An engineered strain for producing xylitol with glucose as the sole carbon source, a construction method and application thereof
By genetically editing Escherichia coli, an engineered strain with glucose as the sole carbon source was constructed, solving the problems of high cost and low yield in existing technologies. This enabled efficient production of xylitol, adaptable to large-scale reactor production, and reduced environmental pollution and energy consumption.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-07
- Publication Date
- 2026-07-10
AI Technical Summary
Existing technologies for one-step xylitol production using E. coli require the use of mixed carbon sources, resulting in high costs or extremely low yields. They cannot effectively utilize glucose as the sole carbon source for efficient production, and traditional chemical methods suffer from high pollution and high energy consumption.
Gene editing technology was used to modify *E. coli*, weakening the glucose phosphate isomerase gene *pgi*, knocking out the 2-keto-3-deoxy-6-phosphate glucuronide gene *eda* and the 6-phosphate gluconic acid dehydratase gene *edd*, knocking out the ribulokinase gene *araB* and the ribose 5-phosphate isomerase gene *rpiA/B*, knocking out the xylulokinase gene *xylB*, and overexpressing the phosphate sugar phosphatase gene *yigL* and the galactose permease gene *galP*. A recombinant expression plasmid carrying the 2-arabinitol dehydrogenase, 4-arabinitol dehydrogenase, and xylitol dehydrogenase genes was constructed to modify the pentose phosphate pathway to improve glucose utilization efficiency.
This method enables efficient production of xylitol using glucose as the sole carbon source, significantly increasing the yield of both arabinitol and xylitol, reducing production costs, and adapting to large-scale reactor production environments, thus demonstrating promising application prospects.
Smart Images

Figure CN122357404A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to an engineered strain that produces xylitol using glucose as the sole carbon source, its construction method, and its applications. Background Technology
[0002] Xylitol is a naturally occurring pentose sugar alcohol widely found in vegetables, fruits, and dietary fiber. Its sweetness is comparable to sucrose, but its calories are only 60% of sucrose. Furthermore, its metabolism does not depend on insulin, preventing drastic fluctuations in blood sugar, making it an ideal sweetener for diabetics.
[0003] Xylitol's most notable characteristic is its ability to prevent tooth decay, as oral bacteria cannot utilize it to produce acid, thus protecting teeth. In addition, it promotes saliva production and maintains the pH balance in the mouth. Furthermore, xylitol is a natural extract with less controversy, while the safety of some artificial sweeteners for long-term consumption is still debated among the public. Therefore, it is commonly found in sugar-free chewing gum, toothpaste, and diabetic foods.
[0004] Traditional chemical methods for synthesizing xylitol have limitations. The high-temperature, high-pressure environment required for these methods places extremely stringent demands on the materials and sealing performance of the reaction vessels. The use of high-pressure hydrogen poses a significant explosion risk at the production site, with related safety maintenance costs accounting for over 15% of the total production cost. Secondly, there are issues of heavy metal pollution and purification difficulties. The nickel catalysts used in chemical methods are not only expensive, but trace amounts of nickel ions inevitably leak out during the reaction. Companies must invest heavily in multi-stage ion exchange purification, which not only increases process complexity but also generates large amounts of acidic and alkaline wastewater.
[0005] Currently, the development of the xylitol industry is constrained by the high environmental impact of traditional processes, particularly the reliance on strong acid hydrolysis in the raw material pretreatment stage. When using xylose or hemicellulose hydrolysate as raw materials, this high-pollution, high-energy-consumption model severely hinders sustainable industrial production. Therefore, academia and industry are driving a fundamental paradigm shift: actively exploring the use of widely available, low-cost, and environmentally friendly glucose as an alternative substrate to directly synthesize xylitol through a "whole-biofermentation method." This innovative strategy is expected to significantly reduce production costs, while substantially mitigating environmental pollution and overcoming resource bottlenecks, paving a new path for the green manufacturing of xylitol.
[0006] However, current literature reports on recombinant strains that utilize E. coli for one-step xylitol production either require the use of mixed carbon sources (L-arabinose, glycerol, etc., leading to high costs) or result in extremely low yields (below 2 g / L). Therefore, there is an urgent need to explore different metabolic pathways to increase xylitol production at a lower cost. Summary of the Invention
[0007] The present invention aims to overcome the shortcomings of the prior art and provide an engineered strain for producing xylitol using glucose as the sole carbon source, as well as its construction method and application.
