Use of uridine phosphorylase 1 (UPP1) as an inhibition target in the preparation of a medicament for treating systemic lupus erythematosus (SLE)

Abstract

This application discloses the application of uridine phosphorylase 1 (UPP1) as an inhibitory target in the preparation of drugs for treating systemic lupus erythematosus (SLE), relating to the field of biomedical technology. This application is the first to discover abnormally elevated UPP1 expression in peripheral blood mononuclear cells of SLE patients, which is positively correlated with disease activity. Validation experiments demonstrate that the specific inhibitor of UPP1, BAU, can effectively inhibit UPP1 enzyme activity. In cell models, it reduces inflammatory factors and type I interferon responses induced by STING pathway activation. In SLE animal models, BAU significantly reduces splenomegaly, proteinuria, and pathological damage to the kidneys and lungs, decreases the proportion of pathogenic immune cells such as M1 macrophages, Th1 cells, and plasma cells in the spleen, and inhibits the deposition of immune complexes in the glomeruli. This invention reveals for the first time the potential of UPP1 as a novel therapeutic target for SLE and provides BAU as a candidate drug for treating SLE and related organ damage, offering a novel strategy for clinical intervention.

Description

Technical Field

[0001] This application relates to the field of biomedical technology, and in particular to the use of uridine phosphorylase 1 (UPP1) as an inhibitory target in the preparation of drugs for the treatment of systemic lupus erythematosus (SLE). Background Technology

[0002] Systemic lupus erythematosus (SLE) is a chronic, multi-system, multi-organ autoimmune disease characterized by excessive activation of B cells, leading to the production of large amounts of autoantibodies, the formation of immune complexes, and deposition in organs such as the kidneys, skin, joints, and lungs, causing persistent inflammatory responses and tissue damage. Currently, first-line clinical treatment for SLE primarily relies on glucocorticoids and traditional immunosuppressants (such as hydroxychloroquine, mycophenolate mofetil, and cyclophosphamide). Although some biologics (such as belimumab) have been introduced in recent years, the overall treatment still faces challenges such as inconsistent treatment response rates, significant long-term side effects (such as infection, metabolic disorders, and bone marrow suppression), and treatment relapse in some patients. Therefore, exploring therapeutic drugs that target new avenues, possess novel mechanisms, and have higher safety profiles is an urgent need in current SLE drug development. Summary of the Invention

[0003] The purpose of this application is to address the technical problems of existing SLE treatment methods, such as limited target points and significant side effects.

[0004] To address the aforementioned technical problems, this application provides the following technical solution:

[0005] The application of uridine phosphorylase 1 (UPP1) as an inhibitory target in the preparation of drugs for the treatment of systemic lupus erythematosus (SLE).

[0006] Preferably, the drug contains a UPP1-targeting inhibitor.

[0007] Preferably, the UPP1-targeting inhibitor is a substance capable of inhibiting UPP1 gene expression, UPP1 protein synthesis, and / or UPP1 enzyme activity.

[0008] Preferably, the UPP1-targeting inhibitor is benzylcyclouridine (BAU).

[0009] Preferably, the application also includes its use in the preparation of medicaments for the treatment and / or prevention of SLE-induced organ damage, said organ damage including at least one of kidney damage, splenomegaly, and lung damage.

[0010] Preferably, the therapeutic and / or preventive effects of the kidney damage are reflected in at least one of the following indicators: reduction of 24-hour urinary protein quantification, reduction of renal tissue pathological damage score, reduction of glomerular immunoglobulin G (IgG) deposition, and reduction of glomerular complement 3 (C3) deposition.

[0011] Preferably, the drug is also used to regulate immune cell imbalance in an SLE model, the regulation including at least one of reducing the proportion of M1 macrophages in the spleen, reducing the proportion of Th1 cells in the spleen, and reducing the proportion of plasma cells in the spleen.

[0012] Preferably, the drug inhibits the excessive activation of the STING signaling pathway by inhibiting the enzymatic activity of UPP1, thereby reducing the expression of inflammatory factors, type I interferon, and interferon-stimulated genes; the inflammatory factors include IL-6; the type I interferon includes IFN-β; and the interferon-stimulated genes include CXCL10 and MX1.

