Antibodies, antibody conjugates against b-lymphocyte antigen cd19 and their use in immunoassays

Abstract

The application belongs to the technical field of antibody preparation, and particularly relates to an antibody against B lymphocyte antigen CD19, an antibody conjugate and application thereof in immune detection. The amino acid sequences of CDR1-3 on the light chain variable region of the antibody are respectively shown as SEQ ID NO. 3-5, and the amino acid sequences of CDR1-3 on the heavy chain variable region are respectively shown as SEQ ID NO. 8-10. The antibody of the application has high recognition sensitivity and binding affinity to CD19 protein naturally expressed by human and monkey cells, has no cross reaction or weak non-specific binding to non-target proteins on cells, is beneficial to improving the sensitivity, specificity, accuracy and detection precision of detection, provides an antibody tool with good performance, reliability and practicality for the fields of immune cell subpopulation typing and B lymphocyte function identification, and is particularly suitable for the establishment and application of a flow cytometry and multi-color flow cytometry detection system.

Description

Technical Field

[0001] This invention relates to the field of antibody preparation technology, and in particular to antibodies against B lymphocyte antigen CD19, antibody-drug conjugates, and their applications in immunoassay. Background Technology

[0002] B lymphocyte antigen CD19, also known as cluster of differentiation 19, B lymphocyte surface antigen B4, T-cell surface antigen Leu-12, or CVID3, is a type I transmembrane glycoprotein specifically expressed in the B cell lineage. It belongs to the immunoglobulin superfamily (IgSF) and is widely expressed at all stages of B cell development, until final differentiation into plasma cells. It is widely distributed on the surface of B lymphocytes and is a functional receptor molecule. Therefore, human CD19 is a pan-B cell marker.

[0003] CD19, a core component of the B-cell co-receptor complex, works synergistically with CD21 and CD81 to finely regulate the signal intensity of the B-cell receptor (BCR). When the BCR is cross-linked, the intracellular region of CD19 undergoes phosphorylation, recruiting signaling molecules such as Lyn, PI3K, and Vav, thereby activating multiple signaling pathways including the MAPK cascade, phospholipase Cγ2 (PLCγ2), and intracellular calcium ion mobilization. This regulates the activation threshold, proliferation, differentiation, and antibody production of B cells, playing a crucial role in humoral immune responses. In addition to being expressed at various developmental stages of B cells, human CD19 is also expressed on the surface of follicular dendritic cells, suggesting a possible auxiliary function in maintaining immune memory and germinal center responses. Abnormal CD19 function is associated with various diseases. Studies show that CD19 is highly expressed in various B-cell-related malignancies such as B-lymphoblastic leukemia and non-Hodgkin's lymphoma, but not in hematopoietic stem cells or other normal cells. Therefore, CD19 is an ideal target for the diagnosis and treatment of B-lymphoblastic leukemia. Monkey CD19 is highly homologous to human CD19 in terms of structure, expression patterns and function. Therefore, it is widely used as a B cell lineage marker in non-human primate models for the study of B cell-related immune mechanisms, and as a key target and monitoring indicator in the preclinical evaluation of immunotherapies such as CAR-T.

[0004] Highly specific monoclonal antibodies are fundamental tools for biological research and diagnostic applications of CD19. Flow cytometry is the core technology platform for the detection of B lymphocyte antigen CD19. Currently, most monoclonal antibodies are focused on human CD19-targeted research, with limited research in model animals, especially non-human primates. This results in problems such as insufficient cross-reactivity, poor specificity, and low quantitative sensitivity. Consequently, different antibodies must be purchased separately for preclinical efficacy evaluation, toxicology evaluation, and related mechanism studies in animal models, as well as for clinical sample testing. This leads to poor data comparability and makes it difficult to meet the cross-species requirements of the entire process from basic research to clinical application. Furthermore, existing antibodies are insufficient to meet the precise single-cell analysis requirements of flow cytometry detection systems. Most antibodies readily react with non-target proteins on the cell surface, leading to severe background interference, high false positive rates, or failure to effectively identify cells with low CD19 expression, causing cell clustering failure and false negative results. Therefore, developing novel antibodies with high specificity, high sensitivity, and / or broad-spectrum recognition of human and monkey CD19 targets has become a pressing technical problem for those skilled in the art. Summary of the Invention

