Messenger RNA vaccines and uses thereof

Abstract

To provide: a method for inducing an immune response in vivo; and a method of delivering a vaccine in vivo.SOLUTION: A method of inducing an immune response in vivo comprises: administering to a subject in need thereof a composition comprising a messenger RNA (mRNA) encoding an antigen, encapsulated in a lipid nanoparticle, in a dosing regimen sufficient to induce an antigen-specific T cell response and / or an antigen-specific antibody response.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 678,225, filed May 30, 2018, the entirety of which is incorporated herein by reference. [Background technology]

[0002] Vaccines are one of the most important medicines for treating or preventing various diseases. Vaccines are biological compositions that induce active adaptive immunity against a particular disease. Traditionally, vaccines typically contain an agent that resembles a disease-causing microorganism and is often made from a neutralized or killed form of a virus or other pathogen, or from its surface protein. The agent stimulates the body's immune system to produce antibodies or cytokines to recognize and destroy any microorganisms related to the agent that may be encountered in the future. Vaccines can be prophylactic or therapeutic. Summary of the Invention [Means for solving the problem]

[0003] The present invention provides an improved, unconventional vaccine format based on the delivery of messenger RNA that promises safer, more effective and cost-effective vaccines for treating and preventing a variety of diseases.

[0004] In one aspect, the present invention provides a method for inducing an immune response in vivo by administering to a subject a messenger RNA (mRNA) composition comprising an mRNA encoding an antigen, in a dosage regimen sufficient to induce an antigen-specific T cell response, and / or an antigen-specific antibody response. In some embodiments, the mRNA is encapsulated in a lipid nanoparticle (LNP). In some embodiments, the composition is a vaccine composition.

[0005] In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intramuscularly. In some embodiments, the composition is administered intravenously. In some embodiments, the composition is not administered intravenously.

[0006] In another aspect, the present invention provides a method of delivering a vaccine in vivo, comprising administering to a subject a vaccine composition comprising an antigen-encoding mRNA encapsulated in LNP, wherein the vaccine composition is administered intramuscularly or subcutaneously. In various embodiments, the vaccine composition is administered in a dosage regimen sufficient to induce an antigen-specific T cell response and / or an antigen-specific antibody response.

[0007] In some embodiments, the antigen encoded by the mRNA is a protein or peptide.

[0008] In some embodiments, a composition is delivered that includes one or more mRNAs encoding one or more polypeptides.

[0009] In some embodiments, a suitable dosing regimen involves injecting a single dose, hi some embodiments, a suitable dosing regimen involves administering multiple doses periodically.

[0010] In some embodiments, the single dose or multiple doses (individually or collectively) range from about 0.1 μg to 100 mg mRNA. The amount (individually or collectively) ranges from about 0.1 μg to 50 mg mRNA, about 0.1 μg to 25 mg mRNA, about 0.1 μg to 10 mg mRNA, about 0.1 μg to 5 mg mRNA, about 0.1 μg to 1 mg mRNA, or about 0.1 μg to 100 μg mRNA. In some embodiments, the single dose or multiple doses (individually or collectively) are selected from 0.1 μg, 0.3 μg, 0.5 μg, 1 μg, 5 μg, 10 μg, 25 μg, 50 μg, or 100 μg.

[0011] In some embodiments, the single dose or multiple doses (individually or collectively) are in the range of about 0.01 μg / kg to 10 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses (individually or collectively) are in the range of about 0.01 μg / kg to 8 mg / kg, about 0.01 μg / kg to 6 mg / kg, about 0.01 μg / kg to 5 mg / kg, about 0.1 μg / kg to 5 mg / kg, about 0.1 μg / kg to 1 mg / kg, or about 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

[0012] In some embodiments, the multiple doses comprise the same individual dosage of the mRNA. In some embodiments, the multiple doses comprise different individual dosages of the mRNA.

[0013] In some embodiments, each of the multiple doses is injected 1-3 weeks apart. In some embodiments, each of the multiple doses is injected weekly. In some embodiments, at least two of the multiple doses are injected within 3 weeks. In some embodiments, the multiple doses are injected on the following schedule: dose 1 at week 0, dose 2 at week 3, and dose 3 at week 5.

[0014] In some embodiments, the mRNA has a length of about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb or more. In some embodiments, the mRNA comprises unmodified nucleotides. In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides comprise pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 4'thiouridine, 4'-thiocytidine, and / or 2-thiocytidine.

[0015] In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR).

[0016] In some embodiments, the nanoparticles are lipid-based or polymer-based nanoparticles. In some embodiments, the lipid-based nanoparticles are liposomes. In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more helper lipids, and / or one or more PEGylated lipids. In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more helper lipids, and one or more PEGylated lipids. In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and one or more PEGylated lipids. As used herein, the terms "PEGylated lipid" and "PEG-modified lipid" are used interchangeably.

[0017] In some embodiments, the lipid nanoparticles comprise one or more PEGylated lipids. In some embodiments, the PEGylated lipids comprise at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the total lipids in the lipid nanoparticles. In some embodiments, the PEGylated lipids comprise at least 5% of the total lipids in the lipid nanoparticles. In some embodiments, the PEGylated lipids comprise about 5% of the total lipids in the lipid nanoparticles. In some embodiments, the PEGylated lipids comprise no more than 10%, no more than 9%, no more than 8%, no more than 7%, no more than 6%, no more than 5%, no more than 4%, or no more than 3% of the total lipids in the lipid nanoparticles. In some embodiments, the PEGylated lipids comprise no more than 5% of the total lipids in the lipid nanoparticles.

[0018] In some embodiments, the lipid nanoparticles include one or more cationic lipids. In some embodiments, the one or more cationic lipids include cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, In some embodiments, the at least one cationic lipid is selected from the group consisting of DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof. In some embodiments, the at least one cationic lipid is selected from CCBene, ICE, ML-2, C12-200, or DLin-SS-DMA. In some embodiments, the one or more cationic lipids comprise ICE. In some embodiments, the one or more cationic lipids comprise ML-2. In some embodiments, the one or more cationic lipids comprise a CCBene.

[0019] In some embodiments, the lipid nanoparticle comprises one or more helper lipids. In some embodiments, the helper lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

[0020] In some embodiments, the lipid nanoparticles comprise one or more cholesterol-based lipids. In some embodiments, the cholesterol-based lipids are selected from DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE.

[0021] In some embodiments, administration of the composition results in expression of the antigen encoded by the mRNA in lymph nodes of the subject. In some embodiments, administration of the composition results in expression of the antigen encoded by the mRNA in lymphocytes of the subject.

[0022] In some embodiments, administration of the composition results in an antigen-specific antibody response, hi some embodiments, the antigen-specific antibody response is measured by the presence of antigen-specific antibodies in serum.

[0023] In some embodiments, administering the composition results in antigen-specific T cell response.In some embodiments, the antigen-specific T cell response is measured by cytokine response.In some embodiments, the antigen-specific T cell response is measured by IFN-γ ELISPOT in splenocytes.

[0024] In some embodiments, an antigen-specific antibody response, and / or an antigen-specific T cell response is detectable at least 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or 1 month after administration.

[0025] An embodiment of the present invention provides a method of treating a disease, disorder, or condition comprising delivering messenger RNA (mRNA) to a subject in need of treatment according to the methods described above.

[0026] In this application, the use of "or" means "and / or" unless otherwise stated. As used in this disclosure, the term "comprise" and variations of terms such as "comprising" and "comprises" are not intended to exclude other additives, components, integers, or steps. As used in this application, the terms "about" and "approximately" are used synonymously. Both terms are meant to cover any normal fluctuations understood by one of ordinary skill in the art.

[0027] Other features, objects, and advantages of the present invention will become apparent in the following detailed description, drawings, and claims. It should be understood, however, that the following detailed description, drawings, and claims, while indicating embodiments of the present invention, are given by way of illustration only and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art.

[0028] The drawings are for purposes of illustration and not limitation. [Brief description of the drawings]

[0029] [Figure 1] 1A and B show comparative data on the efficacy of three different lipid compositions in delivering human erythropoietin (hEPO) mRNA in vivo as demonstrated by measuring human erythropoietin (hEPO) protein in serum.

[0030] [Diagram 2] FIG. 2 shows comparative data on the efficacy of three different routes of human erythropoietin (hEPO) mRNA delivery in vivo as demonstrated by measuring hEPO protein in serum.

[0031] [Diagram 3] FIG. 3 is an image of FFL expression in different mouse tissues showing a comparison of delivery route on tissue-specific enrichment of FFL expression.

[0032] [Figure 4] FIG. 4 shows images of FFL expression in different mouse tissues, illustrating the comparison of different cationic lipids in tissue-specific enrichment of FFL expression.

[0033] [Diagram 5] 5 shows a comparison of remixed and conventional methods of liposome formation. The remixed composition results in higher expression of exemplary hEPO expression where multiple cationic lipids are used.

[0034] [Figure 6] FIG. 6 shows enriched expression of the remixed formulation in lymph nodes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of the following terms, as well as other terms, are set forth throughout the specification.

[0036] Adjuvant: As used herein, the term "adjuvant" refers to a substance or vehicle that non-specifically enhances the immune response to an antigen.

[0037] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, animals may be transgenic animals, genetically modified animals, and / or clones.

[0038] Antigen: As used herein, an antigen is a protein or peptide that induces an immune response, and the antigen is encoded by the administered mRNA. Generally, an antigen is a foreign substance that induces an immune response. In this context, the antigen may be proteinaceous in nature, but may also be a non-proteinaceous entity, such as a toxin, a small molecule, or a nucleic acid. For the purposes of discussion herein, an antigen refers to a protein, peptide, or polypeptide that is encoded by the administered mRNA, which reveals or is expected to reveal an immune response to be an antigen.

[0039] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise stated or clear from the context (except where such number exceeds 100% of possible values).

[0040] Delivery: As used herein, the term "delivery" includes both local delivery and systemic delivery.For example, the delivery of mRNA includes the situation where mRNA is delivered to target tissue, its encoded protein is expressed and retained in the target tissue (also referred to as "local distribution" or "local delivery"), the situation where mRNA is delivered to target tissue, its encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), and distributed throughout the body and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0041] Encapsulation: As used herein, the term "encapsulation" or grammatical equivalents refers to the process of confining individual mRNA molecules within a nanoparticle.

