KASP molecular marker of nbeds1 gene, detection method and application thereof

Abstract

The application relates to a KASP molecular marker of an NbEDS1 gene, a detection method and application, and belongs to the technical field of plant molecular breeding. The KASP molecular marker is designed according to a specific 97 bp InDel site in a Nicotiana benthamiana NbEDS1 gene mutant, the wild-type allele is C (containing a 97 bp insertion sequence), the mutant allele is A (the insertion sequence is deleted), the marker has the advantages of high specificity, fast detection speed, low cost, high throughput and high accuracy, and can be applied to genotype identification of the NbEDS1 gene mutant of the Nicotiana benthamiana, rapid screening of mutant materials in related research on a TNL type immune receptor disease resistance pathway, and genetic analysis and breeding selection related to the NbEDS1 gene.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, and relates to a KASP molecular marker for the NbEDS1 gene, a detection method, and its application. Background Technology

[0002] The plant immune system relies on intracellular nucleotide-binding site-leucine-rich repeat (NLR) immune receptors to recognize pathogen effector proteins and activate immune responses. Based on their N-terminal domains, NLR receptors can be divided into two main classes: TNL (Toll / Interleukin-1 Receptor-NLR) and CNL (Coiled-Coil-NLR). Studies in the model crop Arabidopsis thaliana have shown that after recognizing pathogen effector proteins, TNL immune receptors require downstream signal transduction modules to activate the immune response. Among these, the EDS1 (Enhanced Disease Susceptibility 1) family of proteins are core hub genes in the TNL signaling pathway; mutations in these genes lead to the complete loss of the entire EDS1-dependent immune signaling pathway. Recent important studies have discovered that EDS1 family proteins mediate TNL signal transduction by forming two independent but functionally complementary downstream effector modules: the EDS1-PAD4-ADR1 module and the EDS1-SAG101-NRG1 module. EDS1 forms a heterodimer with PAD4. This complex is nucleocytoplasmic dual-localized. In the nucleus, it activates the salicylate signaling pathway through transcriptional reprogramming, inducing the expression of disease-related proteins and synergistically regulating the immune response with ADR1 family proteins, playing a key role in basal and acquired resistance. EDS1 also forms a heterodimer with SAG101. This complex is nucleocytoplasmic dual-localized. Upon immune activation, it specifically recruits and activates NRG1 family helper NLRs, causing NRG1 to oligomerize in the plasma membrane to form disease-resistant bodies and act as calcium ion channels, mediating calcium ion influx downstream of immune signals. This, in turn, activates programmed cell death, limiting the spread of pathogens at the infection site, and playing a central role in effector protein-triggered immune and hypersensitivity responses.

[0003] Nicotiana benthamiana is a herbaceous plant belonging to the genus Nicotiana in the Solanaceae family. Its highly efficient transient expression system, established using the Agrobacterium infiltration method, is mature and stable, enabling rapid in vivo expression of target genes. It serves as a universal model plant for molecular biology, cell biology, and biochemistry experiments, including protein subcellular localization, protein-protein interaction verification, and heterologous protein expression. In plant disease resistance research, Nicotiana benthamiana exhibits broad-spectrum sensitivity to various plant pathogens, including viruses, pathogenic bacteria, fungi, and nematodes. Its core immune regulatory pathway shows higher homology with major Solanaceae crops such as tomato, pepper, and potato, highlighting the significant industrial transformation value of its research findings. As a model species of the Solanaceae family, Nicotiana benthamiana can fill research gaps in the study of Arabidopsis thaliana, a model organism in the Brassicaceae family, further deepening our understanding of disease resistance pathways. Currently, a complete reference genome, a mature gene editing system, a rich mutant library, and multi-omics public data resources provide research support, meeting the needs of cutting-edge research such as multi-gene interaction analysis and disease resistance molecular design. It has become a core model organism in the field of plant disease resistance signaling pathway research and is widely used in related research work such as elucidating immune regulation mechanisms and validating the function of disease resistance elements. The Nicotiana benthamiana Nbeds1a-1 mutant is a mutant with complete loss of EDS1 function generated by the gene editing system.

[0004] In studies of TNL disease resistance mechanisms, researchers typically hybridize transgenic plants containing the TNL protein immune receptor with mutants of the EDS1-PAD4-ADR1 module or / and EDS1-SAG101-NRG1 module. Through segregation and screening of the progeny, different genotype combinations are obtained, including homozygous single-gene mutants and homozygous mutants of different combinations, to study the function of individual genes, gene redundancy, and the synergistic effects of multiple genes. Depending on the research objectives, the F2 population usually requires screening dozens to thousands of individual plants. Currently, the Sanger sequencing method, commonly used for screening, suffers from high cost, low throughput, long cycle time, and is unsuitable for large-scale screening. Therefore, an efficient, accurate, and high-throughput genotyping method is urgently needed to obtain the aforementioned different mutant combinations through hybridization screening.

