Method for treating cancer by inhibiting SETD2

Abstract

To provide a method and a pharmaceutical composition for treating cancer, namely, pancreatic cancer or esophageal cancer, or for delaying the progression thereof.SOLUTION: A method for treating cancer, namely, pancreatic cancer or esophageal cancer, comprises administering to a human subject in need for treating or delaying the progression of the cancer, a therapeutically effective amount of a histone methyltransferase inhibitor, specifically a SETD2 inhibitor.SELECTED DRAWING: Figure 2A-2B

Description

Technical Field

[0001] Reference to Electronically Submitted Sequence Listing The content of the electronically submitted sequence listing in the ASCII text file (named 3562.012000_ Sequence_listing_ST25.txt; size: 1,142 bytes; and data creation date: August 14, 2017) submitted with the application is hereby incorporated by reference in its entirety herein.

[0002] The present disclosure generally relates to the field of epigenetically based cancer therapies. In particular, the present disclosure relates to methods and pharmaceutical compositions for treating cancer by inhibiting human histone methyltransferase, SETD2.

Background Art

[0003] The selective addition of methyl groups to specific amino acid sites on histones is controlled by the action of a family of enzymes known as histone methyltransferases (HMTs). Specifically, the level of expression of a given gene is affected by the presence or absence of one or more methyl groups at related histone sites. The specific effect of a methyl group at a particular histone site persists until the methyl group is removed by a histone demethylase or until the modified histone is replaced through nucleosome turnover. Similarly, other enzyme classes can modify DNA and histones with other chemical species, and still other enzymes can remove these species to effect control of gene expression. The specific effect of a methyl group at a particular histone site persists until the methyl group is removed by a histone demethylase or until the modified histone is replaced through nucleosome turnover. Similarly, other enzyme classes can modify DNA and histones with other chemical species, and still other enzymes can remove these species to effect control of gene expression.

[0004] SETD2 is located at cytogenic band p21 on chromosome 3. It is a human histone methyltransferase localized at 31 (3p21.31). The initials "SETD2" represent Suppressor of variegation, Enhancer of zeste, and Trithorax domain containing 2. The SETD2 protein contains three conserved functional domains: (1) the triple-AWS-SET-PostSET domain; (2) the WW domain; and (3) the Set2-Rbp1-interacting ("SRI") domain. These three functional domains define the biological functions of SETD2. See Li, J. et al., Oncotarget 7:50719-50734 (2016). SETD2 is a single human gene involved in the trimethylation of lysine 36 of histone H3 (H3K36me3) using dimethylated Lys-36 (H3K36me2) as a substrate. See Edmunds, J. W. et al., The EMBO Journal 27:406-420 (2008). In particular, human SETD2 has been shown to have a tumor suppressor function. Li, J

[0005] . et al., Oncotarget 7:50719-50734 (2016). For example, inactivation of human SETD2 has been reported in renal cell carcinoma (RCC). Larkin, J. et al., Nature Reviews 9:147-155 (2012 ). Also, the expression level of SETD2 in breast cancer samples has been reported to be significantly lower than that in adjacent non-cancerous tissue (ANCT) samples. Newbold, R. F. and Mokbel, K., Anticancer Research 30:3309-3311 ( 2010). 2010). 2010). Furthermore, germline mutations and loss-of-function mutations in SETD2 have been reported in patients with acute leukemia. Zhu, X. et al., Nature Gene tics 46:287-293 (2014). Mutations in SETD2 have also been reported in high-grade gliomas. Fontebasso, A. M. et al., Ac ta Neuropathol. 125:659-669 (2013).

[0006] Despite more than a century of scientific and clinical research efforts, cancer cure remains one of the greatest medical challenges to date. Cancer treatment mainly relies on a combination of surgery, radiotherapy and / or cytotoxic chemotherapy. While effective cancer therapies exist, suboptimal responses, recurrent-refractory disease and / or resistance to one or more therapeutic agents remain difficult problems. Therefore, there is a need in medicine for more effective, safe and durable treatments for all types of cancer.

Summary of the Invention

Means for Solving the Problems

[0007] The present disclosure relates to the surprising and unexpected discovery of inhibiting human SETD2, which can be used to treat cancer, particularly pancreatic cancer and esophageal cancer, despite its known functionality as a tumor suppressor.

[0008] In one aspect, the present disclosure is directed to a method of treating cancer, comprising administering a therapeutically effective amount of a SETD2 inhibitor to a subject in need of

[0009] ​In one aspect, the present disclosure comprises: (i) contacting cancer cells with an effective amount of a SETD2 inhibitor;( ii) attenuating or inhibiting the growth of the cancer cells, and relates to a method for attenuating or inhibiting the growth of cancer cells.

[0010] In certain embodiments, the SETD2 inhibitor is selected from the group consisting of polypeptides, DNA, and RNA.

[0011] In certain embodiments, the SETD2 inhibitor is: (i) an isolated binding molecule that specifically binds to the SETD2 polypeptide; (ii) an isolated binding molecule that specifically binds to a ligand of the SETD2 polypeptide; or (iii) an antiserum raised against the SETD2 polypeptide.

[0012] In certain embodiments, the SETD2 inhibitor is an antibody or an antigen-binding fragment of an antibody that specifically binds to the SETD2 polypeptide. In certain embodiments, the antibody is a polyclonal, monoclonal, mouse, human, humanized, or chimeric antibody. In certain embodiments, the antigen-binding fragment is a Fab, Fab’, F(ab’)2, Fv, scFv, sdFv fragment, VH domain, or VL domain.

[0013] In certain embodiments, the SETD2 inhibitor is an RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, decoy molecule, decoy DNA, double-stranded DNA, single-stranded DNA, complexed DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, etc. that forms a hybrid with the nucleotide sequence encoding the SETD2 polypeptide under stringent conditions or a gene editing system. ​​​​​​​​​​​​​Circularized RNA, viral RNA, double-stranded RNA, a molecule capable of generating RNA interference, or a combination thereof In certain embodiments, the SETD2 inhibitor is siRNA selected from the group consisting of SEQ ID NOs: 1-4 In certain embodiments, the gene editing system is CR ISPR / Cas9

[0014] In certain embodiments, the SETD2 inhibitor is a small molecule compound. In certain embodiments the small molecule compound is a sinefungin derivative selected from the group consisting of N-propylsinefungin and N-benzylsinefungin

[0015] In certain embodiments, the cancer or cancer cell is adrenocortical carcinoma, alveolar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, apocrine hidradenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenomatoid odontogenic tumor, adenosquamous carcinoma , adipose tissue neoplasm, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft part sarcoma , enamel epithelial fibroma, anaplastic large cell lymphoma, anaplastic thyroid carcinoma, angioleiomyolipoma, angiosarcoma , astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, biliary tract cancer, bladder cancer, blastoma , bone cancer, breast cancer, brain cancer, carcinoma, carcinoma in situ, carcinosarcoma, chondroma, cementoma, bone marrow sarcoma , chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, clear cell sarcoma of the kidney, craniopharyngioma, cutaneous T cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, dysembryoplastic neuroepithelial tumor , embryonal carcinoma, endocrine gland neoplasm, endodermal sinus tumor, esophageal cancer, fibrosarcoma , follicular lymphoma, follicular thyroid carcinoma, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma , giant cell fibroblastoma, giant cell tumor of bone, glioma, glioblastoma, gliosarcoma, cerebral ​​Glioma, glucagon-producing tumor, gonadoblastoma, granulosa cell tumor, gynandroblastoma , gallbladder cancer, gastric cancer, hemangioblastoma, head and neck cancer, hemangiopericytoma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T cell lymphoma, infiltrating lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, malignant melanoma, lethal midline carcinoma, leukemia , Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma , liver cancer, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant triton tumor, mediastinal germ cell tumor, medullary carcinoma of the breast, medullary thyroid carcinoma, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, Müllerian duct mixed tumor, mucinous tumor , muscle tissue neoplasm, fungating polypoid tumor, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal carcinoma, nerve sheath tumor, neuroblastoma, neurofibroma, neuroma, nodular melanoma, ocular cancer, oligodendroglioma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, optic nerve tumor, oral cancer, osteosarcoma, ovarian cancer , papillary thyroid carcinoma, paraganglioma, pineoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasmacytoma, polyembryoma, primary central nervous system lymphoma, primary effusion lymph oma, primary peritoneal carcinoma, prostate cancer, pancreatic cancer, pharyngeal cancer, peritoneal pseudomyxoma, renal cell carcinoma, renal medulla cancer, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, neurofibromatosis, seminoma, se rtoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatin-producing tumor, spinal tumor, squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular tumor, thyroid adenocarcinoma, transitional cell carcinoma, throat cancer, urachal duct carcinoma, urogenital cancer, urothelial cancer, vitreous membrane melanoma , uterine cancer, verrucous carcinoma, visual pathway glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, head and neck squamous cell carcinoma, esophageal adenocarcinoma squamous cell carcinoma(adenocarcinoma squam (esophageal squamous cell carcinoma), gastric adenocarcinoma, colonic adenocarcinoma, hepatocellular carcinoma, cholangiocarcinoma of the biliary tract, gallbladder adenocarcinoma, pancreatic adenocarcinoma, intraductal epithelial neoplasia of the breast, breast adenocarcinoma, lung adenocarcinoma, squamous cell carcinoma of the lung, transitional cell carcinoma of the bladder, squamous cell carcinoma of the bladder, squamous cell carcinoma of the cervix, adenocarcinoma of the cervix, endometrial carcinoma, penile squamous cell carcinoma, and squamous cell carcinoma of the skin, and is selected from the group consisting of.

[0016] In certain embodiments, the cancer is pancreatic cancer, or the cancer cells are derived from pancreatic cancer, or the cancer is esophageal cancer, or the cancer cells are derived from esophageal cancer.

[0017] In certain embodiments, the cancer or cancer cells are esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, medulloblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate adenocarcinoma, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, and colorectal cancer, and is selected from the group consisting of thereof.