[0042] Expression: As used herein, "expression" of a nucleic acid sequence refers to the conversion of mRNA to a polypeptide. "expression" refers to the translation of a polypeptide into a protein, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or a fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production" and grammatical equivalents are used interchangeably.

[0043] Half-life: As used herein, the term "half-life" is the time it takes for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of the value measured at the beginning of a period.

[0044] Improve, increase, or reduce: As used herein, the terms "improvement," "increase," or "reduction," or grammatical equivalents, imply a value relative to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) not receiving a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated, and of approximately the same age as the subject being treated.

[0045] In vitro: As used herein, the term "in vitro" refers to events that take place not within a multicellular organism, but in an artificial environment, such as, for example, in a test tube or reaction vessel, in cell culture, etc.

[0046] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as humans and non-human animals. In the context of cell-type systems, the term can be used to refer to events that occur within a living cell (e.g., as opposed to an in vitro system).

[0047] Local distribution or delivery: As used herein, the terms "local distribution", "local delivery", or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires an mRNA-encoded protein (e.g., an enzyme) that is translated and expressed intracellularly or that is secreted to the limited extent to avoid entering the patient's circulatory system.

[0048] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may include one or more coding and non-coding regions. mRNA may be purified from natural sources, produced using recombinant expression systems, and optionally purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, mRNA may include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is selected from the group consisting of natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates, and 5'-N-phosphoramidite linkages).

[0049] Patient: As used herein, the term "patient" or "subject" refers to any organism to which a provided composition can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Human includes prenatal and postnatal forms.

[0050] Pharmaceutically acceptable: As used herein, the term "pharmaceutical acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, inflammatory irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0051] Subcutaneous administration: As used herein, the term "subcutaneous administration" or "subcutaneous injection" refers to a bolus injection into the subcutaneous tissue, which is the layer of tissue between the skin and muscle.

[0052] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. The subject may be a patient, which means a human who visits a medical institution for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be suffering from or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0053] Substantially: As used herein, the term "substantially" refers to a qualitative state of exhibiting all or nearly all extent or degree of a feature or characteristic of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to completion and / or reach a point of completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0054] Systemic distribution or delivery: As used herein, the term "systemic distribution", "systemic delivery", or grammatical equivalents, refers to a mechanism or approach of delivery or distribution that affects the entire body or organism. Typically, systemic distribution or delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery".

[0055] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by a disease to be treated. In some embodiments, the target tissue includes tissue that exhibits pathology, symptoms, or characteristics associated with the disease.

[0056] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. One of skill in the art will understand that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.

[0057] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to " refers to any method used to partially or completely alleviate, ameliorate, relieve, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not show signs of disease and / or who show only early signs of disease with the goal of reducing the risk of developing pathology associated with the disease.

[0058] Vaccination: As used herein, the term "vaccination" refers to the administration of a composition intended to generate an immune response, such as, for example, an mRNA encoding an antigen (e.g., a composition of a disease-causing agent). For purposes of the present invention, vaccination can be administered before, during, and / or after exposure to the disease-causing agent, and in some embodiments, before, during, and / or immediately after exposure to the agent. In some embodiments, vaccination includes multiple administrations of the vaccinating composition, appropriately spaced in time.

[0059] The present invention provides, inter alia, improved methods and compositions for mRNA vaccine delivery.

[0060] Various aspects of the invention are described in detail in the following sections. The use of the sections is not meant to limit the invention. Each section can be applied to any aspect of the invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0061] In one aspect of the present invention, a method for inducing an immune response in a subject is provided. The method comprises administering a composition comprising an mRNA encoding an antigen in a dosage regimen sufficient to induce an antigen-specific T cell response or an antigen-specific antibody response. In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intramuscularly.

[0062] In one aspect of the present invention, a method for in vivo vaccine delivery is provided. The method comprises administering a vaccine comprising an mRNA encoding an antigen encapsulated in lipid nanoparticles to a subject in need thereof. In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intramuscularly.

[0063] Messenger RNA (mRNA) vaccines mRNA vaccines are novel and offer many advantages over current cell-based vaccines that use live vaccines, attenuated or killed pathogen vaccines, or toxoid vaccines. In addition to safety, mRNA vaccines are cost-effective and provide a flexible design platform. Antigen-encoding mRNA can be directed to induce specific immune responses, and thus can be applied to develop a wide range of therapeutic and preventive mRNA vaccines for a wide variety of diseases, including infectious diseases and cancer.

[0064] Vaccines against infectious diseases Vaccine candidates are well established for many infectious agents. Typically, a vaccine is an agent that elicits an immune response by a mammalian host by at least partially mimicking a disease-causing agent. Vaccines generally contain heat-killed, irradiated, or attenuated pathogens, live attenuated microorganisms, protein or peptide antigens, conjugated antigens, toxins, or microbial surface proteins, or other antigens that are capable of inducing disease. or fragments thereof. However, mRNA encoding a protein or peptide antigen is a safe and effective way to induce an immune response against disease. As mentioned above, mRNA can be effectively delivered for expression in vivo by encapsulation in liposomes containing suitable lipids, which will be discussed in a later section. Thus, the mRNA encoding this antigen peptide or protein can be used to generate a vaccine in vivo. The immune response generated by the mammalian host against the vaccine component is intended to protect the host against subsequent attack by the pathogen, as the host's immune system is primed against the pathogen's attack. In other words, the host system has an immunological memory (a component of the adaptive immune response) of the pathogen. This process is known as preventive vaccination. Furthermore, vaccines can boost the host's immune system in existing infections, for example by redirecting the immune response against new and less recognized microbial antigens (subdominant antigens), thus inducing a strong immune response to eliminate the pathogen. This type of vaccine response can be classified as therapeutic vaccination.

[0065] The immune response to pathogens can be broken down into several stages. First, the human body (or mammalian system) encounters a new pathogen by contact, especially through exposed surfaces such as the skin, or through internal mucosal surfaces of the respiratory, gastrointestinal, and urogenital systems, which leads to a non-specific innate immune response through the activation of pattern recognition molecules. Pattern recognition molecules include a variety of germline-encoded receptors specialized to distinguish between microbial and host cell surfaces, or between infected and normal cells. Phagocytes (monocytes, macrophages, and dendritic cells) express pattern recognition molecules on their surface and are primarily responsible for the recognition, killing, and elimination of pathogens in the innate immune response. In doing so, phagocytes also process and present antigens to circulating lymphocytes to generate more specific antigen-targeted immune responses, also known as adaptive immune responses. At this stage, activated lymphocytes mature in lymph nodes into antigen-specific T cells expressing receptors for recognition of antigens so that effector cytotoxic T cells, when present in association with a second set of cell surface molecules, major histocompatibility complex molecules (or MHC), will recognize and kill cells expressing the antigen. Helper T cells also activate the system to generate T cell memory and humoral immune responses. The humoral immune response includes antibody-secreting B cells, which are generated by clonal expression and clonal differentiation over the course of several days while innate immunity continues to function. Clonal expansion of cytotoxic T cells also occurs rapidly in lymphoid organs such as lymph nodes and is augmented by exposure to antigen. Activated T cells produce many cytokines, such as interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α), which are considered hallmarks of T cell activation. Finally, antigen-specific T cells and now antibodies are released into the blood and recruited to sites of infection. A successful vaccine will generate rapid and robust cytotoxic T cell responses, strong antibody responses, and long-lasting immunological memory.

[0066] Cancer vaccines Cancer is considered an immunological disease, and cancer immunotherapy has become the center stage of research and development today. In cancer immunotherapy, vaccines are developed to boost the immune system to fight against cancer antigens and eliminate tumors by activated cytotoxic T cells directed against the antigens. One class of cancer antigens are viral antigens related to cancer-causing viruses, such as Epstein-Barr virus (EBV) antigens such as EBV1 and EBV2 associated with lymphoma and nasopharyngeal carcinoma, human papillomavirus (HPV) antigens such as HPV16 associated with cervical cancer (CC), hepatitis B virus (HBV) antigens and hepatitis C virus (HCV) antigens associated with hepatocellular carcinoma (HCC), human T-cell leukemia virus type 1 (HTLV-1) associated with adult T-cell leukemia / lymphoma, and human herpesvirus 8 (HHV-8) associated with Kaposi's sarcoma, to name a few.

[0067] Cancer cells, on the other hand, express antigens that are not generally expressed by non-cancerous cells or tissues, such antigens include, but are not limited to, epithelial tumor antigen (ETA) found in breast cancer, RAS family member p-53 and other activated RAS antigens, ovarian cancer antigens BRCA1 and BRCA2, melanoma-associated antigen (MAGE) found in malignant melanoma cells, BCR-ABL fusion gene product found in myeloid leukemia, acute lymphoblastic leukemia, and acute myeloid leukemia, BRAF antigen found in cutaneous melanoma and colon cancer, epidermal growth factor receptor (EGFR) in non-small cell lung cancer, KRAS found in colon and non-small cell lung cancer, neuronal specific enolase found in neuroblastoma and non-small cell lung cancer, and NY-ESO found in neuroblastoma. 1, melanoma-associated antigen recognized by T cells (MART-1) found in melanoma, programmed death-ligand 1 (PD-L1) found in non-small cell lung cancer, prostate-specific antigen (PSA) found in prostate cancer, urokinase plasminogen activator (UPA), plasminogen activator inhibitor (PAI-1) found in breast cancer, as well as many others, most of which are mutated endogenous proteins. These cancer antigens, being endogenous, are not presented by antigen-presenting cells (APCs) in a manner similar to viral antigens, i.e., in association with MHC-1 molecules that classify the antigen as foreign, but cytotoxic T cells are able to differentiate and identify mutated self-antigens and have the unique property of seeking out and destroying cells that carry the mutated antigen. Thus, the current goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells directed against mutated antigens. Specific mutations associated with a patient's own cancer can be mapped and used to generate a vaccine, inducing the patient's own cytotoxic T cells to generate the immune response necessary to destroy tumor cells. mRNA vaccines are a safe and cost-effective alternative to peptide vaccines that enable such personalized medicine. Pan-genomic scanning and analysis of mutations harbored by cancer patients can be used to specifically design mRNAs that encode antigens or epitopes containing mutations, which will produce translation products on the cell surface when administered in vivo.This will direct immune response against mutant antigen. In the process, cytotoxic T cells essentially attack tumor cells that express mutant antigen. The methods and protocols involved in carrying out whole genome sequence analysis, mutation analysis, epitope mapping and analysis, and designing suitable peptides for vaccination are known to those skilled in the art.