[0005] To address the technical problems of existing CD19 protein-targeting antibodies, such as poor specificity, low sensitivity, insufficient compatibility with flow cytometry detection systems, and / or a general lack of cross-reactivity with primate models, this invention provides a novel monoclonal antibody against the B lymphocyte antigen CD19 that exhibits high specificity, high sensitivity, compatibility with flow cytometry detection, and excellent cross-reactivity with human and monkey species. This provides a reliable antibody tool for clinical diagnosis and preclinical basic research. Furthermore, the invention provides antibody-drug conjugates (ADCs) of this antibody and detection markers, as well as the application of this antibody and its ADCs in the preparation of CD19 protein immunoassay kits and related immunoassay kits. To achieve the aforementioned objectives, this invention specifically utilizes the following technical solutions:

[0006] The first aspect of the present invention provides an antibody against B lymphocyte antigen CD19, comprising a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown in SEQ ID NO. 3-5, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 8-10, respectively.

[0007] Furthermore, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7.

[0008] Furthermore, the amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0009] Further, the antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

[0010] A second aspect of the present invention provides a nucleic acid molecule or recombinant vector, the recombinant vector comprising the nucleic acid molecule, the nucleic acid molecule comprising a gene sequence encoding an antibody against the anti-B lymphocyte antigen CD19 as described above.

[0011] Furthermore, the nucleic acid molecule also includes a gene sequence encoding a signal peptide.

[0012] Furthermore, the nucleic acid sequence of the light chain variable region of the antibody is as shown in SEQ ID NO.12 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.14 or a complementary sequence thereto.

[0013] Furthermore, the nucleic acid sequence of the light chain of the antibody is as shown in SEQ ID NO.11 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a complementary sequence thereto.

[0014] A third aspect of the present invention provides an antibody conjugate comprising an antibody against B lymphocyte antigen CD19 as described above and a detection marker conjugated to said antibody.

[0015] Furthermore, the detection marker is a fluorescent protein, specifically allophycocyanin (APC).

[0016] The fourth aspect of the present invention provides the use of the antibody or antibody-drug conjugate against B lymphocyte antigen CD19 as described above in the preparation of an immunoassay kit for B lymphocyte antigen CD19, wherein the antibody-drug conjugate comprises the antibody and a detection marker linked to the antibody.

[0017] Furthermore, the B lymphocyte antigen CD19 is human or monkey B lymphocyte antigen CD19.

[0018] Furthermore, the immunoassay kit is a flow cytometry kit.

[0019] The fifth aspect of the present invention provides an immunoassay kit for B lymphocyte antigen CD19, the immunoassay kit comprising an antibody or antibody-drug conjugate against B lymphocyte antigen CD19 as described above.

[0020] The advantages and positive effects of this invention are as follows:

[0021] This invention provides an antibody that simultaneously recognizes and binds to both human and non-human primate CD19 proteins. It exhibits effective cross-reactivity with both human and monkey CD19 proteins, demonstrating high recognition sensitivity and binding affinity for naturally expressed CD19 proteins in human and monkey cells, and effectively distinguishing between CD19 proteins. + Positive groups and CD19 - The antibody population is negative and has no cross-reactivity or weak non-specific binding to non-target proteins on cells, which helps to greatly reduce false positive and false negative results and improve the sensitivity, specificity, accuracy and precision of detection. It provides a high-performance, reliable and practical antibody tool for fields such as immune cell subset typing and B lymphocyte function identification, clinical pathological diagnosis of B cell tumors and efficacy evaluation of immunotherapy. It is especially suitable for the establishment and application of flow cytometry and multicolor flow cytometry detection systems for biological samples such as cells or tissues. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a graph showing the results of immune serum titer detection after immunizing rabbits with the CD19 20-292 amino acid fragment of cynomolgus monkey B lymphocyte antigen in Example 1 of the present invention.

[0024] Figure 2 This is a flow cytometry histogram of 293F cells overexpressing the CD19 gene, detected using immune serum in Example 1 of this invention.

[0025] Figure 3 This is a flow cytometry histogram of wild-type 293F cells detected using immune serum in Example 1 of the present invention.

[0026] Figure 4 This is a vector map of pBR322, the expression vector used to construct an anti-B lymphocyte antigen CD19 antibody in Example 1 of the present invention. From left to right, they are vectors pre-loaded with the antibody light chain constant region and the heavy chain constant region, respectively.

[0027] Figure 5 This is a flow cytometry scatter plot of human peripheral blood mononuclear cells detected using anti-B lymphocyte antigen CD19 antibody combined with anti-CD20 protein antibody in Example 2 of the present invention.

