicken infectious bursal virus strain RD250723A-IBD of this invention.

[0025] Figure 3 This is an anatomical diagram of a dead chicken embryo after inoculation with the chicken infectious bursal virus strain RD250723A-IBD of this invention.

[0026] Figure 4 The figure shows the titer test results of the egg yolk antibody prepared in this invention.

[0027] Figure 5 This is an analysis diagram of the degree of infectious bursal disease in chickens of each group during the IBDV challenge protection test of the egg yolk antibody of this invention. Detailed Implementation

[0028] The technical solution of the present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the methods described are conventional methods, and the materials described are available from publicly available commercial sources.

[0029] Example 1: Isolation and Identification of Chicken Infectious Bursal Disease Virus RD250723A-IBD 1.1 Virus isolation Infectious bursal disease (IBD) virus was aseptically collected from diseased chickens in a poultry farm infected with IBD virus. The collected tissue was added to sterile PBS solution at a 1:2 (w / v) ratio and then ground to obtain a slurry. After three freeze-thaw cycles, the slurry was centrifuged at 6000 rpm for 15 min. The supernatant was used for virus isolation, filtered through a sterile filter, and stored at -20°C. After three blind passages in an artificial chamber of chicken embryos, IBD virus RD250723A-IBD was isolated and purified.

[0030] 1.2 Virus Identification 1.2.1 RT-PCR identification The specific operating procedure should be performed according to the instructions of the StarSceiptⅢ One-Step RT-PCR Kit (Dye), where the sample volume is 300μL, and the desired viral genomic RNA fragment is obtained and recorded as the template.

[0031] Identification primers: Upstream primer (IBD-F): CAACAGCCAACATCAACG (18bp); Downstream primer (IBD-R): AGCTCGAAGTTGCTCACC (18bp); The amplified product fragment size is 687bp.

[0032] PCR amplification system: Amplification was performed using a 20 μL amplification system. Amplification program: After mixing the kit components, reverse transcription was performed at 50℃ for 20 min; then pre-denaturation was performed at 95℃ for 30 s, followed by annealing at 95℃ for 15 s, then annealing at 56℃ for 30 s, and finally extension at 72℃ for 30 s, for a total of 30 cycles; after the cycles, extension was performed at 72℃ for 5 min. The product was stored at 4℃ to obtain the PCR amplification product. The product was subjected to 1% agarose gel electrophoresis, and the results are shown below. Figure 1 As shown; where lane 1: marker; lanes 2-3: chicken infectious bursal virus RD250723A-IBD isolates; lane 4: negative control.

[0033] The results showed that a specific band appeared at approximately 687 bp in the amplified product, which was consistent with the expected size, and the isolate was preliminarily identified as chicken infectious bursal virus.

[0034] 1.2.2 VP2 gene sequencing and genetic evolution analysis The PCR products were sequenced to determine the sequence information of the VP2 gene, and the IBDV VP2 nucleic acid sequence was obtained as shown in SEQ ID NO:1.

[0035] AGACATCATGCGCGATCTTTTGCACTCGTTCGTAGGCCACCAGCGTGACGGGTCGGAGTGCTCCTGGGTAGTTGCCACCATGGATTGTCACTGCTAGACTCCCACTTGCCGACCACGATATCTGTTCCCCTACCTGTCCATCACTTTTGGAGGTCACTATCTC CAATTTGATGGATGTGATTGGCTGGGTTATCTCGCTGGTTGGGATTACTAGGTTGAATGGCATGAGATTGTCGACGCCGCCGTAGCCCATTGTTTGCAGCTACAGCTCTGGTGATTACCGCAGTCCCATCAAAGCCTATAAGGTAGATGGTGGCACCCAGTA CAAGGTTTTGAGTATTTGTTTCGAACACAAGCTCCCCCCCAACGCTGAGACTAGTGATAGCATCGATGTTGGCTGAGAACAGTGTGATTGTCACCCCACCTGCCTTGTACTGTGATGAGAATTGGTAATCATCAGCTGCAGTTATGGTGTAGACTCTGGGCCTG TCACTGCTGTCACATGTTGCTACCATTTTTGGGTCGAGCCCTATTGCAGGTATGGGGTCACCAAGCCTCACATACCCGAGGTCATATGATGTGGGCAAACTGAGAACGGTTACCCCTTCCCCTACCAGGACGTTCCCAATTTTGTCGTTGATGTGGGCTGTTGA The sequencing results were compared with the IBDV reference strain sequences registered in GenBank (see Table 1), and a phylogenetic tree was constructed using MEGA 7.0 software.

