Protective oligonucleotides for CRISPR guide RNA
Patent Information
- Application Number
- JP2024563634
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-01-13
- Filing Date
- 2023-04-28
- Publication Date
- 2026-05-08
AI Technical Summary
In the existing CRISPR gene editing technology, single-stranded RNA that has not been chemically modified is very easy to be degraded by ribozymes, resulting in poor stability in biological samples, affecting editing efficiency and biodistribution.
Completely chemically modified protected oligonucleotides are used, which complement each other with unmodified CRISPR RNA (crRNA), enhance the stability of the crRNA and reduce the untargeted effect.
By enhancing the stability and activity of crRNA, the efficiency and specificity of gene editing are improved while reducing immunogenicity and improving delivery and distribution in vivo.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 336,340, filed April 29, 2022, and U.S. Provisional Patent Application No. 63 / 438,842, filed January 13, 2023. The entire contents of the above-referenced patent applications are hereby incorporated by reference in their entireties.
[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. TR002668 awarded by the National Institutes of Health. The United States Government has certain rights in this invention.
[0003] The present disclosure relates to compositions and methods of protected oligonucleotides for modified guide RNAs for CRISPR genome editing. [Background technology]
[0004] CRISPR RNA-guided genome engineering has revolutionized the study of human genetic diseases and many other aspects of biology. Numerous CRISPR-based in vivo or ex vivo genome editing therapies are approaching clinical trials. At the heart of this revolution are microbial effector proteins found in class II CRISPR-Cas systems, such as Cas9 (type II) and Cas12a / Cpf1 (type V) (Jinek et al. Science 337, 816-821 (2012); Gasiunas et al. PNAS 109, E2579-E2586 (2012); Zetsche et al. Cell 163, 759-771 (2015)).
[0005] The most widely used genome editing tool is type II-A Cas9 (SpCas9) from Streptococcus pyogenes strain SF370 (Jinek et al, supra). Cas9 forms a ribonucleoprotein (RNP) complex with CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) for efficient DNA cleavage in both bacteria and eukaryotes (Figure 1). The crRNA contains a guide sequence that directs the Cas9 RNP to a specific locus through base pairing with the target DNA to form an R-loop. This process requires prior recognition of a protospacer adjacent motif (PAM), which in the case of SpCas9 is NGG. R-loop formation activates the His-Asn-His (HNH) and RuvC-like endonuclease domains, which cleave the target and non-target strands of DNA, respectively, resulting in double-strand breaks (DSBs).
[0006] For mammalian applications, Cas9 and its guide RNA can be expressed from DNA (e.g., viral vectors), RNA (e.g., Cas9 mRNA and guide RNA in lipid nanoparticles) or introduced as a ribonucleoprotein (RNP).
[0007] Unmodified single-stranded RNA is highly vulnerable to nuclease degradation and is rapidly degraded in cells and biological fluids such as serum. Delivering unmodified and unformulated crRNAs is similar to the scenario of delivering other therapeutic oligonucleotides such as antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs), where chemical modifications play a key role in efficacy in vivo. However, complete chemical modification significantly enhanced the stability of crRNA (Fig. 1C), thereby compromising the editing efficiency (Fig. 1D). Herein, we report that short, completely chemically stable oligos (hereafter referred to as "protected oligos") complementary to the low-modification regions of crRNA significantly enhanced the stability of crRNA without compromising activity. Furthermore, we show that protected oligos can enhance the potency of crRNAs and tolerate extensive conjugation, thus improving delivery and biodistribution. We anticipate that protected oligos will enable in vivo delivery of unmodified crRNA with enhanced stability, activity, and cellular uptake. Summary of the Invention
[0008] The present disclosure provides a protective oligonucleotide for CRISPR genome editing. In certain embodiments, the protective oligonucleotide of the present disclosure is heavily or completely chemically modified. The protective oligonucleotide of the present disclosure may confer several advantages in vivo or in vitro, such as crRNA stability, improved efficacy, and / or reduced off-target effects. Furthermore, in certain embodiments, the protective oligonucleotide of the present disclosure has reduced immunogenicity, e.g., reduced ability to induce innate immune responses.
[0009] In certain embodiments, the present disclosure provides a protected oligonucleotide comprising (a) a sequence complementary to crRNA and (b) at least one chemically modified nucleotide, wherein the protected oligonucleotide is capable of binding to crRNA, and wherein the protected oligonucleotide, upon binding, confers nuclease resistance to the crRNA.
[0010] In one embodiment, the modified nucleotides each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.
[0011] In one embodiment, the modifications of the ribose group are 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA). NC ) are independently selected from the group consisting of:
[0012] In one embodiment, at least 80% of the ribose groups are chemically modified. In one embodiment, at least 90% of the ribose groups are chemically modified. In one embodiment, 100% of the ribose groups are chemically modified.
[0013] In one embodiment, the crRNA comprises a guide sequence portion and a repeat sequence portion capable of hybridizing to a target polynucleotide sequence.
[0014] In one embodiment, the protected oligonucleotide binds to the crRNA to form a duplex.
[0015] In one embodiment, the duplex has a melting temperature (Tm) of greater than 37° C. over the entire length of the duplex.
[0016] In one embodiment, the duplex has a melting temperature (Tm) of less than 37° C. over the region of complementarity that includes the guide sequence portion.
[0017] In one embodiment, binding of the tracrRNA to the guide sequence portion of the crRNA dissociates the protective oligonucleotide from the crRNA.
[0018] In one embodiment, the protected oligonucleotide further comprises at least one site conjugated to the protected oligonucleotide, hi one embodiment, the at least one site is conjugated to at least one of the 5' end of the protected oligonucleotide and / or the 3' end of the protected oligonucleotide.
[0019] In one embodiment, at least one moiety increases cellular uptake of the guide RNA. In one embodiment, at least one moiety promotes specific tissue distribution of the guide RNA.
[0020] In one embodiment, the at least one moiety is selected from the group consisting of a fatty acid, a steroid, a secosteroid, a lipid, a ganglioside analog, a nucleoside analog, an endocannabinoid, a vitamin, a receptor ligand, a peptide, an aptamer, and an alkyl chain.
[0021] In one embodiment, the at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3.