[0018] In certain embodiments, the cancer or cancer cells are blood cancer, or the cancer cells are derived from blood cancer is.

[0019] In certain embodiments, the blood cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt's lymphoma (BL), Richter's transformation, acute eosinophilic leukemia, acute erythrocytic leukemia disease, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia Leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma tumor, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia lymphoma, aggressive NK cell leukemia and angioimmunoblastic T-cell lymphoma The compound is selected from the group consisting of:

[0020] In certain embodiments, the subject is a mammal. It is.

[0021] In certain embodiments, the SETD2 inhibitor is formulated for systemic or local administration. In certain embodiments, the SETD2 inhibitor is formulated for oral, nasal, intraperitoneal, or intratumoral administration. In certain embodiments, the SETD2 inhibitor is administered intravenously, intramuscularly, or intravenously. It is formulated for subcutaneous administration.

[0022] In certain embodiments, the method further comprises administering one or more additional therapeutic agents. Included.

[0023] In certain embodiments, a SETD2 inhibitor binds to lysine 36 on histone H3 (H3K It inhibits trimethylation of 36me3.

[0024] In one aspect, the disclosure provides a SETD2 inhibitor for use in a method of treating cancer. The following is the target.

[0025] In one embodiment, the present disclosure provides a method for treating cancer by inhibiting SETD2 in a subject in need of treating cancer. A method for treating cancer is targeted, which includes inhibiting the activity.

Brief Description of the Drawings

[0026]

FIG. 1A-1B

FIG. 2A-2D

FIG. 3A-3B

FIG. 4

Number

Number

Mode for Carrying Out the Invention

[0027] Definition To facilitate understanding of the present invention, some terms and phrases are defined below.

[0028] Open terms such as "include", "including", "contain", "containing", etc. mean "comprising". These open-ended transitional phrases are used to introduce open-ended lists of elements, method steps, etc. that do not exclude additional elements or method steps not recited. When an aspect is described herein with the word "comprising" , similar aspects described with the terms "consisting of" and / or "consisting essentially of" are also provided. When used in the present disclosure and claims, the singular forms "a", "an", and "the" include the plural unless the context clearly dictates otherwise. For example, "a cell" includes a single cell as well as a plurality of cells and mixtures thereof.

[0029]

[0030] ​​​​ "SETD2" (SET Domain Containing 2, Huntingtin interacting protein B, lysine N-methyltransferase 3A, Huntingtin yeast partner B, EC2.1.1.43, P231HBP, HIP-1, HIF-1, KMT3 A, HYPB, SET2, histone-lysine N-methyltransferase SETD2, Huntingtin interacting protein 1, Huntingtin interacting protein 1, SET Domain Containing Protein2, KIAA1732, HSPC06 9, HBP231, HSET2, HIF1 and also known as LLS) refers to, unless otherwise indicated, the native histone methyltransferase SETD2. "Human SETD2" refers to the native human histone methyltransferase SETD2 ."SETD2" includes the full-length, unprocessed SETD2, as well as any form of SETD2 resulting from intracellular processing . This term also includes natural variants of SETD2, such as splice variants, allelic variants and isoforms. SETD2 can be isolated from various sources, such as human tissue types or other animal tissue types, or can be prepared by recombinant or synthetic methods. Examples of human gene sequences encoding SETD2 or SETD2 polypeptide sequences include, but are not limited to, NCBI Gene ID 2 9072, HGNC:18420 and SETD2 transcript variant 1, mRNA-NCBI reference sequence: NM_014159.6. The human gene encoding SETD2 is located on the short arm of chromosome 3. The term "SETD2" as used herein ​​​​​When used, it generally refers to the gene encoding human SETD2, while on the other hand, other mammalian forms of SETD 2 are also contemplated.

[0031] As used herein, the "functional domain of SETD2" refers to one of three conserved functional domains of SETD2 that are thought to define the biological function of SETD2. These functional domains are: (1) the tripartite AWS-SET-PostSET domain; ( 2) the WW domain; and (3) the Set2-Rbp1 interaction ("SRI") domain (L i, J. et al., Oncotarget 7:50719-50734 (2016 ), and can be described as follows: AWS-SET-PostSET domain. Without wishing to be bound by any theory, the human SET domain is evolutionarily conserved from yeast to mammals and is thought to be a 130-amino acid motif found in some bacteria and viruses. The SE T domain is usually present as part of a contiguous multi peptide domain where the AWS (associated with SET) and PostSET domains are adjacent. Generally, SET-domain-containing proteins transfer one or several methyl groups from S-adenosyl-L-methionine to the amino group of lysine or arginine residues of histone or other proteins . This transfer is thought to depend on the flanking AWS and Po stSET regions, which contain several conserved cysteine residues. In contrast to other methyltransferases, SET-domain-containing methyltransferases have an α-sheet structure that promotes multiple methylations without substrate dissociation.

[0032] WW domain. The "WW domain" is a 20- to 22-amino acid-spaced pair of conserved tri Refers to the presence of a Ptofan (W) residue. The binding assay shows that the WW domain preferentially binds to a proline rich segment and is involved in various molecular processes through protein-protein interactions. It is not desired to be bound by any theory, but the WW domain is thought to recognize motifs such as proline-proline-x-tyrosine (PPxY), phospho-serine -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins.

[0033] SRI domain. It is not desired to be bound by any theory, but the Set2 Rpb1 interaction ("SRI") domain is thought to interact with the highly phosphorylated C-terminal domain (C TD) of Rpb1, the largest subunit of RNA Pol II. Also, it is not desired to be bound by any theory, but in humans, RNA Pol -proline (p-SP) or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. It is not desired to be bound by any theory, but the WW domain in the C-terminal region of SETD2 interacts with huntingtin protein through its proline-rich segment and may also interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can prevent the WW domain of SETD2 from interacting with the proline-rich stretches of huntingtin and perhaps also other proteins. The major C-terminal domain docking sites of SETD2 are the first and second helices of SETD2. This domain is thought to be located in the SETD2 domain, which mediates the activity of SETD2 in actively transcribed genes. It is thought to be sexually charged.

[0034] The phrases "substantially similar" or "substantially the same" as used herein mean Within the context of the biological characteristic being measured by the value of A close fit between two values ​​that is deemed to have little or no biological and / or statistical significance It shows high similarity to d value).

[0035] Polypeptides, antibodies, polynucleotides, vectors, cells or compositions that are "isolated" The product may be a polypeptide, antibody, polynucleotide, vector, or other product that is in a form not found in nature. The isolated polypeptide, antibody, polynucleotide, vector, or composition may be a polypeptide, antibody, vector, or cell. The vector, cell or composition may be purified to the extent that it is no longer in the form in which it is found in nature. In some embodiments, the isolated antibody, polynucleoside, The peptide, vector, cell or composition is substantially pure.

[0036] As used herein, "substantially pure" means at least 50% pure (i.e. free of contaminants), at least 90% pure, at least 95% pure, at least 98% pure or refers to a substance that is at least 99% pure.

[0037] "Polynucleotide" or "nucleic acid", as used interchangeably herein, refers to either The term nucleoside refers to a polymer of nucleotides of any length, including both DNA and RNA. A nucleotide is a deoxyribonucleotide, ribonucleotide, modified nucleotide or base and / or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. The polynucleotide can contain modified nucleotides, such as methylated nucleotides and their analogs. When present, modifications to the nucleotide structure can be made before or after polymer assembly. The nucleotide sequence can be interrupted by non-nucleotide components.

[0038] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acids of any length. The polymer can be linear or branched, which can contain modified amino acids and non-amino acids can be incorporated therein. The term also encompasses amino acid polymers that are modified either naturally or by intervention; for example , disulfide bond formation, glycosylation, lipid addition, acetylation, phosphorylation or any other manipulation or modification, such as complexation with a labeling component. For example, analogs of one or more amino acids (including, for example, non-natural amino acids, etc.), and polypeptides containing other modifications known in the art are also included within the definition. Since the polypeptides of the present disclosure are antibody-based, it is understood that in certain embodiments the polypeptides can occur as single-stranded or associated strands .

[0039] The term "identical" or percent "identity" in the context of two or more nucleic acids or polypeptides does not consider any conservative amino acid substitutions as part of sequence identity, but when aligned (introducing gaps as necessary) to maximize comparison and identity, Refers to two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotides or amino acid residues. Percent identity can be measured using sequence comparison software or algorithms or visually. Two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotides or amino acid residues. Percent identity can be measured using sequence comparison software or algorithms or visually. using sequence comparison software or algorithms or visually.

[0040] Various algorithms and software that can be used to obtain an alignment of amino acid or nucleotide sequences are known in the art. Various algorithms and software that can be used to obtain an alignment of amino acid or nucleotide sequences are known in the art. An non-limiting example of a sequence alignment algorithm is the algorithm described by Karlin et al., Proc. Natl. Acad. Sci .90:5873-5877(1993), modified as incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Re s.25:3389-3402(1991)), as described by Karlin et al., Proc. Natl. Acad. Sci. 87:2264-2268(1 990). In certain embodiments, Gapped BLAST can be used as described in Altsch ul et al., Nucleic Acids Res. 25:3389-3402 (1997). BLAST-2, WU-BLAST-2(Altschul et al., Methods in En zymology 266:460-480(1996)), ALIGN, ALIGN- 2(Genentech, South San Francisco, Californi ia) or Megalign(DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain embodiments, two nucleic Percent identity between oligonucleotide sequences is determined using the GAP program in the GCG software (e.g., NWSgapdna. CMP matrix and gap weights of 40, 50, 60, 70 or 90 and length weights of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, to determine the percent identity between two amino acid sequences the GAP program in the GCG software package incorporating the Needleman and Wunsch algorithm (J. Mol. Bio l. 48:444-453 (1970)) can be used (e.g., either the Blossum 62 matrix or the PAM25 0 matrix and gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights of 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example percent identity can be determined using the ALIGN program (version 2.0) with a residue table, a gap length penalty of 12 and a gap penalty of 4, and using PAM1 20. Appropriate parameters for maximum alignment by a particular alignment software can be determined by one skilled in the art. In certain embodiments, the initial setting parameters of the alignment software are used. In certain embodiments the percent identity "X" of a first amino acid sequence to a second amino acid sequence is calculated as 100x (Y / Z) where, when aligned (visually or by a particular sequence alignment program), Y is the number of matches that are identical in the alignment of the first and second sequences and Z is the total number of residues in the shorter of the two sequences when aligned by the particular alignment program. The total number of residues in the longer sequence is not used in the calculation. For example if 6 positions in the first sequence are identical to 6 positions in the second sequence (after alignment), and the second sequence is the shorter of the two sequences with 16 residues, then the percent identity is 100 x (6 / 16) = 37.5. In certain embodiments (visually or by a particular sequence alignment program), Z is the total number of residues in the shorter of the two sequences when aligned by the particular alignment program. The total number of residues in the longer sequence is not used in the calculation. For example is the number of amino acid residues scored, and Z is the total number of residues in the second sequence . When the length of the first sequence is longer than the second sequence, the percentage identity of the first sequence to the second sequence is greater than the percentage identity of the second sequence to the first sequence.