[0036] The results showed that the strain RD250723A-IBD of this invention is not on the same evolutionary branch as the reference classical strain, mutant strain, and highly virulent strain (see...). Figure 2 This indicates that it is a new, independent strain.

[0037] Table 1: IBDV: Reference Strain

[0038] 1.2.3 Toxicity determination Chicken infectious bursal virus RD250723A-IBD was diluted 1:100 with PBS (0.01 mol / L, pH=7.2) and inoculated into 10 8-day-old susceptible chicken embryos, 0.2 mL per embryo, in an artificial chamber. The embryos were incubated at 38℃. Eight embryos died within 48-168 hours post-inoculation. Congestion and fine punctate hemorrhages were observed on the head and toes of the dead embryos, and mottled necrotic foci appeared on the liver surface (see...). Figure 3 ).

[0039] Example 2: Preparation of Egg Yolk Antibodies Against Infectious Bursal Disease Virus in Chickens 2.1 Preparation of inactivated antigen The infectious bursal virus RD250723A-IBD obtained in Example 1 was amplified as follows: 7-day-old susceptible chicken embryos were inoculated into an artificial chamber at a dose of 0.2 mL / egg. Embryos that died within 48 hours were discarded. The yolk, allantoic fluid, and embryo were collected from chicken embryos that died between 48 and 168 hours and showed typical lesions. The embryo was ground with a cell wall breaker and then mixed with the allantoic fluid at a ratio of 1:1. The mixture was centrifuged at 6000 rpm for 15 minutes. The sterile supernatant was quantitatively aliquoted, frozen, and stored to obtain the antigen.

[0040] The antigen was mixed with a 10% formaldehyde solution, and the mixture was shaken immediately after addition to ensure thorough mixing. The final concentration of the formaldehyde solution was 0.1%. The virus solution was then poured smoothly into another sterile stainless steel container and sealed at 37°C for 24 hours with stirring (starting the timer from when the antigen temperature reached 37°C, with stirring 3 times during the period). After inactivation, samples were taken for inactivation testing. The inactivated virus solution was stored at 4°C for later use, thus obtaining the inactivated virus solution.

[0041] 2.2 Preparation of Immunogens Take 94 kg of white oil and 6 kg of Span 80, mix them evenly, add 2 kg of aluminum stearate, heat to 90°C while stirring, and then autoclave at 121°C for 30 min to obtain the oil phase; weigh 96 kg of inactivated virus solution and 4 kg of sterilized Tween 80, mix them and shake well to completely dissolve the Tween 80 to obtain the aqueous phase; take 3 kg of the oil phase and place it in a high-speed shear apparatus, add 1 kg of the aqueous phase while stirring at 15000 r / min, and continue stirring for 6 minutes to fully emulsify the mixture; after emulsification, aseptically dispense into 250 mL sterile bottles and store at 4°C to obtain the immunogen.

[0042] Immunogen testing: Appearance test—The immunogen appears as a milky white, uniform emulsion, exhibiting a water-in-oil emulsion pattern. Using a sterile pipette, add 5 drops of the immunogen to cold water; except for the first drop, the others should not diffuse. Stability test—Add 10 mL of the immunogen to a centrifuge tube and centrifuge at 3000 rpm for 15 minutes. If the aqueous phase precipitated at the bottom of the tube is 0.1 mL, not exceeding 0.5 mL, the condition is stable. Sterility test—The test should be conducted according to the appendix of the current Chinese Veterinary Pharmacopoeia; the result should be sterile.