[0022] In one embodiment, at least one moiety is attached to the guide RNA via a linker, in one embodiment, the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.
[0023] In one embodiment, at least one moiety is a modified lipid. In one embodiment, the modified lipid is a branched lipid.
[0024] In one embodiment, the modified lipid is a branched lipid of formula I: Formula I: X-MC(=Y)MZ-[L-MC(=Y)MR]n, where X is a moiety linking the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, L is an optional linker moiety, and each R is independently a saturated, mono- or polyunsaturated, linear or branched moiety of 2-30 atoms in length, a sterol, or other hydrophobic group. In one embodiment, the modified lipid is a head group modified lipid.
[0025] In one embodiment, the modified lipid is a head-modified lipid of formula II: X-MC(=Y)MZ-[L-MC(=Y)MR]nLKJ, where X is a moiety linking the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, each L is independently any linker moiety, and R is a saturated, mono- or polyunsaturated, linear or branched moiety, sterol, or other hydrophobic group, 2-30 atoms in length, K is a phosphate, sulfate, or amide, and J is an aminoalkane, or a quaternary aminoalkane group.
[0026] In one aspect, the present disclosure provides a double-stranded oligonucleotide comprising: (a) a crRNA comprising (i) a guide sequence portion capable of hybridizing to a target polynucleotide sequence and (ii) a repeat sequence portion; and (b) a protected oligonucleotide complementary to the crRNA, wherein the crRNA comprises at least 50% modified nucleotides and the protected oligonucleotide comprises at least one modified nucleotide.
[0027] In one embodiment, the modified nucleotide comprises a modification of the ribose group, the phosphate group, the nucleobase, or a combination thereof.
[0028] In one embodiment, each modification of the ribose group is 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotide, locked nucleic acid (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, or 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNA). NC ) are independently selected from the group consisting of:
[0029] In one embodiment, at least 80% of the ribose groups are chemically modified. In one embodiment, at least 90% of the ribose groups are chemically modified. In one embodiment, 100% of the ribose groups are chemically modified.
[0030] In one embodiment, the double-stranded oligonucleotide comprises a melting temperature (Tm) greater than 37° C. over the entire length of the double-stranded oligonucleotide.
[0031] In one embodiment, the double-stranded oligonucleotide comprises a melting temperature (Tm) of less than 37° C. over the region of the double-stranded oligonucleotide that comprises the crRNA guide sequence portion.
[0032] In one embodiment, binding of the tracrRNA to the repeat portion of the crRNA dissociates the protective oligonucleotide from the crRNA.
[0033] In one embodiment, the protected oligonucleotide binds to a region of the crRNA that is completely unmodified chemically.
[0034] In one embodiment, the protected oligonucleotide binds to a region of the crRNA that contains less than 100% modified ribose groups.
[0035] In one embodiment, the double-stranded oligonucleotide further comprises at least one site conjugated to a protected oligonucleotide and / or crRNA. In one embodiment, the at least one site is conjugated to at least one of the 5'-end and / or 3'-end of the protected oligonucleotide and / or crRNA.
[0036] In one embodiment, at least one moiety increases cellular uptake of the guide RNA. In one embodiment, at least one moiety promotes specific tissue distribution of the guide RNA.
[0037] In one embodiment, the at least one moiety is selected from the group consisting of a fatty acid, a steroid, a secosteroid, a lipid, a ganglioside analog, a nucleoside analog, an endocannabinoid, a vitamin, a receptor ligand, a peptide, an aptamer, and an alkyl chain.
[0038] In one embodiment, the at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3.
[0039] In one embodiment, at least one moiety is attached to the guide RNA via a linker, in one embodiment, the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.
[0040] In one embodiment, at least one moiety is a modified lipid. In one embodiment, the modified lipid is a branched lipid.
[0041] In one embodiment, the modified lipid is a branched lipid of formula I: Formula I: X-MC(=Y)MZ-[L-MC(=Y)MR]n, where X is a moiety linking the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, L is an optional linker moiety, and each R is independently a saturated, mono- or polyunsaturated, linear or branched moiety of 2-30 atoms in length, a sterol, or other hydrophobic group. In one embodiment, the modified lipid is a head group modified lipid.
[0042] In one embodiment, the modified lipid is a head-modified lipid of formula II: X-MC(=Y)MZ-[L-MC(=Y)MR]nLKJ, where X is a moiety linking the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, each L is independently any linker moiety, and R is a saturated, mono- or polyunsaturated, linear or branched moiety, sterol, or other hydrophobic group, 2-30 atoms in length, K is a phosphate, sulfate, or amide, and J is an aminoalkane, or a quaternary aminoalkane group.
[0043] In one embodiment, the guide RNA binds to a Cas9 nuclease selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).
[0044] In one embodiment, the Cas9 is a variant Cas9 with altered activity.
[0045] In one embodiment, the variant Cas9 is selected from the group consisting of Cas9 nickase (nCas9), catalytically inactive Cas9 (dCas9), high precision Cas9 (HypaCas9), high fidelity Cas9 (Cas9-HF), enhanced specificity Cas9 (eCas9), and PAM-extended Cas9 (xCas9).
[0046] In one embodiment, the off-target activity of Cas9 is reduced compared to an unmodified guide RNA.
[0047] In one embodiment, the on-target activity of Cas9 is increased compared to an unmodified guide RNA.
[0048] In one aspect, the present disclosure provides a method of editing a target region of a genome in a cell to alter expression of a target gene in the cell, comprising administering to the cell a genome editing system comprising a protected oligonucleotide of any of the above-enumerated embodiments, one or more crRNAs of any of the above-enumerated embodiments, one or more tracrRNAs, and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.
[0049] In one embodiment, the target gene is in a cell of an organism.
[0050] In one embodiment, expression of the target gene is knocked out or knocked down.
[0051] In one embodiment, the RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease and one or more tracrRNAs are administered to a cell prior to the one or more crRNAs or protective oligonucleotides.
[0052] In one embodiment, the crRNA comprises a crRNA portion of the modification pattern of any of the preceding embodiments consisting of: mN#mN#mN#mNmNmNmNmNmNmNmNfNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU(crRNA20), where rN=RNA, mN=2'-O-methyl RNA, fN=2'-fluoro RNA, N#N=phosphorothioate linkage, and N=any nucleotide.
