Method for synchronously and efficiently metabolizing mixed sugar based on pichia mixed flora and application thereof

Abstract

The application discloses a method for synchronously and efficiently metabolizing mixed sugar based on a Pichia pastoris mixed flora and application thereof. The Pichia pastoris mixed flora comprises at least one Pichia pastoris engineering strain for xylose metabolism and one Pichia pastoris engineering strain for oligosaccharide metabolism. By means of functional division of the strains, the interference of glucose signal on the xylose metabolic pathway is physically and genetically isolated, and the synchronous metabolism of xylose and cellulosic oligosaccharide is realized. The metabolic burden of each strain is reduced, the exclusive pathway of each strain can be optimized, the pathway competition and the imbalance of auxiliary factors are avoided, the overall fermentation rate and the sugar conversion rate are improved. The mixed flora system has a certain buffering capacity to environmental fluctuations and is more stable than a single strain. The strategy is particularly suitable for complex lignocellulose hydrolysate, and can effectively solve the problem of asynchronous utilization of multiple fermentable sugars in the lignocellulose hydrolysate and improve the total utilization rate of raw materials. In the process of simultaneous saccharification and fermentation of the mixed flora, the utilization rate of xylose and cellulosic oligosaccharide is improved, and the integrated biorefinery cycle is shortened.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation and metabolic engineering, and to a method for the synchronous and efficient metabolism of mixed sugars based on a Pichia pastoris mixed microbial community and its application. Specifically, it relates to a method for constructing a genetically engineered Pichia pastoris (Komagataella phaffii) mixed microbial community and its application in the synchronous and efficient metabolism of mixed sugar substrates containing oligosaccharides such as glucose, xylose and cellobiose, which is particularly suitable for the biotransformation of complex raw materials such as lignocellulose hydrolysate. Background Technology

[0002] Pichia pastoris is an important industrial microbial platform, widely used due to its strong protein expression capabilities and good adaptability to high-density fermentation. However, wild-type Pichia pastoris typically preferentially utilizes glucose, exhibiting weak or absent metabolic capabilities for other monosaccharides (such as xylose) or disaccharides (such as cellobiose). More importantly, the presence of glucose in the environment triggers a strong carbon catabolite repression (CCR) effect, inhibiting the expression of genes related to other carbohydrate metabolism, leading to asynchronous utilization of mixed sugars, prolonged fermentation cycles, low substrate utilization, and decreased product yield.

[0003] Existing technologies have attempted to introduce exogenous xylose metabolic pathways (such as xylose reductase XR, xylitol dehydrogenase XDH, or xylose isomerase XI) and cellobiose metabolic pathways (such as secretory or intracellular β-glucosidase) into Saccharomyces cerevisiae. However, integrating these pathways into a single strain often faces problems such as excessive metabolic burden, cofactor imbalance, inter-pathway competition, and difficulty in completely eliminating the CCR effect. In mixed sugar fermentation by the same strain, differences in substrate metabolic pathways lead to carbon flux loss. Especially in real substrates containing glucose, xylose, and oligosaccharides, such as lignocellulose hydrolysate, it is difficult to achieve efficient utilization of mixed sugar solutions by modifying a single strain. Existing technologies also make it difficult to flexibly adjust pathway expression for different substrate ratios or different metabolic needs.

[0004] Therefore, developing a Pichia pastoris mixed fermentation technology that can avoid the CCR effect and achieve efficient and simultaneous utilization of mixed sugar components is of great significance for reducing biorefining costs and improving process efficiency. Summary of the Invention

[0005] To overcome the shortcomings and deficiencies of existing Pichia pastoris methods for metabolizing mixed sugars, such as the CCR effect, asynchronous sugar utilization, excessive metabolic burden, and low efficiency, the present invention aims to provide a method for the synchronous and efficient metabolism of mixed sugars based on a mixed Pichia pastoris microbiota and its application. This invention creatively proposes a strategy of employing a well-defined division of labor among mixed Pichia pastoris microbiota, rather than modifying a single strain, to achieve efficient synchronous metabolism of mixed sugars.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention breaks down and recombines the complete mixed sugar metabolism capabilities to construct an engineered strain that is primarily glucose-metabolizing, but also possesses metabolic capabilities such as xylose or cellulosic sugars, and is compatible and symbiotic with each other. Through the synergistic effect among the bacterial communities, the CCR effect is naturally avoided in the fermentation system.

[0008] A Pichia pastoris mixed microbial community, wherein the mixed microbial community comprises at least one engineered Pichia pastoris strain that metabolizes xylose and one engineered Pichia pastoris strain that metabolizes oligosaccharides.

[0009] A Pichia pastoris engineered strain that metabolizes xylose, the strain being engineered to utilize xylose in addition to metabolizing glucose. Specifically, it comprises the following: construction by introducing a heterologous xylose metabolic pathway into Pichia pastoris.

[0010] Furthermore, the xylose metabolic pathway includes xylose reductase, xylulose isomerase, and xylulose kinase.

[0011] Specifically, a xylose-metabolizing Pichia pastoris engineered strain is obtained by performing any of the following operations on a Pichia pastoris starting strain:

[0012] (a) Heterologous expression of xylose reductase XR gene and xylitol dehydrogenase XDH gene, and simultaneous expression of xylulose kinase XK gene;

[0013] Alternatively, (b) heterologously express the xylose reductase XR gene and the xylitol dehydrogenase XDHm gene, while simultaneously expressing the xylulose kinase XK gene.