[0005] KASP (Kompetitive Allele Specific PCR) marker technology is a high-throughput genotyping technique based on SNPs or InDels, particularly suitable for large-scale mutant screening. This technology is low-cost, highly accurate, and can precisely distinguish between wild-type homozygotes, heterozygotes, and mutant homozygotes; it has high throughput, suitable for 96-well or 384-well plate formats; it is easy to operate, requiring no gel electrophoresis, only a fluorescence plate reader for result interpretation, and the entire process from DNA extraction to result interpretation can be completed within 3-4 hours; it has a wide range of applications and has been successfully applied to molecular marker-assisted selection breeding of various crops such as wheat, maize, rice, and soybean. However, there are currently no reports on the KASP marker of the Nicotiana benthamiana NbEDS1 gene and its application in mutant screening.

[0006] In summary, the development of KASP markers for the NbEDS1 gene is of significant theoretical and practical value for research on TNL-type immune receptor disease resistance pathways, rapid identification of Nicotiana benthamianis mutant resources, and screening of different mutant combinations using hybridization. Summary of the Invention

[0007] To address the shortcomings of existing technologies and practical needs, this invention provides a KASP molecular marker for the NbEDS1 gene, a detection method, and its application. This marker can accurately and rapidly distinguish between wild-type and mutant genotypes of the NbEDS1 gene, providing an effective molecular detection tool for research related to TNL-type immune receptor disease resistance pathways.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a KASP molecular marker for the NbEDS1 gene, the molecular marker including the InDel site in the Nicotiana benthamian NbEDS1 gene; The wild-type allele of the NbEDS1 gene is C and contains a 97bp insertion sequence. The mutant allele of the NbEDS1 gene is A and the inserted sequence is missing; The nucleic acid sequence of the inserted sequence is shown in SEQ ID NO.1.

[0009] This invention mines KASP molecular markers associated with the genotype of the NbEDS1 gene, and designs a marker targeting a specific 97bp InDel site in the NbEDS1 gene mutant of Nicotiana benthamiana. The wild-type allele is C (containing the 97bp insertion sequence), and the mutant allele is A (lacking the insertion sequence). This marker has the advantages of high specificity, fast detection speed, low cost, high throughput, and high accuracy. It can be applied to the genotype identification of NbEDS1 gene mutants of Nicotiana benthamiana, rapid screening of mutant materials in research related to TNL-type immune receptor disease resistance pathways, and genetic analysis and breeding selection involving the NbEDS1 gene.

[0010] In a second aspect, the present invention provides a detection primer set for the KASP molecular marker of the NbEDS1 gene described in the first aspect, the detection primer set comprising an F1 primer, an F2 primer and an R primer; The F1 primer includes, from the 5' end to the 3' end, a linker sequence of the F1 primer fluorescent reporter group and an F1 primer gene-specific sequence, wherein the nucleic acid sequence of the F1 primer gene-specific sequence includes the sequence shown in SEQ ID NO.2; The F2 primer comprises, from the 5' end to the 3' end, a linker sequence of the F2 primer fluorescent reporter group and an F2 primer gene-specific sequence, wherein the nucleic acid sequence of the F2 primer gene-specific sequence includes the sequence shown in SEQ ID NO. 3; The nucleic acid sequence of the R primer includes the sequence shown in SEQ ID NO.4.

[0011] It is understood that the 5' ends of the F1 primer and the F2 primer in this invention can be any two different fluorescent reporter groups known in the art.

[0012] Preferably, the fluorescent reporter group of the F1 primer or the fluorescent reporter group of the F2 primer are each independently selected from FAM or HEX.

[0013] Preferably, the fluorescent reporter group of the F1 primer is FAM, and the ligation sequence is shown in SEQ ID NO.5.

[0014] Preferably, the fluorescent reporter group of the F2 primer is HEX, and the ligation sequence is shown in SEQ ID NO.6.

[0015] Thirdly, the present invention provides a kit for detecting the genotype of the NbEDS1 gene in Nicotiana benthamiana, the kit comprising a detection primer set for the KASP molecular marker of the NbEDS1 gene as described in the second aspect.

[0016] Optionally, the kit may also include at least one of 2× KASP Master Mix, sterile deionized water, a 96-well PCR plate, or an optical-grade sealing film.

[0017] Fourthly, the present invention provides a method for detecting the genotype of the Nicotiana benthamiana NbEDS1 gene, the method comprising the following steps: (1) Extract genomic DNA from the sample of Nicotiana benthamiana to be tested; (2) Using the genomic DNA extracted in step (1) as a template, KASP-PCR amplification was performed using the detection primer set described in claim 2 or 3; (3) Detect the fluorescence signal of the PCR product and determine the genotype based on the fluorescence signal type.

[0018] Preferably, the genotype determination criteria in step (3) are as follows: The fluorescence signal of the fluorescent reporter group of the F1 primer is only displayed: the individual is identified as a wild-type homozygote. If only the fluorescent signal of the F2 primer fluorescent reporter group is displayed, the individual is identified as a mutant homozygote. Simultaneous display of fluorescence signals from both the F1 and F2 primer fluorescent reporter groups indicates a heterozygote.