[0053] In one embodiment, the protected oligonucleotide of any of the preceding embodiments comprises the following modification pattern: mAmAmAmCmNmNmNmNmN(RC01); mAmAmAmAmCmNmNmNmNmN(RC02); mAmAmAmCmNmNmNmNmNmN(RC03); mAmAmAmAmCmNmNmNmNmNmN(RC04); mUmAmAmAmAmAmCmNmNmNmNmNmN(RC05); mAmAmAmAmCmNmNmNmNmNmNmN(RC06); mUmAmAmAmAmCmNmNmNmNmNmNmN(RC07); mCmUmAmAmAmAmAmCmNmNmNmNmNmNmN(RC08); mUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC09); mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC10); mU#mA#mAmAmAmCmNmNmNmNmN#mN#mN(RC07-2PS); and mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN(RC07-3PS), where rN=RNA, mN=2'-O-methyl RNA, N#N=phosphorothioate linkage, and N=any nucleotide.
[0054] In certain embodiments, the protected oligonucleotide of any one of the preceding embodiments is a protected oligonucleotide modification pattern selected from any of RC01-10 in Table 1.
[0055] In certain embodiments, the crRNA of any one of the preceding embodiments is a crRNA modification pattern selected from any of crRNAs 1-134 in Table 2.
[0056] In one embodiment, the protected oligonucleotide and / or the crRNA of any one of the preceding embodiments, respectively, further comprises one or more additional modified nucleotides independently selected from modifications of a ribose group, a phosphate group, a nucleobase, or a combination thereof.
[0057] In certain embodiments, modifications of the ribose group include 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA). NC ) are independently selected from the group consisting of:
[0058] In certain embodiments, each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetic acid (PACE), thiophosphonoacetic acid (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.
[0059] In certain embodiments, each modification of the nucleobase is 2-thiouridine, 4-thiouridine, N 6 -methyl adenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidines, isoguanine, isocytosine, and halogenated aromatic groups. [Brief description of the drawings]
[0060] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings. This patent or application document contains at least one drawing executed in color. Copies of this patent or patent application publication containing color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0061] [Figure 1A] Schematic diagram of stable cell lines and activity and stability of chemically modified crRNA. Schematic diagram of stable HEK293T cell lines expressing SpyCas9 nuclease, tracrRNA, and a fluorescent reporter gene consisting of a disrupted GFP and an out-of-frame mCherry. Electroporation of the crRNA targeting the GFP sequence generates a frameshift mutation and places the mCherry coding sequence in frame. [Figure 1B] Schematic diagram of stable cell lines and activity and stability of chemically modified crRNA. Schematic diagram of stable HEK293T cell lines expressing SpyCas9 adenine base editor (SpyCas9-ABE8e), tracrRNA, and a fluorescent reporter gene with a G to A nonsense mutation in the GFP coding sequence. Electroporation of the crRNA restores GFP fluorescence with an A to G edit that reverses the mutation. [Figure 1C] Schematic diagram of stable cell lines and activity and stability of chemically modified crRNAs. Activity of different chemically modified crRNAs was measured by electroporating 50 pmol crRNA per 5×104 cells into the stable cell lines shown in FIG. 1A. Cells were harvested 48 hours after electroporation and the percentage of mCherry positive cells was quantified by FACS. The crRNA sequence used was GAGACAAAUCACCUGCCUCGGUUUUAGAGCUAUGCU and the chemical modification pattern of crRNA is listed in Table 2. [Figure 1D]Schematic diagram of stable cell lines and activity and stability of chemically modified crRNAs. Activity of different chemically modified crRNAs measured by electroporating 50 pmoles of crRNA per 5x104 cells into a stable mouse Hepa1-6 cell line expressing SpyCas9-ABE8e and tracrRNA. Data measured by Sanger sequencing and EditR analysis. [Figure 1E] Schematic diagram of stable cell lines and activity and stability of chemically modified crRNA. Stability of partially and fully modified crRNA shown in FIG. 1C is shown. crRNA was diluted to a concentration of 1 μM with 10% FBS and incubated at 37° C. for the indicated times, then denatured with formamide loading dye and fractionated by 10% urea-denaturing polyacrylamide gel electrophoresis (PAGE) followed by staining.
[0062] [Figure 2A] Protective oligos that enhance crRNA stability without compromising activity are shown. Representative designs and chemical modifications of C20 (top) and protected oligos (bottom, RC01-RC10) are shown. Chemical modification patterns of C20 and protected oligos are color-coded as follows: green=2'-O-Me, red=2'-F, black=2'-OH, underlined=PS. [Figure 2B] Protected oligos that enhance crRNA stability without compromising activity are shown. Stability of C20-protected oligo complexes is shown. C20 and the indicated protected oligos were mixed in an equimolar ratio and annealed by heating to 95° C. for 5 h and slowly cooled to 4° C. (−0.1° C. per second). Annealed C20-protected oligo complexes were diluted to 1 μM in 10% FBS and incubated at 37° C. for the times indicated. RNA was then denatured with formamide and separated by 10% denaturing urea PAGE. [Figure 2C]Protected oligos that enhance crRNA stability without compromising activity are shown. Activity of C20-protected oligo complexes is shown. C20 and the indicated protected oligos were annealed as described in FIG. 2B. 50 pmol of crRNA per 5×104 cells were then electroporated using the stable cell line shown in FIG. 1A. Cells were harvested 48 hours after electroporation and the percentage of mCherry was quantified by FACS.
[0063] [Diagram 3] Protected oligos that enhance crRNA potency are shown. A, Activity of C20-protected oligo complexes at non-saturating doses in the stable cell lines shown in FIG. 1A. B, Activity of C20-protected oligo complexes at non-saturating doses in the stable cell lines shown in FIG. 1B. Molar amount of C20-protected oligo complexes per 5×104 cells is shown on the x-axis. Cells were harvested 48 hours after electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS.