[0068] This approach could also be used to find dominant and subdominant antigens in patients. In both chronic infections and cancer, it has been observed that certain antigens play a major role in generating an initial immune response. However, soon after, tolerance to such dominant antigens occurs, thereby weakening the immune response. Genomic analysis and identification of antigens that did not show an initial dominant antigen response (often called subdominant antigens) can now be used to generate new and restored immune responses.

[0069] One advantage of mRNA vaccines compared to peptide vaccines is that they avoid HLA matching to the recipient host.

[0070] In a synthetic approach to mRNA vaccine design, the pathogen proteome can be scanned for antigenic signatures with vaccine potential. (Proteome databases can be accessed using the Uniprot Consortium, http: / / www.uniprot.org / ). This can be effective for new pathogens such as Zika virus. This type of reverse vaccinology has been used to identify many novel peptide vaccine candidates. New peptide vaccines have also been identified from Helicobacter pylori and Mycobacterium tuberculosis by combining genomics and proteomics (e.g., Etz et al., PNAS.2016). 02,99(10)6573-6578). Whether potential antigen candidates can successfully generate immune responses can be demonstrated by suitably expressing a library of potential antigens in various forms of cell surface display and testing opsonization and antibody binding. Exemplary useful databases for vaccine antigen development include: ImMunoGeneTics information system for immunogenetics and immunoinformatics (URL: www.imgt.org); Epitome Database, (URL: www.rostlab.org / services / epitome), Immune Epitope Database and Analysis Resource, www.iedb.org; Immunet database, immunet.cn / ced / index.php; HIV database: www.hiv.lanl.gov / content / immunology.

[0071] Therefore, from the above, it is clear that enrichment of mRNA vaccine delivery to lymph nodes can provide access of the vaccine to both activated and naive lymphocytes for lymphocyte proliferation and generation of antigen-specific T and B cells. This localization of antigen activation also results in less toxicity as opposed to widespread immune activation.

[0072] Messenger RNA (mRNA) The present invention may be used to deliver any mRNA encoding an antigen suitable for use as a vaccine as described herein. As used herein, mRNA is a type of RNA that conveys information from DNA to ribosomes to translate the encoded protein. mRNA may be synthesized by any of a variety of known methods. For example, mRNA according to the present invention may be synthesized via in vitro transcription (IVT). Briefly, IVT is often performed using a linear or circular DNA template containing a promoter, a set of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAseI, pyrophosphatase, and / or RNAse inhibitors. The exact conditions will vary according to the specific application.

[0073] In some embodiments, in vitro synthesized mRNA may be purified prior to formulation and encapsulation to remove undesirable impurities, including various enzymes and other reagents used during mRNA synthesis.

[0074] The present invention can be used to deliver mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths ranging from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 15 kb.

[0075] The present invention can be used to deliver unmodified mRNA or mRNA containing one or more modifications that generally enhance stability, in some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions (UTRs).

[0076] In some embodiments, the modification of the mRNA may include modification of the nucleotides of the RNA. Modified mRNA according to the invention may include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, the mRNA may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, N6-isopenten ... 1-Adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil Uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester Queuosine, beta-D-mannosyl-queuosine, wybutoxosine, as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530 and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated herein by reference in their entirety.

[0077] In some embodiments, mRNA may include RNA backbone modification. Typically, backbone modification is a modification in which the backbone phosphate of the nucleotide contained in RNA is chemically modified. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methylphosphonate, methylphosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means that phosphodiester bond is replaced with other anionic, cationic, or neutral groups.

[0078] In some embodiments, the mRNA may include sugar modifications. Exemplary sugar modifications are chemical modifications of the sugar of the nucleotide, including, but not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate, 2'-O-alkyl oligoribonucleotides, 2'-fluoro-2'-deoxyuridine 5'-triphosphate ... and sugar modifications selected from the group consisting of 2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate, 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azido triphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0079] In some embodiments, the mRNA may include modifications of the base of a nucleotide (base modification). Modified nucleotides that include base modifications are also referred to as base-modified nucleotides. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallyl cytidine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-bromo cytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacylate riboside 5'-triphosphate, 2-amino-6-chloropurine ...thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallyl cytidine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-bromo cytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacylate riboside 5'-triphosphate, uridine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0080] mRNA synthesis typically involves the addition of a "cap" to the 5' end and a "tail" to the 3' end. The presence of the cap is important in conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" helps protect the mRNA from exonuclease degradation.

[0081] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide leaving two terminal phosphates, then guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase to generate a 5'-5' inverted triphosphate bond, and then the 7-nitrogen of guanine is methylated by methyltransferase. 2'-O-methylation can also occur at the first and / or second base after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA, where m represents a 2'-O-methyl residue.

[0082] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. A poly-A tail at the 3' end of an mRNA often comprises about 10-300 adenosine nucleotides (e.g., about 10-200 adenosine nucleotides, about 10-150 adenosine nucleotides, about 10-100 adenosine nucleotides, about 20-70 adenosine nucleotides, or about 20-60 adenosine nucleotides). In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly-C tail at the 3' end of an mRNA often comprises about 10-200 cytosine nucleotides (e.g., about 10-150 cytosine nucleotides, about 10-100 cytosine nucleotides, about 20-70 cytosine nucleotides, about 20-60 cytosine nucleotides, or about 10-40 cytosine nucleotides). The poly C tail can be added to or replace the poly A tail.

[0083] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region includes one or more elements that affect the stability or translation of the mRNA, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0084] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the location of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' untranslated region can be 50-500 nucleotides in length, or longer.

[0085] Cap Construction In some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide leaving two terminal phosphates, then guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase to generate a 5'-5' inverted triphosphate bond, and then the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0086] The naturally occurring cap structure contains 7-methylguanosine, which is linked to the 5' end of the first transcribed nucleotide via a triphosphate bridge, resulting in m 7 This results in a dinucleotide cap of G(5')ppp(5')N, where N is any nucleoside. In vivo, the cap is added enzymatically. The cap is added in the nucleus and is catalyzed by the enzyme guanylyltransferase. Addition of the cap to the 5' end of RNA occurs immediately after the initiation of transcription. The terminal nucleoside is typically guanosine and is in the opposite orientation to all other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0087] The universal cap for mRNAs generated by in vitro transcription is m 7G(5')ppp(5')G, which is used as a dinucleotide cap in in vitro transcription using T7 RNA polymerase or SP6 RNA polymerase to obtain RNA with a cap structure at its 5' end. A common method for in vitro synthesis of capped mRNA is to use a dinucleotide cap of the form m as the initiation factor for transcription. 7 G(5')ppp(5')G("m 7 In one embodiment, a preformed dinucleotide, GpppG, is used.

[0088] Traditionally, the usual form of synthetic dinucleotide cap used in in vitro translation experiments is the anti-reverse cap analog ("ARCA") or modified ARCA, which is typically a modified cap analog in which the 2' or 3' OH group is replaced with -OCH3.

[0089] Further cap analogues include m 7 GpppG, m 7 GppA, m 7 GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m 2,7 GpppG), trimethylated cap analogs (e.g., m 2,2,7 GpppG), dimethylated symmetric cap analogs (e.g., m 7 Gpppm 7 G), or anti-reverse cap analogs (e.g., ARCA;m 7 , 2’Ome GpppG, m 72’d GpppG, m 7,3’Ome GpppG, m 7,3’d GpppG, and their tetraphosphate derivatives) (see, for example, Jemielity, J. et al., "Novel 'anti-reverse' cap analogs with superior translational properties", RNA, 9:1108-1122 (2003)).

[0090] In some embodiments, a suitable cap is 7-methylguanylic acid ("m 7 G"), which is linked to the 5' end of the first transcribed nucleotide via a triphosphate bridge, resulting in , m 7 G(5')ppp(5')N, where N is any nucleoside. 7 A preferred embodiment of the G-cap is 7 G(5')ppp(5')G.

[0091] In some embodiments, the cap is a Cap 0 structure. The Cap 0 structure lacks a 2'-O-methyl residue of the ribose attached to base 1 and base 2. In some embodiments, the cap is a Cap 1 structure. The Cap 1 structure has a 2'-O-methyl residue at base 2. In some embodiments, the cap is a Cap 2 structure. The Cap 2 structure has a 2'-O-methyl residue attached to both base 2 and base 3.

[0092] Various m 7 G-cap analogs are known in the art and many are commercially available. These include the m 7 GpppG and ARCA 3'-OCH3 and 2'-OCH3 cap analogs are included (Jemielity, J. et al., RNA, 9:1108-1122 (2003)). Additional cap analogs for use in embodiments of the present invention include N7-benzylated dinucleoside tetraphosphate analogs (described in Grudzien, E. et al., RNA, 10:1479-1487 (2004)), phosphorothioate cap analogs (described in Grudzien-Nogalska, E., et al., RNA, 13:1745-1755 (2007)), and cap analogs described in U.S. Patent Nos. 8,093,367 and 8,304,529 (herein incorporated by reference), including biotinylated cap analogs.