[0028] Figure 6The flow cytometry scatter plot of peripheral blood mononuclear cells of cynomolgus monkeys used in Example 2 of this invention, which combines anti-B lymphocyte antigen CD19 antibody with anti-CD20 protein antibody. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0030] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0031] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0032] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0033] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0034] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0035] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit-derived antibody," and "rabbit monoclonal antibody" have the same meaning. Unless otherwise specified, they all refer to antibodies that specifically bind to the cluster of differentiation 19 (CD19). The terms "CD19," "CD19 protein," "cluster of differentiation 19," "B-lymphocyte antigen CD19," and "B-lymphocyte antigen CD19" also have the same meaning. The modifier "rabbit" indicates that the antibody's complementarity-determining region (CDR) is derived from a rabbit immunoglobulin sequence.

[0036] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" should be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity. An antibody fragment may be one or more portions or fragments of a full-length antibody, retaining the antibody's ability to specifically bind to a target antigen.

[0037] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts remain relatively constant. The regions of the light and heavy chains with significant amino acid sequence variation near the N-terminus are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are typically the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0038] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0039] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cell-mediated cytotoxicity (ADCC). The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0040] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0041] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0042] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable region and constant region) and a portion of a heavy chain (variable region and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease digestion of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0043] (ii) F(ab)2: contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0044] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0045] (iv) (Fv)2: Consists of two Fv segments covalently linked together.

[0046] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. In this invention, the linker is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0047] (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0048] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a CDR region and a FR region derived from a rabbit immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-rabbit immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a rabbit antibody, and a FR region derived from a human antibody. In some cases, the variable region of the non-human antibody binds to the constant region of a human antibody, such as in human-rabbit chimeric antibodies; in other cases, the CDR region of the non-human antibody binds to both the FR region and the constant region derived from a human antibody sequence, i.e., grafting the CDR region of the non-human antibody onto a human antibody frame (FR) sequence derived from the FR sequence of one or more other human antibody variable regions. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the rabbit CDR region.

[0049] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0050] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0051] To make the objectives, features, and advantages of this invention more apparent and understandable, the specific embodiments of this invention are described in detail below.

[0052] An embodiment of the present invention provides an antibody against the B lymphocyte antigen CD19, comprising a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively.

[0053] This invention uses the 20-292 amino acid fragment of the cynomolgus B lymphocyte antigen CD19 as an immunogen to immunize rabbits. Based on monoclonal antibody development technology using single B lymphocyte screening and culture, a rabbit monoclonal antibody against CD19 protein is obtained. The resulting antibody exhibits cross-reactivity with human and cynomolgus CD19 proteins, specifically targeting CD19 molecules in their native conformation on the surface of both human and cynomolgus cells, thus solving the problem of the lack of tools for cross-detection of human and cynomolgus CD19 molecules in existing technologies. Furthermore, the antibody of this invention has high recognition sensitivity and binding affinity for naturally expressed CD19 protein on cells, and exhibits no cross-reactivity or weak non-specific binding to non-target proteins on cells, effectively ensuring that the detection signal originates from the target protein, which helps to significantly reduce false positive and false negative results and improve accuracy and precision. Using human and cynomolgus peripheral blood mononuclear cells (PBMCs) as detection targets, the aforementioned antibody can effectively distinguish CD19. + Positive groups and CD19 -The negative population and positive detection signals are consistent with the actual expression of CD19 in PBMCs. Combined with markers such as CD20, multi-channel flow cytometry sorting can accurately locate target cells and quantify the proportion changes of different subpopulations in a specific cell population, significantly improving the detection rate and accuracy. It is suitable for the construction of immunobiopsy technology for biological samples such as cells or tissues, especially for the establishment and application of flow cytometry and multicolor flow cytometry detection systems for biological samples such as cells or tissues. It provides a high-performance, reliable and practical antibody tool for fields such as immune cell subpopulation typing and B lymphocyte function identification, clinical pathological diagnosis of B-cell tumors and efficacy evaluation of immunotherapy.

[0054] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged in an alternating sequence with three core parameters (CDRs) to form the variable region. The amino acid sequence of the antibody light chain variable region (VL) of the present invention is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7.

[0055] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH), wherein CL and VL constitute a complete light chain (FL), and CH and VH constitute a complete heavy chain (FH). The constant regions of the antibody are usually obtained by querying the IMGT online database, for example: by searching for rabbit-derived IgG gamma C reign in the IMGT online database (www.imgt.org) to obtain CH, and by searching for rabbit-derived IgG Kappa C reign to obtain CL.