[0013] This application also provides the use of a pharmaceutical composition in the preparation of a medicament for the treatment and / or prevention of systemic lupus erythematosus (SLE), the pharmaceutical composition comprising an effective amount of besylacyclouridine (BAU); the medicament further comprising a pharmaceutically acceptable salt, solvate or prodrug, and one or more pharmaceutically acceptable carriers or excipients.

[0014] Preferably, the dosage form of the pharmaceutical composition is selected from one of oral formulations, injections, transdermal formulations, and inhalation formulations.

[0015] Compared with the prior art, this application has at least the following beneficial effects:

[0016] 1. This application is the first to discover abnormally elevated UPP1 expression in peripheral blood mononuclear cells (PBMCs) of SLE patients, which is positively correlated with disease activity. Validation experiments demonstrated that the specific inhibitor of UPP1, besylacyclouridine (BAU), can effectively inhibit UPP1 enzymatic activity. In cell models, it reduces inflammatory cytokines and type I interferon responses induced by STING pathway activation. In SLE animal models, BAU significantly alleviates splenomegaly, proteinuria, and pathological damage to the kidneys and lungs, reduces the proportion of pathogenic immune cells such as M1 macrophages, Th1 cells, and plasma cells in the spleen, and inhibits the deposition of immune complexes (IgG and C3) in the glomeruli.

[0017] 2. This application also demonstrates through specific verification experiments that BAU can downregulate inflammation and type I interferon response in PBMCs of SLE patients. This invention reveals for the first time the potential of UPP1 as a novel target for SLE treatment and provides BAU as a candidate drug for treating SLE and related organ damage, offering a completely new strategy for clinical intervention. Attached Figure Description

[0018] Figure 1 UPP1 expression is elevated in PBMCs of patients with systemic lupus erythematosus (SLE) and is positively correlated with the disease activity indicator SLEDAI score.

[0019] A: Changes in UPP1 expression in PBMCs of patients with systemic lupus erythematosus;

[0020] B: Correlation between UPP1 expression level in PBMCs of patients with systemic lupus erythematosus and disease activity;

[0021] C: Correlation between UPP1 expression level in PBMCs of patients with systemic lupus erythematosus and type I interferon IFNβ;

[0022] D: Correlation between UPP1 expression level and inflammatory factor IL6 in PBMCs of patients with systemic lupus erythematosus;

[0023] E: Correlation between UPP1 expression level and CXCL10 in PBMCs of patients with systemic lupus erythematosus;

[0024] F: Correlation between UPP1 expression level and MX1 in PBMCs of patients with systemic lupus erythematosus.

[0025] Figure 2 BAU reduced the expression of type I interferon and related genes induced by ISD and 2,3-cGAMP stimulation in macrophages. A: PEMs cells were pretreated with BAU for 2 h, and then stimulated with ISD for 6 h before the expression levels of Ifnβ, Cxcl10, Ccl5, and Mx2 mRNA were detected.

[0026] B: BAU and PEMs cells were pretreated for 2 h, and then stimulated with 2,3-cGAMP for 6 h before the expression levels of Ifnβ, Cxcl10, Irf7, and Mx1 mRNA were detected.

[0027] Figure 3: The therapeutic effect of BAU on MRL / Lpr spontaneous lupus mice. A: Spleen size measurement in mice; B: Spleen length statistics in mice; C: 24-hour urinary protein quantification in mice; D: UPP1 expression level in mouse kidney tissue; E: Relative expression levels of Ifnβ, Ccl5, Il6, Cxcl10, Irf7, Ifna4, Mx1, and Mx2 mRNA in mouse kidney tissue; F: H&E staining of mouse kidney.

[0028] Figure 4 BAU improves the condition of spontaneous lupus in MRL / Lpr mice.

[0029] A: Flow cytometry analysis of the ratio of M1 macrophages (F4 / 80+CD86+) in the spleen of MRL / Lpr mice;

[0030] B: Flow cytometry plot of the proportion of Th1 cells (CD4+ IFNγ+) in the spleen of MRL / Lpr mice;

[0031] C: Flow cytometry plot of the ratio of MRL / Lpr mouse spleen plasma cells (B220-CD138+);

[0032] D: Immunofluorescence of immunoglobulin G (IgG) in the glomeruli of MRL / Lpr mouse kidneys; E: Immunofluorescence of complement 3 (C3) in the glomeruli of MRL / Lpr mouse kidneys.