[0093] Tail Structure In many cases, the presence of a "tail" serves to protect the mRNA from exonuclease degradation. PolyA tails are believed to stabilize natural messenger sense RNAs and synthetic sense RNAs. Thus, in certain embodiments, a long polyA tail can be added to an mRNA molecule to further stabilize the RNA. PolyA tails can be added using a variety of techniques recognized in the art. For example, long polyA tails can be added to synthetic or in vitro transcribed RNAs using polyA polymerase (Yokoe, et al. Nature Biotechnology. 1996; 14: 1252-1256). A transcription vector can also encode a long polyA tail. In addition, polyA tails can be added by direct transcription from PCR products. PolyA can also be ligated to the 3' end of the sense RNA using RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0094] In some embodiments, the mRNA comprises a 3' tail structure. The tail structure typically comprises a poly(A) tail and / or a poly(C) tail. The poly(A) tail or poly(C) tail on the 3' end of the mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenos ... adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, respectively.In some embodiments, the poly-A tail or poly-C tail each comprises about 10-800 adenosine or cytosine nucleotides (e.g., about 10-200 adenosine or cytosine nucleotides, about 10-300 adenosine or cytosine nucleotides, about 10-400 adenosine or cytosine nucleotides, about 10-500 adenosine or cytosine nucleotides, about 10-550 adenosine or cytosine nucleotides, about 10-600 adenosine or cytosine nucleotides, about 50-600 adenosine or cytosine nucleotides, about 100-600 adenosine or cytosine nucleotides, about 150-600 adenosine or cytosine nucleotides, about 200-6 00 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides). In some embodiments, the tail structure comprises a combination of poly(A) tails and poly(C) tails having various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0095] In some embodiments, the length of the polyA tail or polyC tail is adjusted to control the stability of the modified sense mRNA molecule of the present invention and thus the transcription of the protein. For example, since the length of the polyA tail can affect the half-life of the sense mRNA molecule, the length of the polyA tail may be adjusted to modify the level of resistance of the mRNA to nucleases, thereby controlling the time course of polynucleotide expression and / or polypeptide production in the target cell.

[0096] 5' and 3' untranslated regions (UTRs) In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region includes one or more elements that affect the stability or translation of the mRNA, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0097] In some embodiments, the 3' untranslated region can be a polyadenylation signal, a coding sequence for an mRNA in a cell. In some embodiments, the 3' untranslated region may be 50-500 nucleotides in length or longer.

[0098] Exemplary 3' and / or 5' UTR sequences may be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzymes) to enhance the stability of the sense mRNA molecule. For example, the 5' UTR sequence may include a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide. It is also envisioned to include a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3' end or untranslated region of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, including, for example, modifications made to improve the polynucleotide resistance to in vivo nuclease digestion.

[0099] While mRNA resulting from an in vitro transcription reaction is desirable in some embodiments, other sources of mRNA are contemplated within the scope of the invention, including mRNA produced from bacteria, fungi, plants, and / or animals.

[0100] The present invention can be used to deliver mRNAs encoding a variety of proteins. Non-limiting examples of mRNAs suitable for the present invention include mRNAs encoding peptide or protein vaccines.

[0101] Exemplary mRNA Sequences In some embodiments, the present invention provides methods and compositions for delivering mRNA encoding a target protein to a subject for the treatment of a target protein deficiency. Exemplary mRNA sequences are provided below. Construct Design: X-mRNA coding sequence-Y 5' and 3' UTR sequences X(5'UTR sequence)= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0102] In some embodiments, a suitable mRNA encodes a fusion protein that includes a full-length, fragment, or portion of a target protein fused to another protein (e.g., an N-terminal or C-terminal fusion). In some embodiments, the protein fused to the mRNA encoding the full-length, fragment, or portion of the target protein encodes a signal sequence or a cellular targeting sequence.

[0103] Lipid Nanoparticles In accordance with the present invention, the mRNA may be encapsulated or complexed in a nanoparticle, which in some embodiments is also referred to as a "delivery vehicle," "transfer vehicle," or grammatical equivalents thereof.

[0104] According to various embodiments, suitable nanoparticles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of natural and synthetic origin, natural lamellar bodies, synthetic lamellar bodies and semi-synthetic lamellar bodies, nanoparticles, calcium phospho-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, microcrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other targeting tags.

[0105] In some embodiments, the mRNA is encapsulated in one or more liposomes. As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticle vesicle. Typically, the liposome used herein can be formed by mixing one or more lipids, or by mixing one or more lipids and polymers. Thus, the term "liposome" used herein encompasses both lipid-based nanoparticles and polymer-based nanoparticles. In some embodiments, the liposome suitable for the present invention comprises cationic or non-cationic lipids, cholesterol-based lipids, and / or PEG-modified lipids.

[0106] PEGylated lipids In some embodiments, a suitable lipid solution comprises one or more PEGylated lipids. For example, the use of polyethylene glycol (PEG) modified phospholipids and derivatized lipids such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), are also contemplated by the present invention. Contemplated PEG-modified lipids are C6 to C8 ceramides in length. 20In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, certain useful exchangeable lipids have shorter acyl chains (e.g., C 14 or C 18 ) is a PEG-ceramide.

[0107] The PEG-modified phospholipids and derivatized lipids may constitute at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the total lipids in the liposome.

[0108] Cationic lipids As used herein, the term "cationic lipid" refers to any of a number of lipid and lipidoid species that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, and many are commercially available.

[0109] Suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include cationic lipids, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0110] Other suitable cationic lipids for use in the compositions and methods of the present invention include the ionizable cationic lipids described in International Patent Publication No. WO 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of one of the following formulas: [ka] or a pharma- ceutically acceptable salt thereof, wherein R and R are each independently hydrogen, an optionally substituted, variably saturated or unsaturated C-C 20 Alkyl, and optionally substituted, variably saturated or unsaturated C6-C 20 acyl, wherein L and L are each independently selected from the group consisting of hydrogen, optionally substituted C-C 30 Alkyl, optionally substituted variably unsaturated C1-C 30 Alkenyl, and optionally substituted C-C 30 alkynyl, wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and wherein n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-l-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include the cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-l-amine ("HGT5001"), having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetrahydrofuran, having the following compound structure: Cosa-5,15,18-trien-1-amine ("HGT5002"): [ka] and pharma- ceutically acceptable salts thereof.

[0111] Other suitable cationic lipids for use in the compositions and methods of the present invention include those cationic lipids described as amino alcohol lipidoids in International Patent Publication No. 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0112] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0113] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0114] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharma- ceutically acceptable salts thereof.

[0115] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication Nos. WO 2013 / 063468 and WO 2016 / 205691, which are incorporated by reference herein. In some embodiments, the compositions and methods of the invention include cationic lipids of the following formula: [ka] or a pharma- ceutically acceptable salt thereof, wherein R L Each instance of is independently an optionally substituted C-C 40 In certain embodiments, the compositions and methods of the present invention provide a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0116] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids of the following formula: [ka] or a pharma- ceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; and each R A are independently hydrogen, optionally substituted C alkyl, optionally substituted C alkenyl, optionally substituted C alkynyl, optionally substituted C carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C aryl, optionally substituted 5-14 membered heteroaryl or halogen; B are independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen; In certain embodiments, the compositions and methods of the present invention include a cationic lipid "Target 23" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0117] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] or a pharma- ceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] or a pharma- ceutically acceptable salt thereof.

[0118] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in J. McClellan, MCKing, Cell 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277, which are incorporated by reference herein. In certain embodiments, the cationic lipid of the compositions and methods of the present invention is a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0119] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0120] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0121] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids of the following formula: [ka] or a pharma- ceutically acceptable salt thereof, wherein L 1 or L 2 One of them is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O- Yes; another L 1 or L 2 -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -OR-NR a C(=O)O- or a direct bond; G 1 and G 2 are each independently unsubstituted C1-C 12 Alkylene or C1-C 12 Alkenylene; G 3 is C1-C 24 Alkylene, C1-C 24alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 R is alkyl; 1 and R 2 are each independently C6-C 24 Alkyl or C6-C 24 alkenyl; R 3 H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 and R 4 is C1-C 12 R is alkyl; 5 is H or C1-C6 alkyl; and x is 0, 1 or 2.

[0122] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0123] Other suitable cationic lipids for use in the compositions and methods of the invention include those cationic lipids described in International Patent Publication No. 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the invention is a compound of one of the following formulas: [ka] and pharma- ceutically acceptable salts thereof. For any one of these four formulas, R4 is -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) n In certain embodiments, the cationic lipid is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle, where n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention provide a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0124] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication Nos. WO 2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention include cationic lipids having the following compound structures: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0125] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in International Patent Publication No. 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid of the following formula: [ka] , wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino) and pyridyl, and wherein R2 is selected from the group consisting of one of the following two formulas: [ka] wherein R and R each independently represent an optionally substituted variably saturated or unsaturated C-C 20 Alkyl and optionally substituted variably saturated or unsaturated C6-C 20 acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, , 20 or more). In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4001" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and pharma- ceutically acceptable salts thereof.

[0126] In some embodiments, the compositions and methods of the present invention comprise a cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride ( (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the invention include, for example, 5-carboxyspermylglycinedioctadecylamide ("DOGS"), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium ("DOSPA") (Behr et al. Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, incorporated herein by reference). Acad. Sci. 86, 6982 (1989); U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"), 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0127] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"), 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"), N-dioleyl-N,N-dimethylammonium diethyl ammonium chloride ("DODAC"), N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimethylethyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-l-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta-oxybutane-4-yl)-1-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); 1,2-N,N'-Dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); 1,2-N,N'-Dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); l,2-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA");(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy) 2,2-Di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (see WO 2010 / 042877, incorporated herein by reference; Semple et al., Nature; Biotech.28:172-176(2010)). (Heyes, J., et al., J Controlled Release 107:276-287(2005); Morrissey, DV., et al., Nat.Biotechnol.23(8):1003-1007(2005); International Patent Publication No. 2005 / 121348) In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0128] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").

[0129] In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by mole % of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by molar % of the lipid nanoparticles.

[0130] In some embodiments, sterol-based cationic lipids may be used instead of or in addition to the cationic lipids described herein.Suitable sterol-based cationic lipids are dialkylamino-containing sterol-based cationic lipids, imidazole-containing sterol-based cationic lipids, and guanidinium-containing sterol-based cationic lipids. For example, certain embodiments are directed to compositions comprising one or more sterol-based cationic lipids, including imidazoles, such as imidazole cholesterol esters, or the “ICE” lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by structure (I) below. In certain embodiments, lipid nanoparticles for delivery of RNA (e.g., mRNA) encoding a functional protein may include one or more imidazole-based cationic lipids, such as imidazole cholesterol ester, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by the following structures: [ka]

[0131] In some embodiments, the percentage of cationic lipid in the liposome may be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid comprises about 30-50% by weight of the liposome (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, the cationic lipid (e.g., ICE lipid) comprises about 30%, about 35%, about 40%, about 45%, or about 50% by molar ratio of the liposome.