[0056] Specifically, the amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0057] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length form. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained by conventional techniques in the art.

[0058] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the nucleic acid molecule, or a host cell comprising the nucleic acid molecule, wherein the nucleic acid molecule includes a gene sequence encoding an antibody against the anti-B lymphocyte antigen CD19 as described above.

[0059] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand.

[0060] The sequence of a nucleic acid molecule can be derived from the antibody AA sequence using conventional methods such as codon coding rules. The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained using PCR amplification, recombination, or artificial synthesis.

[0061] For example, the nucleic acid sequence of the antibody light chain variable region is as shown in SEQ ID NO.12 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.14 or a complementary sequence thereto.

[0062] For example, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a complementary sequence thereto.

[0063] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules in the above examples should not be regarded as limiting the scope of protection of the present invention.

[0064] To achieve secretory expression of the antibody, the nucleic acid molecule may optionally include a gene sequence encoding a signal peptide, the signal peptide being located upstream of the antibody gene sequence.

[0065] The original vector used to construct the recombinant vector can be any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule, which is then introduced into a host cell and cultured under specific conditions to express and obtain an antibody. This is a well-known technique in the art and will not be described in detail here.

[0066] The nucleic acid molecules encoding the antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.

[0067] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, microinjection, electroporation, or liposome packaging can be used. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or gene gun bombardment.

[0068] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0069] In a preferred embodiment, the recombinant vector described above is the mammalian expression vector pBR322, and the host cell is human renal epithelial cells (293F cells).

[0070] In a typical implementation, the antibody preparation method includes: tandemly loading the heavy chain gene, light chain gene, and signal peptide of the antibody onto the expression vector pBR322, co-transfecting 293F cells, culturing the 293F cells, collecting the cell culture supernatant, and purifying it to obtain the target antibody strain. The selection of the signal peptide is designed based on the host cell, and this invention does not have any special limitations in this regard.

[0071] Another embodiment of the present invention provides an antibody conjugate comprising an antibody against B lymphocyte antigen CD19 as described above and a detection marker conjugated to the antibody.

[0072] The detection markers are used to generate identifiable signal changes to identify the antibodies of the present invention based on these signal changes, thereby identifying the expression of CD19 protein in the sample to be tested through a specific antigen-antibody reaction. Detection markers include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin (APC), phycoerythrin (PE), PerCP, and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, and avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof.

[0073] It is important to emphasize that the antibodies of this invention can be used alone or linked (covalently or non-covalently) with detection markers to form antibody-conjugates. In some embodiments, the antibodies of this invention are used as antigen-binding (or capture) antibodies that specifically recognize and bind to CD19 in the sample to be tested. CD19 is then qualitatively or quantitatively detected by analyzing the signal of the detection marker linked to it, as in the flow cytometry detection system established in Example 2 of this invention below. In other embodiments, the anti-CD19 antibody (as a primary antibody or capture antibody) is not labeled, but the detection marker is coupled to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-CD19 antibody is a rabbit-derived IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, CD19 is qualitatively or quantitatively detected by analyzing the change in the detection marker signal generated after the secondary antibody specifically binds to the antibody of this invention, as in the ELISA detection system established in Example 1 of this invention below.

[0074] Optionally, the detection marker is allophycocyanin (APC). The basic principle is to activate APC to obtain phycocyanin with active groups (such as isothiocyanate, NHS ester, maleimide), and then couple it with a monoclonal antibody, so that the APC molecule is coupled to the amino group of the lysine residue or the thiol group of the cysteine ​​residue of the antibody through the active group, so that the antibody generates a detectable signal while retaining antigen specificity; the reaction types include, but are not limited to: nucleophilic addition reaction of isothiocyanate to amino group, amidation reaction of N-hydroxysuccinimide ester (NHS ester) to amino group, and Michael addition reaction of maleimide to thiol group. For details, please refer to the literature "BRINKLEY M. A brief survey of methods for preparing protein conjugates with dyes, haptens, and cross-linking reagents[J]. Bioconjugate Chemistry, 1992, 3(1): 2-13.".

[0075] In one embodiment of the present invention, the use of the antibody or antibody-drug conjugate against B lymphocyte antigen CD19 as described above in the preparation of an immunoassay kit for B lymphocyte antigen CD19 is provided.