[0033] Figure 5 BAU significantly reduced inflammation of PMBCs and type I interferon expression in SLE patients.

[0034] A: The relative expression levels of IFNβ mRNA were detected in BAU and SLE patients 8 hours after treatment with PBMCs;

[0035] B: The relative expression levels of IL6 mRNA were detected in BAU and SLE patients 8 hours after treatment with PBMCs;

[0036] C: The relative expression levels of CXCL10 mRNA were detected in BAU and SLE patients 8 hours after treatment with PBMCs;

[0037] D: The relative expression levels of IRF7 mRNA were detected in BAU and SLE patients 8 hours after treatment with PBMCs;

[0038] E: The relative expression level of MX1 mRNA was detected 8 hours after treatment with PBMCs in BAU and SLE patients;

[0039] F: The relative expression level of MX2 mRNA was detected 8 hours after treatment with PBMCs in BAU and SLE patients. Detailed Implementation

[0040] The application of uridine phosphorylase 1 (UPP1) as an inhibitory target in the preparation of drugs for the treatment of systemic lupus erythematosus (SLE).

[0041] In one embodiment, the drug comprises a UPP1-targeting inhibitor, specifically, the UPP1-targeting inhibitor is a substance capable of inhibiting UPP1 gene expression, UPP1 protein synthesis and / or UPP1 enzyme activity.

[0042] Preferably, the UPP1 inhibitor is benzylcyclouridine (BAU). The chemical structural formula of benzylcyclouridine (BAU) is shown below:

[0043]

[0044] The applications include the use in the preparation of drugs for the treatment and / or prevention of SLE-induced organ damage, wherein the organ damage includes at least one of kidney damage, splenomegaly, and lung damage.

[0045] The therapeutic and / or preventive effects of the kidney damage described herein are reflected in at least one of the following indicators: reduction of 24-hour urinary protein quantification, reduction of renal tissue pathological damage score, reduction of glomerular immunoglobulin G (IgG) deposition, and reduction of glomerular complement 3 (C3) deposition.

[0046] In one embodiment, the drug is also used to regulate immune cell imbalance in an SLE model, the regulation including at least one of reducing the proportion of M1 macrophages in the spleen, reducing the proportion of Th1 cells in the spleen, and reducing the proportion of plasma cells in the spleen.

[0047] In one embodiment, the drug inhibits the overactivation of the STING signaling pathway by inhibiting the enzymatic activity of UPP1, thereby reducing the expression of inflammatory factors, type I interferon, and interferon-stimulated genes; the inflammatory factors include IL-6; the type I interferon includes IFN-β; and the interferon-stimulated genes include CXCL10 and MX1.

[0048] Furthermore, this application also provides the use of a pharmaceutical composition in the preparation of a medicament for the treatment and / or prevention of systemic lupus erythematosus (SLE), the pharmaceutical composition comprising an effective amount of besylacyclouridine (BAU), and in one embodiment, the medicament further comprising a pharmaceutically acceptable salt, solvate or prodrug, and one or more pharmaceutically acceptable carriers or excipients.

[0049] The dosage form of the pharmaceutical composition is selected from one of the following: oral preparations, injections, transdermal preparations, and inhalation preparations.

[0050] In one embodiment, the daily administration dosage range of Benzylacyclouridine (BAU) is 1 mg / kg to 100 mg / kg of body weight; preferably, the administration dosage is about 30 mg / kg of body weight.

[0051] The above content is described below in combination with specific verification experiments:

[0052] 1. Experimental materials and sources:

[0053] 1. Experimental drugs and reagents: Benzylacyclouridine (BAU) (MCE), 2,3-cGAMP (MCE), DMSO (Solarbio),

[0054] ISD (Forward: tacagatctactagtgatctatgactgatctgtacatgatctaca,

[0055] Reverse: tgtagatcatgtacagatcagtcatagatcactagtagatctgta) (Sangon),

[0056] RNA rapid extraction kit (ESScience), reverse transcription reagents, SYBR (Vazyme), urine protein content detection kit (Solarbio), tissue fixative (Biosharp), goat anti-mouse IgG-FITC, C3-FITC (abcam).