[0008] To achieve the above objectives, the engineered strain provided by the present invention is obtained by modifying Escherichia coli as the starting strain as follows: 1) weakening the glucose phosphoisomerase gene pgi; 2) Knock out the 2-keto-3-deoxy-6-phosphate glucuronide gene eda; 3) Knock out the 6-phosphoglucose dehydratase gene edd; 4) Knock out the ribulokinase gene araB; 5) Knockout of the transketolase gene tktB; 6) Knock out the ribose-5-phosphate isomerase gene rpiA / B; 7) Knock out the xylB xyl kinase gene; 8) Overexpression of the phosphosugar phosphatase gene yigL; 9) Overexpression of the galactose permease gene galP; Furthermore, the engineered strain contains a recombinant expression plasmid carrying genes encoding 2-arabinitol dehydrogenase, 4-arabinitol dehydrogenase, and xylitol dehydrogenase.
[0009] The engineered strain can produce xylitol using glucose as the sole carbon source.
[0010] Typically, but not limited to, the Escherichia coli is Escherichia coli W3110.
[0011] In this invention, by weakening the glucose phosphate isomerase gene, knocking out the 6-phosphoglucuronide dehydratase gene, and knocking out the 2-keto-3-deoxy-6-phosphoglucuronide gene, the glucose metabolism pathway of *E. coli* is focused on the pentose phosphate pathway without significantly affecting the growth of *E. coli*. Knocking out the ribose-5-phosphate isomerase gene, ribulose kinase gene, and transketolase gene enables *E. coli* to accumulate ribulose, a precursor required for the reaction. Knocking out the xylulose kinase gene and overexpressing the phosphatase gene further increases ribulose accumulation and prevents the yield decrease caused by xylulose phosphorylation. Overexpressing the galactose permease gene increases the glucose uptake rate of the bacteria in a high-glucose environment.
[0012] Preferably, the gene sequence encoding 2-arabinoseol dehydrogenase (2-ArDH) is derived from *Gluconobacter*, and its encoded amino acid sequence can be found in NCBI GenBank: AUV64473.1; the gene sequence encoding 4-arabinoseol dehydrogenase (Dald) is derived from *Escherichia coli*, and its encoded amino acid sequence can be found in NCBI GenBank: EFJ67739.1; the gene sequence encoding xylitol dehydrogenase (XDH) is derived from *Gluconobacter oxydans*, and its encoded amino acid sequence can be found in NCBI GenBank: WP_011252435.1. All of the above-mentioned encoded genes have undergone codon optimization in *E. coli*, which is beneficial for achieving heterologous expression in *E. coli*.
[0013] In this invention, to improve the expression level of exogenous genes, the expression plasmid pET-28a was modified. In this recombinant expression plasmid, the 2-arabinitol dehydrogenase encoding gene is expressed using the J23100 promoter and the RBS sequence shown in SEQ ID No. 1 (AGAAGAGGTTCCTATA); the 4-arabinitol dehydrogenase encoding gene and the xylitol dehydrogenase encoding gene are expressed using the same J23100 promoter, and respectively using the RBS sequences shown in SEQ ID No. 2 (AGGAGGTTAAT) and SEQ ID No. 3 (GGTGGTAGGAGGT). This avoids the excessive cell burden caused by the expression of three exogenous enzymes. The J23100 promoter and the expression plasmid pET-28a are both well known in the art.
[0014] As a preferred method, the yigL phosphatase gene overexpression method is as follows: single copy of the yigL gene is overexpressed at the gidB-atpI site, and its transcription and translation levels are regulated by the J23100 strong promoter and the RBS sequence with the sequence AAGGAGG, respectively. The method for overexpressing the galactose permease gene galP is as follows: a single copy of the galP gene is overexpressed at the ybcC site, and its transcription and translation are driven by the J23100 promoter and the RBS sequence with the sequence AAGGAGG. The method to weaken the glucose phosphate isomerase gene pgi is as follows: knock out the pgi gene and overexpress a single copy of the pgi gene at the yeeL site. Its transcription and translation are driven by the J23114 promoter and the RBS sequence with the sequence TATTGCTAA.
[0015] All of the above modifications were carried out without affecting the growth of the host bacteria.