[0014] Among them, XR is xylose reductase XR from Pichia stipitis; XDH is xylitol dehydrogenase XDH from Pichia stipitis; XK is xylulose kinase XK from Pichia stipitis; and XDHm is xylitol dehydrogenase XDH from Pichia stipitis obtained by mutation of D207A / I208R / F209S / N211R.

[0015] Furthermore, the nucleotide sequences of the XR gene, XDH gene, XK gene, and XDHm gene are nucleotide sequences optimized by Pichia pastoris codons.

[0016] Furthermore, the nucleotide and amino acid sequences of the above genes are shown in Table 3.

[0017] Furthermore, the starting strain of Pichia pastoris includes Pichia pastoris GS115 or Pichia pastoris X33, etc.

[0018] Furthermore, the above-mentioned gene is used to construct a gene expression cassette using the constitutive promoter GCW14; the constitutive promoter GCW14 is a constitutive promoter derived from Pichia pastoris, and its nucleotide sequence is shown in SEQ ID NO: 7.

[0019] Furthermore, the above-mentioned genes are integrated using Pichia pastoris neutral sites; the Pichia pastoris neutral sites include, but are not limited to, PNSII-1, PNSI-2, PNSI-4, PNSI-6, PNSI-8, PNSI-9, PNSI-10, PNSI-12, PNSI-14, PNSI-16, PNSII-4, PNSII-5, PNSII-6, etc.; specifically, the XR gene, XDH gene, and XK gene, or the XR gene, XDHm gene, and XK gene, are integrated into the PNSII-1 site.

[0020] Furthermore, during the integration of the aforementioned genes, CRISPR / Cas9 genome editing technology is used for seamless gene knock-in. CRISPR / Cas9 gene editing technology is a technique for specifically modifying the DNA of a target gene. By designing specific guide RNAs (gRNAs), they bind to the target DNA sequence. Subsequently, the Cas9 protein, guided by the gRNA, precisely cuts the target DNA. During the process of DNA repair, the cell may introduce mutations or insert new gene fragments, thereby achieving gene editing.

[0021] The method for constructing the above-mentioned engineered Pichia pastoris strain that metabolizes xylose includes the following steps:

[0022] (A1) Based on Pichia pastoris GS115, the XR gene, XDH gene, and XK gene were heterologously expressed to obtain engineered strain GX1;

[0023] Alternatively, (A2) based on Pichia pastoris GS115, the XR gene, XDHm gene, and XK gene were heterologously expressed to obtain engineered strain GX2.

[0024] An engineered Pichia pastoris strain that metabolizes oligosaccharides, capable of utilizing oligosaccharides (such as cellobiose) in addition to glucose metabolism. Specifically, it comprises the following: constructed by introducing a heterologous oligosaccharide metabolic pathway into Pichia pastoris.

[0025] Furthermore, the oligosaccharide metabolic pathway includes oligosaccharide transporters and β-glucosidase.

[0026] Furthermore, using Pichia pastoris as the host strain, the β-glucosidase GH1-1 gene and the oligosaccharide transporter CDT-1 gene were expressed in the host strain.

[0027] Specifically, an engineered strain of Pichia pastoris that metabolizes oligosaccharides is obtained by performing the following operations on Pichia pastoris:

[0028] Heterologous expression of the β-glucosidase GH1-1 gene and the oligosaccharide transporter CDT-1 gene.

[0029] Among them, the GH1-1 gene is the β-glucosidase GH1-1 derived from Neurospora crassa, and the CDT-1 gene is the oligosaccharide transporter CDT-1 derived from Neurospora crassa.

[0030] Furthermore, the nucleotide sequences of the GH1-1 and CDT-1 genes are nucleotide sequences optimized by Pichia pastoris codons, respectively.

[0031] Furthermore, the nucleotide and amino acid sequences of the above genes are shown in Table 3.

[0032] Furthermore, the Pichia pastoris includes Pichia pastoris GS115 or Pichia pastoris X33, etc.

[0033] Furthermore, the above-mentioned gene is used to construct a gene expression cassette using a constitutive promoter GAP; the constitutive promoter GAP is a constitutive promoter GAP derived from Pichia pastoris.

[0034] Furthermore, the above-mentioned genes were inserted into plasmids pPIC9K or pPICZA, which replaced the AOX1 promoter with the GAP promoter, and integrated into the GAP site on the Pichia pastoris genome.

[0035] The method for constructing the above-mentioned engineered Pichia pastoris strain that metabolizes oligosaccharides includes the following steps:

[0036] Based on the Pichia pastoris GS115 strain, the GH1-1 gene and CDT-1 gene were heterologously expressed to obtain the engineered strain COS03.

[0037] Furthermore, in the Pichia pastoris mixed microbiota, engineered Pichia pastoris strains that metabolize xylose and engineered Pichia pastoris strains that metabolize oligosaccharides are mixed at an initial inoculum concentration ratio of 1-3:3-1; even more specifically, it is 1:3-1.

[0038] The application of the above-mentioned Pichia pastoris mixed microbiota in the fermentation of mixed sugars.

[0039] Furthermore, the mixed sugars include xylose and oligosaccharides.

[0040] The above-mentioned Pichia pastoris mixed flora is used in the preparation of biofuels, chemicals or recombinant protein products.

[0041] The application of the above-mentioned Pichia pastoris mixed microbial community in biorefining using lignocellulose hydrolysate.