[0057] 2. Experimental animals:

[0058] The mice used in this experiment are female MRL / lpr spontaneous lupus model mice and female MRL / MPJ healthy control mice, which were purchased from Changzhou Cavens Laboratory Animal Co., Ltd.

[0059] 2. Experimental methods:

[0060] 1. Cell culture

[0061] The cells used in the present application are PEMs. BALB / c mice were intraperitoneally injected with 3 mL of 3% thioglycolate aqueous solution, 3 to 4 days after injection, the mice were sacrificed by cervical dislocation, then soaked in disinfectant alcohol for 10 min, and PEMs were extracted. PEMs are cultured in DMEM complete medium (10% FBS, 2 mM L-Glutamine, 100 U / mL penicillin-streptomycin) at 37°C with 5% CO2. Macrophages are seeded in a 24-well plate at a density of 100,000 cells / mL.

[0062] 2. RNA extraction, reverse transcription, and real-time quantitative PCR

[0063] Collect cells, wash once with PBS, add 500 μL of Lysis Buffer to lyse the cells thoroughly, add an equal volume of anhydrous ethanol to the lysed cells, mix thoroughly, transfer to a centrifuge column, and centrifuge at 12000 g at 4℃ for 1 minute. Add 500 μL of Wash Buffer to the RNA column, centrifuge at 12000 g for 1 minute, place the column on a clean, RNase-free 1.5 mL centrifuge tube, and allow it to air dry for 2 minutes. Add 20–50 μL of Elution Buffer to the center of the RNA column membrane, incubate at room temperature for 2 minutes, and then centrifuge at 12000 g for 1 minute to obtain RNA. Store the RNA at -80℃.

[0064] Reverse transcription: First, mix 1 μg RNA and 4 μL 4×gDNA wiper Mix, and adjust the volume to 16 μL with DEPC water. Incubate at 42℃ for 2 min, then add 4 μL 5×HiScript III qRT Super Mix, incubate at 37℃ for 15 min, then at 85℃ for 5 sec to obtain the cDNA template for qPCR.

[0065] The qPCR reaction system consisted of 10 μL: 3.2 μL deionized water, 5 μL SYBR-Green Master Mix, 1 μL diluted cDNA template, and 0.8 μL forward and reverse primers.

[0066] The reaction procedure was as follows: 95℃ for 3 min; 95℃ for 10 sec, 60℃ for 30 sec, read the fluorescence value, for a total of 40 cycles; 95℃ for 15 sec; 60℃ for 60 sec; 95℃ for 15 sec to melt, read the fluorescence value.

[0067] The RT-qPCR primer sequences are as follows:

[0068]

[0069] 3. Drug administration to mice

[0070] SLE mice were grouped according to requirements: a healthy control group, a BAU (dissolved in DMSO) 30 mg / kg administration group, and a negative control group (equal volume of DMSO), with 5-8 mice in each group. BAU was administered intraperitoneally every three days for 5 weeks.

[0071] 4. Urine protein test

[0072] Urine was collected from mice 24 h after metabolic cage administration. Five weeks after intraperitoneal injection of BAU, urine was collected again. The BSA standard provided in the kit was serially diluted with PBS buffer. 20 μL of urine sample was mixed with 1× G250 staining solution and incubated at room temperature in the dark for 3–5 min; absorbance at 595 nm was measured using a microplate reader.

[0073] 5. H&E staining

[0074] Mouse kidneys were placed in 4% paraformaldehyde, then embedded and sectioned. The morphological characteristics of the kidney and lung tissues were assessed by staining with hematoxylin and eosin.

[0075] 6. Flow cytometry

[0076] Mouse spleen cells were prepared into a single-cell suspension. After washing with erythrocytes, the suspension was blocked with FcR (Fc receptor) at room temperature for 15 min.