[0041] By way of non-limiting example, whether a particular polynucleotide has a particular percentage sequence identity to a reference sequence (e.g., is at least 80% identical, is at least 85% identical, is at least 90% identical, and in some embodiments, is at least 95%, 9 6%, 97%, 98% or 99% identical) can be determined in a particular embodiment using the Bestfit program (Wisconsin Sequence Analys is Package, Version 8 for Unix, Genetics C omputer Group, University Research Park, 5 75 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mat hematics 2:482 489 (1981) to find the best segment of homology between two sequences . When using Bestfit or some other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present disclosure , the parameters are set such that the percentage of identity is calculated over the entire length of the reference nucleotide sequence and gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed . . . . . .

[0042] In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, i.e., they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90 % and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity when compared and aligned using a sequence comparison algorithm or visually inspected and aligned to maximize matches. In certain embodiments, the identity is over a region of the sequence that is at least about 10, about 20, about 40 - 60 residues in length or any integer value in between, or over a region longer than 60 - 80 residues, at least about 90 - 100 residues, or the sequences are substantially identical over the entire length of the sequences being compared, such as the coding region of a nucleotide sequence.

[0043] As used herein, the term "subject" refers to any animal (e.g., a mammal) including but not limited to humans, non - human primates, rodents, etc., that is to be the recipient of a particular treatment. Generally, the terms "subject" and "patient" are used interchangeably herein with respect to human subjects.

[0044] "Tumor" and "neoplasm" refer to any mass of tissue that results from excessive cell growth or proliferation, whether benign (non - cancerous), including precancerous and epithelial lesions, or malignant (cancerous).

[0045] A physiological state in a mammal (i.e., a human) characterized by uncontrolled or unregulated cell growth or proliferation. Examples of cancers include, for example, carcinomas, lymphomas, blastomas, sarcomas, myelomas and leukemias. Non-limiting examples of cancer types that can be treated with the methods and pharmaceutical compositions of the present disclosure include esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer, colorectal cancer , skin cancer, endometrial cancer, ovarian cancer, and colorectal cancer.

[0046] In a patient, the term "recurrent" cancer refers to a patient who has previously achieved either complete or partial remission, but shows evidence of disease progression more than 6 months later.

[0047] In a patient, the term "refractory" cancer refers to a patient who has had treatment failure or whose disease has progressed within 6 months of the last anti-cancer therapy.

[0048] A tumor that "does not respond" or "responds poorly" to treatment (e.g., with a particular chemotherapy regimen) does not show a statistically significant improvement in response to the treatment compared to no treatment or placebo treatment in an approved animal model or human clinical trial, or responds to the initial treatment but grows over the course of the treatment.

[0049] The term "pharmaceutical formulation" refers to a preparation in a form such that the biological activity of the active ingredient can be made effective and that does not contain additional ingredients that are toxic to the subject to which the formulation is administered. Such a formulation can be sterile.

[0050] The term "therapeutically effective amount" refers to the amount of a therapeutic agent (e.g., a small molecule inhibitor of SETD2) that is effective to "treat" a disease or disorder in a subject or mammal. In the case of cancer, a therapeutically effective amount of an agent can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells. The term "prophylactically effective amount" refers to the dosage that achieves the desired prophylactic result and is effective over the time necessary therefor. Generally, prophylactic dosages are used in a subject before or at an earlier stage than the disease, so a prophylactically effective amount can be, but need not necessarily be, less than a therapeutically effective amount. The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments and can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells. and can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells. and can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells. and can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells. and can reduce the number of cancer cells, attenuate the growth of cancer cells, reduce the tumor size, inhibit the invasion of cancer cells into peripheral organs (i.e., retard, and in some embodiments stop), inhibit tumor metastasis (i.e., retard, and in some embodiments stop), somewhat inhibit tumor growth, and / or somewhat alleviate one or more of the symptoms associated with cancer. See the definition of "treating" in this specification. This can be cytostatic and / or cytotoxic to the extent that the agent can prevent growth and kill existing cancer cells.

[0051] The term "prophylactically effective amount" refers to the dosage that achieves the desired prophylactic result and is effective over the time necessary therefor. Generally, prophylactic dosages are used in a subject before or at an earlier stage than the disease, so a prophylactically effective amount can be, but need not necessarily be, less than a therapeutically effective amount. The term "prophylactically effective amount" refers to the dosage that achieves the desired prophylactic result and is effective over the time necessary therefor. Generally, prophylactic dosages are used in a subject before or at an earlier stage than the disease, so a prophylactically effective amount can be, but need not necessarily be, less than a therapeutically effective amount. The term "prophylactically effective amount" refers to the dosage that achieves the desired prophylactic result and is effective over the time necessary therefor. Generally, prophylactic dosages are used in a subject before or at an earlier stage than the disease, so a prophylactically effective amount can be, but need not necessarily be, less than a therapeutically effective amount. The term "prophylactically effective amount" refers to the dosage that achieves the desired prophylactic result and is effective over the time necessary therefor. Generally, prophylactic dosages are used in a subject before or at an earlier stage than the disease, so a prophylactically effective amount can be, but need not necessarily be, less than a therapeutically effective amount.

[0052] The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments The terms "treat", "treatment", "treating", "having a therapeutic effect", "alleviate", "alleviating", or "retard progression" refer to both 1) a therapeutic treatment that cures, eradicates, retards, alleviates the symptoms of, and / or stops the progression of a diagnosed pathological disorder such as cancer; and 2) a prophylactic or preventative treatment that prevents and / or delays the onset of cancer. Thus, those in need of treatment include those already having the disorder; those having a tendency to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments In the current situation, the National Cancer Institute and and the US Food and Drug Administration (FDA) Patients experience one or more of the following, each measured by a standard established by the Increased survival time, increased time to tumor progression, decreased tumor mass, decreased tumor burden and / or tumor Metastasis-free time, tumor recurrence-free time or time to progressive disease, tumor response, complete remission (C R), partial response (PR), stable disease, progression-free survival (PFS), and overall survival (OS) were When this occurs, the subject is successfully "treated" for cancer according to the methods of the present disclosure. et al., J. Clin. Oncol. 21:1404-1411 (2003). In some embodiments, a "therapeutic effect," as defined above, is a toxic or This also includes reducing adverse side effects and / or improving tolerability.

[0053] "Administering" refers to administering a pharmaceutical composition to a patient using any of a variety of methods and delivery systems known to those of skill in the art. A SETD2 inhibitor as described herein (and / or one or more additional therapeutic agents) The term refers to the physical introduction of a substance into a subject. Routes of administration include oral, mucosal, topical, intravenous, and intramuscular. Intracutaneous, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, e.g., by injection or infusion; As used herein, the phrase "parenteral administration" includes intravenous, intramuscular, , intra-arterial, intra-subarachnoid, intra-lymphatic, intralesional, intra-capsular, intra-orbital, intracardiac, intradermal, intraperitoneal, transdermal Tracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion Administration by in vivo electroporation is intended to mean modes of administration that include, but are not limited to, in vivo electroporation. Administration can be, for example, once, multiple times, and / or over one or more extended periods of time.

[0054] "Drug combinations", such as combinations of SETD2 inhibitors and one or more other therapeutic agents The term refers to the administration of these drugs to the same subject, either simultaneously, sequentially, or both simultaneously and sequentially. By way of example, administration of a SETD2 inhibitor either preceding or following (e.g., by time, day, week, or month) the administration of another therapeutic agent, by any of the same or different routes of administration, constitutes administration of a drug combination, whether the drugs are administered together in a single pharmaceutical formulation or in separate pharmaceutical formulations.

[0055] The term "attenuate or inhibit the growth of cancer cells" as used herein, when referring to one or more cells derived from mammalian (e.g., human) cancer, refers to a decrease in growth in vitro, ex vivo, or in vivo, as described herein.

[0056] Unless otherwise indicated, all numbers expressing amounts, ratios, physical properties of materials, and / or use in this disclosure are to be understood as being modified by the term "about". The term "about", when referring to a number or range of numbers, means that the recited number or range is approximate and, for example, within the variation by experiment (or within error of a statistical experiment), and thus the number or range of numbers can vary, for example, by 1% to 15% of the recited number or range of numbers.

[0057] SETD2 inhibitor The present disclosure provides an innovative treatment for subjects with cancer. Despite its known function as a tumor suppressor, the present disclosure surprisingly shows that inhibition of the histone methyltransferase, SETD2, can be used to treat cancer and particularly pancreatic cancer and esophageal cancer. ​​​​​​​​​​​ Relates to a surprising discovery that should be made.

[0058] This treatment includes administering, to a subject in need thereof, a therapeutically effective amount of an inhibitor of histone methyltransferase, SETD2, to treat cancer.