[0132] As used herein, the phrase "non-cationic lipid" refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (D ... amine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), or mixtures thereof.

[0133] Non-cationic lipids In some embodiments, such non-cationic lipids may be used alone, but are preferably used in combination with other lipids, such as cationic lipids. In some embodiments, the non-cationic lipids may comprise a molar ratio of about 5% to about 90%, or about 10% to about 70% of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that do not carry a net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the percentage of non-cationic lipids in the liposome may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0134] Cholesterol-based lipids In some embodiments, a suitable lipid solution comprises one or more cholesterol-based lipids. By way of example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. Bis(2-methyl-2-phenylpropionyl ... oTechniques 23,139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid comprises at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipid in a suitable lipid solution, by weight or molar. In some embodiments, the cholesterol-based lipid comprises about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid in a suitable lipid solution, by weight or molar.

[0135] In some embodiments, the cholesterol-based lipids may comprise a molar percentage of about 2% to about 30%, or about 5% to about 20% of the total lipids present in the liposome. In some embodiments, the percentage of cholesterol-based lipids in the lipid nanoparticles may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0136] The use of derivatized lipids, such as polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), alone or preferably in combination with other lipid formulations, including import vehicles (e.g., lipid nanoparticles), is also contemplated by the present invention. Contemplated PEG-modified lipids range in length from C6 to C 20 The addition of such moieties can prevent aggregation of the complex and can also increase circulation lifetime and provide a means for increasing delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237). Alternatively, these moieties can be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention can comprise a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipid present in the liposome import vehicle.

[0137] According to various embodiments, the selection of cationic lipid, non-cationic lipid, and / or PEG-modified lipid, which comprises lipid nanoparticles, and the selection of the relative molar ratio of these lipids to each other are based on the characteristics of the selected lipid, the nature of the intended target cell, and the characteristics of the mRNA to be delivered.Further considerations include, for example, the saturation degree of the alkyl chain of the selected lipid, as well as size, charge, pH, pKa, fusogenicity, and toxicity.Therefore, the molar ratio can be adjusted accordingly.

[0138] In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, alone or in combination with other carriers, including various lipids, as described herein. Thus, in some embodiments, liposome delivery vehicles as used herein also encompass nanoparticles that include polymers. Suitable polymers may include, for example, polyacrylates, polyalkoxyanoacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is included, the PEI may be a branched PEI with a molecular weight in the range of 10-40 kDa, for example, a branched PEI of 25 kDa (Sigma #408727).

[0139] Liposomes suitable for the present invention are comprised of any one of the cationic lipids, non-cationic lipids, cholesterol lipids, PEG-modified lipids, and / or polymers described herein. The above may be included in various proportions. As a non-limiting example, a suitable liposome formulation may include a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K.

[0140] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the proportion of the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome by molar ratio.

[0141] In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid may be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 50:25:20:5. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 50:45:5. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 50:40:10. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 55:40:5. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 55:35:10. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 60:35:5. In some embodiments, the ratio of sterol lipid:non-cationic lipid:PEG-modified lipid is 60:30:10.

[0142] In some embodiments, liposomes suitable for the present invention comprise ICE and DOPE in a molar ratio of ICE:DOPE >1:1. In some embodiments, the molar ratio of ICE:DOPE is <2.5:1. In some embodiments, the molar ratio of ICE:DOPE is between 1:1 and 2.5:1. In some embodiments, the molar ratio of ICE:DOPE is approximately 1.5:1. In some embodiments, the molar ratio of ICE:DOPE is approximately 1.7:1. In some embodiments, the molar ratio of ICE:DOPE is approximately 2:1. In some embodiments, liposomes suitable for the present invention comprise ICE and DMG-PEG-2K in a molar ratio of ICE:DMG-PEG-2K >10:1. In some embodiments, the molar ratio of ICE:DMG-PEG-2K is <16:1. In some embodiments, the molar ratio of ICE:DMG-PEG-2K is approximately 12:1. In some embodiments, the molar ratio of ICE:DMG-PEG-2K is approximately 14:1. In some embodiments, liposomes suitable for the present invention comprise DOPE and DMG-PEG-2K in a molar ratio of DOPE:DMG-PEG-2K >5:1. In some embodiments, the molar ratio of DOPE:DMG-PEG-2K is <11:1. In some embodiments, the molar ratio of DOPE:DMG-PEG-2K is approximately 7:1. In some embodiments, the molar ratio of DOPE:DMG-PEG-2K is approximately 10:1. In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of ICE:D ... In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of 50:40:10 ICE:DOPE:DMG-PEG-2K. In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of 55:40:5 ICE:DOPE:DMG-PEG-2K. In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of 55:35:10 ICE:DOPE:DMG-PEG-2K. In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of 60:35:5 ICE:DOPE:DMG-PEG-2K. In some embodiments, liposomes suitable for the present invention comprise ICE, DOPE, and DMG-PEG-2K in a molar ratio of ICE:DOPE:DMG-PEG-2K of 60:30:10.

[0143] The liposome import vehicles for use in the compositions of the present invention can be prepared by a variety of techniques currently known in the art. A variety of methods are described in published U.S. application No. 2011 / 0244026, published U.S. application No. 2016 / 0038432, and U.S. Provisional Patent Application No. 62 / 580,155, filed November 1, 2017, all of which are incorporated herein by reference, and can be used in the practice of the present invention.

[0144] The following applications involving lipid compositions filed by the applicant are hereby incorporated by reference in their entirety: 62 / 672,194, filed May 16, 2018; 62 / 676,147, filed May 24, 2018; and an application having Attorney Docket No. MRT-2016USP1, filed on the same date as this application entitled Cationic Lipids Comprising a Steroidal Moiety; Attorney Docket No. MRT-2017USP1, filed on the same date as this application entitled Phosphoester Cationic Lipids; Attorney Docket No. MRT-2018USP1, filed on the same date as this application entitled Macrocyclic Lipids; Attorney Docket No. MRT-2019USP1, filed on the same date as this application entitled Vitamin K Cationic Lipids; Attorney Docket No. MRT-2022USP1, filed on the same date as this application entitled Vitalipids an application filed on the same date as this application entitled Vitalipids II; attorney docket number MRT-2023USP1, an application filed on the same date as this application entitled Vitalipids III; attorney docket number MRT-2024USP1, an application filed on the same date as this application entitled Vitalipids IV.

[0145] mRNA-loaded nanoparticles Any desired lipids can be mixed in any ratio suitable for encapsulation of mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids including cationic lipids, non-cationic lipids, cholesterol, and / or PEGylated lipids.

[0146] In some embodiments, the process of encapsulating mRNA in lipid nanoparticles includes mixing an mRNA solution with a lipid solution, where the mRNA solution and / or the lipid solution are heated to a predetermined temperature higher than ambient temperature prior to mixing to form lipid nanoparticles that encapsulate the mRNA (see U.S. Patent Application Publication No. 14 / 790,562, entitled "Encapsulation of messenger RNA," filed July 2, 2015, and U.S. Provisional Patent Application No. 62 / 020,163, filed July 2, 2014, the disclosures of which are incorporated herein by reference in their entireties).

[0147] In some embodiments, the process of encapsulating mRNA in lipid nanoparticles comprises mixing preformed lipid nanoparticles with the mRNA (see U.S. Provisional Patent Application No. 62 / 420,413, filed Nov. 10, 2016, and U.S. Provisional Patent Application No. 62 / 420,413, filed Nov. 1, 2017). (See Provisional Patent Application No. 62 / 580,155, the disclosures of which are incorporated herein by reference). In some embodiments, mixing preformed lipid nanoparticles with mRNA results in lipid nanoparticles that improve the efficiency of delivering mRNA into cells. In some embodiments, mixing preformed lipid nanoparticles with mRNA results in encapsulation of the mRNA in lipid nanoparticles with extremely high encapsulation efficiency (i.e., in the range of 90-95%). In some embodiments, the preformed lipid nanoparticles and the mRNA are mixed using a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and facilitates large scale production.

[0148] Suitable liposomes according to the present invention can be made in various sizes. In some embodiments, the provided liposomes can be made smaller than the conventionally known mRNA-encapsulating liposomes. In some embodiments, the reduced size of the liposomes increases the efficiency of mRNA delivery. The appropriate liposome size can be selected by considering the site of the target cell or tissue, and also by considering to some extent the use of the liposomes to be made.

[0149] In some embodiments, liposomes of appropriate size are selected to promote the systemic distribution of the antibody encoded by mRNA.In some embodiments, it may be desirable to limit the transfection of mRNA to specific cells or tissues.For example, to target hepatocytes, liposomes can be sized so that their size is smaller than the fenestration of the endothelial layer covering the hepatic sinusoids of the liver, and in this case, liposomes can easily penetrate the fenestration to reach the target hepatocytes.

[0150] Alternatively or additionally, liposomes may be sized to be of sufficient diameter to limit or purposely prevent distribution within certain cells or tissues. For example, liposomes may be sized to be larger than the fenestrations in the endothelial layer lining the liver sinusoids, thereby limiting distribution of the liposomes to liver cells.

[0151] In some embodiments, the size of the liposome is determined by the length of the maximum diameter of the liposome particle. In some embodiments, suitable liposomes have a size of about 250 nm or less (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less). In some embodiments, suitable liposomes have a size in the range of about 10 to 250 nm (e.g., about 10 to 225 nm, 10 to 200 nm, 10 to 175 nm, 10 to 150 nm, 10 to 125 nm, 10 to 100 nm, 10 to 75 nm, or 10 to 50 nm). In some embodiments, suitable liposomes have a size in the range of about 100 to 250 nm (e.g., about 100 to 225 nm, 100 to 200 nm, 100 to 175 nm, or 100 to 150 nm). In some embodiments, suitable liposomes have a size in the range of about 10-100 nm (e.g., in the range of about 10-90 nm, 10-80 nm, 10-70 nm, 10-60 nm, or 10-50 nm). In certain embodiments, suitable liposomes have a size less than about 100 nm.