[0064] [Figure 4A] Figure 1 shows conjugation of protected oligos to enhance cellular uptake without interfering with crRNA activity. Figure 1 shows activity of C20-protected oligo complexes with conjugation measured in stable cell lines shown in Figure 1B by electroporating 50 picomoles of complex per 5x104 cells. The chemical modification patterns of C20 ("crRNA20") are listed in Table 2, and the chemical modification pattern of the protected oligo RC10 is listed in Table 1. Cells were harvested 48 hours after electroporation, and the percentage of mCherry or GFP positive cells was quantified by FACS. [Figure 4B] Figure 1 shows the conjugation of protective oligos to enhance cellular uptake without interfering with crRNA activity. Schematic diagram of editing efficiency by GFP quantification of the designed and modified protective oligonucleotides with and without lipid conjugation (cholesterol is Chol, docosahexaenoic acid is DHA, N-acetylgalactosamine is GalNac). [Figure 4C]Figure 1 shows conjugation of protected oligos to enhance cellular uptake without interfering with crRNA activity. Figure 2 shows uptake of C20-protected oligo complexes in mouse CNS (n=3 mice per group) after intrastriatal injection. [Figure 4D] Conjugation of the protected oligo to enhance cellular uptake without interfering with crRNA activity is shown. Cellular uptake of Cy3-labeled crRNA (right), Cy3-labeled crRNA with protected oligo (middle), and Cy3-labeled crRNA with cholesterol-conjugated protected oligo (left) is shown. Oligonucleotides were diluted to 1.5 μM in DMEM+3% FBS and then mixed with HEK293T cells. Cells were plated on 8-well glass-bottom cell culture chamber slides (SKU230118) and incubated overnight. Cell culture medium was then replaced with PBS and one drop of NucBlue (Hoechst 33342) was added to the cell culture and imaged. Images were acquired at 40x magnification on a Leica fluorescence microscope.
[0065] [Diagram 5] Editing efficiency by passive incorporation of C20 with and without protective oligos is shown. GFP positive cells were quantified by FACS.
[0066] [Figure 6] This indicates that optimal duplex stability between the protected oligo and the crRNA may be necessary for efficient editing. Figure 1B shows the activity of C20-protected oligo complexes in the stable cell lines shown. C20 and the indicated protected oligos were annealed as described in Figure 1A. 50 pmol of crRNA per 5x104 cells were then electroporated using the stable cell lines shown in Figure 1A. Cells were harvested 48 hours after electroporation and the percentage of mCherry was quantified by FACS. The chemical modification patterns of C20 and protected oligos are color-coded as follows: green=2'-O-Me, red=2'-F, black=2'-OH, underline=PS, double underline=locked nucleic acid (LNA).
[0067] [Figure 7A]In vivo genome editing in adult mouse CNS by co-delivery of AAV and self-delivered crRNA. Process up to immunohistochemistry (IHC) detection of genome editing in adult mice using scAAV9 by injection. Editing efficiency of these conjugates was examined by IHC staining using anti-EGFP antibody and quantified by the percentage of EGFP-positive cells within 1 mm2 around the injection site. [Figure 7B] In vivo genome editing in adult mouse CNS by co-delivery of AAV and self-delivered crRNA is shown. Results from Figure 7A are shown. Chemical modification patterns are listed in Table 1.
[0068] [Figure 8A] Figure 1 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA-expressing AAV with GalNac-conjugated self-delivered crRNA. Figure 2 shows the results of expression of injected AAV with SpyCas9-ABE8e and tracrRNA expression. [Figure 8B] Figure 1 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA-expressing AAV with GalNac-conjugated self-delivered crRNA. Figure 2 shows the results of expression of SpyCas9 nuclease and tracrRNA expression by injected AAV. [Figure 8C] In vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA expressing AAV with GalNac-conjugated self-delivered crRNA. FahPM / PM generating point mutations leading to exon 8 skipping and FAH deficiency. [Figure 8D] Figure 1 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA expressing AAV with GalNac-conjugated self-delivered crRNA. A schematic diagram of AAV delivery to FahPM / PM mice is shown. First, AAV expressing SpyCas9-ABE8e and tracrRNA were RO-injected. Five weeks later, RO injection of C20 with a pre-validated spacer sequence was performed. [Figure 8E]Figure 1 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA expressing AAV with GalNac-conjugated self-delivered crRNA. Figure 2 shows base editing efficiency of genomic DNA in liver of mice treated with co-delivery of AAV-SpyCas9-ABE-tracrRNA with the indicated C20 / protected oligos. Editing efficiency was measured by targeted amplicon deep sequencing (n=3 mice per group). Data represent mean ± SD, *=P<0.05, **=P<0.01, ***=P<0.001 (2-way ANOVA). [Figure 8F] Figure 1 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA-expressing AAV with GalNac-conjugated self-delivered crRNA. Figure 2 shows the results of body weight measured over time for mice treated with SpyCas9-ABE8e and tracrRNA-expressing AAV, as well as C20 with protective oligonucleotides. [Figure 8G] Figure 8 shows in vivo genome editing in adult mouse liver by co-delivery of effector and tracrRNA expressing AAV and GalNac-conjugated self-delivered crRNA. The mouse in Figure 8F was sacrificed after 3 months of NTBC cycle, and IHC staining was performed on liver sections using anti-FAH antibody.
[0069] [Figure 9] Figure 8 shows the effect of optimizing the dosing regimen on in vivo editing efficiency. A shows a schematic diagram of the experimental process in which repeated crRNA dosing regimens were tested. RO is retro-orbital injection. B shows the editing efficiency of co-delivery of AAV-SpyCas9-ABE-tracrRNA with a single 80 mg / kg dose compared to that of three consecutive daily injections of 26 mg / kg doses of C20+RC07-GalNac targeting the mouse Pcsk9 gene. Editing efficiency was measured by targeted amplicon deep sequencing of mouse liver genomic DNA (n=3 mice per group). Single dose data were the same as shown in Figure 8A. Data represent mean ± SD, ****=P<0.0001 (two-way ANOVA).