[0016] Specifically, the glucose phosphate isomerase gene (pgi) has NCBI Gend ID 948535; the 2-keto-3-deoxy-6-phosphate glucuronide gene (eda) has NCBI Gend ID 946367; the 6-phosphate gluconic acid dehydratase gene (edd) has NCBI Gend ID 946362; the ribulokinase gene (araB) has NCBI Gend ID 946017; the transketolase gene (tktB) has NCBI Gend ID 945865; the ribose 5-phosphate isomerase gene (rpiA / B) has NCBI Gend IDs 947407 and 948602; the xylulokinase gene (xylB) has NCBI Gend ID 948133; the phosphate sugar phosphatase gene (yigL) has NCBI Gend ID 2847768; and the galactose permease gene (galP) has NCBI Gend ID 948535. The ID is 947434.
[0017] The present invention also provides a method for constructing the aforementioned engineered strain, which includes the following steps: 1) Using Escherichia coli as the starting strain, target genes are knocked out or weakened through gene editing technology to construct chassis strains with modified metabolic pathways; 2) Construct a recombinant expression plasmid carrying the genes encoding 2-arabinitol dehydrogenase, 4-arabinitol dehydrogenase, and xylitol dehydrogenase; 3) Transform the recombinant expression plasmid described in step 2) into the chassis strain constructed in step 1) to obtain the engineered strain.
[0018] Preferably, the gene editing technology is CRISPR / Cas9 gene editing technology.
[0019] The present invention also provides the application of the engineered strain in the production of xylitol using glucose as the sole carbon source.
[0020] Furthermore, the application includes the following steps: inoculating the engineered strain into a glucose-containing fermentation medium for fermentation culture to produce xylitol.
[0021] Preferably, the fermentation is carried out in a bioreactor, with the dissolved oxygen level controlled at 25%-35%, the glucose concentration in the fermentation broth controlled at 10-30 g / L, and glucose as the sole carbon source.
[0022] Compared with the prior art, the present invention achieves the following beneficial technical effects: This invention utilizes gene editing to weaken the glycolysis pathway, knock out the 2-keto-3-deoxy-6-phosphogluconic acid pathway, and modify the pentose phosphate pathway, thereby enhancing glucose uptake. This results in the construction of a recombinant *E. coli* strain capable of efficiently synthesizing xylitol using glucose as the sole carbon source. Compared to existing reports, this significantly increases the yields of arabinitol and xylitol, and possesses advantages such as requiring no inducing agents and being adaptable to large-scale reactor production environments. It shows promising application prospects and can be used for the large-scale production of xylitol. Attached Figure Description
[0023] Figure 1 This is the peak chromatogram of the HPLC product; Figure 2 Map of pEcgRNA-araB plasmid; Figure 3 The pET-28a-galP plasmid map; Figure 4 Map of p-2-ardh plasmid; Figure 5 The p-dald-xdh plasmid map; Figure 6 pET-ADX plasmid map; Figure 7 The results of shake-flask fermentation of a strain carrying plasmid peT-ADX to overexpress the galP gene are shown in the figure. Figure 8 The results of shake-flask fermentation of a strain carrying plasmid peT-ADX to overexpress the yigL gene are shown in the figure. Figure 9 This is a diagram of the fermentation process in a 3L fermenter. Detailed Implementation
[0024] The present invention will be further described and illustrated below with reference to specific embodiments. The embodiments described are merely examples of the content of this disclosure and do not limit the scope of the invention. The technical features of each embodiment in the present invention can be combined accordingly, provided that there is no mutual conflict.
[0025] The cloning strain used in the following examples was *E. coli* BL21, the expression strain was *E. coli* W3110, and the gene modification starter strain was wild-type W3110, all of which were commercially available. The pEcCas and pEcgRNA plasmids used for CRISPR / Cas9 gene editing were derived from addgene. The exogenous gene sequences 2-ArDH, DalD, and XDH were synthesized by Hangzhou Qingke Biotechnology Co., Ltd. The primers for plasmid and strain construction are shown in Table 1 (SEQ ID No. 4 ~ SEQ ID No. 49): Table 1 Detection methods for fermentation samples: After appropriate concentration dilution of the sample, xylitol and arabinitol were quantitatively detected using a Shimadzu LC-20AT high-performance liquid chromatography system. Figure 1 As shown. Detector: RID-20A differential refractive index detector, analytical column: Aminex HPX-87C, mobile phase: pure water, flow rate: 0.6 mL / min, column temperature setting: 76℃.