[0019] Preferably, the reaction system for KASP-PCR amplification in step (2) includes: 5~25 ng / μL Nicotiana benthamiana genomic DNA, 1×~3×KASP Master Mix, 0.5~2 μM F1 primer, 0.5~2 μM F2 primer and 1~5 μM R primer.

[0020] Preferably, the volume ratio of the F1 primer, F2 primer, and R primer is 1:1:(2~4).

[0021] Preferably, the reaction program for KASP-PCR amplification in step (2) is as follows: 1) 94℃~96℃ (e.g., 94℃, 95℃, or 96℃) for 10~20 min (e.g., 10 min, 15 min, or 20 min); 2) denaturation at 94℃~96℃ (e.g., 94℃, 95℃, or 96℃) for 15~25 s (e.g., 15 s, 20 s, or 25 s), followed by cyclic cooling annealing extension at 61℃~55℃ (e.g., 61℃, 60.4℃, 59.8℃, 58℃, or 55℃), decreasing by 0.5℃~0.6℃ per cycle (e.g., decreasing by 0.5℃ or 0.6℃ per cycle), for 50~60 s (e.g., 50 s, 55 s, or 60 s). 1) 8-12 cycles (e.g., 8, 10, or 12 cycles); 2) 94-96°C (e.g., 94, 95, or 96°C) denaturation for 15-25 s (e.g., 15, 20, or 25 s); 55-58°C (e.g., 55, 57, or 58°C) annealing extension for 50-60 s (e.g., 50, 55, or 60 s), for a total of 25-30 cycles (e.g., 25, 26, or 30 cycles).

[0022] Fifthly, the present invention provides the use of the KASP molecular marker (or its detection reagent) described in the first aspect, the detection primer set described in the second aspect, or the kit described in the third aspect in any of the following aspects: (1) Genotyping of the NbEDS1 gene mutant of Nicotiana benthamiana; (2) Rapid screening of mutant materials in research on TNL-type immune receptor disease resistance pathways; (3) Genetic analysis related to the NbEDS1 gene; (4) Functional analysis of NbEDS1 gene in disease resistance pathway.

[0023] Compared with the prior art, the present invention has the following beneficial effects: (1) High specificity: Designed for the specific 97bp InDel site of NbEDS1 gene mutant, the genotyping specificity reached 100% after validation in 96 samples; (2) Fast detection speed: The entire process from DNA extraction to result interpretation can be completed within 3-4 hours; (3) Low cost: The cost of single sample detection can be controlled at 0.5-1 yuan, which is more than 95% lower than the cost of Sanger sequencing; (4) High throughput: suitable for 96-well or 384-well plate formats; (5) High accuracy: After testing and verification of 96 samples, the success rate of genotyping reached 100%, and the accuracy of sequencing verification was 100%. Attached Figure Description

[0024] Figure 1 This diagram illustrates the structure of the wild-type NbEDS1 gene and the Nbeds1a-1 mutant in Nicotiana benthamiana. Dark solid squares represent exon regions, light gray solid squares represent intron regions, and dashed lines represent deletion (Indel) regions. The gene structure consists of exon 1 (Exon1) 318 bp, intron 1 (Intron1) 867 bp, exon 2 (Exon2) 804 bp, intron 2 (Intron2) 79 bp, and exon 3 (Exon3) 702 bp, for a total length of 2770 bp. The Nbeds1a-1 mutant exhibits a large deletion of 97 bp in the 1526 bp–1622 bp region of the NbEDS1 gene, located in the exon 2 region.

[0025] Figure 2 The fluorescence signal distribution of the NbEDS1 gene genotype was obtained by KASP marker detection. Genotyping was performed on two wild-type homozygous genotypes (C:C, blue dots, bottom right), two mutant homozygous genotypes (A:A, red dots, top left), and two F1 heterozygous genotypes (C:A, green dots, top right). Black dots represent negative controls without template DNA (bottom left). The three different genotype samples were clearly divided into three independent clusters, indicating that the KASP marker can achieve accurate and stable genotyping of the NbEDS1 gene, which can meet the needs of subsequent large-scale screening.

[0026] Figure 3 To achieve clear and non-overlapping genotyping of 90 Nicotiana benthamiana genomic DNA samples using the Nb902097_K01 primer set, KASP detection was performed. Red dots represent A:A mutant homozygotes (25 plants, 27.8%, top left), purple dots represent C:A heterozygotes (40 plants, 44.4%, top right), and blue dots represent C:C wild-type homozygotes (25 plants, 27.8%, bottom right). The black dots in the bottom left corner are negative controls (NTC), showing no amplification signal. These results indicate that the KASP marker can stably and accurately distinguish the three genotypes of the NbEDS1 gene and is suitable for large-scale population genotyping. Detailed Implementation

[0027] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0028] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0029] Tobacco materials used in specific embodiments of the present invention: proTNL1::TNL1Nb is a Benedictine material containing the TNL-type anti-bacterial wilt gene RTSW. For details, please refer to the US patent with publication number US20250092416A1, entitled "SPOTTED WILT DISEASE RESISTANCE GENE RTSW FROM TOBACCO AND USE THEREOF", and the Chinese patent application with publication number CN117866972A, entitled "RTSW from tobacco and its application". It has also been published in non-patent literature (Liu Y, Wang J, Zuo C, Fan W, Yuan C, Zeng J, et al. Identification of a geneconferring broad-spectrum orthotospovirus resistance in Solanaceae. ScienceAdvances. 2025;11(25):eadw4333. doi: doi:10.1126 / sciadv.adw4333). The tobacco material is preserved at the Yunnan Provincial Academy of Tobacco Agricultural Sciences and can be obtained by the public from tobacco germplasm resource preservation units.