[0070] [Figure 10A] Figure 1 shows the effect of C20 targeting different sequences with and without protective oligonucleotides. Figure 2 shows dose-response curves of C20 targeting different sequences with and without protective oligonucleotides on HEK293T-SpyCas9-ABE-tracrRNA-dGFP reporter. Editing efficiency was quantified by FACS. Data represent mean ± SD, ns = P > 0.05, **** = P < 0.0001 (2-way ANOVA) (C20 was used as a control for multiple comparisons). [Figure 10B] Figure 1 shows the effect of C20 targeting different sequences with and without protection oligonucleotides. Figure 2 shows the editing efficiency of fully modified crRNA C40 at different doses with and without 14-mer protection oligonucleotides on SpyCas9-ABE-tracrRNA-dGFP reporter. The left panel shows the chemical modification patterns of crRNA and protection oligonucleotides. Data represent the mean ± SD, ns = P > 0.05 (2-way ANOVA). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0071] Provided herein are protected oligonucleotides, including oligonucleotides that are heavily or completely chemically protected. In certain embodiments, protected oligonucleotides and crRNAs with 5' and / or 3' splice sites are provided. Also provided are methods of using the disclosed protected oligonucleotides and crRNAs for genome editing with CRISPR nucleases, and kits for carrying out the methods.
[0072] Unless otherwise defined herein, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout the specification, unless otherwise specified. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein, unless otherwise specified. The nomenclature used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein, and the laboratory procedures and techniques thereof, are well known and commonly used in the art, unless otherwise specified. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
[0073] Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise indicated. The use of the term "including" as well as other forms such as "include" and "included" are not limiting.
[0074] In order that this disclosure may be more readily understood, certain terms are first defined.
[0075] As used herein, the term "protective oligonucleotide" refers to an oligonucleotide that contains complementarity with crRNA and, upon binding, confers increased nuclease resistance to crRNA compared to crRNA without the protective oligonucleotide bound.
[0076] As used herein, the term "guide RNA" or "gRNA" refers to any nucleic acid that facilitates the specific association (or "targeting") of an RNA-guided nuclease, such as Cas9, to a target sequence (e.g., a genomic or episomal sequence) within a cell.
[0077] As used herein, a "modular" or "dual RNA" guide comprises two or more, typically two, separate RNA molecules, e.g., a CRISPR RNA (crRNA) and a transactivating crRNA (tracrRNA), which are typically associated with each other, e.g., by forming a duplex. gRNAs and their component parts are described throughout the literature (see, e.g., Briner et al. Mol. Cell, 56(2), 333-339 (2014), which is incorporated by reference).
[0078] As used herein, a "unimolecular gRNA," "chimeric gRNA," or "single guide RNA (sgRNA)" comprises a single RNA molecule. The sgRNA can be a crRNA and a tracrRNA linked together. For example, the 3' end of the crRNA can be linked to the 5' end of the tracrRNA. The crRNA and the tracrRNA can be linked to a single unimolecular or chimeric gRNA by, for example, a four nucleotide (e.g., GAAA) "tetraloop" or "linker" sequence that bridges the complementary regions of the crRNA (at its 3' end) and the tracrRNA (at its 5' end).
[0079] As used herein, a "repeat" sequence or region is a nucleotide sequence at or near the 3' end of the crRNA that is complementary to the anti-repeat sequence of the tracrRNA.
[0080] As used herein, an "anti-repeat" sequence or region is a nucleotide sequence at or near the 5' end of the tracrRNA that is complementary to the repeat sequence of the crRNA.
[0081] Additional details regarding guide RNA structure and function, including gRNA / Cas9 complexes for genome editing, can be found at least in Mali et al. Science, 339(6121), 823-826 (2013); Jiang et al. Nat. Biotechnol. 31(3): 233-239 (2013); and Jinek et al. Science, 337(6096), 816-821 (2012), which are incorporated herein by reference.
[0082] As used herein, "guide sequence" or "targeting sequence" refers to a nucleotide sequence of a gRNA, whether unimolecular or modular, that is fully or partially complementary to a target domain or target polynucleotide within a DNA sequence within the genome of a cell in which editing is desired. Guide sequences are typically 10-30 nucleotides in length, preferably 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and are located at or near the 5' end of the Cas9 gRNA.
[0083] As used herein, a "target domain" or "target polynucleotide sequence" is a DNA sequence in the genome of a cell that is complementary to the guide sequence of a gRNA.
[0084] In addition to the targeting domain, gRNA typically contains multiple domains that affect the formation or activity of gRNA / Cas9 complex. For example, as described above, the duplex structure (also called repeat:anti-repeat duplex) formed by the first and second complementarity domains of gRNA can interact with the recognition (REC) lobe of Cas9 and mediate the formation of Cas9 / gRNA complex (Nishimasu et al. Cell 156:935-949 (2014); Nishimasu et al. Cell 162(2), 1113-1126 (2015), both of which are incorporated herein by reference). It should be noted that the first and / or second complementarity domain may contain one or more polyA tracts that can be recognized by RNA polymerase as a termination signal. Thus, the sequences of the first and second complementarity domains are optionally modified to eliminate these tracts and facilitate complete in vitro transcription of the gRNA, for example, through the use of AG swaps, or AU swaps, as described in Briner 2014. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.
[0085] In addition to the first and second complementarity domains, Cas9 gRNAs typically contain two or more additional duplex regions that are necessary for nuclease activity in vivo but not in vitro (Nishimasu 2015, supra). The first stem-loop near the 3' portion of the second complementarity domain is variously referred to as the "proximal domain," "stem-loop 1" (Nishimasu 2014, supra; Nishimasu 2015, supra), and "nexus" (Briner 2014, supra). One or more additional stem-loop structures are generally present near the 3' end of the gRNA, the number of which varies by species. That is, S. pyogenes gRNAs typically contain two 3' stem-loops (for a total of four stem-loop structures including the repeat:anti-repeat duplex), while S. aureus and other species have only one (for a total of three). A description of the various engineered conserved stem-loop structures (and gRNA structures more generally) is provided in Briner 2014, which is incorporated herein by reference. Additional details regarding guide RNAs generally can be found in WO2018026976A1, which is incorporated herein by reference.