[0059] As used herein, the term "inhibitor of SETD2" or "SETD2 inhibitor" refers to any molecule or compound that modulates, e.g., down-regulates, the activity of human SETD2. For example, a SETD2 inhibitor can inhibit the histone methyltransferase activity of SETD2. For example, a SETD2 inhibitor can have a biochemical 50% inhibitory concentration (IC 50) of about 1 nM to about 10,000 nM, about 1 nM to about 1,000 nM, about 1 nM to about 5 00 nM, about 1 nM to about 100 nM, about 1 nM to about 50 nM, or about 1 nM to about 10 nM with respect to SETD2 in a purified enzyme assay. 50) and can be a compound that exhibits such an IC 50 50.

[0060] In some embodiments, "down-regulating (or inhibiting) the activity of human SETD2" refers to inhibiting the trimethylation of lysine 36 of histone 3.

[0061] In some embodiments, the SETD2 inhibitor can be, for example, a polypeptide, DNA, or RNA. The inhibitor of SETD2 can also be, for example, a molecule that specifically binds to the SETD2 polypeptide, a molecule that specifically binds to a ligand of the SETD2 polypeptide, an anti-serum that is generated against a soluble SETD2 polypeptide that comprises, consists essentially of, or consists of the extracellular domain of the SETD2 polypeptide. ​

[0062] In some embodiments, the SETD2 inhibitor is, for example, an antibody that specifically binds to the SETD2 polypeptide or an antigen-binding fragment of an antibody that specifically binds to the SETD2 polypeptide. In some embodiments, the antibody is polyclonal, monoclonal , murine, human, humanized or chimeric. Monoclonal and polyclonal anti-SETD2 antibodies are commercially available and can be purchased, for example, from Thermo Fisher Scien tific and Millipore Sigma. In some embodiments , the antigen-binding fragment is a Fab, Fab’, F(ab’)2, Fv, scFv, sdF v fragment, VH domain or VL domain.

[0063] In some embodiments, the SETD2 inhibitor hybridizes to a nucleotide sequence encoding the SETD2 polypeptide, such as RNAi, miRNA, siRN A, shRNA, antisense RNA, antisense DNA, decoy molecule, decoy DNA , double-stranded DNA, single-stranded DNA, complex DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA , a molecule capable of generating RNA interference or a combination thereof.

[0064] Downregulation of SETD2 can also be achieved by gene editing techniques. In some embodiments , the SETD2 inhibitor can be, for example, a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 system. The CRISPR-Cas9 system has been described in the literature along with its applications in cancer biology, such as Cas9 nuclease ​ and may include a single guide RNA (sgRNA). Sanchez-Rivera, F.J. and Jacks, T., "Applications of the CRIS PR-Cas9 System in Cancer Biology", Nat Re v Cancer 15:387-395 (2015); Chen, S. et al., "CRISPR-Cas9: from Genome Editing to Canc er Research", Int. J. Biol. Sci. 12:1427-1436 (2016). See, for example, an sgRNA that targets the SETD2 gene together with Cas9 nuclease can be administered to a subject, thereby causing a specific sequence deletion of the SETD2 gene that causes downregulation of SETD2 activity (i.e., inhibition of trimethylation of lysine 36 of histone H3). In particular, the SET, AWS, PS, SRI or WW domain can be targeted using CRISPR-Cas9 for deletion. Non-limiting examples of the CRISPR-Ca s9 system include sgRNA target sequence #1 having the sequence AGCACCAGTAACAGAGCCAG (SEQ ID NO: 5), sgRNA target sequence #2 having the sequence GACTGTGAACGGACAACTGA (SEQ ID NO: 6) and Cas9 mRNA. In some embodiments, the sgRNA and Cas9 mRNA can be contained in separate vectors, respectively. In some embodiments, the sgRNA can be contained in a first vector, and the Cas9 mRNA can be contained in a second vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in one vector. In some embodiments, the sgRNA and Cas9 mRNA can be contained in separate vectors, respectively. In some embodiments, the sgRNA can be contained in a first vector, and the Cas9 mRNA can be contained in a second vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in one vector. In some embodiments, the sgRNA and Cas9 mRNA can be contained in separate vectors, respectively. In some embodiments, the sgRNA can be contained in a first vector, and the Cas9 mRNA can be contained in a second vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in one vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in one vector. For administration to a subject in need, those of ordinary skill in the art know the reagents and methods for formulating the CRISPR-Cas9 system.

[0065] In addition to CRISPR-Cas9-based systems, other alternative CRISPR-based systems can be used to inhibit SETD2, such as the CRISPR / Cpf1 system of the bacterium Francisella novicida. See Zetsche,B.et al.,Cell 163:759-771(2015);Fonfara,I et al.,Nature 532:517-521(2016).

[0066] In addition to CRISPR-based systems, other gene editing technologies can also be used to inhibit SETD2, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and engineered homing meganucleases. See, for example, Maeder,M.L. and Gersbach,C.A., "Genome-editing Technologies for Gene and Cell Therapy ", Mol.Ther.24:430-446(2016);Gaj,T.et al. ", "ZFN,TALEN and CRISPR / Cas-based methods for genome engineering", Trends Biotechn ol 31:397-405(2013);Perez-Pinera,P.et al ., "Advances in targeted genome editing", Curr Opin Chem Biol 16:268-277(2012).

[0067] In some embodiments, the SETD2 inhibitor used in the methods of the present disclosure selectively targets and downregulates one or more activities of SET D2 and is a small molecule (i.e., a molecule having a molecular weight of less than about 1,500 g / mol, such as from about 100 g / mol to about 1,500 g / mol) chemical compound. In some embodiments, the small molecule inhibitor of SETD2 is a sinefungin derivative. Sinefungin is an analog of S-adenosylmethionine (SAM). In some embodiments, the sinefungin analog is an N-alkyl (methyl ethyl, propyl, benzyl) sinefungin. In some embodiments , the N-alkyl sinefungin is N-propyl sinefungin (Pr-SNF) or N- benzyl sinefungin (Bn-SNF). The synthesis of sinefungin derivatives and their inhibition profiles against human methyltransferase SETD2 are described in Zheng , W. et al., J. Am. Chem. Soc. 134:18004-18014( 2012), which is incorporated herein by reference in its entirety.

[0068] In certain embodiments, the SETD2 inhibitor is an antisense nucleic acid or oligonucleotide that is wholly or partially complementary to a target nucleic acid encoding a SETD2 polypeptide (either DNA or R NA) and can hybridize with it to form a hybrid . For example, the antisense nucleic acid or oligonucleotide can be complementary to the 5' or 3' untranslated region, or can overlap with the translation initiation codon (5' untranslated and translation regions) of at least one nucleic acid molecule encoding SETD2. By way of non-limiting example, the antisense oligonucleotide can be in the following regions ​: mRNA cap region, translation start site; translation termination site; transcription start site; transcription termination site; Polyadenylation signal; 3' untranslated region; 5' untranslated region; 5' coding region, mid co -d region; 3' coding region: Targets the DNA replication initiation and elongation sites and can hybridize with them.

[0069] In some embodiments, an oligonucleotide that binds to a double-stranded nucleic acid (i.e., DNA:DNA or DNA:R NA) to form a stable triple helix or triple-stranded nucleic acid can be constructed. Such a triple-stranded oligonucleotide can inhibit the transcription and / or expression of the nucleic acid encoding SETD2. Using the base pairing rules for triple helix formation, a triple-stranded oligonucleotide is constructed.

[0070] In yet further embodiments, oligonucleotides containing moieties with non-natural moieties can be used in the method. Thus, the oligonucleotide can have a modified sugar moiety or sugar-sugar linkage. Representative among these are phosphorothioates and other sulfur-containing species known in the art. In a preferred embodiment, at least one of the phosphodiester linkages of the oligonucleotide is replaced with a structure that functions to promote the ability of the composition to penetrate into the region of the cell where the RNA to be modulated is localized. Such substitutions preferably include phosphorothioate linkages, methyl phosphate linkages, or short-chain alkyl or cycloalkyl structures.

[0071] In other embodiments, the phosphodiester bond is replaced with a structure that is simultaneously substantially non-ionic and non-chiral, or with a structure that is chiral and enantiomerically specific. ​​ One of ordinary skill in the art can select other linkages for use in the disclosed methods, including reverse terminal nucleotides. Oligonucleotides can also include species containing at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature can be used as such. Similarly, modifications on the furanosyl moiety of the nucleotide subunit can also be affected. Examples of such modifications are 2'-O-alkyl- and 2'-halogen-substituted nucleotides. Some non-limiting examples of modifications at the 2'-position of the sugar moiety include OH, SH, SCH3, F, OCH3, OCN, O(CH2), NH2, and O(CH2)nCH3, where n is from 1 to about 10. Such oligonucleotides can function equivalently with natural oligonucleotides or synthetic oligonucleotides that have one or more differences from the natural structure. All such analogs are encompassed herein as long as they effectively function to hybridize with at least one nucleic acid molecule encoding SETD2 such that they do not inhibit its function. Alternatively, for delivery of the nucleotide sequence to the target organ, tissue, or cell population, expression vectors derived from retroviruses, adenoviruses, herpes, or vaccinia viruses or various bacterial plasmids can be used. Methods well known to those of ordinary skill in the art can be used to construct recombinant vectors that express nucleic acid sequences complementary to the nucleic acid sequence encoding the human SETD2 polypeptide.

[0072] RNA interference (RNAi) can be mediated by miRNA or dsRNA (small interfering RNA; siRNA).