[0030] The Nbeds1a-1 mutant of Nicotiana benthamiana is a mutant with complete loss of EDS1 function produced by a gene editing system. This mutant material has been publicly reported in international literature and is widely used in the field of disease resistance. It has been published in non-patent literature (Ordon J, Gantner J, Kemna J, Schwalgun L, Reschke M, Streubel J, et al. Generation of chromosomal deletions in dicotyledonous plants employing auser-friendly genome editing toolkit. The Plant Journal. 2017;89(1):155-68.). The public can obtain this tobacco material from tobacco germplasm resource conservation units.

[0031] This invention relates to the screened Nicotiana benthamiana NbEDS1 gene (gene number Nbe10g25300.1), whose reference genome sequence can be obtained from the Nicomics JBrowse platform (reference URL http: / / lifenglab.hzau.edu.cn / Nicomics / JBrowse / index.php).

[0032] The F1 generation plants (Nbeds1a-1×RTSW F1) obtained by crossing Nbeds1a-1 (male ♂) with ProTNL1::TNL1Nb (female ♀), and the F2 population obtained by self-pollination of Nbeds1a-1×RTSW F1, were all created in this invention and are preserved at the Yunnan Provincial Tobacco Agricultural Science Research Institute.

[0033] The main reagents used in the embodiments of this invention are: The KASP-TF V4.0 2X Master Mix reagent (catalog number LGC-KBS-1050-132) was purchased from LGCBiosearch. The universal genomic DNA extraction kit using magnetic beads (catalog number DP705) was purchased from Tiangen Biotech Co., Ltd.

[0034] Example 1 This embodiment identifies the mutation site of the NbEDS1 gene in Nicotiana benthamiana.

[0035] Nbeds1a-1 is a gene-edited mutant of Nicotiana benthamiana EDS1 with a complete loss of function. This mutant material has been publicly reported and widely used in the field of plant disease resistance research. However, the existing public information does not disclose the precise editing site information of this mutant. In order to verify the genotype accuracy of this mutant and to develop subsequent genotype identification markers based on the mutation information, this embodiment amplifies and analyzes the full-length NbEDS1 gene sequence of the Nbeds1a-1 mutant.

[0036] The experimental materials used in this embodiment included two transgenic Nicotiana benthamiana plants with the proTNL1::TNL1Nb gene without NbEDS1 mutation and two Nbeds1a-1 mutant Nicotiana benthamiana plants. All materials were provided by the Yunnan Academy of Tobacco Agricultural Sciences. The materials were cultured in a controlled greenhouse at a temperature of 25±2℃, with a photoperiod of 16 h light / 8 h dark and a relative humidity of 60%~70%. Fresh leaves were collected when the plants reached the 4-leaf stage for genomic DNA extraction. Total DNA was extracted from the tobacco leaves using a universal genomic DNA extraction kit with magnetic beads (Tiangen Biotech Co., Ltd., catalog number DP807-TB). The concentration and purity of the extracted genomic DNA were finally detected using NanoDrop. DNA samples with an OD260 / OD280 ratio in the range of 1.8~2.0 were screened and stored at -20℃ for later use.

[0037] Full-length amplification primers were designed based on the reference sequence of the Nicotiana benthamiana NbEDS1 gene (gene number: Nbe10g25300.1). The upstream primer NbEDS1-F sequence is: 5'-ATGGTGAGAATTGAAGAGGGGAG-3', and the downstream primer NbEDS1-R sequence is: 5'-CTAAGAATTTACTTTCCCTGATATCCAAGATG-3'.

[0038] PCR amplification was performed using a 25 μL system. The system components were: 12.5 μL of 2×Phanta Max Master Mix (Vazyme), 1.0 μL of 10 μM upstream primer, 1.0 μL of 10 μM downstream primer, 2.0 μL of 20 ng / μL genomic DNA template, and 8.5 μL of sterile deionized water. The PCR amplification program was set to 95℃ pre-denaturation for 3 min, followed by 32 cycles of amplification: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 2 min, and a final extension at 72℃ for 5 min after the cycle. The amplified products were stored at 4℃.

[0039] After PCR amplification, the amplification products were purified using the AxyPrep PCR Cleanup Kit. The purified products were then sent to Shanghai Jieli Biotechnology Co., Ltd. for Sanger bidirectional sequencing. The sequences obtained from sequencing were assembled and aligned using sequence analysis software.