[0042] A method for the simultaneous and efficient metabolism of mixed sugars based on a Pichia pastoris mixed microbiota includes the following steps:

[0043] After culturing the above-mentioned engineered strains of Pichia pastoris that metabolize xylose and engineered strains that metabolize oligosaccharides separately, they were then co-inoculated into a culture medium containing mixed sugars for fermentation.

[0044] In the early stages of fermentation, the mixed microbial community rapidly consumes glucose. After the glucose is metabolized, the mixed microbial community metabolizes xylose and oligosaccharides, thus enabling Pichia pastoris to metabolize the mixed sugars.

[0045] Furthermore, after culturing the xylose-metabolizing Pichia pastoris engineered strain and the oligosaccharide-metabolizing Pichia pastoris engineered strain separately, they are inoculated according to the inoculation ratio. The inoculation ratio of the xylose-metabolizing Pichia pastoris engineered strain to the oligosaccharide-metabolizing Pichia pastoris engineered strain is determined according to the mass ratio (or molar ratio) of xylose to oligosaccharide in the mixed sugar, so that the growth rates of the two engineered strains in the mixed system are matched to synergistically improve the metabolic efficiency of the mixed sugar.

[0046] Furthermore, the oligosaccharide includes cellulose oligosaccharide, which is an oligosaccharide composed of 2 to 6 glucose molecules linked by β-1,4-glycosidic bonds; further still, the cellulose oligosaccharide includes at least one of cellobiose, cellotriose, cellotetraose, cellopentaose, and cellohexaose.

[0047] Furthermore, the dose for co-vaccination is the initial OD. 600 =0.9~1.1; the fermentation conditions are 30±1℃, 250±10 rpm, fermentation culture for 20~60 h; the mixed sugar content in the culture medium is 1.0~4.0% cellobiose and 1.0~4.0% xylose; further, it is 1.0~2.0% cellobiose and 1.0~2.0% xylose.

[0048] Furthermore, the engineered strains of Pichia pastoris that metabolize xylose and Pichia pastoris that metabolize oligosaccharides were mixed at an initial inoculum concentration ratio of 1–3:3–1; even further, the ratio was 1:3–1.

[0049] Furthermore, the Pichia pastoris mixed microbiota can metabolize both xylose and oligosaccharides simultaneously, and the xylose metabolism capacity is not affected.

[0050] No repression effect of glucose on carbon metabolites of xylose metabolism occurs during the fermentation process.

[0051] The present invention has the following advantages and effects compared with the prior art:

[0052] (1) This invention, through functional division of strains, physically and genetically isolates the interference of glucose signals on the xylose metabolic pathway, achieving synchronous metabolism of xylose and cellulosic oligosaccharides. The metabolic burden of each strain is reduced, its specific pathway can be optimized, avoiding pathway competition and cofactor imbalance, and the overall fermentation rate and sugar conversion rate are improved. The mixed microbial community system has a certain buffering capacity against environmental fluctuations and is more stable than a single strain. This strategy is particularly suitable for complex lignocellulose hydrolysates, and can effectively solve the problem of asynchronous utilization of multiple fermentable sugars, thereby improving the overall utilization rate of raw materials. The mixed microbial community is set up with cellulosic oligosaccharides and xylose in lignocellulose hydrolysates as the starting point, and integrates with the biorefining process. During the synchronous saccharification and fermentation process, the utilization rate of xylose and cellulosic oligosaccharides is improved, and the integrated biorefining cycle is shortened.

[0053] (2) The mixed microbial community of the present invention plays a role in enabling independent substrate metabolism pathways and reducing the influence between different pathways. Each pathway operates independently in different cell factories, avoiding competition of metabolic nodes within the same cell, so that each engineered microorganism can specifically and efficiently convert the corresponding substrate into the target product.

[0054] (3) By decoupling the xylose metabolism module from the oligosaccharide metabolism module, the inoculation ratio can be independently adjusted according to the actual composition of xylose / oligosaccharide in the mixed sugar (e.g., inoculated in proportion to the substrate concentration), without the need to modify the strains. This modular strategy enables the same microbial community system to adapt to raw materials with fluctuating sugar compositions (e.g., lignocellulose hydrolysate, molasses, etc.), and can be further extended to the metabolism of other rare sugars or oligosaccharides, exhibiting strong technical universality and industrial application flexibility. Attached Figure Description

[0055] Figure 1 This is a diagram of xylose metabolism in strains GS115 and GX2 in Example 2 of the present invention.

[0056] Figure 2 The residual cellobiose and biomass (OD) of X33, COS01, COS02 and COS03 after 24 h of fermentation in Example 4 of this invention are shown. 600 The result image.

[0057] Figure 3 This is a schematic diagram of a fermentation method using mixed microbial communities in xylose, xylose and glucose, and xylose and cellobiose media.

[0058] Figure 4This is a graph showing the growth curve and xylose consumption curve of the mixed bacterial community in Example 5 of the present invention after fermentation for 20 h in xylose, xylose and glucose, and xylose and cellobiose media.

[0059] Figure 5 This is a graph showing the glucose and cellobiose consumption curves of the mixed bacterial community fermenting in xylose and glucose, and xylose and cellobiose culture media in Example 5 of the present invention.

[0060] Figure 6 This is a graph showing the cellobiose consumption curves of mixed bacterial communities with different mixing ratios in a mixed sugar culture medium of xylose and cellobiose in Example 6 of the present invention.