[0026] Example 1: Construction of genetically engineered strain W3110-ΔaraB Using Escherichia coli W3110 as the starting strain, the araB gene (gene sequence see Gene ID: 946017) was knocked out in its genome using the CRISPR / Cas9 method. The steps are as follows: 1. Construction of plasmid pEcgRNA-araB-N20 The original pEcgRNA plasmid was extracted, digested with BsaI, and after successful verification, the required fragment was recovered by gel extraction for later use.
[0027] Preparation of the araB-N20 sequence: A suitable N20 sequence (CCAAGTGTCAGTGAACAGCG) was selected. Two synthesized primers (N20-araB-F / N20-araB-R) were annealed and self-ligated to obtain a double strand. This double strand was then ligated to the backbone obtained from the enzyme digestion process described above. The resulting solution was transformed into BL21 competent cells and screened using Spec (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmids were extracted and stored for later use.
[0028] 2. Construction of plasmid pEcgRNA-araB Using the wild-type *Escherichia coli* W3110 genome as a template, the upstream homologous arm of the araB gene was amplified using primers araB-UF and araB-UR, and the downstream homologous arm was amplified using primers araB-DF and araB-DR. The amplified components were then recovered from the gel for later use. Using the pEcgRNA-araB-N20 plasmid as a template, the linear backbone was amplified using primers pEcg-F and pEcg-R. This amplified components were then recovered from the gel for later use.
[0029] The aforementioned homologous arm fragments and backbone were seamlessly cloned and transformed into BL21 competent cells, then selected using Spec (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmids were extracted and stored for later use. Figure 2 As shown.
[0030] 3. Electroporation to introduce pEcCas plasmid a. Pick a single colony of W3110 from an LB agar plate and incubate it in a liquid LB tube at 37°C and 220 rpm for 8–12 h. Transfer 200 μL of the bacterial culture to a 10 mL liquid LB tube and incubate at 37°C and 220 rpm until OD (dose elapsed). 600 The bacterial culture should be approximately 0.6-0.8. Let it stand on ice for 15-20 minutes, while simultaneously pre-cooling the centrifuge to 4°C.
[0031] b. Transfer the bacterial culture to a 50mL sterile centrifuge tube, centrifuge at 4000 rpm for 10 min at 4 ℃, and discard the supernatant.
[0032] c. Resuspend the bacterial cells in 10 mL of pre-cooled 10% glycerol, centrifuge at 4 °C and 4000 rpm for 10 min, and discard the supernatant.
[0033] d. Repeat step c once.
[0034] e. Resuspend in 5 mL of pre-cooled 10% glycerol and aliquot into sterile 1.5 mL centrifuge tubes (100 μL per tube) for later use.
[0035] f. Add 500-1000 ng of pEcCas plasmid. Mix well and transfer to a pre-cooled 2 mm sterile electroporation cuvette for electroporation. Electroporation conditions: 2.5 kV, 25 μF, 200 Ω, pulse time approximately 9 ms.
[0036] g. Immediately after electroporation, add 800 μL of sterile liquid LB medium and transfer to a 1.5 mL sterile centrifuge tube. Incubate at 37 °C and 220 rpm for 1 h.
[0037] h. Centrifuge the revived bacterial culture at 4000 rpm for 5 min, discard the supernatant, and spread the remaining 100 μL onto a plate containing Kana (50 μg / mL) resistance. Incubate overnight at 37°C.
[0038] i. Select single-clone transformants for PCR verification to obtain Escherichia coli W3110-pEcCas.
[0039] 4. Electroporation of plasmid pEcgRNA-araB a. Using the *E. coli* W3110-pEcCas obtained in step 3 as the starting strain, streak it on a Kana (50 μg / mL) antibiotic plate and incubate overnight at 37 °C. Then, pick a single colony and transfer it to a liquid LB tube. Incubate at 37 °C and 220 rpm for 8-12 h. Pipette 200 μL of the bacterial solution into a 10 mL liquid LB tube and add L-arabinose (final concentration 10 mM). Incubate at 37 °C and 220 rpm until the OD600 reaches approximately 0.6-0.8. Let the bacterial solution stand on ice for 15-20 min, and simultaneously pre-cool the centrifuge to 4 °C.
[0040] b. Repeat the operation of be in step 3.
[0041] c. Add 500-1000 ng of pEcgRNA-araB plasmid. Mix well and transfer to a pre-cooled 2 mm sterile electroporation cuvette for electroporation. Electroporation conditions: 2.5 kV, 25 μF, 200 Ω, pulse time approximately 9 ms.
[0042] d. Electroporation and resuscitation methods are the same as in step 3g.