[0040] The amplification results showed that both the proTNL1::TNL1Nb transgenic Nicotiana benthamiana and the Nbeds1a-1 mutant Nicotiana benthamiana successfully amplified the target bands. The amplified fragment length of the proTNL1::TNL1Nb sample was 2770 bp, and the amplified fragment length of the Nbeds1a-1 mutant sample was 2673 bp, both of which were consistent with the expected fragment size. The amplified sequence of the proTNL1::TNL1Nb sample was compared with the reference sequence of the NbEDS1 gene, and the two sequences were completely identical. The gene structure of the reference sequence was confirmed to be 318 bp in the first exon, 867 bp in the first intron, 804 bp in the second exon, 79 bp in the second intron, and 702 bp in the third exon, with a total length of 2770 bp. The amplified sequence of the Nbeds1a-1 mutant was compared with the wild-type reference sequence and a large 97 bp deletion was found in the 1526 bp to 1622 bp region of the NbEDS1 gene. This deletion site was located in the second exon region of the gene.

[0041] Wild-type sequence (partial): 5'-...TATCAGCACGAGGTAGTTGTAAGATCATATGATGCATCGAAGAATTTCTTTATGACTGTAATGAGGAGTGCATCCTCTGTTGCAAGTTATGCTGCATGTAATCTGAAAGGATG...-3'.

[0042] Mutant sequence (partial): 5'-...TATCAGC---------------------------------GAAAGGATG...-3'.

[0043] Missing sequence (97bp): 5'-ACGAGGTAGTTGTAAGATCATATGATGCATCGAAGAATTTCTTTATGACTGTAATGAGGAGTGCATCCTCTGTTGCAAGTTATGCTGCATGTAATCT-3' (SEQ ID NO. 1).

[0044] Further analysis of the mutation effect revealed that the aforementioned 97 bp deletion is located in the second exon region of the NbEDS1 gene, and this deletion leads to a frameshift mutation in the gene's reading frame. Figure 1 The InDel site is used to predict the translation of a C-terminal truncated nonfunctional protein. Based on this InDel site, a corresponding KASP molecular marker can be developed for subsequent genotyping of the mutant.

[0045] Example 2 This embodiment designs the KASP marker for the NbEDS1 gene.

[0046] Based on the 97 bp InDel mutation site of the Nbeds1a-1 mutant identified in Example 1, this example develops and optimizes the KASP molecular marker for genotyping of this mutation site.

[0047] KASP primer design follows these rules: the 3' terminal bases of allele-specific forward primers F1 and F2 are completely complementary to the flanking sequences of the InDel site in wild-type and mutant types, respectively; the length of gene-specific primers without fluorescent tail sequences is controlled at 18-30 bp, with an optimal length of 20-24 bp; the primer Tm value is set in the range of 58-62℃; the difference in Tm values ​​between F1 and F2 primers does not exceed 2℃; the GC content is controlled at 40%-60%; the primer sequences should avoid the formation of secondary structures, primer dimers, and hairpin structures; the 5' end of primer F1 is supplemented with the FAM fluorescent reporter group-specific tail sequence GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 5); the 5' end of primer F2 is supplemented with the HEX fluorescent reporter group-specific tail sequence GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 6); and the expected size of the amplified product is controlled in the range of 80-120 bp. The parameters for primer design were set as follows: primer length without tail sequence 20~27 bp, Tm value 58~62℃, product size 80~120 bp, GC content 40%~60%, maximum number of consecutive single bases 4, and 3' end stability ΔG greater than -9 kcal / mol.

[0048] The final designed Nb902097_K01 primer set, including the three primer sequences and related parameters, is as follows: The wild-type specific F1 primer (FAM marker) sequence is: 5'-GAAGGTGACCAAGTTCATGCTAAGCAATCTTTGACTTCATCAATCC-3' (SEQ ID NO.7), where the 5' end 21 bp is the FAM fluorescent tail sequence, and the remaining 25 bp is the gene-specific sequence (SEQ ID NO.2: AAGCAATTCTTTGACTTCATCAATCC). The total primer length is 46 bp, Tm value is 60.2℃, GC content is 44%, and the 3' end base is C, which is completely complementary to the wild-type sequence. The mutant-type specific F2 primer (HEX marker) sequence is: 5'-GAAGGTCGGAGTCAACGGATTGGAGTGCATCCTCTGTTGCAAGTTA-3' (SEQ ID NO.8), where the 5' end 21 bp is the HEX fluorescent tail sequence, and the remaining 25 bp is the gene-specific sequence (SEQ ID NO.3: GGAGTGCATCCTCTGTTGCAAGTTA). The total primer length is 46 bp. The target sequence of the primer set is 5'-GTTTCTAACAACAAGTTTGTGCATCC-3' (SEQ ID NO.4), with a length of 26 bp, a Tm value of 60.5℃, a GC content of 46%, and an A 3' terminal base, which is completely complementary to the mutant sequence. The universal reverse primer R sequence is 5'-GTTTCTAACAACAAGTTTGTGCATCC-3' (SEQ ID NO.4), with a length of 26 bp, a Tm value of 59.8℃, a GC content of 42%, and an expected amplification product size of 95 bp. The specificity of the designed primers was verified by comparing them to the Nicotiana benthamiana RefSeq mRNA database. The verification results showed that all three primers specifically bound to the NbEDS1 gene target site only, with no non-specific binding sites, and the primer specificity met the requirements for subsequent detection.