[0061] Figure 7 This is a graph showing the xylose consumption curves of mixed bacterial communities with different mixing ratios in a mixed sugar culture medium of xylose and cellobiose in Example 6 of the present invention.

[0062] Figure 8 This is a graph showing the growth curves of mixed bacterial communities with different mixing ratios in a mixed sugar culture medium of xylose and cellobiose in Example 6 of the present invention. Detailed Implementation

[0063] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed under conventional experimental conditions or according to the manufacturer's recommended experimental conditions. Unless otherwise specified, the materials and reagents used are commercially available.

[0064] Information on strains and plasmids involved in the specific implementation method:

[0065] Table 1. Strain Information

[0066]

[0067] Table 2 Plasmid Information

[0068]

[0069] The Addgene_83946 plasmid used in this invention is named pCfB2312 (TEF1p-Cas9-CYC1t_kanMX), which is a commercial yeast CRISPR / Cas9 plasmid purchased from the Addgene plasmid sharing library (https: / / www.addgene.org / 83946 / ).

[0070] The neutral integration sites used above are disclosed in the paper “Cai P, Duan X, Wu X, Gao L, Ye M, ZhouYJ. Recombination machinery engineering facilitates metabolic engineering of the industrial yeast Pichia pastoris. Nucleic Acids Res. 2021 Jul 21;49(13):7791-7805. doi: 10.1093 / nar / gkab535. PMID: 34197615; PMCID:PMC8287956.”.

[0071] Table 3 Gene Information

[0072]

[0073] Note: The nucleotide sequences of xylose reductase XR, xylitol dehydrogenase XDH, xylulose kinase XK, oligosaccharide transporter CDT-1, and β-glucosidase GH1-1 from *Neurospora crassa*, after codon optimization by *Pichia pastoris*, are shown in SEQ ID NO: 1-5, respectively.

[0074] Example 1: Construction of Xylose Metabolizing Engineered Bacteria

[0075] 1. Construction of the PNSⅡ-1-GXR-GXDH-GXK integrated vector

[0076] Using pPICZA as the starting plasmid, 800 bp each of the upstream and downstream homologous arms of the target sequence (Table 2) of the Pichia pastoris neutral site PNSⅡ-1 were constructed into the pPICZA plasmid to obtain the plasmid pPICZA-PNSⅡ-1. up -PNSⅡ-1 down (Named plasmid PNSⅡ-1-HA; wherein, the upstream homologous arm 800bp is inserted between the ori element and the AOX1 promoter, and an HpaI restriction site is introduced at the 5' end; the downstream homologous arm 800bp is inserted between the AOX1 terminator and the TEF1 promoter, and an AvrII restriction site is introduced at the 5' end and a BspEI restriction site is introduced at the 3' end).

[0077] Xylose reductase XR, xylitol dehydrogenase XDH, or xylitol dehydrogenase mutant XDHm from Pichia pastoris were synthesized after codon optimization and integrated between the EcoRI and NotI restriction sites of the pPICZA plasmid, respectively. The AOX promoter in the plasmid was then removed by digestion with BglII and EcoRI. The Pichia pastoris genome was amplified using primer 1 (5'-tccagatctCAGGTGAACCCACCTAACTAT-3') and primer 2 (5'-catgaattcctTTTTGTTGTTGAGTGAAGCGAGT-3') to obtain the GCW14 promoter sequence (SEQ ID NO: 7). The GCW14 promoter sequence was then double-digested with BglII and EcoRI. The two fragments were ligated using DNA ligase to obtain plasmids PGCW14-XR, PGCW14-XDH, PGCW14-XDHm, and PGCW14-XK. The expression cassette sequences from the GCW14 promoter to the AOX1 terminator in the plasmids were named GXR, GXDH, GXDHm, and GXK, respectively.

[0078] The PNSⅡ-1-HA vector was obtained by digestion with BglII and AvrII enzymes. Using PGCW14-XR as a template, GXR was amplified by primer 3 (5'-ccgttcctacttcaaaagtccagatctCAGGTGAACCCACCTAACTAT-3') and primer 4 (5'-ggcgcaagtttggttactggcctaggTCTCACTTAATCTTCTGTACTCTG-3'). Homologous recombination, a common method in molecular cloning, was used to ligate the vector to obtain plasmid PNSⅡ-1-GXR.

[0079] The plasmid PNSⅡ-1-GXR was digested with AvrII to obtain the vector, which was then amplified with primer 5 (5'-cagagtacagaagattaagtgagaccttcgtttgtgcCAGGTGAACCCACCTAACTAT-3') and primer 4 to obtain plasmid PGCW14-XDH or PGCW14-XDHm and GXDHm. The resulting GXDH or GXDHm was then ligated by homologous recombination to obtain plasmid PNSⅡ-1-GXR-GXDH or PNSⅡ-1-GXR-GXDHm.

[0080] The plasmid PNSⅡ-1-GXR-GXDH or PNSⅡ-1-GXR-GXDHm was digested with AvrII to obtain the vector. The vector was then amplified with primers 5 and 4 to obtain GXK from plasmid PGCW14-XK. The vector was then ligated by homologous recombination to obtain plasmid PNSⅡ-1-GXR-GXDH-GXK or PNSⅡ-1-GXR-GXDHm-GXK.

[0081] The strain information is shown in Table 1, the plasmid information in Table 2, and the gene information in Table 3.