[0073] ​​​​​A post-transcriptional gene silencing process induced by (A), which is used to regulate gene expression. It is used for this purpose. RNAi is described herein for inhibiting SETD2. It can be used in the treatment methods described herein. Generally, RNAi is performed by contacting cells with double-stranded siRNA or low-molecular-weight hairpin RNA (shRNA). However, manipulation of RNA outside the cell is cumbersome due to the sensitivity of RNA to degradation. Therefore, small interfering RNA (siRNA) molecules containing one strand of the siRNA to be used or DNA compositions encoding intermediate siRNA molecules (such as shRNA) are also included herein. Accordingly, the present application provides an isolated DNA molecule, which, when it is a component of siRNA, contains an expressible template nucleotide sequence of at least about 16 nucleotides encoding an intermediate siRNA that mediates RNA interference (RNAi) of the target RNA. The present application further relates to the use of RNA interference (RNAi) to regulate the expression of nucleic acid molecules encoding SETD2 in target cells. While the therapeutic application is not limited to a specific mode of action, RNAi can involve the degradation of messenger RNA (e.g., the mRNA of the SETD2 gene) by the RNA-induced silencing complex (RISC), which blocks the translation of the transcribed target mRNA. Alternatively, this can also involve the methylation of genomic DNA that blocks the transcription of the targeted gene. The suppression of gene expression caused by RNAi can be transient or it can be more stable or even permanent. "Small interfering RNA" (siRNA) can also be used in this method as a SETD2 inhibitor. On the other hand, RNAi can involve the degradation of messenger RNA (e.g., the mRNA of the SETD2 gene) by the RNA-induced silencing complex (RISC), which blocks the translation of the transcribed target mRNA. Alternatively, this can also involve the methylation of genomic DNA that blocks the transcription of the targeted gene. The suppression of gene expression caused by RNAi can be transient or it can be more stable or even permanent. The suppression of gene expression caused by RNAi can be transient or it can be more stable or even permanent.

[0074] "Small interfering RNA" (siRNA) can also be used in this method as a SETD2 inhibitor. . siRNA refers to any nucleic acid molecule that can mediate RNA interference (RNAi) or gene silencing. For example, siRNA is a double-stranded RNA molecule about 10 to about 30 nucleotides in length, named for their ability to specifically interfere with protein expression (e.g., SETD2 protein expression). In certain embodiments, the siRNA of the present disclosure is 12-28 nucleotides in length, more preferably 15-25 nucleotides in length, even more preferably 19-23 nucleotides in length, and most preferably 21-23 nucleotides in length. Thus, preferred siRNAs are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 nucleotides in length. As used in this specification, siRNA molecules need not be limited to molecules containing only RNA, but may further include chemically modified nucleotides and non-nucleotides. siRNA can be designed to reduce the expression of SETD2 in target cells by RNA interference. The siRNA can include a sense region and an antisense region, where the antisense region includes a sequence complementary to the mRNA sequence for the nucleic acid molecule encoding SETD2, and the sense region includes a sequence complementary to the antisense sequence of the mRNA of this gene. The siRNA molecule can be assembled from two nucleic acid fragments, one fragment containing the sense region and the second fragment containing the antisense region of the siRNA molecule. The sense region and the antisense region can also be covalently linked via a linker molecule. The linker molecule can be a polynucleotide linker or a non-polynucleotide linker. For example, siRNA is named for their ability to specifically interfere with protein expression (e.g., SETD2 protein expression). It can be a double-stranded RNA molecule about 10 to about 30 nucleotides in length. In certain embodiments, the siRNA of the present disclosure is 12-28 nucleotides in length, more preferably 15-25 nucleotides in length, even more preferably 19-23 nucleotides in length, and most preferably 21-23 nucleotides in length. Thus, preferred siRNAs are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 nucleotides in length. As used in this specification, siRNA molecules need not be limited to molecules containing only RNA, but may further include chemically modified nucleotides and non-nucleotides. siRNA can be designed to reduce the expression of SETD2 in target cells by RNA interference. The siRNA can include a sense region and an antisense region, where the antisense region includes a sequence complementary to the mRNA sequence for the nucleic acid molecule encoding SETD2, and the sense region includes a sequence complementary to the antisense sequence of the mRNA of this gene. The siRNA molecule can be assembled from two nucleic acid fragments, one fragment containing the sense region and the second fragment containing the antisense region of the siRNA molecule. The sense region and the antisense region can also be covalently linked via a linker molecule. The linker molecule can be

[0075] In certain embodiments, the SETD2 inhibitor is a human SETD2 siRNA selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. UAAAGGAGGUAUAUCGAAU (SEQ ID NO:1) GAGAGGUACUCGAUCAUAA (SEQ ID NO:2) GCUCAGAGUUAACGUUUGA (SEQ ID NO:3) CCAAAGAUUCAGACAUAUA (SEQ ID NO:4)

[0076] A ribozyme (also called ribonucleic acid enzyme, RNA enzyme, or catalytic RNA) is an RNA molecule that catalyzes a chemical reaction. Some ribozymes can play important roles as therapeutic agents, as enzymes that target defined RNA sequences, as biosensors, and for applications in functional genomics and gene discovery. Ribozymes can be genetically engineered to specifically cleave transcripts of genes from nucleic acid molecules encoding SETD2 where down-regulation of expression is desired.

[0077] (Partially or fully encoding sequences that reduce SETD2 expression) Delivery of genes or genetic materials into cells is the first step in any genetic therapy treatment of disorders. A number of delivery methods are well known to those of skill in the art. Preferably, the nucleic acid is administered for use in in vivo or ex vivo gene therapy. Non-viral vector delivery systems include nucleic acids complexed with delivery vehicles such as DNA plasmids, naked nucleic acids, and liposomes. Viral vector delivery systems include DNA and RNA viruses, which can have either episomal or integrated genomes after delivery into cells.

[0078] The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues.

[0079] In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid. The use of virus-based systems based on RNA or DNA for nucleic acid delivery exploits highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. A viral vector can be administered directly to a patient (in vivo) or used to treat cells and modified cells in vitro and then administered to a patient (ex vivo). Conventional virus-based systems for nucleic acid delivery can include retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues. In applications where transient expression of nucleic acid is preferred, adenovirus-based systems are commonly used. Adenovirus-based vectors enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors are also used for in vitro production of, for example, nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures to transduce cells with a target nucleic acid.

[0080] Recombinant adeno-associated virus vector (rAAV) is a defective and non-pathogenic parvovirus -based promising alternative gene delivery system. All vectors are derived from plasmids that retain only the AAV 145 bp inverted terminal repeats adjacent to the transgene expression cassette. Efficient gene transfer into the genome of the transduced cells and stable transgene delivery are important properties of this vector system.

[0081] Replication-defective recombinant adenovirus vectors (Ad) are mainly used in transient expression gene therapy because they can be produced at high titers and easily infect many different cell types. Most adenovirus vectors replace the Ad E1a, E1b and E3 genes; subsequently, the replication-defective vectors are modified to be propagated in human 293 cells that trans-complement the defective gene functions. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing differentiated cells such as those found in the liver, kidney and muscle tissues. Conventional Ad vectors have a large carrying capacity.

[0082] In many gene therapy applications, it is desired that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type, such as gli al cells. Virus vectors are generally engineered to have specificity for certain cell types by expressing a ligand as a fusion protein with the viral coat protein on the outer surface of the virus. The ligand is selected to have an affinity for a receptor known to be present on the cell type of interest. ​​​​​

[0083] By administration to an individual subject, generally by systemic administration (e.g., intravenous, intratumoral, intraperitoneal, intramuscular, subcutaneous or intracranial infusion) or by topical application, a gene therapy vector can be delivered in vivo. Alternatively, the vector can be delivered ex vivo to cells explanted from individual patients (e.g., lymphocytes, bone marrow aspirates and tissue biopsies) or universal donor hematopoietic stem cells, etc., delivered to the cells, and subsequently, usually after selection for cells incorporating the vector, the cells can be retransplanted into the subject.

[0084] In certain embodiments, stem cells are used in ex vivo procedures for gene transfer and gene therapy of cells. Advantages of using stem cells include the ability to differentiate them in vitro into other cell types or the ability to engraft them in a mammal (such as the donor of the cells) at an appropriate location (such as the bone marrow). For example, methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such as GM-CSF, IFN-γ and TNF-α are known.

[0085] Stem cells are isolated for transduction and differentiation using known methods. For example, unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (pan B cells), GR-1 (granulocytes) and lad (differentiated antigen-presenting cells), etc., to bind antibodies to bone marrow cells By panning, stem cells can be isolated from bone marrow cells.

[0086] Administration of SETD2 inhibitors Suitable methods of administering the SETD2 inhibitors described herein are inhibitors (i.e., low molecular weight based on the properties of (substances, DNA, RNA, proteins, antibodies), and are well-known to those skilled in the art and are known to those skilled in the art. The SETD2 inhibitors described herein can be administered orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, transdermally, intrathecal, intranasally, transmucosally, intratumorally, rectally, intravaginally or buccally, or by inhalation. For example, intravenous injection such as infusion, intramuscular injection, intraperitoneal injection, subcutaneous injection, suppositories, intestinal lavage, oral enteric-coated agents can be selected, and depending on the need and depending on the age and condition of the patient, the method of administration can be selected. The SETD2 inhibitors described herein can be administered systemically (e.g., by intravenous injection) or locally (e.g., intrathecally,

[0087] intratumorally or into lymph nodes). An appropriate dosage of the SETD2 inhibitors of the present disclosure depends on, for example, the judgment of the treating physician, and factors such as the type of cancer to be treated, the severity, course and stage of the cancer, the responsiveness of the cancer, previous treatments, the patient's clinical history, etc. In some embodiments, the dosage of the SETD2 inhibitor is about 0.01 mg / kg to about 1000 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is about 1 mg / kg to about 500 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is about 0.1 mg / day to about 50 g / day; about 0.1 mg / day to about 25 g / day; about 0.1 mg / day to about 10 g / day; about 0.1 mg / day to about 3 g / day; or about 0.1 mg / day to about 1 g / day. Alternatively, the dosage of the SETD2 inhibitor is in the range of 1 to 2000 mg and preferably 100 to 1000 mg / patient.