[0049] All primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd. and purified using PAGE. After brief centrifugation, the received primer powder was mixed with sterile deionized water to prepare a 100 μM stock solution, which was then stored at -20°C. Before use, the stock solution was diluted to a 10 μM working solution. The primer working solution was prepared according to the ratio F1:F2:R = 1:1:3: 10 μL of 10 μM F1 primer, 10 μL of 10 μM F2 primer, and 30 μL of 10 μM R primer were added, and the volume was adjusted to 100 μL with 50 μL of sterile deionized water. The final concentrations of F1 and F2 primers in the prepared primer mixture were 1 μM, and the final concentration of R primer was 3 μM. The mixture was then aliquoted and stored at -20°C for later use.

[0050] Example 3 This embodiment optimizes the KASP marker reaction system and amplification procedure for the NbEDS1 gene.

[0051] To ensure that the KASP marker developed in Example 2 can achieve accurate and stable genotyping, this example systematically optimizes the reaction system and PCR amplification program for the marker. The experimental materials used include two wild-type proTNL1::TNL1Nb Nicotiana benthamiana genomic DNA samples (corresponding to C:C homozygous genotype), two Nbeds1a-1 mutant genomic DNA samples (corresponding to A:A homozygous genotype), and two genomic DNA samples from the offspring of the two hybrids (corresponding to C:A heterozygous genotype). All DNA samples were extracted by the magnetic bead method in Example 1. The reagents used in the experiment included 2× KASP Master Mix (catalog number KB-3061) produced by LGC Genomics and the primer mixture prepared in Example 2.

[0052] The reaction system optimization phase included three gradient testing dimensions: first, the gradient in primer mixture volume per 10 μL of reaction system, namely 0.10 μL, 0.14 μL, 0.18 μL, and 0.22 μL; second, the gradient in genomic DNA template volume per 10 μL of reaction system, namely 5 ng, 10 ng, 20 ng, 40 ng, and 80 ng. The amplification program optimization phase also included three gradient testing dimensions: first, the gradient in initial annealing temperature for Touch-down RCR (decremental PCR), namely 63℃, 61℃, 59℃, and 57℃, with the final annealing temperature fixed at 55℃ for all test groups, decreasing by 0.6℃ per cycle; second, the gradient in the number of cycles in the Touch-down phase, namely 8, 10, 12, and 15 cycles; and third, the gradient in amplification extension time, namely 30 s, 45 s, 60 s, and 90 s. All test groups were configured with three technical replicates, and positive controls with known genotypes and negative controls without templates were set up simultaneously to ensure the reliability of the test results.

[0053] After multiple repeated tests and orthogonal validations, the optimal reaction system for a 10 μL volume was determined to be: 5.0 μL of 2× KASP Master Mix (final concentration 1×), 0.14 μL of the primer mixture prepared in Example 2, 2.0 μL of genomic DNA template at a concentration of 5–25 ng / μL (corresponding to a template dosage of 10–50 ng), and 2.86 μL of sterile deionized water to a final volume of 10 μL. The optimization results of each parameter showed that stable genotyping results could be obtained within the DNA template dosage range of 10–50 ng, with 20 ng being the optimal template dosage. The following guidelines must be followed during the experimental procedure: All reagents must be thoroughly mixed before use and the droplets on the tube wall collected after a brief centrifugation. KASP Master Mix must be kept on ice throughout the operation to avoid repeated freeze-thaw cycles. Use low-adsorption pipette tips and PCR plates during sample loading to reduce sample loss. The order of sample loading is as follows: sterile deionized water, primer mixture, 2×KASP Master Mix, and finally DNA template. After sample loading, seal the PCR plate with optical-grade sealing film. After a brief centrifugation at 2000 rpm for 1 min to remove air bubbles, amplification can be performed.

[0054] The optimized amplification program was determined as follows: First, hot-start activation of the Taq enzyme was achieved by incubation at 94℃ for 15 min. This was followed by a 10-cycle Touch-down amplification phase, with each cycle involving denaturation at 94℃ for 20 s, followed by annealing and extension. The annealing temperature started at 61℃ and decreased by 0.6℃ each cycle until reaching 55℃, with an annealing and extension time of 60 s per cycle. After the Touch-down phase, a 26-cycle conventional amplification phase followed, with each cycle involving denaturation at 94℃ for 20 s and annealing and extension at 55℃ for 60 s. After amplification, the product was stored at 4℃ for later detection. The optimized parameters showed that a Touch-down initiation annealing temperature of 61℃ resulted in the least non-specific amplification and the best fluorescence signal clustering. A Touch-down phase of 10 cycles achieved the optimal balance between amplification efficiency and specificity. A 60-s extension time ensured complete amplification of the 95 bp target product with moderate fluorescence signal intensity. The Touch-down amplification strategy employed in this study enhances amplification specificity by progressively decreasing the annealing temperature. The initial annealing temperature was set at 61℃, approximately 2℃ higher than the average Tm value of the primers. This ensures that only perfectly matched primers bind to the template during the initial amplification phase. Subsequent cycles gradually decrease the temperature by 0.6℃ to allow for primer binding. At this point, the target product has completed its initial amplification and gains a competitive advantage in the reaction, effectively reducing non-specific amplification, improving the signal-to-noise ratio of the fluorescence signal, and ultimately obtaining clearer genotype clustering results. Figure 2 ).