[0152] A variety of alternative methods known in the art can be used to size liposome populations. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of the liposome suspension, either by bath or probe sonication, results in a gradual size reduction down to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method, which utilizes shear energy to fragment larger liposomes into smaller ones. In a typical homogenization procedure, MLVs are observed to be the size of the selected liposomes, typically about 0.1 to 0.5 micrometers in size. The emulsion is recirculated using a standard emulsion homogenizer until the liposome size reaches 100%. The liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981) (incorporated herein by reference). The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS evaluation to guide efficient liposome synthesis.

[0153] In some embodiments, a method for preparing lipid nanoparticles containing mRNA is identified, which includes combining preformed lipid nanoparticles with mRNA under conditions where the resulting formed particles exhibit improved potency and efficacy due to the order of addition of these components. The mixing of components is achieved using a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and facilitates mass production. This process is described in detail in applicant's international application PCT / US17 / 61113, filed November 10, 2017, which claims priority to application No. 62 / 420,413, filed November 10, 2016, and U.S. patent application No. 15 / 809,680, filed the same day, all of which are incorporated herein by reference in their entirety. The above-mentioned formulation process is often referred to herein as a "remixed" formulation.

[0154] Vaccine Compositions The immunogenic compositions of the present invention may contain additional substances, such as adjuvants to enhance the effectiveness of the vaccine, and may contain pharma- ceutically acceptable carriers, including, but not limited to, wetting or emulsifying agents or buffers (Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, (ed.) 1980).

[0155] Adjuvants Suitable adjuvants include, but are not limited to, mineral salts (e.g., AlK(SO4)2, AlNa(SO4)2, AlNH(SO4)2, silica, aluminum, Ca3(PO4)2, kaolin, or carbon), polynucleotides with or without immune stimulating complexes (ISCOMs) (e.g., CpG oligonucleotides, poly IC acid or poly AU acid, such as those described in Chuang, T. et al, (2002) J. Leuk. Biol. 71(3):538-44; Ahmad-Nejad, P. et al, (2002) Eur. J. Immunol. 32(7):1958-68), polyarginine with or without CpG (also known in the art as IC31; Schellack, C. et al, (2003) Proceedings of the 34th Annual Meeting of the American Academy of Clinical Oncology, 2003). German Society of Immunology; see Lingnau, K. et al (2002) Vaccine 20(29-30):3498-508), JuvaVax™ (U.S. Patent No. 6,693,086), certain natural substances (e.g., wax D from Mycobacterium tuberculosis, substances found in Corynebacterium parvum, Bordetella pertussis, or members of the Brucella genus), flagellin (Toll-like receptor 5 ligand; McSorley, S. Jeter, J. et al. (2002) Vaccine 20(29-30):3498-508), and ... al (2002) J. Immunol. 169(7):3914-9), saponins such as QS21, QS17, and QS7 (U.S. Pat. Nos. 5,057,540, 5,650,398, 6,524,584, 6,645,495), monophosphoryl lipid A, particularly 3-de-O-acylated monophosphoryl lipid A (3D-MPL), imiquimod (also known in the art as IQM and commercially available as Aldara®; U.S. Pat. Nos. 4,689,338, 5,238,944; Zuber, AK et al (2004) 22(13-14):1791-8), the CCR5 inhibitor CMPD167 (Veazey, RST et al (2003) J. Exp. Med. 198:1551-156 2), and squalene emulsion, i.e. MF59.

[0156] In some embodiments, the adjuvant is another RNA.

[0157] An adjuvant that has been widely used in humans is aluminum. In some embodiments, a suitable adjuvant is aluminum phosphate. In some embodiments, a suitable adjuvant is aluminum hydroxide. In some embodiments, a suitable adjuvant is a combination of aluminum phosphate and aluminum hydroxide. Saponin and its purified components Quil A, Freund's complete adjuvant, and other adjuvants are typically used in research and veterinary applications, however, novel chemically defined preparations such as muramyl dipeptide, monophosphoryl lipid A, phospholipid complexes such as those described in Goodman-Snitkoff et al. J. Immunol. 147:410-415 (1991) and incorporated herein by reference.

[0158] Carriers, excipients To facilitate expression of the mRNA in vivo, delivery vehicles such as lipid nanoparticles, including liposomes, may be formulated in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizing reagents, or may be formulated into pharmacological compositions in admixture with suitable excipients. In some embodiments, the lipid nanoparticles encapsulating the mRNA are administered simultaneously with hyaluronidase. Techniques for drug formulation and administration are described in "Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition.

[0159] Typically, the immunogenic vaccine composition according to the present invention includes a pharma- ceutically acceptable carrier. In general, pharma- ceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation is suitable for the method of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. Any of the common pharmaceutical carriers, such as sterile saline or sesame oil, can be used. The medium can also contain existing pharmaceutical auxiliary substances, such as, for example, pharma- ceutical acceptable salts to adjust osmotic pressure, buffers, preservatives, and the like.

[0160] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Thus, there is a wide variety of suitable formulations of the immunogenic compositions of the present invention. In some embodiments, the immunogenic vaccine compositions are formulated for parenteral (i.e., intramuscular, intradermal, or subcutaneous) or nasopharyngeal (i.e., intranasal) administration. Typically, formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's oil, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), etc. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.

[0161] Some of the immunogenic compositions may potentially be administered as pharma- ceutically acceptable acid or base addition salts, which may be prepared by addition of inorganic acids, such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, or the like. , thiocyanic, sulfuric, and phosphoric acid) and organic acids (formic, acetic, propionic, glycolic, lactic, pyruvic, oxalic, malonic, succinic, maleic, and fumaric acids), or by reaction with inorganic bases (sodium hydroxide, ammonium hydroxide, potassium hydroxide) and organic bases (mono-, di-, tri-alkyl, and aryl amines, and substituted ethanol amines).

[0162] The provided liposome-encapsulated or liposome-associated mRNA and compositions comprising the same may be administered and dosed according to current medical practice, taking into consideration the subject's clinical condition, the site and method of administration, the administration schedule, the subject's age, sex, weight, and other factors relevant to a clinician in the art. For purposes herein, an "effective amount" may be determined by such appropriate considerations known to those skilled in the art of experimental clinical studies, pharmacology, clinical, and medical fields. In some embodiments, the amount administered is effective to at least somewhat stabilize, improve, or eliminate symptoms or other indicators selected by those skilled in the art as appropriate measures of disease progression, regression, or improvement. For example, a suitable amount and dosing regimen is one that results in at least transient production of a protein (e.g., an enzyme).

[0163] Alternatively, or additionally, the liposome-encapsulated mRNA and compositions of the present invention may be administered in a local rather than systemic manner.

[0164] Administration may be in single or multiple doses.

[0165] The provided method of the present invention contemplates single administration as well as multiple administration of a therapeutically effective amount of the vaccination agent (e.g., mRNA encoding an antigen) described herein. The vaccination agent may be administered at regular intervals depending on the nature, severity, and extent of the subject's condition (e.g., stage of infection, prevalence demographics, or stage of cancer, etc.). In some embodiments, a therapeutically effective amount of the vaccination agent (e.g., mRNA encoding an antigen) of the present invention may be administered periodically at regular intervals (e.g., once a year, once every 6 months, once every 5 months, once every 3 months, bimonthly (once every 2 months), monthly (once every month), biweekly (once every 2 weeks), twice a month, once every 30 days, once every 28 days, once every 14 days, once every 10 days, once every 7 days, weekly, twice a week, daily, or consecutively).

[0166] In some embodiments, the liposomes and / or compositions provided are formulated to be suitable for sustained release of the mRNA contained therein. Such sustained release compositions can be administered to subjects at extended dosing intervals as appropriate. For example, in some embodiments, the compositions of the present invention are administered to subjects twice a day, daily, or every other day. In preferred embodiments, the compositions of the present invention are administered to subjects twice a week, once a week, once every 7 days, once every 10 days, once every 14 days, once every 28 days, once every 30 days, once every 2 weeks, once every 3 weeks, or more preferably once every 4 weeks, once a month, twice a month, once every 6 weeks, once every 8 weeks, once every other month, once every 3 months, once every 4 months, once every 6 months, once every 8 months, once every 9 months, or annually. Compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) are also contemplated to either deliver or release mRNA over an extended period of time. Preferably, the sustained release measures employed are combined with modifications made to the mRNA to enhance stability.

[0167] As used herein, the term "therapeutically effective amount" is primarily based on the total amount of the vaccinating agent contained in the vaccine composition of the present invention. Generally, a therapeutically effective amount is an amount sufficient to achieve a meaningful benefit to a subject (e.g., treat, regulate, cure, prevent, and / or ameliorate an infectious disease or cancer). For example, a therapeutically effective amount may be an amount sufficient to obtain a desired therapeutic and / or prophylactic effect. Generally, a therapeutically effective amount is an amount sufficient to obtain a desired therapeutic and / or prophylactic effect to a subject in need thereof. The amount of therapeutic agent (e.g., mRNA encoding an antigen) administered will depend on the characteristics of the subject. Such characteristics include the subject's condition, disease severity, general health, age, sex and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other related factors. Moreover, both objective and subjective assays can be used to identify optimal dosage ranges.

[0168] In some embodiments, a priming dose of the vaccine is administered at week 0, followed by one or more additional vaccine doses. In some embodiments, one, two, or three additional vaccine doses, also known as booster doses, are administered after the priming dose. In some embodiments, the priming dose and the booster dose have a specific time interval. In some embodiments, the priming dose and the booster dose are administered one week apart, or two weeks apart, or any other interval suitable for the vaccine and the desired immunological response. In some embodiments, the time interval between two consecutive booster doses is the same as the interval between the priming and the booster dose. In some embodiments, the time interval between two consecutive booster doses is different from the interval between the priming and the booster dose.