[0043] e. The bacterial culture was spread on resistant plates containing Kana (50 μg / mL) + Spec (50 μg / mL) and incubated overnight at 37 °C.
[0044] f. Select single-clone transformants and perform PCR reaction and sequencing verification using primers arb-yz-f / arab-yz-r to obtain E. coli W3110-ΔaraB with the araB gene knocked out.
[0045] g. Pick transformants into LB liquid tubes containing kana (50 μg / mL) and rhamnose (final concentration 10 mM), and incubate at 37 ℃ and 220 rpm for 12 hours to eliminate plasmid pEcgRNA-araB.
[0046] h. For strain W3110-ΔaraB-pEcCas, after culturing at 37 ℃ and 220 rpm for 12 hours as needed, the single colony that can grow on the streaked sucrose LB plate (final concentration 10 g / L) is the W3110-ΔaraB strain with the pEcCas plasmid eliminated.
[0047] Example 2: Construction of galP expression cassette in genetically engineered bacteria Using peT-28a plasmid as the starting plasmid, we obtained the desired expression plasmid by replacing its promoter and RBS sequence. Using the wild-type *E. coli* W3110 genome as a template, we amplified the fragment containing the galP gene by PCR using primers galP-F and galP-R, and then recovered it from the gel for later use. Using the commercial plasmid peT-28a as a template, we amplified a linear backbone containing the J23100 promoter, the BBa_B0034 RBS sequence, and the rrnB T1 terminator by PCR using long primers PET-GALP-F and PET-GALP-R.
[0048] The above fragment and backbone were seamlessly cloned and transformed into BL21 competent cells, then selected using Kana (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmids were extracted and stored for later use. Figure 3 As shown.
[0049] Example 3: Construction of genetically engineered bacterium W7Δ Using the *E. coli* W3110-ΔaraB constructed in Example 1 as the starting strain, the CRISPR / Cas9 method was used to knock out / knock in its genome to complete the knockout of the araB, rpiA / B, tktB, edd, eda, and xylB genes. The gene knockout steps are as shown in Example 1, resulting in strain W6Δ (using the wild-type W3110 strain as the starting strain, through multiple rounds of gene editing, the araB, rpiA / B, tktB, edd, eda, and xylB genes were knocked out sequentially).
[0050] Based on strain W6Δ, the glucose phosphate isomerase gene pgi was further weakened to construct the genetically engineered strain W7Δ. The steps for weakening the gene are as follows: 1. Using strain W6Δ as the starting strain, the plasmid pEcgRNA-pgi was designed, and the pgi gene was knocked out by implementing the method shown in Case 1 to obtain strain W6Δ-Δpgi.
[0051] 2. Construction of PGI-Low Expression Kit in Genetically Engineered Bacteria Referring to Example 2, the pTrc-99a plasmid was used as the starting plasmid, and its promoter was replaced with the weak promoter J23114, the RBS sequence tattgctaa, and the pgi gene of wild-type Escherichia coli W3110 was carried. After successful sequencing, the pgi-low expression cassette was obtained.
[0052] 3. Construction of pEcgRNA-yeeL plasmid Following the construction process of plasmid pEcgRNA-araB in Example 1, plasmid pEcgRNA-yeeL was obtained.
[0053] 4. Construction of pEcgRNA-yeeL-pgi plasmid Using the wild-type *E. coli* W3110 genome as a template, the upstream homologous arm of the *yeeL* gene was amplified using primers YEEL-UF and YEEL-UR, and the downstream homologous arm was amplified using primers YEEL-DF and YEEL-DR. The amplified segments were then recovered from the gel for verification. Using the pEcgRNA-yeeL plasmid as a template, the linear backbone was amplified using primers pEcg-F and pEcg-R. The expression cassette fragment was then amplified using the pgi-low expression cassette as a template and primers ardhJ-F and ardhJ-R.
[0054] The aforementioned homologous arm fragment, expression cassette fragment, and backbone were seamlessly cloned and transformed into BL21 competent cells, then selected using Spec (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmids were extracted and stored for later use.
[0055] 5. Electroporation to introduce pEcCas plasmid Refer to the method in Example 1.
[0056] 6. Electroporation to introduce pEcgRNA-yeeL-pgi plasmid Following the method described in Example 1, the genetically engineered bacterium W7Δ was obtained through PCR reaction and sequencing verification.
