Panax notoginseng ethylene response factor gene PnERF120 and application thereof

Abstract

This invention discloses a Panax notoginseng ethylene response factor gene. PnERF120 Its nucleotide sequence is shown in SEQ ID NO:1, and the encoded amino acid sequence is shown in SEQ ID NO:2. PnERF120 The gene originates from Panax notoginseng, and the encoded protein sequence contains a typical conserved domain of the ERF transcription factor. This invention demonstrates, through gene cloning, bioinformatics analysis, expression pattern analysis, subcellular localization, overexpression, and other techniques and methods, that... PnERF120 This invention can be used to improve the resistance of Panax notoginseng to Panax notoginseng A virus, and also to improve the resistance of tobacco to tobacco mosaic virus. This invention provides new functional genes and application pathways for antiviral breeding and disease-resistant materials of Panax notoginseng and other plants.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology, plant genetic engineering, and plant antiviral breeding technology, specifically relating to a Panax notoginseng ethylene response factor gene. PnERF120 Its application in improving Panax notoginseng's resistance to Panax notoginseng A virus and tobacco's resistance to tobacco mosaic virus. Background Technology

[0002] Plant viral diseases are the second largest plant diseases after fungal diseases, causing serious economic losses to agricultural production in countries around the world. They have become one of the most difficult types of diseases to control in agricultural production (Xiao Qinzhi, Deng Bin, Zou Hailu et al. Research progress on biological control of plant viral diseases. Southern Agriculture, 2021, 15(34): 64-69). Through long-term research, a relatively mature integrated management system for fungal diseases has been established, including chemical control, selection of disease-resistant varieties, and cultivation management. However, plant viruses are obligate parasites that live within living cells. Their replication, movement, and systemic infection are highly dependent on the host plant's metabolic system. In addition, plants lack adaptive immune mechanisms similar to those of higher animals and cannot produce specific antibodies or immune memory. Once a virus invades a plant, it can spread rapidly and cause systemic damage, making control difficult (Anikina I, Kamarova A, Issayeva K, et al. Plant protection from virus: a review of different approaches. Frontiers in Plant Science, 2023, 14: 1163270).

[0003] Sanqi [ Panax notoginseng (Burk.) FH Chen] belongs to the genus Panax (Araliaceae). PanaxPanax notoginseng is a perennial herb and a traditional and precious Chinese medicinal herb, as well as one of the most distinctive local medicinal herbs in Yunnan Province. Its rhizome is used in medicine and has the effects of dispersing blood stasis, stopping bleeding, reducing swelling and relieving pain. Modern research shows that the main active ingredients of Panax notoginseng include saponins, flavonoids, polysaccharides and phenolic acids, among which Panax notoginseng saponins have anti-inflammatory, antioxidant and cardiovascular protective pharmacological effects (Xu Y, Zhu MJ, Feng YB, et al. Panax notoginseng-microbiota interactions:From plant cultivation to medicinal application. Phytomedicine, 2023, 119:154978; Guo Xi et al. Research progress on the components and clinical pharmacological effects of Panax notoginseng saponins. Journal of Nanjing University of Traditional Chinese Medicine, 2024,40(09): 985-992). Since Panax notoginseng prefers shade, it is cultivated in a shaded environment. The warm and humid ecological environment is conducive to the infection and spread of pathogens. Viral diseases, root rot, black spot, gray mold and other diseases have become important factors that limit the yield, quality and sustainable development of Panax notoginseng industry.