[0076] The antibody of this invention can recognize the human-monkey homologous CD19 protein. Its cross-species reactivity can support the dynamic monitoring of CD19 in human and primate (e.g., cynomolgus monkey) models, verify target binding, pharmacokinetic, and pharmacodynamic indicators in NHP models, simulate its effects in the human body, and achieve cross-species, full-process applicability from basic research to clinical application, greatly expanding the application scenarios of the antibody. Therefore, in a preferred embodiment of this invention, the CD19 protein can be human or monkey CD19 protein, specifically cynomolgus monkey CD19 protein. The amino acid and nucleotide sequences of the CD19 protein can be obtained using conventional techniques. Information on human CD19 protein can be found in NCBI number NP_001171569.1, and information on cynomolgus monkey CD19 protein can be found in NCBI number XP_005591597.1.

[0077] Based on the same inventive concept, embodiments of the present invention also provide an immunoassay kit for B lymphocyte antigen CD19, the immunoassay kit comprising antibodies or antibody-drug conjugates against B lymphocyte antigen CD19 as described above.

[0078] The aforementioned immunoassay methods include, but are not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), Western blot (WB), immunoprecipitation (IP), and flow cytometry (FC). Immunoassay kits may be ELISA kits, ELISPOT kits, immunohistochemistry kits, immunofluorescence kits, Western blot kits, or flow cytometry kits.

[0079] Preferably, the immunoassay kit is a flow cytometry kit.

[0080] Optionally, the test samples include, but are not limited to, serum, plasma, urine, cells or cell culture medium, tissue or tissue homogenate.

[0081] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0082] Example 1: Preparation of rabbit monoclonal antibody against Human / Monkey CD19 protein

[0083] 1.1 Animal Immunization: The immunogen used was recombinant Macaca fascicularis CD19 protein. The sequence of Macaca fascicularis CD19 protein (B-lymphocyte antigen CD19) can be found in NCBI sequence number XP_005591597.1 (Gene ID: 102145514), and the gene sequence can be found in NCBI sequence number XM_005591540.2. The immunogen was the amino acid (AA) fragment from positions 20 to 292 of the CD19 protein. The gene sequence corresponding to AA from positions 20 to 292 of the CD19 protein was constructed into an expression vector, transformed into 293F cells, and expressed high-quality recombinant CD19 protein with biological activity.

[0084] Four New Zealand white rabbits were immunized with recombinant CD19 protein at a dose of 200 μg / rabbit. Before the first immunization, the immunogen was mixed with an equal volume of complete Freund's adjuvant (purchased from Sigma) to prepare an emulsion, which was injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Every three weeks after the first immunization, 100 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant (purchased from Sigma) to prepare an emulsion, which was then injected subcutaneously at multiple sites on the abdomen and back of the rabbits for two booster immunizations. After three immunizations, rabbit serum samples were collected, diluted 1:243000, and their titer against CD19 was determined using enzyme-linked immunosorbent assay (ELISA). The OD values ​​were then collected. 450nm Rabbits with a titer greater than 0.2 were given a booster immunization via subcutaneous injection of 200 μg immunogen at multiple sites, and their spleens were harvested three days later. Flow cytometry (FC) was used to determine the specificity of serum samples compared to positive samples.

[0085] Serum titer test results are shown below Figure 1 The primary antibody was recombinant CD19 protein, with a final coating concentration of 1 μg / mL. The primary antibody was the serum sample, initially diluted 1:1000 with 1×PBS buffer, followed by serial dilutions at a 1:3 ratio, for a total of eight gradients. The secondary antibody was horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (purchased from Jackson Immunoresearch, catalog number 111-035-045), diluted 1:5000. Pre-immunization rabbit serum served as a negative control, and the detection system without immunized serum served as a blank control (NC). WA-64320D is the project number, and N18478-N18479 are the rabbit numbers. Figure 1 It can be seen that a strong immune response was generated in the rabbits after the third to fourth immunizations, with high titers of neutralizing antibodies and good activity of specific antibodies, which can be used to isolate antibodies.