[0082] 2. Construction of Cas9-gPNSⅡ-1

[0083] Using the commercial yeast CRISPR / Cas9 plasmid Addgene_83946 as a template, PCR was performed using primers F1 and R-10 to obtain a circular PCR product. After template digestion, the circular PCR product was transformed into E. coli TOP10 using a 42℃ heat shock method. The product was then plated on LB resistant plates containing 100 μg / mL of ampicillin. After single colonies grew, the product was sent to the company for whole-plasmid sequencing. The plasmid with correct sequencing was named Cas9-gPNSⅡ-1 plasmid.

[0084] F1: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT-3' (Universal for all sites);

[0085] R-10: 5'-GCTATTTCTAGCTCTAAAAC taaagtaacagagcatcctg GCGTCACAGACAGGATTCG-3'; where the lowercase part is the gRNA of the neutral site PNSⅡ-1.

[0086] 3. Yeast electroporation conversion method

[0087] (1) Linearize the successfully constructed PNSⅡ-1-GXR-GXDH-GXK or PNSⅡ-1-GXR-GXDHm-GXK plasmids using HpaI and BspEI, incubate at 37 ℃ for 2-3 h, and then recover the product using a kit to obtain the donor fragment for electroporation: PNSⅡ-1 up -GXR-GXDH-GXK-PNSⅡ-1 down Or, PNSⅡ-1 up -GXR-GXDHm-GXK-PNSⅡ-1 down ;

[0088] Specifically, the linearization system consisted of (50 μL): 5 μL of 10×FastDigest Buffer, 2.5 μL of each enzyme, 2.0–3.0 μg of plasmid, and ddH2O to 50 μL. After the reaction, the linearization system was recovered using a PCR product recovery kit.

[0089] (2) Take the linearized fragment (donor) and mix it with 1.5-2.0 μg of Cas9-gPNSⅡ-1 plasmid, add it to Pichia pastoris GS115 competent cells, mix gently, transfer the mixture to an electric shock cup in an ice bath, and place it on ice for 5 min.

[0090] (3) Set the parameters of the electric shock device to Fungi mode, wipe the water off the outside of the electric shock cup, perform electric shock, and then add 1 mL of 1 M sorbitol in an ice bath.

[0091] (4) Aspirate all the mixture from the electroporation cup and transfer it to a 1.5 mL centrifuge tube. Place it in a 30 ℃ incubator and incubate for 1.0 to 1.5 h. Then centrifuge at 4000 rpm for 5 min.

[0092] (5) After removing the supernatant, resuspend the bacterial cells in 800-1000 μL of YPD medium. Place it on a constant temperature shaker and set the conditions to 30 ℃, 250 rpm, for 1.5-2 h, then centrifuge at 4000 rpm for 5 min.

[0093] (6) Remove 800-900 μL of supernatant, resuspend the bacterial cells in the remaining supernatant, and spread them all onto YPD (YPDG) plates containing 200-250 μg / mL G418 antibiotic. Incubate at 30 ℃ in an inverted incubator for 2-3 days.

[0094] 4. Recombinant strain resistance knockout

[0095] (1) Identify the transformants from step 3. For correctly identified strains, inoculate them into 10 mL of YPD liquid medium, place them on a shaker, and incubate overnight at 30 ℃ and 250 rpm.

[0096] (2) On a clean bench, use a sterile inoculation loop or pipette tip to dip a small amount of bacterial solution into an antibiotic-free YPD plate and streak it on the plate. Then place the plate in a 30 ℃ incubator and invert it for 1 to 2 days.

[0097] (3) On the clean bench, pick up a small amount of Pichia pastoris single colony with a sterile pipette tip and mix it with 5 μL of sterile water by blowing and aspiration. Then, take 2.5 μL of the mixture and spot it on YPD and YPDG plates respectively. Place the plates in a 30 ℃ constant temperature incubator and invert them for 1-2 days.

[0098] (4) Observe the YPD and YPDG plates after spot culture. If there are no colonies on the YPDG plate, but the colonies on the corresponding positions on the YPD plate grow normally, it proves that the G418 resistance of the recombinant strain has been successfully removed. At this time, the corresponding colonies on the YPD plate are the engineered bacteria GX1 or GX2.

[0099] Example 2: Verification of xylose fermentation by strain

[0100] The starting strain GS115 and the engineered strain GX2 were each inoculated into 10 mL of YPG medium and cultured in a constant-temperature shaker for 24 h at 30 °C and 250 rpm. Then, the initial OD was used as the starting material. 600 =1 was transferred to 25 mL of YPX medium and cultured for 48 h. Samples were taken at 0, 6, 12, 20, 28, 36, and 48 h to determine the xylose content. The xylose detection method was as follows: 1 mL of fermentation broth was centrifuged at 12000 rpm, and the supernatant was sterilized through an aqueous filter membrane before being analyzed by liquid chromatography (LC). The LC detection conditions were: an amino chromatography column (Waters XBridge Amide 3.5 μm, 4.6 × 250 mm), and a Shimadzu LC-16 high-performance liquid chromatograph. The mobile phase consisted of 80% acetonitrile, 20% water, and 0.1% ammonia; the flow rate was 1.0 mL / min; the temperature was 40℃; a differential detector was used; and the injection volume was set to 10 μL.