[0055] Example 4 This embodiment performs high-throughput screening using KASP tags.

[0056] We planted approximately 100 individual plants from the F2 population obtained by self-pollination of Nbeds1a-1×RTSW F1. Leaf samples were taken from each of the 100 tobacco plants, with a 1.5 cm diameter sample taken. 2 Samples (approximately the size of a thumbnail) were loaded into a 96-well sampling plate for high-throughput DNA extraction using the magnetic bead method. DNA quality testing revealed that 90 DNA samples met the KASP testing standards.

[0057] KASP detection was performed on the above 90 DNA samples using the Nb902097_K01 primer set designed in Example 2. KASP detection was performed according to the optimized reaction system and amplification procedure in Example 3. After thermal cycling, the reaction plates were read using a FLUOstar Omega SNP microplate reader with FRET function. Data were plotted and subjected to genotyping and cluster analysis.

[0058] KASP test results showed that it contained the C:C homozygous genotype (located in...). Figure 3 There were 25 samples (top left); containing the A:A homozygous genotype (located in the top left corner). Figure 3 There were 25 samples (bottom right corner); 40 samples contained the C:A heterozygous genotype. The corresponding percentages were 27.8%, 44.4%, and 27.8%. The chi-square test results showed that... 2 The value was 1.11, and the P-value was 0.574 (degrees of freedom df=2). Since the P-value was much greater than 0.05, it indicates that the observed segregation ratio was not significantly different from the theoretical ratio of 1:2:1, which is consistent with Mendelian inheritance laws of single-gene control.

[0059] Example 5 This embodiment verifies the KASP marker of the NbEDS1 gene through sequencing.

[0060] To verify the genotyping accuracy of the aforementioned developed NbEDS1 gene KASP marker, this embodiment randomly selected 20 strains from the segregating population of 90 offspring of Nbeds1a-1 and proTNL1::TNL1Nb hybrids, and cross-validated the KASP genotyping results using Sanger sequencing. The amplification primers used in this validation were the full-length NbEDS1 gene amplification primers validated in Example 1. The upstream primer NbEDS1-F sequence is 5'-ATGGTGAGAATTGAAGAGGGGAG-3', and the downstream primer NbEDS1-R sequence is 5'-CTAAGAATTTACTTTCCCTGATATCCAAGATG-3'. PCR amplification was performed in a 25 μL system. The system components were: 12.5 μL of 2×Phanta Max Master Mix (Vazyme), 1.0 μL of 10 μM upstream primer, 1.0 μL of 10 μM downstream primer, 2.0 μL of 20 ng / μL genomic DNA template, and 8.5 μL of sterile deionized water. The PCR amplification program was set to 95℃ pre-denaturation for 3 min, followed by 32 cycles of amplification: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 2 min, and a final extension at 72℃ for 5 min after the last cycle. The amplification products were stored at 4°C for 1 minute. After PCR amplification, the amplification products were purified using the AxyPrepPCR Cleanup Kit. The purified products were then sent to Shanghai Jieli Biotechnology Co., Ltd. for Sanger bidirectional sequencing. The sequences obtained from the sequencing were assembled and compared with the wild-type NbEDS1 gene reference sequence and the mutant deletion sequence. The comparison results were then verified for consistency with the results obtained from the corresponding samples using the KASP typing detection method of this invention.

[0061] The validation results showed that the KASP genotyping results of the 20 test samples were completely consistent with the Sanger sequencing results, with a genotyping accuracy of 100%. Among them, 4 samples were homozygous for the A:A genotype mutation, and the sequencing results showed a 97 bp deletion in all of them; 9 samples were heterozygous for the C:A genotype, and the sequencing results showed a double peak at the 1526 bp site; 7 samples were homozygous for the C:C genotype wild-type, and the sequencing results were completely matched with the NbEDS1 gene reference sequence. The specific correspondence is shown in Table 1.