[0088] In some embodiments, the SETD2 inhibitor is administered once or in a series that lasts for several days to several months or until a cure is achieved, or until a reduction in the disease state (e.g., tumor size) is achieved. The drug may be administered until a reduction in the level of

[0089] In some embodiments, the SETD2 inhibitors described herein are administered daily, weekly, or in combination with other In certain embodiments, the SETD2 inhibitor may be administered once or more than once a month or year. The drug is administered once every day, once every two days, once every three days, or once every four days. In certain embodiments, the SETD2 inhibitor is administered twice daily, three times daily, or four times daily. In certain embodiments, the SETD2 inhibitor is given once a week. The TD2 inhibitor is given once every two weeks. In certain embodiments, the SETD2 inhibitor is In some embodiments, the SETD2 inhibitor is administered once every 4 weeks. In some embodiments, the SETD2 inhibitor is administered once a month. do.

[0090] In some embodiments, the SETD2 inhibitors described herein initially induce a higher In some embodiments, a low "loading" dose may be administered, followed by one or more lower doses. In some embodiments, the frequency of administration may also be varied. An initial dose is administered, followed by twice daily, once daily, once every other day, once every third day, or every third day. Or, a further dose (or "maintenance" dose) may be administered once a week. An initial loading dose is administered, followed by daily maintenance doses, e.g., half the initial dose. Alternatively, the dosing regimen may include administering an initial loading dose followed by, for example, The dosing regimen may include administering a maintenance dose of half the initial dose every other day. Administer the first dose three times over a three-day period, followed by, for example, the same maintenance dose every other day which may be included.

[0091] One of ordinary skill in the art will, depending on the circumstances of the particular subject being treated, consider factors such as the recipient's age, sex , health and weight, the condition or disorder to be treated, the severity of the disorder, the type of concomitant treatment and if any the nature of the desired effect, etc., and recognize that the dosage, route of administration and frequency of administration will vary.

[0092] One of ordinary skill in the art will recognize that during a series of treatments, or during different phases (i.e., treatment or maintenance) of treatment, the dosage and / or frequency of administration of the SETD2 inhibitor may vary (increase or decrease), depending on the patient's clinical response, side effects, etc.

[0093] Pharmaceutical composition The SETD2 inhibitor used in the methods described herein can be formulated into a pharmaceutical composition suitable for administration to a subject in need thereof (i.e., a subject suffering from cancer). As used herein, "pharmaceutical composition" refers to a preparation of one or more agents (e.g., a SETD2 inhibitor or a SETD2 inhibitor in combination with one or more other therapeutic agents) or a physiologically acceptable salt or prodrug thereof, as described herein, with other chemical components including, but not limited to, pharmaceutically acceptable carriers, excipients, lubricants, buffers, antimicrobial agents, bulking agents (e.g., mannitol), antioxidants (e.g., ascorbic acid or sodium bisulfite ). The purpose of the pharmaceutical composition is to facilitate the administration of the agent to the subject. "Pharmaceutically acceptable carrier", "excipient" and "adjuvant" and "physiologically acceptable salt" or "prodrug" are used interchangeably herein to refer to a preparation of one or more agents (e.g., a SETD2 inhibitor or a SETD2 inhibitor in combination with one or more other therapeutic agents) or a physiologically acceptable salt or prodrug thereof, as described herein, with other chemical components including, but not limited to, pharmaceutically acceptable carriers, excipients, lubricants, buffers, antimicrobial agents, bulking agents (e.g., mannitol), antioxidants (e.g., ascorbic acid or sodium bisulfite ). The purpose of the pharmaceutical composition is to facilitate the administration of the agent to the subject.

[0094] "Pharmaceutically acceptable carrier", "excipient" and "adjuvant" and "physiologically acceptable Terms such as "possible vehicle" can be administered to a patient together with the SETD2 inhibitor described in this specification, and are to be understood to refer to acceptable carriers or adjuvants that do not destroy or inhibit its pharmacological activity. As used herein, pharmaceutically acceptable excipients, when appropriate for the particular dosage form desired, include any solvent, dispersion medium, or other liquid vehicle, dispersion or suspension aids, diluents, granulating and / or dispersing agents, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oils, coloring agents, sweetening or flavoring agents, stabilizing agents, antioxidants, antimicrobial or antifungal agents, osmotic pressure regulators, pH regulators, buffers, chelating agents, cryoprotectants and / or bulking agents, among others, but are not limited thereto. The various excipients for formulating pharmaceutical compositions and the techniques for preparing such compositions are well known in the art (Remington: The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety)). acceptable carriers or adjuvants that do not destroy or inhibit its pharmacological activity. When used herein, pharmaceutically acceptable excipients include, when appropriate for the particular dosage form desired, any solvent, dispersion medium, or other liquid vehicle dispersion or suspension aids, diluents, granulating and / or dispersing agents, surfactants, isotonic agents , thickening or emulsifying agents, preservatives, binders, lubricants or oils, coloring agents, sweetening or flavoring agents, stabilizing agents, antioxidants, antimicrobial or antifungal agents, osmotic pressure regulators, pH regulators, buffers, chelating agents, cryoprotectants and / or bulking agents, among others, but are not limited thereto. The various excipients for formulating pharmaceutical compositions and the techniques for preparing such compositions are well known in the art (Remington: The Science and Practice of Pharmacy, 21 st Edition, A.R st Gennaro (Lippincott, Williams & Wilkins, B altimore, MD, 2006; incorporated herein by reference in its entirety into this specification). ).

[0095] Representative diluents include calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose , kaolin, mannitol, sorbitol, and the like and / or combinations thereof, among others, but are not limited thereto. .

[0096] Representative granulating and / or dispersing agents include starch, pregelatinized starch or microcrystalline ​Starch, alginic acid, guar gum, agar, poly(vinyl-pyrrolidone), (provid ne), cross-linked poly(vinyl-pyrrolidone) (crospovidone), cellulose, methylcell ulose, carboxymethylcellulose, cross-linked carboxymethylcellulose sodium (cro scarmellose), magnesium aluminum silicate (VEEGUM (registered trademark)), la uryl sodium sulfate, etc. and / or combinations thereof are included but not limited to.

[0097] Typical surfactants and / or emulsifiers include natural emulsifiers (e.g., acacia, aga r, alginic acid, sodium alginate, tragacanth, condru x, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, lanolin, chole sterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxy ethylene sorbitan monooleate [TWEEN (registered trademark) 80], sorbitan monopa lmitate [SPAN (registered trademark) 40], glyceryl monooleate, polyoxyeth ylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR (reg istered trademark)), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ (registered trademark) 30]), PLUORINC (registered trademark) F68, POLOXA MER (registered trademark) 188, etc. and / or combinations thereof are included but not limited to.

[0098] Typical binders include starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol) , amino acids (such as glycine), natural and synthetic rubbers (such as acacia, sodium alginate), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, etc. and combinations thereof are included but not limited to. um), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose etc. and combinations thereof are included but not limited to.

[0099] Representative antioxidants include alpha-tocopherol, ascorbic acid, acorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc. and combinations thereof are included but not limited to. lumitate (acorbyl palmitate), benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, mono thioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc. and combinations thereof are included but not limited to. thioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc. and combinations thereof are included but not limited to. pyll, sodium ascorbate, etc. and combinations thereof are included but not limited to. not.

[0100] Representative chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc. and combinations thereof are included but not limited to. hydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc. and combinations thereof are included but not limited to. stone acid, trisodium edetate, etc. and combinations thereof are included but not limited to.

[0101] Representative antibacterial or antifungal agents include benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxy benzoic acid, potassium or sodium benzoate, potassium or sodium sorbate sodium propionate, sorbic acid, etc. and combinations thereof are included but limited not.

[0102] Representative preservatives include vitamin A, vitamin C, vitamin E, beta-carotene, Citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, lauryl Sodium Lauryl Sulfate (SLS), Sodium Lauryl Ether Sulfate (SLES), etc. Combinations of these include, but are not limited to,

[0103] Representative buffer solutions for adjusting pH include sodium phosphate, sodium citrate, , sodium succinate, histidine (or histidine-HCl), sodium malate , sodium carbonate, and the like and / or combinations thereof.

[0104] Representative lubricants include magnesium stearate, calcium stearate, and stearate. Allyl acid, silica, talc, malt, hydrogenated vegetable oil, polyethylene glycol, benzoic acid sodium, sodium or magnesium lauryl sulfate, and combinations thereof. This can be, but is not limited to:

[0105] The pharmaceutical compositions or formulations described herein may be frozen to remove the polynucleotides described herein. A cryoprotectant may be included to stabilize the optide. Exemplary cryoprotectants include: Mannitol, sucrose, trehalose, lactose, glycerol, dextrose and the like, and combinations thereof, but are not limited to these.

[0106] Administration of a SETD2 inhibitor of the present disclosure introduces the molecule into ultimate contact with tumor cells. The pharmaceutical composition comprising a SETD2 inhibitor is preferably administered via any of the routes commonly used for the treatment of inflammatory bowel disease. , by any suitable method, e.g., parenterally, intracerebroventricularly, orally, topically, rectally, vaginally, nasally, buccally, or via an implanted reservoir. The term "parenteral" includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, hepatic in, intralesional and intracranial injection or infusion techniques.

[0107] Parenteral formulations can be single bolus administration, infusion, or loading bolus administration followed by maintenance dosing. These compositions can be administered at specific fixed or variable intervals, such as twice a week or once a week. In some embodiments, the SETD2 inhibitor is administered intravenously administered.

[0108] In certain embodiments, the pharmaceutical composition can be administered orally in an acceptable dosage form, such as capsules, tablets, aqueous suspensions or solutions. In certain embodiments, the pharmaceutical composition can also be administered by nasal aerosol or inhalation. Such compositions can be prepared as solutions in saline, with benzyl alcohol or other suitable preservatives, absorption enhancers to facilitate bioavailability and / or other conventional solubilizing or dispersing agents used. obtained.