[0077] In one embodiment, to detect macrophages, the cells are reacted with Fixable Viability DyeeFluor TM Incubate the CD86-FITC antibody at 455 UV for 30 min in the dark using F4 / 80-PERCP.

[0078] In one embodiment, to detect Th1 cells, the cells are reacted with Fixable Viability Dye eFluor TM Incubate with CD3-APC-CY7 and CD4-FITC antibodies at 455 UV for 30 min in the dark. After fixation and membrane perforation, incubate with IFNγ-PE antibody in the dark.

[0079] In one embodiment, to detect plasma cells, the cells are reacted with a Fixable Viability Dye eFluor TM Incubate at 455 UV, TCRβ-Percp-cy5.5, B220-APC, CD138-BV605 in the dark for 30 min.

[0080] After washing, the cell suspension was resuspended in 200 μL of buffer for subsequent flow cytometry (BDBiosciences, USA) analysis.

[0081] 7. Immunofluorescence staining

[0082] Mouse kidneys were embedded in paraffin and sectioned. The paraffin sections were dewaxed, antigens were retrieved, and the sections were blocked with immunofluorescence blocking solution at 37°C for 1 hour. Goat anti-mouse IgG-FITC and C3-FITC were added, and the sections were incubated overnight at 4°C. After washing with PBS, the sections were incubated with secondary antibody, and the cell nuclei were stained with DAPI working solution at room temperature for 5 minutes. After washing with PBS, the sections were mounted, and the deposition of IgG and C3 in the glomeruli was observed using a fluorescence microscope.

[0083] 8. Statistical methods

[0084] Statistical analysis was performed using Graphpad Prism software. Data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and P < 0.05 was considered statistically significant.

[0085] III. Experimental Results:

[0086] Please see Figure 1 , Figure 1 The study showed that UPP1 expression was significantly elevated in PBMCs of patients with systemic lupus erythematosus, and that UPP1 expression was positively correlated with inflammatory factors (IL6), type I interferon (IFNβ), interferon-related genes (CXCL10, MX1), and the disease activity indicator SLEDAI score.

[0087] Specifically, Figure 1 A showed that UPP1 expression was significantly elevated in PBMCs of patients with systemic lupus erythematosus. Figure 1 B showed that the expression level of UPP1 in PBMCs of patients with systemic lupus erythematosus was positively correlated with disease activity. Figure 1 C showed that the expression level of UPP1 in PBMCs of patients with systemic lupus erythematosus was positively correlated with the expression level of type I interferon IFNβ. Figure 1 D showed that the expression level of UPP1 in PBMCs of patients with systemic lupus erythematosus was positively correlated with the expression level of the inflammatory factor IL6. Figure 1 E showed that the expression levels of UPP1 and CXCL10 in PBMCs of patients with systemic lupus erythematosus were positively correlated. Figure 1 F showed that the expression levels of UPP1 and MX1 in PBMCs of patients with systemic lupus erythematosus were positively correlated.

[0088] like Figure 2 As shown, Figure 2 The results showed that BAU significantly reduced the expression of type I interferon and related genes induced by ISD and 2,3-cGAMP stimulation of macrophages. Figure 2 A showed that a BAU concentration of 10 uM significantly reduced the expression levels of Ifnβ, Cxcl10, Ccl5, and Mx2 mRNA induced by ISD stimulation for 6 h. Figure 2B showed that a 10 μM BAU administration significantly reduced the expression levels of Ifnβ, Cxcl10, Irf7, and Mx1 mRNA induced by 6 h of 2,3-cGAMP stimulation.

[0089] Figure 3 and Figure 4 BAU treatment showed relief of symptoms in MRL / Lpr spontaneous lupus mice. Compared with control mice, 5 weeks of BAU 30 mg / kg treatment significantly reduced splenomegaly in lupus mice. Figure 3 A), the length of the spleen was significantly reduced ( Figure 3 B), 24-hour urine protein quantification decreased ( Figure 3 C), the expression level of UPP1 in mouse kidney tissue was significantly decreased ( Figure 3 D), the expression of inflammatory factors, IFN gene, and ISGs in mouse kidney tissue was reduced ( Figure 3 E), glomerular swelling, renal tubular dilation, and decreased infiltration of immune cells in the renal interstitium were observed in mice. Figure 3 F).