[0043] 2.3 Immunization of laying hens and the acquisition of immunized eggs The immunogen was administered to 140-day-old laying hens via intramuscular injection. The immunization schedule is as follows: Initial vaccination: 0.5 mL per chicken; A second vaccination is administered 15 days after the first vaccination: 1.0 mL per chicken. A third vaccination will be administered 15 days after the second vaccination: each chicken will be immunized with 1.5 mL of the solution. A fourth vaccination will be administered 30 days after the third vaccination: 2.0 mL of immunization will be given to each chicken.

[0044] Eggs were collected 14 days after the fourth immunization. The antibody titer of the eggs was tested by agar diffusion test. Eggs with a titer of not less than 1:64 were selected as immunized eggs and stored at 4℃ for later use.

[0045] 2.4 Disinfection treatment and yolk separation of immunized eggs The immunized eggs were first soaked in a 0.1% benzalkonium chloride solution for 5 minutes, drained, and then fumigated with a 0.1% glutaraldehyde spray for 30 minutes. After the eggs were dried, they were cracked and the egg whites and yolks were separated to obtain the yolks.

[0046] 2.5 Extraction, sedimentation and purification of egg yolk Mix egg yolks with 0.025 mol / L disodium hydrogen phosphate solution at a volume ratio of 1:1 until homogeneous. Filter the mixture through a 60-mesh sieve to remove impurities and obtain egg yolk liquid. Add 2 times the volume of disodium hydrogen phosphate solution (0.025 mol / L) to the egg yolk liquid and stir at 1000 rpm for 60 minutes to obtain a turbid liquid.

[0047] The turbid liquid and the settling agent were mixed at a volume ratio of 1:1 to obtain a composite liquid. The settling agent was prepared by mixing 6.66g of polyvinylpyrrolidone (PVP K30), 4.16g of trehalose, and 1L of water until completely dissolved. The pH of the composite liquid was adjusted to 6.0 with a 30% citric acid solution, and the mixture was settling at 4℃ for 12 hours. The supernatant was then transferred. Octyl acid with a final concentration of 0.1% was added to the supernatant, stirred evenly, and allowed to stand for 4 hours. Finally, the mixture was sterilized by filtration through a 0.22μm microporous filter, filtered to remove viruses using an ultrafiltration membrane with a molecular weight cutoff of 1000kDa, and the egg yolk antibodies were concentrated twice using an ultrafiltration membrane with a molecular weight cutoff of 100kDa. The mixture was then dispensed, sealed, and stored at 4℃ to obtain the finished product.

[0048] Example 3: Detection of Egg Yolk Antibody Titer Egg yolk antibodies were prepared using the method described in Example 2, and samples were taken for agar diffusion assay to detect their titer.

[0049] The results showed that the prepared egg yolk antibody titer was ≥1:256 (see...) Figure 4 ).

[0050] Example 4: ELD of chicken infectious bursal virus RD250723A-IBD 50 Toxicity testing Eight-day-old SPF chicken embryos were used, and sterile PBS was used as the diluent. The infectious bursal virus strain used in the experiment was the strain prepared in this invention. The virus solution was serially diluted 10-fold with sterile PBS, and 10... -1 ~10 -8 There are a total of 8 dilutions, and 10 is selected. -3 ~10 -8 Six suitable dilutions were used for chicken embryo inoculation. Inoculation was performed via the chorioallantoic membrane route, with five chicken embryos inoculated at each dilution, each inoculated with a volume of 0.2 mL. A blank control group containing PBS dilution was also established. After inoculation, the chicken embryos were incubated at 37°C for 7 consecutive days. Non-specifically dead embryos within 24 hours were discarded. The number of dead embryos and embryonic lesions at each dilution were recorded daily (see Table 2).