[0109] One of ordinary skill in the art will recognize that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the particular therapeutic agent being used, the age, weight, general health, sex and diet of the patient, and the time of administration, excretion rate, drug combination, and the severity of the particular disease being treated. The determination of such factors by a medical practitioner is within the ordinary skill of the art within. This amount will also depend on the individual patient to be treated, the route of administration, the type of formulation, the characteristics of the compound being used, the severity of the disease and the desired effect. The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art recognized. This amount will also depend on the individual patient to be treated, the route of administration, the type of formulation, the characteristics of the compound being used, the severity of the disease and the desired effect. The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art recognized. obtained.

[0110] In some embodiments, the SETD2 inhibitors as described herein are administered in combination with one or more additional therapeutic agents and / or therapeutic procedures. In some embodiments, the SETD2 inhibitors as described herein can be co-formulated with and / or co-administered with one or more additional therapeutic agents. In some embodiments, the methods described herein further comprise administering at least one additional therapeutic agent to a subject.

[0111] Methods of treating cancer In one aspect, the present disclosure provides a method of treating cancer or delaying its progression in a subject in need thereof by administering a therapeutically effective amount of a SETD2 inhibitor, such as those described above, to the subject.

[0112] Many types of cancer can be treated by the disclosed methods and pharmaceutical compositions. In some embodiments, the cancer is adrenocortical carcinoma, alveolar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, apocrine adenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenomatoid odontogenic tumor, adenosquamous carcinoma, adipose tissue neoplasm, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft part sarcoma, ameloblastic fibro-odontoma, anaplastic large cell lymphoma, anaplastic thyroid carcinoma, angio-myolipoma, angiosarcoma, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, carcinoma, carcinoma in situ, carcinosarcoma, chondroma, cementoma, chordoma, choriocarcinoma, choroid plexus papilloma, clear cell sarcoma of the kidney, craniopharyngioma, cutaneous T cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, embryonal dysplastic neuroepithelial tumor, undifferentiated ​​​​​​​​​​​​​​​Embryonal cell tumor, embryonal carcinoma, endocrine gland neoplasm, yolk sac tumor, esophageal cancer, fibrosarcoma, follicular lymphoma Follicular lymphoma, follicular thyroid cancer, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma, giant cell fibroblastoma Giant cell tumor of bone, glioma, glioblastoma, glioma, cerebral gliosis, glucagon-producing tumor, gonadoblastoma, granulosa cell tumor, gynandroblastoma, gallbladder cancer, gastric cancer, hemangioblastoma Head and neck cancer, hemangiopericytoma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, infiltrating lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, malignant melanoma, lethal midline carcinoma, leukemia, Leydig cell tumor Lipoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer Non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant Triton tumor, mediastinal germ cell tumor, medullary carcinoma of breast, medullary thyroid cancer, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma Mesothelioma, metastatic urothelial carcinoma, Müllerian duct mixed tumor, mucinous tumor, muscle tissue neoplasm, myxoid polypoid tumor, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal cancer, neuroma, neuroblastoma, neurofibroma Neuroma, nodular melanoma, ocular cancer, oligodendroglioma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, optic nerve tumor, oral cancer, osteosarcoma, ovarian cancer, papillary thyroid cancer, paraganglioma Pineoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasmacytoma, polyembryoma, primary central nervous system lymphoma, primary effusion lymphoma, primary peritoneal cancer Prostate cancer, pancreatic cancer, pharyngeal cancer, peritoneal pseudomyxoma, renal cell carcinoma, renal medullary carcinoma, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannomatosis Seminoma, Sertoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatin-producing tumor, spinal tumor, squamous cell carcinoma Synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular tumor, thyroid cancer, transitional cell carcinoma, pharynx ​​​​​​​ Laryngeal cancer, cloacogenic carcinoma, urogenital cancer, urothelial cancer, choroidal melanoma, uterine cancer, verrucous carcinoma, optic pathway glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, squamous cell carcinoma of the head and neck, esoph ageal adenocarcinoma squamous cell c arcinoma of the esophagus), gastric adenocarcinoma, colonic adenocarcinoma, hepatocellular carcinoma, cholangiocarcinoma of the biliary tract, gallbladder adenocarcinoma, pancreatic adenocarcinoma, intraductal epitheli al carcinoma in situ of the breast, breast adenocarcinoma, lung adenocarcinoma, lung squamous cell carcinoma, transitional cell carcinoma of the bladder, squamous cell carcinoma of the bladder, squamous cell carcinoma of the cervix, adenocarcinoma of the cervix, endometrial cancer, penile squamous cell carcinoma, and squamous cell carcinoma of the skin, and is selected from the

[0113] In some embodiments, the cancer is esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, or colorectal cancer.

[0114] In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is esophageal cancer.

[0115] In some embodiments, the cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell Diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroid leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma, which is a blood cancer selected from the group consisting of.

[0116] In some embodiments, the blood cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL) including extranodal and nodular MZL, hairy cell leukemia (HCL), Burkitt lymphoma (BL), and Richter transformation, which is selected from the group consisting of.

[0117] In some embodiments, the cancer is refractory to conventional chemotherapy.

[0118] In some embodiments, the cancer has recurred.

[0119] The SETD2 inhibitor (alone or in combination with one or more additional therapeutic agents or procedures) used in the methods described herein is in any order or The doses may be administered at any interval.

[0120] In some embodiments, treatment with the methods described herein is indefinite (i.e. In some embodiments, the methods described herein may be continued (i.e., as maintenance therapy). Treatment with is for up to about 18 weeks, up to about 17 weeks, up to about 16 weeks, up to about 15 weeks, It may last for up to about 14 weeks, up to about 13 weeks, or up to about 12 weeks. In embodiments, the treatment may last for about 12 weeks. The treatment by the method described above may be continued for about 1 week to about 52 weeks, about 1 week to about 26 weeks, or about 1 week ~ about 12 weeks, ~ about 1 week ~ about 6 weeks, ~ about 6 weeks ~ about 52 weeks, ~ about 6 weeks ~ about 26 weeks, or In some embodiments, the methods described herein may last from about 12 weeks to about 52 weeks. Treatment with the method may last for more than 52 weeks.

[0121] This invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all patent and non-patent references cited throughout this application are incorporated herein by reference in their entirety. and are expressly incorporated herein by reference. EXAMPLES

[0122] Example 1 Pancreatic ductal adenocarcinoma (PDAC) cell lines depend on SETD2 for proliferation CRISPR pooled screening. 249 cancer cell lines and non-transformed MCF10 A cell line (control) was treated with CRISPR-s targeting different genes, including human SETD2. The cell lines were infected with pooled lentiviruses containing the gRNA library. The cells were obtained from the TCC, DSMZ or JCRB cell banks. Each bar represents a cell line. The LogP score on the Y-axis of the graph represents the depletion of a specific target from the population. Therefore, the LogP score indicates the dependency of each cell line on a specific gene. In this case, each cell line with a LogP score below -2.5 was dependent on SETD2 for survival. Table 1 gives all the cell lines and their mean LogP and median fold change values.

[0123] Figure 1A shows a plot for all 250 cell lines tested. Figure 1B shows a plot for cell lines derived from pancreatic ductal adenocarcinoma (PDAC). Notably, Figure 1B shows that some pancreatic cancer cell lines had a significantly high sensitivity to depletion of the SETD2 gene.

[0124] In addition to revealing that cell lines derived from pancreatic cancer were sensitive to SETD2 depletion, Figure 1A shows that additional cancer cell lines sensitive to SETD2 depletion included breast, esophageal, kidney, lung, stomach, bladder / urinary tract, endometrial, skin, hematopoietic (DLBCL and AML), soft tissue, CNS, and ovarian cell lines.

[0125]

Table 1

[0126]

Table 2

[0127]

Table 3

[0128]

Table 4

[0129]

Table 5

[0130]

Table 6

[0131] Verification of CRISPR pooled screening. SU8686 is a cell line derived from pancreatic ductal adenocarcinoma and has. A CRISPR virus containing a dual sgRNA targeting two sites of SETD2 was infected into the cell line and the growth of the cell line was measured over time by automated cell counting . As shown in Figure 2B, combinations of sgRNAs containing one or both of the two sgRNAs targeting the active site of SETD2 were found to have a dramatic effect on the growth of this pancreatic cancer cell line . In contrast, the negative control, sgRNA targeting SMARCA2 had no effect on growth

[0132] Next, next-generation sequencing (NGS ) of the sgRNA cleavage sites shown in Figures 2C and 2D was used to confirm the growth data in Figure 2B. The bar graphs in Figures 2C and 2D show the genotypes of the cells that survived the infection over time

Number

Number

[0133] esophageal cell line showed a very strong depletion signal from the SET domain and the "SET-associated" (AWS) domain of SETD2 (shown in Figure 3A), indicating that targeting the SET domain / active site of SETD2 with, for example, a small molecule inhibitor results in a growth phenotype (i.e., reduced proliferation) in this cell line.

[0134]

[0135] ​​​​​​​​​​​ Summary of dual assay target validation. A summary of the target validation tests is provided in the table of Figure 4. The results of the CRISPR pooled screening against the selected cell lines are shown in the "Epi pool column". The results of the domain-specific CRISPR pooled screening are shown in the "Epidomain in pool column". From these results, it is shown that the SET domain of SETD2 is required for the effect. Validation of the results of the CRISPR pooled screening in cell lines by dual sgRNA CRISPR assay (Figure 2B) and NGS confirmation (as shown in Figures 2C and 2D) is shown in the "Proliferation" and "NGS" columns of Figure 4. .

Number

Number

[0136] Conclusion: Based on the dual signal RNA (sgRNA) assay, pancreatic cancer cell lines, SU86 86 and several other cancer-derived cell lines, such as those from breast, ovary, lung, stomach, kidney, esophagus, bladder , CNS, soft tissue and skin, etc., are dependent on SETD 2 activity and particularly the SET domain for their viability and growth. Therefore, inhibiting the histone methyltransferase SETD2 (with small molecule inhibitors such as alkyl-sinefungin, etc.) has a wide-ranging impact on the treatment of many cancers and particularly pancreatic cancer.