[0057] Example 4: Construction of genetically engineered bacterium W7Δ-galP Using the *E. coli* W7Δ strain constructed in Example 3 (this strain was developed by using the wild-type strain W3110 as the starting strain, and through multiple rounds of gene editing, knocking out the araB, rpiA / B, tktB, edd, eda, xylB, and pgi genes, while simultaneously knocking in the pgi gene transcribed by a weak promoter to achieve attenuation), the endogenous galP gene (gene sequence see Gene ID: 946017) was overexpressed at the ybcC site in its genome using the CRISPR / Cas9 method. Overexpression of the galP gene increased the rate at which *E. coli* utilized glucose, reducing the residual glucose from 5.3 g / L to 1.1 g / L after 48 h of fermentation. The construction steps are as follows: 1. Construction of plasmid pEcgRNA-ybcC-N20 Following the construction method of plasmid pEcgRNA-araB-N20 in Example 1, plasmid pEcgRNA-ybcC-N20 was constructed.
[0058] 2. Construction of plasmid pEcgRNA-ybcC-galP Using the wild-type *E. coli* W3110 genome as a template, the upstream homologous arm of the ybcC gene was amplified using primers YBCC-UF and YBCC-UR, and the downstream homologous arm was amplified using primers YBCC-DF and YBCC-DR. After verification, the amplified fragments were recovered from the gel. Using the pEcgRNA-ybcC-N20 plasmid as a template, a linear backbone was amplified using primers pEcg-F and pEcg-R. After verification, the amplified fragments were recovered from the gel. Using an expression cassette containing the galP gene as a template, an expression cassette fragment was amplified using primers PJ-F and PJ-R. After verification, the amplified fragments were recovered from the gel.
[0059] The aforementioned homologous arm fragment, expression cassette fragment, and backbone were seamlessly cloned and transformed into BL21 competent cells, then selected using Spec (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmids were extracted and stored for later use.
[0060] 3. Electroporation to introduce pEcCas plasmid Refer to the method in Example 1.
[0061] 4. Electroporation to introduce pEcgRNA-ybcC-galP plasmid Following the method described in Example 1, the genetically engineered bacterium W7Δ-galP was obtained through PCR reaction and sequencing verification.
[0062] Example 5: Construction of genetically engineered bacterium W7Δ-galP-yigL Using the *E. coli* W7Δ-galP strain constructed in Example 4 as the starting strain, the endogenous yigL gene (gene sequence see Gene ID: 2847768) was overexpressed in the gidB-atpI region of its genome using the CRISPR / Cas9 method. The construction steps are as follows: 1. Construction of the yigL expression box Referring to Example 2, using peT-28a plasmid as the starting plasmid, the promoter was replaced with J23100, the RBS sequence was AGAGGTTCCTATA, and it carried the yigL gene of wild-type Escherichia coli W3110. After successful sequencing, the yigL expression cassette was obtained.
[0063] 2. Construction of plasmid pEcgRNA-gidB-atpI-N20 Following the construction method of plasmid pEcgRNA-araB-N20 in Example 1, plasmid pEcgRNA-gidB-atpI-N20 was constructed.
[0064] 3. Construction of plasmid pEcgRNA-gidB-atpI-yigL Following the construction method of plasmid pEcgRNA-ybcC-galP in Example 4, plasmid pEcgRNA-gidB-atpI-yigL was constructed.
[0065] 4. Electroporation to introduce pEcCas plasmid Refer to the method in Example 1.
[0066] 5. Electroporation to introduce pEcgRNA-gidB-atpI-yigL plasmid Following the method described in Example 1, the genetically engineered bacterium W7Δ-galP-yigL was obtained through PCR reaction and sequencing verification.
[0067] Example 6: Construction of engineered bacteria with expression plasmid peT-ADX 1. Constructing the peT-ADX plasmid Using the p-2-ardh(J23100+BBa_B0034) plasmid as a template (this plasmid was constructed by replacing the promoter with J23100 and the RBS sequence with aaagaggagaaa, and adding the exogenous gene fragment 2-ardh), as shown in the example. Figure 4 As shown), using ardhJ-F and ADX(DALD)-R as primers, expression cassette fragment 1 (promoter, RBS sequence, and exogenous gene fragment) was amplified. After successful verification, it was gel-recovered for later use. Using p-dald-xdh plasmid as a template (this plasmid was constructed by replacing the promoter with J23100, the RBS sequence with AGGAGGTTAAT and GGTGGTAGGAGGT, and adding the exogenous gene fragments dald and xdh), as shown... Figure 5 As shown in the image, DalD-F and XDH-R primers were used to amplify expression cassette fragment 2 (promoter, RBS sequence, and exogenous gene fragment). After successful verification, the fragment was recovered from the gel for later use. Using peT-28a plasmid as a template, pet-ADX-R and pet-ADX-F primers were used to amplify the backbone fragment. After successful verification, the fragment was recovered from the gel for later use.