[0169] The therapeutically effective amount is generally administered in a dosage regimen that may include multiple unit doses. For any particular vaccine, the therapeutically effective amount (and / or the appropriate unit dose within an effective administration regimen) may vary, for example, depending on the route of administration, depending on the combination with other pharmaceuticals. Also, the therapeutically effective amount (and / or unit dose) specific to any particular patient may depend on various factors, including the disorder being treated and the severity of the disorder; the activity of the specific vaccine agent being employed; the specific composition being employed; the age, weight, general health, sex, and diet of the patient; the time of administration, the route of administration, and / or the excretion or metabolic rate of the specific protein being employed; the duration of treatment; and similar factors well known in the medical field.

[0170] In some embodiments, the therapeutically effective dosage is from about 0.005 mg / kg body weight to 500 mg / kg body weight, e.g., from about 0.005 mg / kg body weight to 400 mg / kg body weight, from about 0.005 mg / kg body weight to 300 mg / kg body weight, from about 0.005 mg / kg body weight to 200 mg / kg body weight, from about 0.005 mg / kg body weight to 100 mg / kg body weight, from about 0.005 mg / kg body weight to 90 mg / kg body weight, from about 0.005 mg / kg body weight to 80 mg / kg body weight, from about 0.005 mg / kg body weight to 7 ... The range is about 0 mg / kg (body weight), about 0.005 mg / kg (body weight) to 60 mg / kg (body weight), about 0.005 mg / kg (body weight) to 50 mg / kg (body weight), about 0.005 mg / kg (body weight) to 40 mg / kg (body weight), about 0.005 mg / kg (body weight) to 30 mg / kg (body weight), about 0.005 mg / kg (body weight) to 25 mg / kg (body weight), about 0.005 mg / kg (body weight) to 20 mg / kg (body weight), about 0.005 mg / kg (body weight) to 15 mg / kg (body weight), about 0.005 mg / kg (body weight) to 10 mg / kg (body weight).

[0171] In some embodiments, a therapeutically effective dose of the vaccine is greater than about 0.1 mg / kg body weight, greater than about 0.5 mg / kg body weight, greater than about 1.0 mg / kg body weight, greater than about 3 mg / kg body weight, greater than about 5 mg / kg body weight, greater than about 10 mg / kg body weight, greater than about 15 mg / kg body weight, greater than about 20 mg / kg body weight, greater than about 30 mg / kg body weight, greater than about 40 mg / kg body weight, greater than about 50 mg / kg body weight, greater than about 60 mg / kg body weight, greater than about 100 mg / kg body weight, greater than about 150 mg / kg body weight, greater than about 200 mg / kg body weight, greater than about 300 mg / kg body weight, greater than about 40 mg / kg body weight, greater than about 50 mg / kg body weight, greater than about 60 mg / kg body weight, greater than about 10 ... g (body weight), greater than about 70 mg / kg (body weight), greater than about 80 mg / kg (body weight), greater than about 90 mg / kg (body weight), greater than about 100 mg / kg (body weight), greater than about 150 mg / kg (body weight), greater than about 200 mg / kg (body weight), greater than about 250 mg / kg (body weight), greater than about 300 mg / kg (body weight), greater than about 350 mg / kg (body weight), greater than about 400 mg / kg (body weight), greater than about 450 mg / kg (body weight), or greater than about 500 mg / kg (body weight). In certain embodiments, the therapeutically effective dosage is 1.0 mg / kg (body weight). In some embodiments, a therapeutically effective dose of 1.0 mg / kg body weight is administered subcutaneously, intramuscularly, or intravenously.

[0172] In some embodiments, about 0.3 μg of vaccine is administered per dose. In some embodiments, about 0.4 μg of vaccine is administered. In some embodiments, about 0.5 μg of vaccine is administered. In some embodiments, about 0.6 μg of vaccine is administered. In some embodiments, about 0.7 μg of vaccine is administered. In some embodiments, about 0.8 μg of vaccine is administered. In some embodiments, about 0.9 μg of vaccine is administered. In some embodiments, about 1 μg of vaccine is administered. In some embodiments, about 2 μg of vaccine is administered. In some embodiments, about 3 μg of vaccine is administered. In some embodiments, about 4 μg of vaccine is administered. In some embodiments, about 5 μg of vaccine is administered. In some embodiments, about 6 μg of vaccine is administered. In some embodiments, about 7 μg of vaccine is administered. In some embodiments, about 8 μg of vaccine is administered. In some embodiments, about 9 μg of vaccine is administered. In some embodiments, about 10 μg of vaccine is administered. In some embodiments, about 12, 15, 20, 30, 50, or 100 μg of vaccine, or any amount in between, are administered. In some embodiments, up to about 1 mg of vaccine is administered per dose. In some embodiments, up to about 10 mg of vaccine is administered per dose. In some embodiments, up to about 100 mg of vaccine is administered per dose.

[0173] In some embodiments, the priming dose and the subsequent vaccine dose are the same amount. In some embodiments, the priming dose and the subsequent vaccine dose are different amounts.

[0174] In some embodiments, administration of the composition results in expression of the antigen encoded by the mRNA in lymph nodes of the subject. In some embodiments, administration of the composition results in expression of the antigen encoded by the mRNA in lymphocytes of the subject.

[0175] In some embodiments, administration of the composition results in an antigen-specific antibody response, hi some embodiments, the antigen-specific antibody response is measured by the presence of antigen-specific antibodies in serum.

[0176] In some embodiments, administering the composition results in antigen-specific T cell response.In some embodiments, the antigen-specific T cell response is measured by cytokine response.In some embodiments, the antigen-specific T cell response is measured by IFN-γ ELISPOT in splenocytes.

[0177] In some embodiments, an antigen-specific antibody response, and / or an antigen-specific T cell response is detectable at least 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or 1 month after administration.

[0178] Also contemplated herein are lyophilized pharmaceutical compositions comprising one or more of the liposomes disclosed herein, and related methods for using such compositions, for example, as disclosed in International Patent Application PCT / US12 / 41663, filed June 8, 2012. The teachings of said application are incorporated herein by reference in their entirety. For example, the lyophilized pharmaceutical compositions according to the present invention can be reconstituted prior to administration or reconstituted in vivo. For example, the lyophilized pharmaceutical compositions can be formulated into a suitable dosage form (e.g., an intradermal dosage form such as a disk, rod, or membrane) and administered such that the dosage form is rehydrated in vivo over time by the body fluids of an individual.

[0179] The provided liposomes and compositions can be administered to any desired tissue. In some embodiments, the provided liposomes and compositions containing mRNA are delivered subcutaneously and NA is expressed in cells or tissue types other than subcutaneous tissue. Certain compositions lead to delivery and expression bias in certain tissues other than the administration site. The present invention provides a composition for subcutaneous administration that leads to robust expression in lymph nodes. Other examples of tissues where delivered mRNA can be expressed include, but are not limited to, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid.

[0180] In some embodiments, administering the provided compositions increases the expression of the administered mRNA and / or increases the expression and activity levels of other enzymes or proteins in a biological sample from a subject, compared to baseline expression or activity levels before treatment or administration. In some embodiments, administering the provided compositions increases cytokine or chemokine expression, compared to baseline expression or activity levels before treatment. For example, a T cell vaccine that stimulates and activates cytotoxic T cells will increase IFN-gamma production above baseline. IFN-γ, as well as other cytokines and chemokines, are known in the art as immune response or activation markers. Typically, baseline levels are measured immediately before treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administering the provided compositions increases the expression or activity marker level of immune response by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administering the provided compositions increases the mRNA expression or activity level in a biological sample from a subject compared to an untreated subject. In some embodiments, administering the provided compositions increases the expression or activity level of a therapeutic protein in a biological sample from a subject compared to an untreated subject.

[0181] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit a particular medical need. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, or 1 month after administration of the provided liposomes and / or compositions.

[0182] In some embodiments, a therapeutically effective amount of a composition provided when administered. EXAMPLES

[0183] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve merely to illustrate the compounds of the present invention and are not intended to be limiting thereof.

[0184] lipid material The formulations described in the Examples below contain, unless otherwise noted, multi-component lipid mixtures using one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), and PEGylated lipids in various ratios designed to encapsulate various nucleic acid materials. Cationic lipids for the process include, but are not limited to, cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione), OF-02, Target 23, Target 24, imidazole cholesterol ester (ICE), HGT5000, HGT5001, HGT4003, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al. "Rational Design of Cationic Lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al. "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869), dialkylamino-based, imidazole-based, guanidinium-based, and the like can be mentioned. The helper lipid may include, but is not limited to, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), cholesterol, etc. PEGylated lipids may include, but are not limited to, C6-C 20 The lipid may comprise a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having an alkyl chain of up to 5 kDa in length.

[0185] mRNA material In some embodiments, codon-optimized messenger RNA encoding the target protein was synthesized by in vitro transcription from a plasmid DNA template encoding the gene, followed by the addition of a 5' cap structure (Cap1) (Fechter, P.; Brownlee, GG "Recognition of mRNA cap structures by viral and cellular proteins" J. Gen. Virology 2005, 86, 1239-1249) and 3' poly(A). The 5' and 3' untranslated regions present in each mRNA product are designated X and Y, respectively, and are defined as previously described.

[0186] Example 1. Comparison of single dose efficacy of different lipid formulations on mRNA expression in serum Using human erythropoietin (hEPO) as a sensitive quantitative measure of mRNA transfection efficacy, three different lipid formulations, ML-2, ML-7, and MC3, were compared for hEPO protein expression levels in serum. MC3 is understood to be the state-of-the-art formulation for a particular RNA delivery platform. Mice were administered intravenously with either 0.3mg / Kg or 1mg / Kg of mRNA in lipid formulations containing either ML-2, ML-7, or MC3. Serum hEPO protein levels were measured 6 and 24 hours after administration, respectively.

[0187] As shown in Figures 1A and 1B, both ML-2 and ML-7, regardless of dose, resulted in higher serum hEPO levels measured at 6 and 24 hours, respectively. These results indicate that the lipid formulations ML-2 and ML-7 are more effective in mRNA delivery and expression than the conventional MC3 formulation.