[0090] Compared with control mice, BAU treatment regulated the immune cell balance in a systemic lupus erythematosus model mouse, specifically by reducing the proportion of M1 macrophages (F4 / 80+ CD86+) in the spleen. Figure 4 A); reduce the proportion of Th1 (CD4+ IFNγ+) cells in the spleen ( Figure 4 B); Reduce the proportion of plasma cells (B220-CD138+) in the spleen ( Figure 4 C). Compared with control mice, BAU reduced immunoglobulin G (IgG) in the glomeruli of the kidneys of SLE mice. Figure 4 D) Deposition of complement 3 (C3) Figure 4 E). The above results indicate that BAU treatment can effectively alleviate the symptoms of spontaneous lupus in MRL / Lpr mice.

[0091] Figure 5 The study showed that BAU significantly reduced the release of inflammatory factors, IFN genes, and ISGs in PBMCs of SLE patients. Specifically, after 8 hours of treatment with 10 μM BAU, the expression levels of IFNβ, IL6, CXCL10, IRF7, MX1, and MX2 mRNA in PBMCs of SLE patients were significantly reduced. These results indicate that BAU effectively alleviates inflammation and interferon response in PBMCs of SLE patients.

[0092] In summary, this application is the first to propose the application of targeting UPP1 in the treatment of systemic lupus erythematosus (SLE), and provides ideas and methods for the application of BAU in the preparation of drugs for the treatment of SLE. This invention provides a mechanism by which BAU reduces the expression of inflammation, type I interferon, and interferon-related genes induced by macrophage stimulation from the double-stranded DNA mimic ISD and the STING agonist 2,3-cGAMP by inhibiting UPP1 activity, providing a solid experimental basis for clinical application.

Claims

1. Application of uridine phosphorylase 1 (UPP1) as an inhibitory target in the preparation of drugs for the treatment of systemic lupus erythematosus (SLE).

2. The application according to claim 1, characterized in that: The drug contains an inhibitor that targets UPP1.

3. The application according to claim 2, characterized in that: The UPP1-targeting inhibitor is a substance that can inhibit UPP1 gene expression, UPP1 protein synthesis and / or UPP1 enzyme activity.

4. The application according to claim 2, characterized in that: The UPP1-targeting inhibitor is Benzylacyclouridine (BAU).

5. The application according to claim 1, characterized in that: The application also includes its use in the preparation of medicaments for the treatment and / or prevention of SLE-induced organ damage, including at least one of kidney damage, splenomegaly, and lung damage.

6. The application according to claim 1, characterized in that: The therapeutic and / or preventive effects of the kidney damage are reflected in at least one of the following indicators: reduction of 24-hour urinary protein quantification, reduction of renal tissue pathological damage score, reduction of glomerular immunoglobulin G (IgG) deposition, and reduction of glomerular complement 3 (C3) deposition.

7. The application according to claim 1, characterized in that: The drug is also used to regulate immune cell imbalance in an SLE model, the regulation including at least one of reducing the proportion of M1 macrophages in the spleen, reducing the proportion of Th1 cells in the spleen, and reducing the proportion of plasma cells in the spleen.

8. The application according to claim 1, characterized in that: The drug inhibits the excessive activation of the STING signaling pathway by inhibiting the enzyme activity of UPP1, thereby reducing the expression of inflammatory factors, type I interferon, and interferon-stimulated genes; the inflammatory factors include IL-6; the type I interferon includes IFN-β; and the interferon-stimulated genes include CXCL10 and MX1.

9. The use of a pharmaceutical composition in the preparation of a medicament for the treatment and / or prevention of systemic lupus erythematosus (SLE), characterized in that: The pharmaceutical composition contains an effective amount of benzylcyclouridine (BAU); the pharmaceutical composition also includes a pharmaceutically acceptable salt, solvate or prodrug, and one or more pharmaceutically acceptable carriers or excipients.

10. The application according to claim 9, characterized in that: The dosage form of the pharmaceutical composition is selected from one of the following: oral preparations, injections, transdermal preparations, and inhalation preparations.

Images