[0068] Expression cassette fragment 1, expression cassette fragment 2, and the backbone fragment were seamlessly cloned and transformed into BL21 competent cells. Selection was performed using Kana (50 μg / mL) antibiotic plates. After successful colony PCR verification and sequencing, plasmid was extracted and named peT-ADX. Figure 6 As shown, save for future use.
[0069] 2. peT-ADX plasmid transformation Following the electroporation method in Example 1, the plasmid peT-ADX was transformed into the strain W7Δ-galP-yigL. After successful verification, the engineered strain W7Δ-galP-yigL-ADX carrying the expression plasmid peT-ADX was obtained, which is the engineered strain of the present invention that produces xylitol using glucose as the sole carbon source.
[0070] Following the construction method of the aforementioned embodiments, engineered strains W7Δ-ADX (which, compared to W7Δ-galP-yigL-ADX obtained in Example 6, did not undergo overexpression modification of the phosphosugar phosphatase gene yigL and the galactose permease gene galP) and W7Δ-galP-ADX (which did not undergo overexpression modification of the phosphosugar phosphatase gene yigL) were constructed as control strains.
[0071] Example 7: Xylitol production by shake-flask fermentation of engineered bacteria with expression plasmid peT-ADX The components and final concentrations of the glucose-containing culture medium used are as follows: tryptone 16 g / L, yeast extract 32 g / L, 0.17 M KH2PO4, 0.72 M K2HPO4, 2 mM MgSO4, glucose 25 g / L, and kanamycin 50 μg / mL.
[0072] Overnight cultured W7Δ-galP-yigL-ADX strains were inoculated at a ratio of 2% into 30 mL Erlenmeyer flasks containing glucose medium and cultured at 37°C and 220 rpm for 4 h until the OD600 reached approximately 0.8. The temperature was then reduced to 30°C and cultured for another 44 h. HPLC analysis showed that arabinitol was produced at a yield of 0.213 g / g (5.31 g / L), and xylitol at a yield of 0.123 g / g (3.08 g / L). Control groups consisted of W7Δ-ADX and W7Δ-galP-ADX strains, with results as follows: Figure 7 , 8 As shown, the W7Δ-galP-yigL-ADX constructed in Example 6 produced significantly higher yields of arabinitol and xylitol than the control group.
[0073] Example 8: Fermentation validation of engineered bacteria with expression plasmid peT-ADX The strain W7Δ-galP-yigL-ADX, activated on LB solid medium, was picked and inoculated into a sterile test tube containing 5 mL of liquid LB medium. It was incubated at 37°C and 220 rpm for 12 h. 2 mL of the bacterial culture was then inoculated into a 500 mL Erlenmeyer flask containing 60 mL of seed culture medium and incubated at 37°C and 220 rpm for 12 h. The entire seed culture was then transferred to 0.54 L of initial fermentation medium, and fermentation in a fermenter began. The components of the seed culture medium are shown in Table 2, and the components of the initial fermentation medium are shown in Table 3.
[0074] Table 2 Table 3 The initial fermentation conditions were 37℃, 300 rpm, aeration rate of 0.8 vvm, and pH controlled at 6.85. Dissolved oxygen was maintained at 25%-35% throughout fermentation. After 4-6 hours of culture, glucose was fed into the system until a concentration of 30-35 g / L was reached. The glucose concentration was subsequently maintained at 10-30 g / L, with samples taken and analyzed every 4-6 hours. The fermentation process was as follows: Figure 9 As shown, after 60 h of fermentation, glucose was depleted, producing 23.18 g / L of arabinitol (yield 0.31 g / g) and 8.79 g / L of xylitol (yield 0.12 g / g).