[0004] Currently reported viruses infecting Panax notoginseng include cucumber mosaic virus (Cucumber mosaic virus). Cucumber mosaic virus CMV), Tomato Mosaic Virus (CMV) Tomato mosaic virus Tomato Spotted Wilt Virus (ToMV), Tomato spotted wilt virus TSWV), Panax virus Y (PnVY), Chinese tomato yellow leaf curl virus and its satellite, Panax virus A ( Panax notoginseng virus A Multiple viruses, including PnVA, etc. (Guo LF, Yang X, Wu W, et al. Identification and molecular characterization of Panax notoginseng virus A . Archives of Virology, 2016, 161(3): 731-734; Chen HJ, Li WY, Chen XH, etal. Viral infections inhibit saponin biosynthesis and photosynthesis in Panax notoginsengPlant Physiology and Biochemistry, 2023, 203: 1-10). Panax notoginseng plants infected with viral diseases typically exhibit symptoms such as leaf wrinkling, curling, chlorotic mottling, yellowing, mosaic malformation, stunted growth, and poor root and stem development. These symptoms not only affect plant growth and fresh weight accumulation but also interfere with photosynthesis, primary metabolism, and the biosynthesis of medicinal components such as saponins, thereby reducing the yield and quality of Panax notoginseng medicinal materials. Currently, the control of Panax notoginseng viral diseases mainly focuses on cutting off the transmission vector and integrated field management. There is a lack of safe, efficient, and broad-spectrum antiviral agents and mature molecular disease-resistant breeding techniques. Therefore, it is urgent to discover key functional genes from Panax notoginseng's own disease resistance mechanisms that can be used for genetic improvement.

[0005] Transcription factors are crucial hubs in the plant's antiviral defense regulatory network. Ethylene-responsive factors (ERFs) belong to the AP2 / ERF transcription factor superfamily and typically contain highly conserved AP2 / ERF DNA-binding domains. They can recognize cis-acting elements such as GCC-box and DRE / CRT and regulate the expression of downstream defense-related genes, playing important roles in plant growth and development, hormone signal transduction, biotic and abiotic stress responses, and secondary metabolic regulation (Nakano T, Suzuki K, Fujimura T, et al. Genome-wide analysis of the ERF gene family in Arabidopsis and Rice Plant Physiology, 2006, 140(2): 411-432; Feng K, Hou XL, Xing GM, et al. Advances in AP2 / ERF super-family transcription factors in plant. Critical Reviews in Biotechnology, 2020, 40(6): 750-776). Previous studies have shown that many plant ERF members can participate in pathogen infection response, but the key genes of the Panax notoginseng ERF gene family that are directly related to viral defense still lack systematic identification and functional verification. Summary of the Invention

[0006] This invention provides a Panax notoginseng ethylene response factor gene. PnERF120 Its application in improving the resistance of Panax notoginseng to Panax notoginseng A virus (PnVA) and tobacco to tobacco mosaic virus (TMV).

[0007] This invention clones an ethylene response factor gene from Panax notoginseng. PnERF120Its nucleotide sequence is shown in SEQ ID NO:1. The CDS length of this gene is 690 bp, encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0008] Another object of the present invention is to... PnERF120 The gene was applied to improve the resistance of Panax notoginseng to PnVA and tobacco to TMV. The specific operation is as follows: 1. Gene cloning and overexpression vector construction Using cDNA obtained by reverse transcription of total RNA from Panax notoginseng as a template, PnERF120 Specific primers were used to amplify the complete open reading frame, the PCR product was ligated into a T vector and confirmed by sequencing; then... Kpn I and Pst The target fragment was obtained by restriction endonuclease digestion and ligated downstream of the CaMV 35S promoter of the plant expression vector pCAMBIA2300s to construct pCAMBIA2300s- PnERF120 Plant overexpression vectors; 2. Acquisition and Identification of Panax notoginseng Anti-PnVA Materials pCAMBIA2300s- PnERF120 Introducing Agrobacterium tumefaciens ( Agrobacterium tumefaciens LBA4404 was used to transform Panax notoginseng buds via Agrobacterium-mediated transformation; screening was performed using genomic DNA PCR and quantitative reverse transcription PCR (qRT-PCR). PnERF120 Transgenic plants that are positive and highly express PnVA were inoculated with PnVA, and disease symptoms were observed and viral load was detected to identify the resistance of transgenic Panax notoginseng to PnVA. 3. Acquisition and Identification of Tobacco-Resistant TMV Materials pCAMBIA2300s- PnERF120 Agrobacterium tumefaciens GV3101 was introduced and stably transformed into tobacco using the Agrobacterium-mediated transformation method. Transgenic plants exhibiting high expression of this gene were screened by genomic DNA PCR and qRT-PCR. These plants were then inoculated with tobacco mosaic virus (TMV), and disease symptoms such as leaf wrinkling, yellowing, and necrotic spots were observed. TMV levels were also measured. CP The relative expression levels of the gene (encoding the outer shell protein) were used to obtain transgenic tobacco with significantly enhanced TMV resistance.