[0086] Protected Oligonucleotides The inventors have surprisingly found that the use of a protected oligonucleotide confers increased nuclease resistance to the crRNA. The protected oligonucleotides described herein comprise complementarity with the crRNA. Upon binding, the protected oligonucleotides confer nuclease resistance to the crRNA. In a preferred embodiment, the protected oligonucleotides described herein bind to a region of the crRNA that contains at least one unmodified ribose group. In a particular embodiment, the protected oligonucleotides bind to a region of the crRNA that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unmodified ribose groups.
[0087] In certain embodiments, the protected oligonucleotide is about 5 to about 20 nucleotides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length). In certain embodiments, the protected oligonucleotide is 10, 11, 12, 13, 14, 15, or 16 nucleotides in length. The length of the protected oligonucleotide is shorter than the crRNA with which it contains complementarity (i.e., the protected oligonucleotide contains complementarity to a region of the crRNA, where said region is not the full length of the crRNA).
[0088] In certain embodiments, a protected oligonucleotide binds to crRNA to form a duplex, and optionally, the protected oligonucleotide binds to a region of crRNA that is not completely chemically modified.
[0089] In certain embodiments, the duplex has a melting temperature (Tm) of greater than 37° C. over the entire length of the duplex.
[0090] In certain embodiments, the duplex has a melting temperature (Tm) of less than 37° C. over the region of complementarity that includes the guide sequence portion.
[0091] In certain embodiments, binding of the tracrRNA to the guide sequence portion of the crRNA dissociates the protective oligonucleotide from the crRNA.
[0092] Exemplary protection oligonucleotide sequences are listed below, where "N" represents any nucleotide: AAACNNNNN AAAACNNNNN AAACNNNNNN AAAACNNNNNN UAAACNNNNNN AAAACNNNNNNN UAAACNNNNNNN CUAAACNNNNNNN UAAACNNNNNNNN CUAAACNNNNNNNN
[0093] Chemically modified guide RNA and protected oligonucleotides The protected oligonucleotides and guide RNAs (i.e., crRNA and tracrRNA) of the present disclosure have improved in vivo stability, improved genome editing efficacy, and / or reduced immunotoxicity compared to unmodified or minimally modified protected oligonucleotides and guide RNAs.
[0094] The protected oligonucleotides and guide RNAs of the present disclosure contain one or more modified nucleotides, including modifications of the ribose group, the phosphate group, the nucleobase, or combinations thereof.
[0095] Chemical modifications to the ribose group include 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, 2'-O-allyl, 2'-O-ethylamine, 2'-O-cyanoethyl, 2'-O-acetal ester, or bicyclic nucleotides, such as locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, or 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA). NC ), but are not limited to these.
[0096] The term "4'-thio" as used herein corresponds to a ribose group modification in which the sugar ring oxygen of the ribose is replaced with a sulfur.
[0097] Chemical modifications to the phosphate group include, but are not limited to, phosphorothioate, phosphonoacetic acid (PACE), thiophosphonoacetic acid (thioPACE), amide, triazole, phosphonate, or phosphotriester modifications.
[0098] In one embodiment, the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications). In one embodiment, the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications) and comprises at least about 50% activity compared to a guide RNA that does not comprise phosphorothioate modifications (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity compared to a guide RNA that does not comprise phosphorothioate modifications).
[0099] Chemical modifications to nucleic acid bases include 2-thiouridine, 4-thiouridine, and N 6 Examples of suitable aryl groups include, but are not limited to, -methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidines, isoguanine, isocytosine, or a halogenated aromatic group.
[0100] A chemically modified guide RNA may have one or more chemical modifications in the crRNA portion and / or the tracrRNA portion in a modular or dual RNA guide. A chemically modified guide RNA may also have one or more chemical modifications in the single guide RNA in a unimolecular guide RNA.
[0101] The protected oligonucleotides and guide RNAs may comprise at least about 50% to at least about 100% chemically modified nucleotides, at least about 60% to at least about 100% chemically modified nucleotides, at least about 70% to at least about 100% chemically modified nucleotides, at least about 80% to at least about 100% chemically modified nucleotides, at least about 90% to at least about 100% chemically modified nucleotides, and at least about 95% to at least about 100% chemically modified nucleotides.
[0102] The protected oligonucleotides and guide RNAs may comprise at least about 50% chemically modified nucleotides, at least about 60% chemically modified nucleotides, at least about 70% chemically modified nucleotides, at least about 80% chemically modified nucleotides, at least about 90% chemically modified nucleotides, at least about 95% chemically modified nucleotides, at least about 99% chemically modified, or 100% (completely) chemically modified nucleotides.
[0103] The protected oligonucleotides and guide RNAs may contain at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides.
[0104] Protected oligonucleotides and guide RNAs that contain at least about 80% to at least about 99% chemically modified nucleotides are considered "heavily" modified as used herein.
[0105] Protected oligonucleotides and guide RNAs that contain 100% chemically modified nucleotides are considered "fully" modified as used herein.
[0106] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may contain chemically modified ribose groups at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.
[0107] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may contain chemically modified ribose groups at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
[0108] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise chemically modified ribose groups at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
[0109] Protected oligonucleotides and guide RNAs having at least about 80% to at least about 99% of ribose groups that are chemically modified are considered "heavily" modified as used herein.
[0110] Protected oligonucleotides and guide RNAs with 100% chemically modified ribose groups are considered "fully" modified as used herein.
[0111] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may contain chemically modified phosphate groups at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.
[0112] In certain exemplary embodiments, the protective oligonucleotides and guide RNAs may contain chemically modified phosphate groups at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
[0113] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise chemically modified phosphate groups at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
[0114] Protected oligonucleotides and guide RNAs having at least about 80% of their phosphate groups chemically modified to at least about 99% of their phosphate groups chemically modified are considered "heavily" modified as used herein.
[0115] Protected oligonucleotides and guide RNAs having 100% chemically modified phosphate groups are considered "fully" modified as used herein.
[0116] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise chemically modified nucleobases at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.
[0117] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
[0118] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
[0119] Protected oligonucleotides and guide RNAs having at least about 80% of the nucleobases that are chemically modified to at least about 99% of the nucleobases that are chemically modified are considered "heavily" modified as used herein.
[0120] Protected oligonucleotides and guide RNAs having 100% chemically modified nucleobases are considered "fully" modified as used herein.