[0086] The recognition specificity of immune serum against positive cell samples (293F cells transformed with CD19 expression vector) and negative samples (wild-type 293F cells) was determined by the FC method, and the following steps were taken: 1) The ultra-clean workbench was sterilized by UV irradiation for 15-20 min, and the fan was turned on for 5 min to prepare for aseptic work; 2) Cells were collected and washed, the total cell count was determined, and cell viability was checked to be 90%-95%; 3) The cells were resuspended in 1×PBS solution to approximately 3×10⁻⁶ cells. 6 -5×10 64) Distribute cells at 100 μL / well into 96-well V-plates and wash once with 1×PBS; 5) Stain with L / D staining solution from Biolegend's Zombie NIR Fixable Viability Kit (catalog number 423105). Dilute the L / D staining solution 1:1500 with 1×PBS and distribute 100 μL / well into each well, resuspending the cells in the wells; 6) Wrap the cells in aluminum foil and gently mix on a microplate shaker for 15 min, then centrifuge at 400g for 5 min, discard the supernatant, and wash twice with PBS containing 0.5% bovine serum albumin (0.5% BSA / PBS); 7) Distribute 100 μL / well of the solution containing 0.5% bovine serum albumin into each well. 7) Dispense the BSA / PBS diluted immune serum (dilutions 1:500 and 1:2000) into the wells and resuspend the cells in each well; 8) Repeat step 5); 9) Add 100 μL / well of the fluorescent secondary antibody Allophycocyanin (APC) AffiniPure F(ab')2 Fragment Goat Anti-Rabbit IgG (H+L) (purchased from Jackson, catalog number 111-136-144) diluted 1:200 with 0.5% BSA / PBS into the wells and resuspend the cells in the wells; 10) Repeat step 5), then resuspend the cells in each well with 200 μL of 0.5% BSA / PBS and store in the dark; 11) Perform the analysis according to the Beckman Cytoflex Flow Cytometer Operation and Maintenance SOP-105-AND-CA-008.

[0087] The results of the assay for the binding ability of immune serum to positive and negative cells are shown below. Figure 2-3 In the figure, serum dilutions from left to right are 1:500 and 1:2000. The red curve represents the negative control, the blue curve represents the rabbit IgG antibody isotype control, and the yellow curve represents the test serum. The horizontal axis represents the relative fluorescence intensity of the channel's fluorescence signal / scattered light signal, and the vertical axis represents the number of cells, i.e., the number of cells falling within that range. It can be seen that after the fourth booster immunization, the immune serum produced antibodies that specifically recognize the naturally expressed CD19 protein on the surface of living cells. This is manifested in the presence of bimodal signals in immune serum at different dilutions compared to both the negative and isotype controls, with a significant signal difference compared to the single peak of the isotype control.

[0088] 1.2 Isolation of B lymphocytes and sorting of antigen-specific B lymphocytes in the spleen: For relevant methods, please refer to the published patents “Method for efficient isolation of single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)” and “An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: 2020-08-11)”.

[0089] 1.3 Cloning of the gene encoding a rabbit-derived monoclonal antibody: The supernatant of cultured B lymphocytes was used to identify antigen-specific B lymphocytes using an ELISA coated with recombinant CD19 protein. Lysed cells were collected and analyzed using Quick-RNA... TM RNA was extracted using the Micro Prep kit (ZYMO, catalog number R1100-250) and reverse transcribed into cDNA. Using cDNA as a template, naturally paired rabbit antibody light chain variable region (VL) and heavy chain variable region (VH) genes were amplified by PCR and sequenced. The PCR system consisted of: 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (ABclonal, catalog number RK20717), and 6.5 μL H2O. The PCR program consisted of: 98℃ for 30 s, followed by 40 cycles of 98℃ for 10 s, 64℃ for 30 s, and 72℃ for 30 s, with a final incubation at 72℃ for 5 min. The reaction mixture was stored at 4℃. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers, respectively.

[0090] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 15);

[0091] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 16);

[0092] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 17);

[0093] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 18).

[0094] The amplified DNA product was sequenced to obtain the VL sequence shown in SEQ ID NO.2 and the VH sequence shown in SEQ ID NO.7; then the sequence of the constant region was obtained by querying the IMGT online database (www.imgt.org), resulting in antibody 1A9 with the complete light chain (FL) shown in SEQ ID NO.1 and the complete heavy chain (FH) shown in SEQ ID NO.6.

[0095] Antibody sequencing was performed by Kinkai Biotechnology Co., Ltd. The antibody amino acid sequence and DNA sequence are shown in Table 1-2. In the table, LCDR1-3 represent complementarity-determining regions (CDR1-3) on the light chain variable region, and HCDR1-3 represent complementarity-determining regions (CDR1-3) on the heavy chain variable region. The variable region numbering system is the Kabat numbering system.