[0009] This invention clones the Panax notoginseng ethylene response factor gene. PnERF120 The CDS sequence was obtained, and the target gene was transferred into recipient plants and overexpressed using Agrobacterium tumefaciens-mediated transformation. The experiment was conducted to verify whether the gene has the activity of improving plant antiviral resistance, laying the foundation for the later use of this gene to improve the ability of Panax notoginseng to resist PnVA, tobacco to resist TMV, and other plants to resist viral diseases. Attached Figure Description

[0010] Figure 1 This is a multiple sequence alignment diagram of the PnERF120 protein; Figure 2 for PnERF120 A diagram analyzing gene expression patterns in different organs of Panax notoginseng. In the diagram, Tuberous root, Fibrous root, Rhizome, Stem, Leaf, Seed, and Flower represent the main root, fibrous root, cut end, stem, leaf, seed, and flower, respectively. Figure 3 This is a subcellular localization analysis diagram of PnERF120; in the diagram, GFP is the green fluorescent signal, PI is the nuclear staining signal, Bright is the bright field image, and Merged is the overlay image; the top row shows the PnERF120-GFP fusion protein, and the bottom row shows the GFP empty vector control. Figure 4 For overexpression PnERF120 Figure 1 shows the resistance analysis of Panax notoginseng plants to PnVA; Figure A shows the comparison of disease phenotypes of Panax notoginseng plants after inoculation with PnVA; Figure B shows... PnERF120 Figure C shows the expression level detection results; Figure D shows the PnVA viral load detection results. Figure 5 For overexpression PnERF120 Figure 1 shows the resistance analysis of *Nicotiana benthamiana* to TMV. Figure A compares the phenotypic symptom patterns of *Nicotiana benthamiana* leaves after TMV inoculation; Figure B shows the TMV... CP Relative expression level detection results. Detailed Implementation

[0011] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the content described therein; unless otherwise specified, the methods in the embodiments are conventional methods in the art, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0012] Example 1: PnERF120 Gene cloning and sequence analysis Total RNA was extracted from leaves or aerial tissues of Panax notoginseng and reverse transcribed to synthesize cDNA. The Panax notoginseng cDNA was then used as a template for amplification. PnERF120The complete open reading frame was amplified using upstream primer F: ATGAATTCATCTATTTTTCAATCCTTG and downstream primer: TCACCAAGTACTAGAATTATCCGTTAT. The PCR reaction volume was 50 μL, including 5 μL 10× KOD Buffer, 5 μL dNTPs, 3 μL MgSO4, 1.5 μL each of upstream and downstream primers, 1 μL DNA template, 1 μL KOD DNA Polymerase, and ddH2O to a final volume of 50 μL. The PCR program was as follows: 98℃ pre-denaturation for 2 min; 32 cycles of 98℃ for 10 s, 55℃ for 30 s, and 72℃ for 30 s; and a final extension at 72℃ for 5 min. The PCR product was recovered and purified after detection by agarose gel electrophoresis and ligated into the T vector. The ligation system was 10 μL, including 5 μL 2× Rapid Ligation Buffer, 1 μL pGEM-T Easy Vector, 1-3 μL PCR product, 1 μL T4 DNA Ligase, and ddH2O to a final volume of 10 μL. After mixing, ligation was carried out at 16℃ for 12 h. The successfully ligated vector was transformed into E. coli DH5α, and positive clones were obtained after sequencing confirmation. PnERF120 Genes; sequencing results show that PnERF120 The gene's CDS length is 690 bp, and its nucleotide sequence is shown in SEQ ID NO:1, encoding 229 amino acids, the encoded amino acid sequence of which is shown in SEQ ID NO:2.