[0101] Experimental results:

[0102] Starting with GS115, xylose reductase XR, xylitol dehydrogenase mutant XDHm, and xylulose kinase XK from *Pichia pastoris* were heterologously introduced to construct strain GX2. Fermentation was carried out in a xylose-containing medium YPX, such as... Figure 1 As shown, after 20 h of fermentation, strain GX2 completely consumed the xylose in the culture medium. The xylose metabolism capacity of the engineered strain GX2 was superior to that of the starting strain GS115. Therefore, strain GX2 was selected as the xylose metabolism strain in the mixed sugar metabolism.

[0103] The YP medium consisted of 10 g / L yeast extract and 20 g / L peptone.

[0104] YPG medium: Add glycerol to YP medium to a final concentration of 10 g / L.

[0105] YPX medium: Add xylose to YP medium to a final concentration of 10 g / L.

[0106] Example 3: Construction of Oligosaccharide Metabolic Strains

[0107] 1. Construction of the integrated vectors pGAPZA-GH1-1 and pPIC9K-GAP-CDT-1

[0108] Genes GH1-1 or CDT-1 were optimized using Pichia pastoris codons, and gene GH1-1 was synthesized between the BstBI and KpnI restriction sites on pGAPZA to obtain plasmid pGAPZA-GH1-1.

[0109] Using pPIC9K as the starting plasmid, homologous recombination, a method commonly used in molecular cloning, was employed to replace the AOX1 promoter with the GAP promoter of Pichia pastoris and insert the CDT-1 gene between the BamHI and NotI restriction sites, resulting in the plasmid pPIC9K-GAP-CDT-1.

[0110] 2. Yeast electroporation conversion method

[0111] (1) Linearize the successfully constructed pGAPZA-GH1-1 or pPIC9K-GAP-CDT-1 plasmids using enzyme AvrII, place them at 37 ℃ for constant temperature reaction, and recover the product using a kit after 2-3 h to obtain the linearized fragment for electroporation.

[0112] Specifically, the linearization system consisted of (50 μL): 5 μL of 10×FastDigest Buffer, 2.5 μL of enzyme, 2.0–3.0 μg of plasmid, and ddH2O to 50 μL. After the reaction, the linearization system was recovered using a PCR product recovery kit.

[0113] (2) Take the linearized fragment (donor) and add it to Pichia pastoris GS115 competent cells. After gently mixing, transfer the mixture to an electric shock cup in an ice bath and place it on ice for 5 min.

[0114] (3) Set the parameters of the electric shock device to Fungi mode, wipe the water off the outside of the electric shock cup, perform electric shock, and then add 1 mL of 1 M sorbitol in an ice bath.

[0115] (4) Aspirate all the mixture from the electroporation cup and transfer it to a 1.5 mL centrifuge tube. Place it in a 30 ℃ incubator and incubate for 1.0 to 1.5 h. Then centrifuge at 4000 rpm for 5 min.

[0116] (5) After removing the supernatant, resuspend the bacterial cells in 800-1000 μL of YPD medium. Place it on a constant temperature shaker and set the conditions to 30℃, 250 rpm, for 1.5-2 h, then centrifuge at 4000 rpm for 5 min.

[0117] (6) Remove 800-900 μL of supernatant, resuspend the bacterial cells in the remaining supernatant, and spread them all on plates (the introduced pGAPZA-GH1-1 strain was spread on YPD plates containing 100 ng / μL Zeocin antibiotic, and the introduced pPIC9K-GAP-CDT-1 strain was spread on MD plates), and incubate in an inverted state at 30 ℃ for 2-3 days.

[0118] (7) Identify the transformants. Colonies that correctly identify the GH1-1 gene are engineered bacteria COS01, and colonies that correctly identify the CDT-1 gene are engineered bacteria COS02.

[0119] 3. Following the gene introduction steps described above, integrate the CDT-1 gene into the genome of the engineered strain COS01. Screen on MD plates. Colonies that successfully identify both the GH1-1 gene and the CDT-1 gene are engineered strains COS03.

[0120] Example 4: Cellobiose fermentation

[0121] Control strain X33, engineered strains COS01, COS02, and COS03 were inoculated into 10 mL of YPG medium and cultured in a constant temperature shaker for 24 h at 30 °C and 250 rpm. The initial OD was then used as the starting point. 600 =1.0 was transferred to 25 mL of YPCB medium and cultured for 48 h. Samples were taken 24 h after fermentation to determine the cellobiose content. The cellobiose detection method was as follows: 1 mL of fermentation broth was centrifuged at 12000 rpm, and the supernatant was sterilized through an aqueous filter membrane before being analyzed by liquid chromatography (LC). The LC detection conditions were: ion size exclusion column (Carbomix H-NP 10 μm, 7.8 × 300 mm), Shimadzu LC-16 high-performance liquid chromatograph. The mobile phase was 2.5 mM H₂SO₄, the flow rate was 0.6 mL / min, the temperature was 55℃, a differential detector was used, and the injection volume was set to 10 μL.

[0122] Experimental results:

[0123] In Pichia pastoris GS115, the Neurospora crassa GH1-1 and CDT-1 genes were introduced to construct strains COS01, COS02, and COS03, respectively. These three strains, along with the control strain X33, were fermented in YPCB medium containing cellobiose for verification. Figure 2The results showed that after 24 h of fermentation, strain COS03 completely consumed the cellobiose in the culture medium. The cellobiose metabolism capacity of the engineered strain COS03 was superior to that of the control strain X33 and engineered strains COS01 and COS02 (the extracellular cellobiose content of COS02 decreased, but the biomass did not increase). Strain COS03 was selected as the oligosaccharide metabolism strain in mixed sugar metabolism.