[0096] Table 1. Sequence information of rabbit antibody 1A9 in this embodiment.

[0097]

[0098] Table 2. Gene sequence of rabbit-derived antibody 1A9 in this embodiment.

[0099]

[0100] 1.4 Expression and Large-Scale Production of Antibody 1A9: The amplified VL and VH genes described above were inserted in tandem with the light chain constant region (CL) and heavy chain constant region (CH) into an expression vector. Monoclonal antibodies were produced in large quantities through recombinant expression of the antibody genes. In this example, the CL and CH genes were pre-inserted into the mammalian expression vector pBR322, and its expression profile is shown below. Figure 2 In the figure, pBR322origin and f1 origin are replication promoters, Ampcillin is the resistance gene, CMV immediate promoter is the transcription promoter, SV40 PA terminator is the tailing signal, the light chain constant is the nucleotide sequence of CL (left figure), and the heavy chain constant is the nucleotide sequence of CH (right figure). Then, the VL and VH genes were ligated to the expression vector pBR322 carrying the CL and CH genes, linearized with XbaI and NheI restriction endonucleases respectively, via homologous recombination to obtain the FL and FH gene expression vectors. Sequencing confirmed the successful construction of the vectors.

[0101] To facilitate antibody purification, secretory expression of the antibody is achieved by adding a signal peptide upstream of the VL and VH genes. Commonly used antibody expression signal peptides in the field can be used. For further purification, secretory expression of the antibody can also be achieved by adding a signal peptide upstream of the VL and VH genes, again using commonly used antibody expression signal peptides, such as those in the patents "Rabbit Monoclonal Antibody against Human Interferon α2 and its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and "High Affinity Human...". The signal peptide described in the patents “IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: 2023-03-21),” “PAC1 antibody and its use (Publication No.: CN111566126A, Publication Date: 2020-08-21),” and “Monoclonal antibody against human carbohydrate antigen CA125 and its application (Publication No.: CN120484121A, Publication Date: 2025-08-15)” is present upstream of VL in this embodiment, and the signal peptide “MDTRAP” is present upstream of VL. TQLLGLLLLWLPDARC (encoding gene atggacacgagggcccccactcagctgggcctgctgctgttgtggctgcctgacgccagatgt), with a signal peptide "METGLRWLLLVAVLKGVQC (encoding gene atggagactgggctgcgctggcttctcctggtcgcagtgctgaaaggcgtgcagtgc)" upstream of VH. Of course, those skilled in the art can replace the signal peptide with another after obtaining the antibody sequence of this invention for antibody expression; therefore, the signal peptide sequence is not shown in Table 1 of this embodiment.

[0102] The successfully constructed FL and FH expression vectors were co-transfected into 293F cells. After transfection and culture for 72-96 hours, the culture supernatant contained antibody 1A9, which recognizes the Human / Monkey CD19 protein. The target antibody was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA015100). The antibody purity was verified to be ≥95% by 12% SDS-PAGE. The purified antibody was aliquoted and stored at -20°C for later use.

[0103] Example 2: Establishment and evaluation of a flow cytometry detection system for antibody 1A9.

[0104] This embodiment uses cynomolgus monkey and human peripheral blood mononuclear cells (PBMCs) as the detection subjects, and employs combined flow cytometry detection with anti-CD20 and anti-CD19 antibodies. The rabbit monoclonal antibody labeled with PE against Human / Monkey CD20 protein (purchased from ABclonal, catalog number A24420) and the rabbit IgG antibody labeled with APC (purchased from ABclonal, catalog number A24173) serve as isotype controls.

[0105] Preparation of allophycocyanin (APC) labeled antibody 1A9: Prepare an antibody solution of 1 mg / mL with PBS, add pre-activated NHS-APC to the antibody solution, the molar ratio of APC to antibody is 5-10:1, adjust the pH to 7.5-8.5, react at 4℃ in the dark for 1-2 h, dialyze to remove unreacted dye, and obtain APC fluorescently labeled antibody 1A9.