[0121] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% to about 100% of the nucleotides, at about 60% to about 100% of the nucleotides, at about 70% to about 100% of the nucleotides, at about 80% to about 100% of the nucleotides, at about 90% to about 100% of the nucleotides, and at about 95% to about 100% of the nucleotides.
[0122] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
[0123] In certain exemplary embodiments, the protected oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
[0124] Protected oligonucleotides and guide RNAs having at least about 80% of any combination of chemically modified ribose groups, phosphate groups, and nucleobases and at least about 99% of chemically modified nucleobases are considered "heavily" modified as used herein.
[0125] Protected oligonucleotides and guide RNAs that have 100% of any combination of chemically modified ribose groups, phosphate groups, and nucleobases are considered "fully" modified as used herein.
[0126] The heavily and completely chemically modified protected oligonucleotides and guide RNAs of the present disclosure have several advantages over minimally modified protected oligonucleotides and guide RNAs in the art. It is expected that the heavily and completely chemically modified protected oligonucleotides and guide RNAs facilitate chemical synthesis, further enhance in vivo stability, and provide a scaffold for terminally added chemical functional groups that facilitate delivery and efficacy during clinical applications for genome editing.
[0127] The chemical modification pattern used in the guide RNA is such that the activity of the guide RNA is maintained when paired with an RNA-guided DNA endonuclease, e.g., Cas9.
[0128] In one embodiment, a chemically modified guide RNA of the disclosure comprises at least about 50% activity compared to an unmodified guide RNA (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity compared to an unmodified guide RNA).
[0129] The activity of guide RNA can be easily determined by any means known in the art. In one embodiment, the activity % is measured using the Traffic Light Reporter (TLR) Multi-Cas Variant1 system (TLR-MCV1) described below. The TLR-MCV1 system provides the fluorescent cell % which is a measure of the activity %.
[0130] Exemplary chemical modification patterns are set forth in Tables 1 and 2 below. [Table 1] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15]
[0131] It will be understood by those skilled in the art that the base sequence of the first 20 nucleotides of the exemplary crRNA listed in Table 2 above is directed to a specific target. The 20 nucleotide base sequence may be altered based on the target nucleic acid, but the chemical modification remains the same. An exemplary unmodified crRNA sequence from 5' to 3' is NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCU (SEQ ID NO: 1), where "N" corresponds to any nucleotide (e.g., A, U, G, or C). An exemplary unmodified tracrRNA sequence from 5' to 3' is AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO: 2).
[0132] Further, one of skill in the art will understand that the guide sequence is 10-30 nucleotides in length, preferably 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length) and is located at or near the 5' end of the Cas9 gRNA.
[0133] Chemically modified guide RNAs, including chemically modified crRNA and tracrRNA, are described in further detail in US20210363518 and US20210388348, each of which is incorporated by reference herein.
[0134] The protective oligonucleotides described herein may be designed to bind to any region of the crRNA modification pattern that contains at least one unmodified ribose group, thereby conferring nuclease resistance to the crRNA.
[0135] High-affinity repeat / anti-repeat guide RNA modifications The crRNA and tracrRNA hybridize together by forming a duplex between the repeat region of the crRNA and the anti-repeat region of the tracrRNA. In certain embodiments, the modular, or dual RNA, guide RNA is modified in the repeat and anti-repeat regions to increase the affinity between the two regions to form a stronger duplex.
[0136] High affinity interactions can be enhanced by increasing the GC nucleotide content in the duplex formed by the repeat and anti-repeat regions. Nucleotide modifications such as 2'-fluoro and 2'-O-methyl modifications can also be introduced, which increase the melting temperature (Tm) of the duplex. Further modifications include the use of orthogonal and non-naturally occurring nucleotides. The various repeat / anti-repeat region modifications described herein enhance duplex stability and help prevent crRNA and tracrRNA from folding into suboptimal structures, thus promoting higher genome editing efficacy.
[0137] Joint The protected oligonucleotides and / or crRNA of the present disclosure may be modified with terminal splice sites. As used herein, "terminal splice site" or "site" refers to a compound that may be linked or attached to the 5' and / or 3' ends of the crRNA and protected oligonucleotide. The terminal splice site may enhance stability, enhance the ability to penetrate cell membranes, increase cellular uptake, extend circulation time in vivo, act as a cell-specific indicator reagent, and / or provide a means to monitor cellular or tissue-specific uptake.
[0138] In certain embodiments, the terminal junction site is attached to the 5' end of the crRNA. In certain embodiments, the terminal junction site is attached to the 3' end of the crRNA. In certain embodiments, the terminal junction site is attached to the 5' end of the protected oligonucleotide. In certain embodiments, the terminal junction site is attached to the 3' end of the protected oligonucleotide.
[0139] In certain exemplary embodiments, terminal attachment sites include, but are not limited to, fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, alkyl chains, fluorophores, antibodies, nuclear localization signals, and the like.
[0140] In certain exemplary embodiments, terminal conjugation sites include, but are not limited to, cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, Cy3, and the like.
[0141] In certain exemplary embodiments, at least one terminal attachment site is a modified lipid, including a branched lipid (such as the structure shown in Formula I) or a head group-modified lipid (such as the structure shown in Formula II).
[0142] Formula I: X-MC(=Y)MZ-[L-MC(=Y)MR] where X is a moiety linking a lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH, NH, O, or S, Z is a branching group that allows for two or three ("n") chains to be attached to the remainder of the structure, L is an optional linker moiety, and each R is independently a saturated, mono- or polyunsaturated, linear or branched moiety 2-30 atoms in length, a sterol, or other hydrophobic group.
[0143] Formula II: X-MC(=Y)MZ-[L-MC(=Y)MR]nLKJ wherein X is a moiety linking a lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH, NH, N-alkyl, O, or S, Z is a branching group that allows for two or three ("n") chains to be attached to the remainder of the structure, each L is independently an optional linker moiety, and R is a saturated, mono- or polyunsaturated, linear or branched moiety 2-30 atoms in length, sterol, or other hydrophobic group, K is phosphate, sulfate, or amide, and J is an aminoalkane, or a quaternary aminoalkane group.