[0124] YPCB medium: Cellobiose is added to YP medium to make its final concentration 10 g / L.

[0125] Example 5: Fermentation of a mixed bacterial culture of GX2 and COS03 in a mixed sugar medium

[0126] Strains GX2 and COS03 were inoculated into 10 mL of YPG medium and cultured in a constant-temperature shaker for 24 h at 30 °C and 250 rpm. Then, the two strains were cultured at an initial bacterial concentration ratio of 1:1. Figure 3 As shown, with the initial OD 600 =1 was transferred to 25 mL of YPX, YPDX, and YPCBX culture media respectively, and cultured for 20 h. Samples were taken at 0, 4, 8, 12, and 20 h of fermentation to determine the xylose residue. Xylose and cellobiose contents were detected according to the methods described above. Glucose was detected by centrifuging 1 mL of fermentation broth at 12000 rpm, and the supernatant was sterilized by aqueous filter membrane before being analyzed by liquid chromatography. The liquid chromatography conditions were: amino column (WatersXBridge Amide 3.5 μm, 4.6×250 mm), Shimadzu LC-16 high-performance liquid chromatograph. The mobile phase consisted of 80% acetonitrile, 20% water, and 0.1% ammonia; the flow rate was 1.0 mL / min; the temperature was 40℃; a differential detector was used; and the injection volume was 10 μL.

[0127] Experimental results:

[0128] The mixed bacterial culture of GX2 and COS03 was fermented in a mixed sugar medium. Figure 4 As shown, after 20 h of mixed fermentation with xylose-metabolizing strain GX2 and oligosaccharide-metabolizing strain COS03, the CCR effect of cellobiose metabolism was significantly reduced, and the xylose metabolism rate was basically consistent with that in the xylose-only medium. The biomass (OD) of the mixed cellobiose / xylose substrate after 20 h of growth was also shown. 600 The concentration reached 39.25, a 25% increase compared to glucose / xylose substrates. Glucose and cellobiose metabolism in the mixed sugar medium is as follows: Figure 5As shown, cellobiose was completely consumed within 28 hours, while glucose was completely consumed within 20 hours. The glucose consumption rate was higher than that of cellobiose. However, glucose metabolism inhibited xylose metabolism, severely impacting the total sugar metabolism rate. This invention not only provides a solution to the problem of glucose metabolism inhibition in lignocellulose hydrolysate but also provides technical support for the future utilization of oligosaccharides from cellulose degradation. It proposes a mixed microbial fermentation strategy based on Pichia pastoris, a microbial yeast primarily responsible for oligosaccharide metabolism, offering a new approach to the developing integrated biorefining process.

[0129] YPX medium: Xylose is added to YP medium to make its final concentration 10 g / L.

[0130] YPDX medium: Add glucose and xylose to YP medium to a final concentration of 10 g / L.

[0131] YPCBX medium: Add cellobiose and xylose to YP medium to a final concentration of 10 g / L.

[0132] Example 6: Fermentation of mixed microbial communities of GX2 and COS03 with different inoculation ratios

[0133] Strains GX2 and COS03 were inoculated into 10 mL of YPG medium and cultured in a constant-temperature shaker for 24 h at 30 °C and 250 rpm. Then, the two strains were cultured at initial bacterial concentration ratios of GX2:COS03 = 3:1, 1:1, and 1:3, based on the total initial OD... 600 =0.1 was transferred to 25 mL of YPCBX medium and cultured for 60 h. Samples were taken at 0, 12, 24, 36, 48, and 60 h of fermentation to determine the OD of the bacterial community. 600 The residual amounts of xylose and cellobiose were measured. The xylose and cellobiose contents were determined using the methods described above.

[0134] Experimental results:

[0135] Different ratios of mixed bacterial cultures of GX2 and COS03 were fermented in mixed sugar medium. The inoculation ratio of xylose-metabolizing strain GX2 and oligosaccharide-metabolizing strain COS03 was adjusted to 3:1, 1:1, and 1:3. Figure 6 As shown, changing the inoculation ratio of COS03 affects the cellobiose content in the fermentation system. After 60 hours of fermentation, the cellobiose residue in the mixed culture system with GX2:COS03 = 1:3 was only 3.1%, indicating improved cellobiose metabolism compared to other mixed cultures. Figure 7As shown, mixed bacterial communities of different proportions can complete xylose metabolism within 60 hours, but xylose metabolism is slower in the GX2:COSO3=1:3 ratio, with a metabolic rate of only 43.6% of that in the GX2:COSO3=3:1 ratio from 12 to 24 hours. Figure 8 As shown, after 60 h of fermentation, the biomass of the GX2:COSO3=1:3 mixture reached 23.4, which was higher than that of other mixed microbial communities. These results indicate that the ratio of oligosaccharide-metabolizing strains to xylose-metabolizing strains has a significant impact on the fermentation of mixed microbial communities. Increasing the inoculation proportion of oligosaccharide-metabolizing strain COSO3 can improve cellobiose metabolism in the mixed sugar system and increase the biomass of the mixed microbial community.

[0136] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A Pichia pastoris mixed microbial community, characterized in that: The Pichia pastoris mixed microbiota includes at least one engineered Pichia pastoris strain that metabolizes xylose and one engineered Pichia pastoris strain that metabolizes oligosaccharides. The xylose-metabolizing Pichia pastoris engineered strain was constructed by introducing a heterologous xylose metabolism pathway into Pichia pastoris; The Pichia pastoris engineered strain for oligosaccharide metabolism was constructed by introducing a heterologous oligosaccharide metabolic pathway into Pichia pastoris.