[0075] The above-described embodiments are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. An engineered strain that produces xylitol using glucose as the sole carbon source, characterized in that, The engineered strain was obtained by modifying Escherichia coli as the starting strain as follows: 1) Weaken the glucose phosphate isomerase gene pgi; 2) Knock out the 2-keto-3-deoxy-6-phosphate glucuronide gene eda; 3) Knock out the 6-phosphoglucose dehydratase gene edd; 4) Knock out the ribulokinase gene araB; 5) Knockout of the transketolase gene tktB; 6) Knock out the ribose-5-phosphate isomerase gene rpiA / B; 7) Knock out the xylB xyl kinase gene; 8) Overexpression of the phosphosugar phosphatase gene yigL; 9) Overexpression of the galactose permease gene galP; Furthermore, the engineered strain contains a recombinant expression plasmid carrying genes encoding 2-arabinitol dehydrogenase, 4-arabinitol dehydrogenase, and xylitol dehydrogenase.
2. The engineered strain according to claim 1, characterized in that, The 2-arabinose dehydrogenase encoding gene is derived from *Gluconobacter*, and its encoded amino acid sequence is shown in NCBI GenBank: AUV64473.1; the 4-arabinose dehydrogenase encoding gene is derived from *Escherichia coli*, and its encoded amino acid sequence is shown in NCBI GenBank: EFJ67739.1; the xylitol dehydrogenase encoding gene is derived from *Gluconobacter oxydans*, and its encoded amino acid sequence is shown in NCBI GenBank: WP_011252435.
1.
3. The engineered strain according to claim 1, characterized in that, In the recombinant expression plasmid, the 2-arabinitol dehydrogenase encoding gene is expressed by the J23100 promoter and the RBS sequence shown in SEQ ID No. 1; the 4-arabinitol dehydrogenase encoding gene and the xylitol dehydrogenase encoding gene are expressed by the same J23100 promoter and by the RBS sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.
4. The engineered strain according to claim 1, characterized in that, The method for overexpressing the phosphosugar phosphatase gene yigL is as follows: a single copy of the yigL gene is overexpressed at the gidB-atpI site, and its transcription and translation levels are regulated by the J23100 strong promoter and the RBS sequence with the sequence AAGGAGG, respectively. The method for overexpressing the galactose permease gene galP is as follows: a single copy of the galP gene is overexpressed at the ybcC site, and its transcription and translation are driven by the J23100 promoter and the RBS sequence with the sequence AAGGAGG. The method to weaken the glucose phosphate isomerase gene pgi is as follows: knock out the pgi gene and overexpress a single copy of the pgi gene at the yeeL site. Its transcription and translation are driven by the J23114 promoter and the RBS sequence with the sequence TATTGCTAA.
5. The engineered strain according to claim 1, characterized in that, The NCBI Gene ID of the glucose phosphate isomerase gene pgi is 948535; the NCBI Gene ID of the 2-keto-3-deoxy-6-phosphate glucuronide gene eda is 946367; the NCBI Gene ID of the 6-phosphate gluconic acid dehydratase gene edd is 946362; the NCBI Gene ID of the ribulokinase gene araB is 946017; the NCBI Gene ID of the transketolase gene tktB is 945865; the NCBI Gene IDs of the ribose 5-phosphate isomerase genes rpiA / B are 947407 and 948602; the NCBI Gene ID of the xyl kinase gene xylB is 948133; the NCBI Gene ID of the phosphate sugar phosphatase gene yigL is 2847768; and the NCBI Gene ID of the galactose permease gene galP is 947434.
6. A method for constructing an engineered strain as described in any one of claims 1-5, characterized in that, Includes the following steps: 1) Using Escherichia coli as the starting strain, target genes are knocked out or weakened through gene editing technology to construct chassis strains with modified metabolic pathways; 2) Construct a recombinant expression plasmid carrying the genes encoding 2-arabinitol dehydrogenase, 4-arabinitol dehydrogenase, and xylitol dehydrogenase; 3) Transform the recombinant expression plasmid described in step 2) into the chassis strain constructed in step 1) to obtain the engineered strain.
7. The construction method according to claim 6, characterized in that, The gene editing technology mentioned is CRISPR / Cas9 gene editing technology.
8. The use of an engineered strain as described in any one of claims 1-5 in the production of xylitol using glucose as the sole carbon source.
9. The application according to claim 8, characterized in that, The process includes the following steps: inoculating the engineered strain into a glucose-containing fermentation medium and fermenting it to produce xylitol.
10. The application according to claim 9, characterized in that, The fermentation culture is carried out in a bioreactor, with the dissolved oxygen level controlled at 25%-35% and the glucose concentration in the fermentation broth controlled at 10-30 g / L, and glucose is used as the sole carbon source.