[0051] Table 2 Infectious Bursal Disease Virus (ELD) in Chickens 50 Results of toxicity assay

[0052] According to the Reed-Muench method, the distance ratio is 0.25, and the dilution factor is 10 for mortality rates above 50%. -5 Finally, the ELD of this strain was calculated. 50 10 6.25 ELD 50 / 0.2mL. The results showed that the chicken infectious bursal virus strain described in this invention has typical lethality to chicken embryos and a stable virulence level.

[0053] Example 5: Challenge and Protection Test of Infectious Bursal Disease Virus in Chickens One hundred 30-day-old chickens free from specific pathogens were randomly divided into four groups and raised in isolation. The experimental protocol is as follows: Group 1 (negative control group): 10 animals, each injected intramuscularly with 0.5 mL of PBS buffer.

[0054] Group 2 (challenge-non-treatment group): 30 animals, each subcutaneously injected with 200 ELD in the neck. 50 0.5 mL of RD250723A-IBD strain virus solution.

[0055] Group 3 (Treatment Group): 30 animals, each initially vaccinated with 200 ELD. 50 The virus solution was administered intramuscularly 24 hours later, followed by an intramuscular injection of 1 mL of the egg yolk antibody prepared in Example 2.

[0056] Group 4 (Challenge and Prevention Group): 30 animals. Each animal was first injected intramuscularly with 1 mL of the egg yolk antibody prepared in Example 2, and 24 hours later was inoculated with 200 ELD. 50 Viral fluid.

[0057] On the 10th day after the virus challenge, all chickens were euthanized and necropsy was performed to observe the degree of bursal disease and score it (scoring criteria: 0 points - normal; 1 point - mild edema and congestion; 2 points - obvious edema and hemorrhage; 3 points - severe edema and hemorrhage, with a gelatinous or purple appearance).

[0058] The results are as follows Figure 5 As shown, the degree of bursal lesions in the non-treated group was severe, while the degree of bursal lesions in the treated and preventive groups was significantly lower than that in the non-treated group, and there was no significant difference compared with the negative control group. This indicates that the egg yolk antibody prepared in this invention has significant therapeutic and preventive effects against infectious bursal virus in chickens.

[0059] The embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A chicken infectious bursal virus, characterized in that: designated as chicken infectious bursal disease virus (Infectious) bursal disease virus) RD250723A-IBD, deposited with China General Microbiological Culture Collection Center on October 27, 2025, and assigned accession number CGMCC No. 46653.

2. The use of the infectious bursal disease virus of chickens according to claim 1 in the preparation of egg yolk antibodies for the prevention or treatment of infectious bursal disease in chickens.

3. A method for the production of egg yolk antibodies against chicken infectious bursal disease virus, characterized in that, Includes the following steps: (1) An inactivated antigen was prepared using the infectious bursa of Fabricius of chickens as described in claim 1; (2) Immunize laying hens with the inactivated antigen to obtain immunized eggs; (3) Disinfect the immunized eggs and separate the yolks; (4) Extract, settle and purify the egg yolk to obtain egg yolk antibody.

4. The method of claim 3, wherein: In step (2), immunization is performed using an incremental dose method, and the interval between the last immunization is longer than the interval between the previous immunizations.

5. The method of claim 4, wherein: The interval between previous immunizations is 10 to 20 days, and the interval between the last immunizations is 25 to 35 days.

6. The method of claim 3, wherein: The disinfection treatment in step (3) includes treatment with quaternary ammonium salt disinfectants and aldehyde disinfectants.

7. The method of claim 6, wherein: The quaternary ammonium salt disinfectant is benzalkonium chloride, and the aldehyde disinfectant is glutaraldehyde.

8. The method of claim 3, wherein: In step (4), a settling agent containing a polymeric flocculant and a protein stabilizer is added during the settling process.

9. The method according to claim 8, characterized in that: The polymeric flocculant is polyvinylpyrrolidone, and the protein stabilizer is trehalose.

10. The method according to claim 8 or 9, characterized in that: During the sedimentation process, the pH was adjusted to 5.8–6.2 using organic acids, and sedimentation was carried out at 0–10°C.