[0013] Will PnERF120 Sequence alignment with other plant ERF homologous proteins revealed that all aligned sequences form a highly conserved AP2 domain in the mid-segment region. This region contains the signature YRG and RAYD motifs of the ERF transcription factor. The YRG motif, located at the N-terminus of the AP2 domain, is rich in basic amino acids (Arg, Lys) and is a core functional module mediating the binding of transcription factors to DNA cis-elements. The RAYD motif, located at the C-terminus of the AP2 domain, is predominantly composed of hydrophobic amino acids and α-helical structures, responsible for stabilizing the DNA-binding conformation and participating in protein-protein interactions. Figure 1 The results showed that the PnERF120 protein contains the typical AP2 / ERF conserved domain of ERF transcription factors, and it belongs to the ERF class of transcription factors.

[0014] Example 2: PnERF120 Gene expression patterns and subcellular localization analysis 1. Collect different organs of Panax notoginseng, extract total RNA and reverse transcribe it into cDNA, using the Panax notoginseng Actin gene as an internal reference, according to... PnERF120Gene sequence-specific primers were designed for qRT-PCR: upstream primer F: GGGCTAGAATTCGACAATTCC, downstream primer R: CCATACCCTCATGCCATTTC; qRT-PCR was used for detection. PnERF120 The level of expression; The reaction volume was 20 μL, including 10 μL of 2× GoTaq® qPCR Master Mix, 0.2 μL each of forward and reverse primers, 1 μL of cDNA template, and Nuclease-Free Water to bring the volume to 20 μL. The amplification program was 95℃ pre-denaturation for 2 min, followed by 95℃ for 15 s and 60℃ for 1 min, for a total of 40 cycles. Figure 2 The results show PnERF120 The expression level is high in the stems and leaves of Panax notoginseng, but low in the taproot, fibrous roots, cut surfaces and flowers.

[0015] 2. According to PnERF120 Sequence-specific primers were designed, and PCR amplification was performed using Panax notoginseng cDNA as a template (amplification system as above). The recovered target fragment was ligated into the pGEM-T vector to obtain pGEM-T- PnERF120 Recombinant carrier; pGEM-T- PnERF120 Plasmids and subcellular localization vectors pBIN m-gfp-ER were respectively used for... Kpn I and Pst I. Double enzyme digestion; The digested and purified DNA was then purified using T4 DNA ligase. PnERF120 The fragment was linked to the linearized pBIN m-gfp-ER vector to construct pBIN m-gfp- PnERF120 Fusion expression plasmids; Will contain pBINm -gfp-ER- PnERF120 Recombinant plasmid and pBIN m-gfp-ER bacterial suspensions were streaked onto LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampin, respectively, and incubated in the dark at 28°C for 3-4 days. The grown bacterial colony was scraped and inoculated into 50 mL MGL medium (containing 50 μL of 25 mg / mL acetylsyl syringone), and incubated at 28°C with shaking at 200 rpm for 3-4 hours. Fresh onion bulbs that had undergone 3-4 days of dark acclimatization were used, and approximately 1.5 × 1.5 mm incisions were made in the inner epidermis using a microsurgical scalpel in a clean bench. 2A grid of varying sizes was prepared. The onion epidermis was gently peeled off and immersed in the MGL medium containing the bacterial growth. The mixture was incubated at 28°C with shaking for 20 minutes at 200 rpm. The onion epidermis was removed from the MGL medium, the surface medium was blotted dry with sterile filter paper, and the onion was transferred to a co-culture medium and spread evenly. It was then co-cultured in the dark for 24 hours. The co-cultured onion epidermis was then used to prepare slides, and the expression of green fluorescent protein within the cells was observed using a laser confocal microscope.

[0016] Figure 3 The results showed that the PnERF120-GFP signal overlapped with the PI nuclear staining signal, indicating that the PnERF120 protein is located in the cell nucleus.