2. The Pichia pastoris mixed microbiota according to claim 1, characterized in that: The xylose metabolic pathway includes xylose reductase, xylulose isomerase, and xylulose kinase; The oligosaccharide metabolic pathway includes oligosaccharide transporters and β-glucosidase.

3. The Pichia pastoris mixed microbiota according to claim 2, characterized in that: The xylose-metabolizing Pichia pastoris engineered strain is obtained by performing any of the following operations on the Pichia pastoris starting strain: (a) Heterologous expression of xylose reductase XR gene and xylitol dehydrogenase XDH gene, and simultaneous expression of xylulose kinase XK gene; Or, (b) heterologously express the xylose reductase XR gene and the xylitol dehydrogenase XDHm gene, while simultaneously expressing the xylulose kinase XK gene; The Pichia pastoris engineered strain that metabolizes oligosaccharides is obtained by performing the following operations on Pichia pastoris: Heterologous expression of the β-glucosidase GH1-1 gene and the oligosaccharide transporter CDT-1 gene.

4. The Pichia pastoris mixed microbiota according to claim 3, characterized in that: XR is xylose reductase XR derived from *Scheffersomyces stipitis*; XDH is xylitol dehydrogenase XDH derived from *Scheffersomyces stipitis*; XK is xylulose kinase XK derived from *Scheffersomyces stipitis*; XDHm is xylitol dehydrogenase XDH derived from *Scheffersomyces stipitis* through the D207A / I208R / F209S / N211R mutation. The GH1-1 gene is a β-glucosidase GH1-1 derived from Neurospora crassa, and the CDT-1 gene is an oligosaccharide transporter CDT-1 derived from Neurospora crassa.

5. The Pichia pastoris mixed microbiota according to claim 4, characterized in that: The amino acid sequence encoded by the XR gene is shown in XP_001385181.1; The amino acid sequence encoded by the XDH gene is shown in XP_001386982.1; The amino acid sequence encoded by the XK gene is XP_001387325.2 obtained through the S597L mutation; The amino acid sequence encoded by the XDHm gene is obtained by the mutation of XP_001386982.1 through D207A / I208R / F209S / N211R; The amino acid sequence encoded by the CDT-1 gene is shown in XP_963801.1; The amino acid sequence encoded by the GH1-1 gene is shown in XP_011393758.

1.

6. The Pichia pastoris mixed microbiota according to claim 5, characterized in that: The xylose-metabolizing Pichia pastoris engineered strain includes Pichia pastoris GS115 or Pichia pastoris X33 as the starting strain. And / or, gene expression cassettes are constructed using the constitutive promoter GCW14 for the XR gene, XDH gene, XK gene, or XDHm gene; wherein the constitutive promoter GCW14 is a constitutive promoter derived from Pichia pastoris. And / or, the XR gene, XDH gene or XDHm gene, and XK gene are integrated using Pichia pastoris neutral sites; said Pichia pastoris neutral sites include PNSII-1, PNSI-2, PNSI-4, PNSI-6, PNSI-8, PNSI-9, PNSI-10, PNSI-12, PNSI-14, PNSI-16, PNSII-4, PNSII-5, and PNSII-6; And / or, in the oligosaccharide-metabolizing Pichia pastoris engineered strain, Pichia pastoris includes Pichia pastoris GS115 or Pichia pastoris X33; And / or, the GH1-1 gene or CDT-1 gene uses a constitutive promoter GAP to construct a gene expression cassette; the constitutive promoter GAP is a constitutive promoter GAP derived from Pichia pastoris.

7. The Pichia pastoris mixed microbiota according to any one of claims 3 to 6, characterized in that: The method for constructing the xylose-metabolizing Pichia pastoris engineered strain includes the following steps: (A1) Based on Pichia pastoris GS115, the XR gene, XDH gene, and XK gene were heterologously expressed to obtain engineered strain GX1; Alternatively, (A2) based on Pichia pastoris GS115, the XR gene, XDHm gene, and XK gene were heterologously expressed to obtain engineered strain GX2; And / or, the method for constructing the oligosaccharide-metabolizing Pichia pastoris engineered strain includes the following steps: Based on the Pichia pastoris GS115 strain, the GH1-1 gene and CDT-1 gene were heterologously expressed to obtain the engineered strain COS03.

8. The application of the Pichia pastoris mixed microbiota according to any one of claims 1 to 7, characterized in that: For at least one of the following applications: (I) Application in the fermentation of mixed sugars; (II) Applications in the preparation of biofuels, chemicals or recombinant protein products; (III) Application in biorefining using lignocellulose hydrolysate.

9. A method for the simultaneous and efficient metabolism of mixed sugars based on a Pichia pastoris mixed microbiota, characterized in that, Includes the following steps: The xylose-metabolizing Pichia pastoris engineered strain as described in any one of claims 1 to 7 and the oligosaccharide-metabolizing Pichia pastoris engineered strain as described in any one of claims 1 to 7 are cultured separately and then co-inoculated into a culture medium containing mixed sugars for fermentation.

10. The method according to claim 9, characterized in that: The mixed sugars include xylose and oligosaccharides; And / or, the oligosaccharide includes cellulose oligosaccharides.

Images