[0062] Table 1. Sequencing comparison of KASP markers and PCR products from 20 samples. The verification results show that the NbEDS1 gene KASP marker and detection method developed in this invention provides accurate and reliable genotyping results, effectively distinguishing the three genotypes of the NbEDS1 gene. Compared with traditional phenotypic identification and PCR product sequencing identification methods, this marker has several advantages: it enables early screening, allowing genotype identification to be completed at the seedling stage without waiting for the disease resistance phenotype to appear; the detection results are stable and reliable, genotype determination is not affected by environmental factors, and the accuracy rate can reach 100%; it supports high-throughput detection, is compatible with 96-well or 384-well plate detection platforms, and can complete the detection of thousands of samples per day; at the same time, the detection cost is low, with a single sample detection cost of only 0.5~1 yuan, significantly reducing the screening cost of large-scale segregating populations, and has important application prospects in molecular-assisted selection breeding of NbEDS1 gene mutants.

[0063] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A KASP molecular marker for the NbEDS1 gene, characterized in that, The molecular marker includes the InDel site in the Nicotiana benthamiana NbEDS1 gene; The wild-type allele of the NbEDS1 gene is C and contains a 97bp insertion sequence. The mutant allele of the NbEDS1 gene is A and the inserted sequence is missing; The nucleic acid sequence of the inserted sequence is shown in SEQ ID NO.

1.

2. The detection primer set for the KASP molecular marker of the NbEDS1 gene as described in claim 1, characterized in that, The detection primer set includes F1 primer, F2 primer and R primer; The F1 primer includes, from the 5' end to the 3' end, a linker sequence of the F1 primer fluorescent reporter group and an F1 primer gene-specific sequence, wherein the nucleic acid sequence of the F1 primer gene-specific sequence includes the sequence shown in SEQ ID NO.2; The F2 primer comprises, from the 5' end to the 3' end, a linker sequence of the F2 primer fluorescent reporter group and an F2 primer gene-specific sequence, wherein the nucleic acid sequence of the F2 primer gene-specific sequence includes the sequence shown in SEQ ID NO. 3; The nucleic acid sequence of the R primer includes the sequence shown in SEQ ID NO.

4.

3. The detection primer set for the KASP molecular marker of the NbEDS1 gene according to claim 2, characterized in that, The fluorescent reporter group of the F1 primer or the fluorescent reporter group of the F2 primer are each independently selected from FAM or HEX; Preferably, the fluorescent reporter group of the F1 primer is FAM, and the ligation sequence is shown in SEQ ID NO.5; Preferably, the fluorescent reporter group of the F2 primer is HEX, and the ligation sequence is shown in SEQ ID NO.

6.

4. A kit for detecting the genotype of the NbEDS1 gene in Nicotiana benthamiana, characterized in that, The kit includes a detection primer set for the KASP molecular marker of the NbEDS1 gene as described in claim 2 or 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes at least one of 2× KASP MasterMix, sterile deionized water, a 96-well PCR plate, or an optical-grade sealing film.

6. A method for detecting the genotype of the NbEDS1 gene in Nicotiana benthamiana, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the sample of Nicotiana benthamiana to be tested; (2) Using the genomic DNA extracted in step (1) as a template, KASP-PCR amplification was performed using the detection primer set described in claim 2 or 3; (3) Detect the fluorescence signal of the PCR product and determine the genotype based on the fluorescence signal type.

7. The method for detecting the genotype of the Nicotiana benthamiana NbEDS1 gene according to claim 6, characterized in that, The criteria for determining genotype in step (3) are as follows: The fluorescence signal of the fluorescent reporter group of the F1 primer is only displayed: the individual is identified as a wild-type homozygote. If only the fluorescent signal of the F2 primer fluorescent reporter group is displayed, the individual is identified as a mutant homozygote. Simultaneous display of fluorescence signals from both the F1 and F2 primer fluorescent reporter groups indicates a heterozygote.

8. The method for detecting the genotype of the Nicotiana benthamiana NbEDS1 gene according to claim 6 or 7, characterized in that, The reaction system for KASP-PCR amplification in step (2) includes: 5~25 ng / μL Nicotiana benthamiana genomic DNA, 1×~3×KASPMaster Mix, 0.5~2 μM F1 primer, 0.5~2 μM F2 primer and 1~5 μM R primer; Preferably, the volume ratio of the F1 primer, F2 primer, and R primer is 1:1:(2~4).

9. The method for detecting the genotype of the Nicotiana benthamiana NbEDS1 gene according to claim 7 or 8, characterized in that, The reaction program for KASP-PCR amplification in step (2) is as follows: 1) 94℃~96℃, 10~20 min; 2) 94℃~96℃ denaturation for 15~25 s, 61℃~55℃ cyclic cooling annealing extension, each cycle decreasing by 0.5℃~0.6℃ for 50~60 s, for a total of 8~12 cycles; 3) 94℃~96℃ denaturation for 15~25 s; 55℃~58℃ annealing extension for 50~60 s, for a total of 25~30 cycles.

10. The use of the KASP molecular marker of claim 1, the detection primer set of claim 2 or 3, or the kit of claim 4 or 5 in any of the following aspects: (1) Genotyping of the NbEDS1 gene mutant of Nicotiana benthamiana; (2) Rapid screening of mutant materials in research on TNL-type immune receptor disease resistance pathways; (3) Genetic analysis related to the NbEDS1 gene; (4) Functional analysis of NbEDS1 gene in disease resistance pathway.

Images