[0017] Example 3: Overexpression PnERF120 Resistance analysis of transgenic Panax notoginseng plants to PnVA Select Kpn I and Pst I restriction site, through double digestion PnERF120 The complete open reading frame (ORF) was cloned downstream of the CaMV 35S promoter in the plant overexpression vector pCAMBIA2300s to construct the recombinant plasmid pCAMBIA2300s- PnERF120 And it was verified by sequencing. Next, the recombinant plasmid pCAMBIA2300s- PnERF120 The recombinant plasmid was introduced into *E. coli* DH5α competent cells via heat shock. After verification by colony PCR and sequencing, the plasmid was extracted and transformed into *Agrobacterium* LBA4404 competent cells using a freeze-thaw method. *Agrobacterium* bacterial suspension containing the recombinant plasmid was injected into the cut surfaces of *Panax notoginseng*. After new leaves emerged from the *Panax notoginseng*, genomic DNA was extracted and used... PnERF120 PCR amplification was performed using specific primers to screen for positive transgenic lines. Total RNA was further extracted from positive plants and reverse transcribed into cDNA, which was then detected by qRT-PCR. PnERF120 The relative expression level of Panax notoginseng Actin Genes are used as internal controls, using 2 -ΔΔCt The relative expression level was calculated using a method to screen and obtain... PnERF120 Overexpression plants with high expression levels were identified and analyzed. PnERF120 Effect of overexpression on PnVA resistance. Leaves of positive overexpressing plants and control plants (transformed with empty vector) were inoculated with the PnVA infectious clonal vector. Symptoms were observed and recorded regularly after inoculation. Samples were taken on day 14 post-inoculation, and PnVA load was detected using qRT-PCR to analyze viral accumulation levels.

[0018] Figure 4 The results showed that the control plants (empty vector) exhibited more obvious symptoms of leaf wrinkling, yellowing, or mottling, and overexpression of [a specific substance / method]. PnERF120 plant ( PnERF120-OE) symptoms are milder, overexpression PnERF120 The viral load decreased significantly afterward, indicating that PnERF120 Overexpression can enhance the resistance of Panax notoginseng to PnVA.

[0019] Example 4: Overexpression PnERF120 Analysis of resistance of Tobacco Bunsenii to TMV The recombinant plasmid pCAMBIA2300s- PnERF120 Agrobacterium GV3101 competent cells were transferred using the heat shock method. Single colonies were picked and cultured in LB broth containing the appropriate antibiotics until the logarithmic growth phase. The cells were collected by centrifugation and resuspended in osmotic buffer (10 mM 2-morpholinoethanesulfonic acid, 10 mM MgCl2, 150 μM acetylsuccinone) to OD200. 600 The bacterial suspension was approximately 1.0. Using a sterile, needle-free syringe, the bacterial suspension was injected into fully expanded leaves of 4-5 week old *Nicotiana benthamiana*, with leaves injected with empty pCAMBIA2300s as a negative control. After injection, the leaves were incubated in a greenhouse for 72 hours. CMV was then inoculated into the same injection area. After 14 days of incubation, local and systemic symptoms (chlorosis, necrotic spots, malformation, etc.) were observed and recorded. Tissue samples were collected from the injection area using a perforator, and CMV virus was quantitatively detected by qRT-PCR. CP Relative gene expression levels were used to assess viral accumulation and antiviral efficacy. Compared to the control (empty vector), overexpression... PnERF120 Benedict's tobacco ( PnERF120 -OE) TMV symptoms are alleviated, and TMV accumulation is reduced ( Figure 5 ), can be seen through expression PnERF120 It can improve the resistance of tobacco Benzovia to TMV.

[0020] The above embodiments show that, PnERF120 The gene can serve as a functional gene to enhance the resistance of Panax notoginseng to PnVA and tobacco to TMV, and can be used for plant antiviral breeding and the creation of disease-resistant materials. This invention provides... PnERF120 The gene and its application methods can be used for molecular breeding of Panax notoginseng for antiviral activity, screening of disease-resistant germplasm, and development of plant antiviral functional gene resources. This method can be achieved through conventional molecular cloning, Agrobacterium-mediated genetic transformation, and qPCR, with a clear operational pathway and promising applications in scientific breeding and disease resistance improvement of medicinal plants.

Claims

1. A gene for a Panax notoginseng ethylene response factor PnERF120 Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The Panax notoginseng ethylene response factor gene as described in claim 1 PnERF120 Application in improving Panax notoginseng's resistance to Panax notoginseng A virus.

3. The Panax notoginseng ethylene response factor gene as described in claim 1 PnERF120 Application in improving tobacco resistance to tobacco mosaic virus.

Images