[0188] Example 2. Comparison of the efficacy of single-dose mRNA delivery routes for detection of expressed proteins in serum In this exemplary experiment, intradermal, subcutaneous, and intramuscular routes of hEPO mRNA administration were compared for hEPO protein expression in serum. Mice were administered either 1, 10, or 5 μg of hEPO mRNA either subcutaneously, intradermally, or intramuscularly. hEPO was administered intramuscularly in the following manner. Serum hEPO protein levels were measured in serum 6 and 24 hours after administration. As shown in Figure 2, among the three administration routes studied at 6 and 24 hours, intramuscular administration produced the highest results for serum expression of delivered mRNA.

[0189] Example 3. Subcutaneous and intradermal delivery of mRNA results in robust mRNA expression in lymph nodes In this exemplary study, subcutaneous, intradermal, and intramuscular delivery routes were compared at a single dose in mice using firefly luciferase (FFL) as the experimental mRNA. Male CD1 mice (N=13) aged 6-8 weeks were administered 1 mg / Kg of FFL mRNA at a concentration of 0.2 mg / mL and a dose of 5 mL / Kg either intradermally (SC) or subcutaneously (ID) or intramuscularly (IM) or appropriate controls without mRNA. 24 hours after administration, all animals received 150 mg / Kg (60 mg / mL) luciferin via intraperitoneal injection at 2.5 mL / Kg. All mice were euthanized 15 minutes after luciferin administration and whole body intracardiac perfusion was performed with saline. The liver, spleen, heart, lungs, kidneys, and brachial, axillary, and inguinal lymph nodes were harvested and prepared for in vivo luciferase assays with image visualization using the IVIS Lumina instrument and protocol. As shown below, the results indicate that the route of administration affects mRNA delivery and expression in vivo.

[0190] Table 1 shows the results expressed as the mean total fluorescence in the various tissues indicated in each treatment group. Enriched FFL mRNA in lymph nodes was observed with all delivery routes. However, surprisingly, delivery by subcutaneous and intradermal routes resulted in robust FFL protein expression in the axillary and brachial lymph nodes compared to the liver and spleen, while intramuscular delivery resulted in preferential expression in the liver, spleen, muscle and inguinal lymph nodes, while resulting in modest expression in the axillary and brachial lymph nodes. Figure 3 shows the fluorescence images of tissues from each mouse in each group. (Groups: control without mRNA, subcutaneous, intradermal and intramuscular). Diagrams showing the arrangement of the various tissues on the Petri dish are provided as an index in the diagram to identify the different tissues by shape and location. Table 1. [Table 1-1] [Table 1-2]

[0191] Example 4. Evaluation of the biodistribution of FFL LNPs using different cationic lipids In this example, mice received a single subcutaneous injection of FFL-LNPs (1 mg / Kg) using the protocol described in the study in Example 3 and with different cationic lipid components of the LNP composition. The results suggest that multiple formulations result in enrichment and robust expression of mRNA in lymph nodes. However, the use of certain cationic lipids results in biased expression of mRNA in lymph nodes. For example, a composition containing ICE (LNP composition 2 in Table 2), a composition containing target 23 (LNP compositions 4 and 5 in Table 2), a composition containing ML2 (LNP composition 1 in Table 2), and a composition containing CCBene (LNP composition 8 in Table 2) result in robust expression of FFL mRNA in lymph nodes. Representative tissue images are shown in Figure 4. Tissues with high fluorescence are indicated by arrows. Diagrams showing the arrangement of various tissues on a Petri dish are provided as an index in the figure to identify different tissues by shape and location. Table 2 shows the average fluorescence in various tissues resulting from FFL expression. Table 2. [Table 2-1] [Table 2-2]

[0192] In addition, an improved LNP formulation process has been adapted to increase the efficacy of mRNA-LNP expression in vivo. The process involves bringing one or more solutions to a temperature above ambient temperature. The method includes heating (i.e., applying heat from a heat source to the solution) until the temperature reaches a certain level (or until the temperature is maintained). The solution includes preformed lipid nanoparticles, mRNA, and a mixed solution containing the mRNA encapsulated by lipid nanoparticles (hereinafter, remixed formulation), as outlined in Applicant's prior application U.S. Patent Application No. 15 / 809,680, or corresponding International Application PCT / US17 / 61113, both filed November 10, 2017, and incorporated herein by reference in their entireties. As shown in FIG. 5 using an exemplary hEPO mRNA as a proof of concept using the remixing protocol, higher expression of hEPO was found in multiple cationic lipid compositions compared to conventional (no heating, unmixed LNP formulation). FIG. 6 shows enrichment of FFL expression in axillary and brachial lymph nodes when delivered as a remixed formulation 24 hours after administration of the mRNA-LNP composition.

[0193] Equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. 1. A method for inducing an immune response in vivo, comprising: A method comprising administering to a subject in need thereof a composition comprising messenger RNA (mRNA) encoding an antigen encapsulated in lipid nanoparticles in a dosage regimen sufficient to induce an antigen-specific T cell response and / or an antigen-specific antibody response.

2. The method of claim 1 , wherein the composition is administered subcutaneously.

3. The method of claim 1 , wherein the composition is administered intradermally.

4. The method of claim 1 , wherein the composition is administered intramuscularly.

5. The method of claim 1 , wherein the composition is not administered intravenously.

6. The method of any one of claims 1 to 5, wherein the composition is a vaccine composition.

7. 1. A method for delivering a vaccine in vivo, comprising: A method comprising administering to a subject in need thereof a vaccine composition comprising messenger RNA (mRNA) encoding an antigen encapsulated in lipid nanoparticles, wherein the vaccine composition is administered intramuscularly or subcutaneously.

8. 8. The method of claim 7, wherein the vaccine composition is administered in a dosage regimen sufficient to induce an antigen-specific T cell response, and / or an antigen-specific antibody response.

9. The method of any one of claims 1 to 8, wherein the antigen is a protein.

10. The method according to any one of claims 1 to 8, wherein the antigen is a peptide.

11. The method of any one of claims 1 to 10, wherein the composition comprises one or more mRNAs encoding one or more polypeptides.

12. The method of any one of claims 1 to 11, wherein the dosing regimen comprises injecting a single dose.

13. The method of any one of claims 1 to 11, wherein the dosing regimen comprises multiple doses injected periodically.

14. 14. The method of claim 12 or 13, wherein the single dose or the multiple doses are in the range of 0.1 μg to 100 mg of mRNA.

15. 14. The method of claim 12 or 13, wherein the single dose or the multiple doses are in the range of 0.1 μg to 50 mg, 0.1 μg to 25 mg, 0.1 μg to 10 mg, 1 μg to 1 mg, or 1 μg to 100 μg of mRNA.

16. 14. The method of claim 12 or 13, wherein the single dose or the multiple doses are selected from 0.1 μg, 0.3 μg, 0.5 μg, 1 μg, 5 μg, 10 μg, 25 μg, 50 μg, or 100 μg.

17. 14. The method of claim 12 or 13, wherein the single dose or the multiple doses range from 0.01 μg / kg to 10 mg / kg (mRNA / body weight).

18. 14. The method of claim 12 or 13, wherein the single dose or the multiple doses are in the range of 0.01 μg / kg to 8 mg / kg, 0.01 μg / kg to 6 mg / kg, 0.01 μg / kg to 5 mg / kg, 0.1 μg / kg to 5 mg / kg, 0.1 μg / kg to 1 mg / kg, or 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

19. The method of any one of claims 13 to 18, wherein each of the multiple doses comprises the same dosage of mRNA.

20. The method of any one of claims 13 to 18, wherein each of the multiple doses comprises a different dosage of mRNA.

21. 21. The method of any one of claims 13 to 20, wherein each of the multiple doses is injected at intervals of 1 to 3 weeks.

22. 21. The method of any one of claims 13 to 20, wherein each of the multiple doses is injected weekly.

23. 21. The method of any one of claims 13 to 20, wherein at least two of the multiple doses are injected within three weeks.

24. 21. The method of any one of claims 13-20, wherein the multiple doses are injected on a schedule of dose 1 at week 0, dose 2 at week 3, and dose 3 at week 5.

25. The method of any one of claims 1 to 24, wherein the mRNA comprises one or more modified nucleotides.

26. The method of any one of claims 1 to 25, wherein the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR).

27. The method of any one of claims 1 to 26, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more helper lipids, and one or more PEG lipids.

28. The lipid nanoparticles are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2- 28. The method of any one of claims 1 to 27, comprising at least one cationic lipid selected from the group consisting of: 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 25), and combinations thereof.

29. 29. The method of claim 28, wherein the at least one cationic lipid is selected from CCBene, ICE, ML-2, C12-200, or DLin-SS-DMA.

30. 30. The method of claim 29, wherein the at least one cationic lipid is ICE.

31. 30. The method of claim 29, wherein said at least one cationic lipid is ML-2.

32. 30. The method of claim 29, wherein said at least one cationic lipid is CCBene.

33. 33. The method of any one of claims 1 to 32, wherein the one or more helper lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

34. The lipid nanoparticles are N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), ６ ~C ２０ 34. The method of any one of claims 1 to 33, comprising one or more PEG lipids selected from a PEG-modified lipid having a polyethylene glycol chain of up to 5 kDa in length covalently attached to a lipid having an alkyl chain of up to 5 kDa in length, PEGylated cholesterol, and a derivatized ceramide such as PEG-2K.

35. 35. The method of any one of claims 1 to 34, wherein the PEG-modified lipid comprises at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the total lipid in the liposome.

36. 36. The method of any one of claims 1 to 35, wherein said administration of said composition results in expression of said antigen encoded by mRNA in lymphocytes of said subject.

37. The method of any one of claims 1 to 36, wherein said administration of said composition results in an antigen-specific antibody response.

38. 37. The method of claim 36, wherein the antigen-specific antibody response is measured by the presence of antigen-specific antibodies in serum.

39. The method of any one of claims 1 to 38, wherein said administration of said composition results in an antigen-specific T cell response.

40. 39. The method of claim 38, wherein the antigen-specific T cell response is measured by IFN-γ ELISPOT in splenocytes.

Images