[0137] The present invention utilizes functional components that exemplify the execution of specific functions and their relationships, as described above herein. The boundaries of these functional components are arbitrarily defined herein for the convenience of the description. As long as the specific functions and their relationships are properly implemented, alternative boundaries (alternate boundaries) may also be defined. (alternate boundaries) may also be defined.

[0138] The foregoing description of specific embodiments enables others, applying knowledge within the skill of the art, to make various adaptations and / or modifications to such specific embodiments without undue experimentation and without departing from the general concept of the present invention, so as to fully clarify the generality of the present invention for various applications. Accordingly, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed embodiments based on the teachings and advice presented herein. It is to be understood that the terminology or phraseology herein is for explanatory purposes and not limiting, as would be understood by one of ordinary skill in the art in light of the teachings and advice presented herein. All patents and publications referred to herein are indicative of the level of those of ordinary skill in the art to which the present disclosure pertains. All patents and publications are hereby incorporated by reference into this specification to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference herein. The terminology or phraseology of this application is to be interpreted by one of ordinary skill in the art in light of the teachings and advice, and it is to be understood that the terminology or phraseology herein is for explanatory purposes and not limiting as would be understood by one of ordinary skill in the art in light of the teachings and advice presented herein.

[0139] All patents and publications referred to in this application are indicative of the level of those of ordinary skill in the art to which the present disclosure pertains. All patents and publications are hereby incorporated by reference into this specification to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference herein. herein.

Claims

1. administering to a subject in need of treatment for cancer a therapeutically effective amount of a SETD2 inhibitor; A method for treating cancer.

2. (i) contacting a cancer cell with an effective amount of a SETD2 inhibitor; and (ii) reducing proliferation of said cancer cell.

23. A method of attenuating or inhibiting the proliferation of cancer cells, comprising attenuating or inhibiting the proliferation of cancer cells.

3. The SETD2 inhibitor is selected from the group consisting of a polypeptide, DNA, and RNA. The method according to claim 1 or 2.

4. The SETD2 inhibitor comprises: (i) an isolated binding molecule that specifically binds to a SETD2 polypeptide; (ii) an isolated binding molecule that specifically binds to a ligand of a SETD2 polypeptide; or or (iii) an antiserum raised against a SETD2 polypeptide, 2. The method according to claim 1.

5. The inhibitor is an antibody or an antigen binding of an antibody that specifically binds to a SETD2 polypeptide. The method according to any one of claims 1 to 4, wherein the nucleic acid sequence is a fragment.

6. The antibody may be a polyclonal, monoclonal, murine, human, humanized or chimeric antibody. The method according to claim 5, wherein

7. The antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv, sdFv, The method of claim 5, wherein the polypeptide is a fragment, a VH domain or a VL domain.

8. The SETD2 inhibitor inhibits SETD2 under stringent conditions or a gene editing system. Hybridizing with a nucleotide sequence encoding a polypeptide, RNAi, miR NA, siRNA, shRNA, antisense RNA, antisense DNA, decoy molecule , decoy DNA, double-stranded DNA, single-stranded DNA, complexed DNA, encapsulated DNA, virus DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA , double-stranded RNA, a molecule capable of generating RNA interference, or a combination thereof.

4. The method according to any one of claims 1 to 3.

9. The SETD2 inhibitor is an siRNA selected from the group consisting of SEQ ID NOs: 1 to 4. The method according to claim 8.

10. 9. The method of claim 8, wherein the gene editing system is CRISPR / Cas9.

11. The method according to any one of claims 1 to 3, wherein the SETD2 inhibitor is a small molecule compound. 。

12. The low molecular weight compound is selected from N-propyl sinefungin and N-benzyl sinefungin. The method of claim 11, wherein the sinefungin derivative is selected from the group consisting of:

13. The cancer or cancer cells are adrenal cancer, acinic cell carcinoma, acoustic neuroma, acral lentigo melanoma, acral sweat gland cancer, Adenoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenomatous odontogenic tumor, adenosquamous carcinoma, adipose tissue neoplasm, adenocarcinoma Renal cortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft part sarcoma, enamel epithelium fibroblasts tumor, anaplastic large cell lymphoma, anaplastic thyroid cancer, angiomyolipoma, angiosarcoma, astrocytoma, non- Typical teratoid rhabdoid tumor, basal cell carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain Cancer, carcinoma, carcinoma in situ, carcinosarcoma, cartilage tumor, cementoma, myelosarcoma, chondroma, chordoma , choriocarcinoma, choroid plexus papilloma, clear cell sarcoma of the kidney, craniopharyngioma, cutaneous T-cell lymphoma, cervical Cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, dysembryoplastic neuroepithelial tumor, undifferentiated Germ cell tumors, embryonal carcinomas, endocrine neoplasms, yolk sac tumors, esophageal cancer, fibrosarcoma, follicular lymphoma follicular thyroid cancer, ganglioneuroma, gastrointestinal cancer, germ cell tumors, gestational choriocarcinoma, giant cell fibroblastic tumors Cystoma, Giant cell tumor of bone, Glial tumor, Glioblastoma, Gliomatosis cerebri, Glucagon gonadoblastoma, granulosa cell tumor, ginandroblastoma, gallbladder cancer, gastric cancer, blood vessels Blastoma, head and neck cancer, hemangioectiothelioma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, invasive Lobular cancer, intestinal cancer, kidney cancer, laryngeal cancer, lentigo maligna, fatal midline cancer, leukemia, Leydig cell tumor tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer , non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant Triton tumor, mediastinal tumor Germ cell tumors, medullary carcinoma of the breast, medullary thyroid carcinoma, medulloblastoma, melanoma, meningioma, Merkel cell Cancer, mesothelioma, metastatic urothelial carcinoma, mixed Müllerian tumor, mucinous tumor, muscle tissue neoplasm, fungus Myxoid fungoides, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal carcinoma, schwannoma, neuroblastoma, Transdermal fibroma, neuroma, nodular melanoma, eye cancer, oligoastrocytoma, oligodendroglioma, oncosis Itoma, optic nerve sheath meningioma, optic nerve tumor, oral cancer, osteosarcoma, ovarian cancer, papillary thyroid cancer, paraneoplastic Ganglioneuroma, pineoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, morphology Plasmacytoma, polyembryomas, primary central nervous system lymphoma, primary effusion lymphoma, primary peritoneal carcinoma, Prostate cancer, pancreatic cancer, pharyngeal cancer, pseudomyxoma peritonei, renal cell carcinoma, renal medullary carcinoma, retinoblastoma, thoracic carcinoma Rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannomatosis, seminoma, Sertoli cell tumor, sex cord tumor Gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatin-producing tumor, spinal tumor, tonsillitis Squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular tumor, thyroid cancer, transitional cell carcinoma, throat Throat cancer, urachal cancer, genitourinary cancer, urothelial cancer, uveal melanoma, uterine cancer, verrucous cancer, optic cancer Sensory tract glioma, vulvar cancer, vaginal cancer, Warthin's tumor, Wilms' tumor, squamous cell carcinoma of the head and neck, edema Adenocarcinoma squamous cell carcinoma (adenocarcinoma squamous cell carcinoma) arcinoma of the esophagus, adenocarcinoma of the stomach, adenocarcinoma of the colon, hepatocellular carcinoma ductal carcinoma, cholangiocarcinoma of the biliary system, adenocarcinoma of the gallbladder, adenocarcinoma of the pancreas, intraductal carcinoma in situ of the breast, adenocarcinoma of the breast Cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, transitional cell carcinoma of the bladder, squamous cell carcinoma of the bladder, squamous cell carcinoma of the cervix The group consisting of epithelial carcinoma, adenocarcinoma of the cervix, endometrial carcinoma, squamous cell carcinoma of the penis, and squamous cell carcinoma of the skin The method according to any one of claims 1 to 12, wherein the method is selected from the group consisting of

14. The cancer is pancreatic cancer, or the cancer cells are derived from pancreatic cancer, or the cancer is esophageal cancer. or the cancer cells are from esophageal cancer.

15. The cancer or cancer cells are esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, NS) Cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate cancer, blood cancer, pancreatic cancer , skin cancer, endometrial cancer, ovarian cancer and colorectal cancer.

13. The method according to any one of the preceding claims.

16. The cancer or cancer cells are blood cancers or the cancer cells are derived from blood cancers.

13. The method according to any one of claims 12 to 12.

17. The blood cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CRL), or chronic myelogenous leukemia (CL). Lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL) ), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldens Trehm's macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL) ), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma ( BL), Richter transformation, acute eosinophilic leukemia, acute erythrocytic leukemia, acute lymphoblastic leukemia Leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia Hemopathy, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T lymphoblastic leukemia Myeloid lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggrecan selected from the group consisting of acute NK cell leukemia and angioimmunoblastic T-cell lymphoma; 17. The method of claim 16.

18. 18. The method of any one of claims 1 or 3 to 17, wherein the subject is a mammal.

19. 18. The method of any one of claims 1 or 3 to 17, wherein the subject is a human.

20. 20. The method of claim 1 or any of claims 3 to 19, wherein the SETD2 inhibitor is formulated for systemic or local administration. The method according to any one of claims 1 to 5.

21. 4. The method of claim 3, wherein the SETD2 inhibitor is formulated for oral, nasal, intraperitoneal or intratumoral administration.

21. The method according to any one of claims 1 or 3 to 20.

22. The SETD2 inhibitor is formulated for intravenous, intramuscular or subcutaneous administration. Item 21. The method according to any one of items 1 or 3 to 20.

23. 23. The method of claim 1 further comprising administering one or more additional therapeutic agents. The method according to

24. The SETD2 inhibitor inhibits the trimethylation of lysine 36 on histone H3 (H3K36m The method according to any one of claims 1 to 23, wherein e3) is inhibited.

25. SET for use in a method for treating cancer according to any one of claims 1 or 3 to 24. D2 inhibitors.

26. Treating cancer, including inhibiting the activity of SETD2 in a subject in need of such treatment. How to do it.

Images