[0106] FC detection includes the following steps: 1) Sterilize the clean bench with ultraviolet light for 15-20 minutes, turn on the fan for 5 minutes, and prepare for aseptic work; 2) Collect and wash cells, determine the total cell count, and check that the cell viability is between 90% and 95%; 3) Resuspend the cells in 1×PBS solution to approximately 3×10⁻⁶ cells. 6 -5×10 6 4) Dispense 100 μL of L / D staining solution into 96-well V-plates at a ratio of 1:1500 with 1×PBS, and dispense 100 μL of the diluted L / D staining solution into each well, resuspending the cells in the wells; 5) Wrap the cells in aluminum foil, gently mix on a microplate shaker for 15 min, then centrifuge at 400g for 5 min, discard the supernatant, and wash twice with 0.5% BSA / PBS; 6) Dispense 100 μL of APC fluorescently labeled 1A9 antibody (working concentration 5 μL / Test) and PE fluorescently labeled CD19 antibody diluted with 0.5% BSA / PBS into each well, resuspending the cells in each well; 7) Repeat step 5), then resuspend the cells in each well with 200 μL of 0.5% BSA / PBS and store in the dark; 8) Follow Beckman's instructions. Perform analysis using the Cytoflex flow cytometer in accordance with Operation and Maintenance SOP-105-AND-CA-008.

[0107] The FC test results for human and cynomolgus PBMCs are shown in the following figures. Figure 5-6The left side shows a scatter plot of isotype control and CD20 antibody double staining, while the right side shows a scatter plot of 1A9 antibody and CD20 antibody double staining. The horizontal axis represents the fluorescence signal of isotype control or 1A9 antibody, and the vertical axis represents the fluorescence signal of CD20 antibody. PBMCs are a population of cells with single nuclei in peripheral blood, mainly composed of T lymphocytes, followed by B lymphocytes, and others including monocytes, dendritic cells, and NK cells. CD19 and CD20 are the two most core markers of the B lymphocyte lineage. CD19 is a pan-B cell marker, expressed from pro-B to the pre-plasmacytic stage, while CD20 expression begins in the pre-B stage and is lost in the plasmacytic stage. Therefore, in PBMC detection, theoretically, the expression signals of both should present a clear, stable, and co-expressed pattern. In the late-differentiated plasmablast stage, CD19 may still be expressed at a low level (CD19...). + (Weakly positive), CD20 was negative. The detection results of this invention show that the CD19 positivity rate is close to 0 compared to the isotype control (as a negative control). Using the antibody 1A9 of this invention, a clear and well-aggregated CD19 was observed in human and monkey PBMC samples. + CD20 + Double-positive cell population and a very weak CD19 count. + CD20 - The positive results detected in the cell population were consistent with the distribution characteristics of B lymphocytes in PBMCs, indicating that the 1A9 antibody can specifically target CD19 molecules on the surface of human and monkey cells, exhibit cross-reactivity with target antigens of different species, and demonstrate high sensitivity and good binding affinity to the target antigen, effectively distinguishing CD19. + Positive groups and CD19 - The negative group has virtually no cross-reaction with non-target antigens and exhibits low non-specific signal.

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An antibody against B lymphocyte antigen CD19, characterized in that, It includes a light chain variable region and a heavy chain variable region. The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.

2. The antibody against B lymphocyte antigen CD19 according to claim 1, characterized in that, The amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

7.

3. The antibody against B lymphocyte antigen CD19 according to claim 2, characterized in that, The amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

6.

4. The antibody against B lymphocyte antigen CD19 according to claim 1, characterized in that, The antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of the following fragments: Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

5. A nucleic acid molecule or recombinant vector, characterized in that, The recombinant vector includes the nucleic acid molecule, which includes a gene sequence encoding an antibody against the anti-B lymphocyte antigen CD19 as described in any one of claims 1-4.

6. The nucleic acid molecule or recombinant vector according to claim 5, characterized in that, The nucleic acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO.12 or is complementary to it, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.14 or is complementary to it.

7. An antibody conjugate, characterized in that, The antibody comprises the anti-B lymphocyte antigen CD19 as described in any one of claims 1-4, and a detection marker linked to the antibody.

8. The antibody conjugate according to claim 7, characterized in that, The detection marker is a fluorescent protein, specifically allophycocyanin.

9. The use of the antibody against B lymphocyte antigen CD19 as described in any one of claims 1-4 or the antibody conjugate as described in any one of claims 7-8 in the preparation of a B lymphocyte antigen CD19 immunoassay kit.

10. The use of the antibody or antibody-conjugate against B lymphocyte antigen CD19 according to claim 9 in the preparation of a B lymphocyte antigen CD19 immunoassay kit, characterized in that, The B lymphocyte antigen CD19 is a human or monkey B lymphocyte antigen CD19. The immunoassay kit is a flow cytometry kit.

Images