[0144] The moiety may be attached to the terminal nucleotide of the guide RNA via a linker. Exemplary linkers include, but are not limited to, ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, block copolymers, and the like.
[0145] In certain embodiments, the site is joined to the 5' and / or 3' end of any one of RC01-RC10 (i.e., RC01, RC02, RC03, RC04, RC05, RC06, RC07, RC08, RC09, or RC10).
[0146] Chemically modified single guide RNA As described herein, the chemically modified guide RNA of the present disclosure can be constructed as a single guide RNA (sgRNA) by linking the 3' end of the crRNA to the 5' end of the tracrRNA. The linker can be an oligonucleotide loop comprising a chemically modified oligonucleotide loop. In certain embodiments, the oligonucleotide loop comprises a GAAA tetraloop. The linker can also be a non-nucleotide chemical linker, including but not limited to an ethylene glycol oligomer (see, e.g., Pils et al. Nucleic Acids Res. 28(9):1859-1863 (2000)).
[0147] RNA-guided nucleases RNA-guided nucleases according to the present disclosure include, but are not limited to, naturally occurring Type II CRISPR nucleases such as Cas9, as well as other nucleases derived or obtained therefrom. Exemplary Cas9 nucleases that may be used in the present disclosure include, but are not limited to, S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9). In functional terms, an RNA-guided nuclease is defined as a nuclease that (a) interacts with (e.g., forms a complex with) a gRNA, and (b) together with the gRNA, associates with and optionally cleaves or modifies a target region of DNA that contains (i) a sequence complementary to the targeting domain of the gRNA, and optionally (ii) an additional sequence called a "protospacer adjacent motif" or "PAM" described in more detail below. As illustrated in the Examples below, RNA-guided nucleases may be defined in broad terms by their PAM specificity and cleavage activity, even though there may be variations between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Those skilled in the art will appreciate that some aspects of the present disclosure relate to systems, methods, and compositions that can be implemented using any suitable RNA-guided nuclease with a particular PAM specificity and / or cleavage activity. To this end, unless otherwise indicated, the term RNA-guided nuclease should be understood as generic and not limited to any particular type (e.g., Cas9 vs. Cpfl), species (e.g., S. pyogenes vs. S. aureus), or variant (e.g., full-length vs. truncated or split; naturally occurring vs. engineered PAM specificity).
[0148] Different RNA-guided nucleases may require different sequential relationships between the PAM and the protospacer. Generally, Cas9 recognizes the PAM sequence that is 5' of the protospacer as visualized relative to the top or complementary strand.
[0149] In addition to recognizing a specific sequential orientation of the PAM and protospacer, RNA-guided nucleases generally recognize specific PAM sequences. S. aureus Cas9, for example, recognizes the PAM sequence of NNGRRT, where the N sequence is immediately 3' to the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes the NGG PAM sequence. It should also be noted that engineered RNA-guided nucleases can have PAM specificity that differs from that of similar nucleases (such as the naturally occurring variants from which the RNA-guided nuclease is derived or the naturally occurring variants with the greatest amino acid sequence homology to the engineered RNA-guided nuclease). Modified Cas9s that recognize alternative PAM sequences are described below.
[0150] RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally occurring RNA-guided nucleases typically form DSBs at the target nucleic acid, but engineered variants have been created that generate only SSBs (see also Ran 2013, supra, incorporated herein by reference) or do not cleave at all.
[0151] The RNA-guided nuclease Cas9 may be a variant of Cas9 with altered activity. Exemplary variant Cas9 nucleases include, but are not limited to, Cas9 nickase (nCas9), catalytically inactive Cas9 (dCas9), high fidelity Cas9 (HypaCas9) (Chen et al. Nature, 550(7676), 407-410 (2017)), high fidelity Cas9 (Cas9-HF) (Kleinstiver et al. Nature 529(7587), 490-495 (2016)), enhanced specificity Cas9 (eCas9) (Slaymaker et al. Science 351(6268), 84-88 (2016)), and PAM-extended Cas9 (xCas9) (Hu et al. Nature doi:10.1038 / nature26155 (2018)).
[0152] RNA-guided nuclease may be combined with the chemically modified guide RNA of the present disclosure to form a genome editing system. RNA-guided nuclease may be combined with the chemically modified guide RNA to form an RNP complex that can be delivered to a cell where genome editing is desired. RNA-guided nuclease may be expressed in a cell where genome editing is desired, with the chemically modified guide RNA being delivered separately. For example, RNA-guided nuclease may be expressed from a polynucleotide, such as a vector or synthetic mRNA. The vector may be a viral vector, including but not limited to an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.
[0153] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made, using appropriate equivalents, without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, the embodiments will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting. EXAMPLES
[0154] Example 1 - Genome editing efficiency of chemically modified crRNA and tracrRNA To test the compatibility of specific chemical modifications of crRNA with SpyCas9 / base editor (BE) activity, we established a scenario in which cell lines stably express either SpyCas9 or base editor, tracrRNA, and a fluorescent reporter gene (Figure 1A and Figure 1B), but not crRNA. We first screened the activity of different previously designed chemically modified crRNAs (described in WO 2019 / 183000 A1 and WO 2021 / 231606 A2, which are incorporated herein by reference) by electroporation into stable cell lines and quantified the percentage of fluorescent positive cells (reporting on editing activity) using fluorescence-activated cell sorting (FACS). Compared to the terminally modified C0 crRNA, the heavily modified C20 showed a significant enhancement of activity, whereas all of the fully modified crRNAs showed a reduction of activity (Figure 1C). We further confirmed this conclusion using crRNAs targeting various endogenous genomic loci (Figure 1D). We next compared the stability of heavily modified and fully modified crRNAs by incubating them with fetal bovine serum (FBS). Only fully modified crRNAs were found to be stable in FBS (Figure 1E). We note that C20 has six ribose residues containing 3'-phosphorothioates, and although phosphorothioate modifications improve stability compared to unmodified phosphate linkages, substantial degradation still occurs. Thus, the most active CRISPR guide of the present invention (C20) requires further stabilization.
[0155] The protected oligonucleotides used in the examples are listed below in Table 3. The crRNAs used in the examples are listed below in Table 4. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 4-1] [Table 4-2]
[0156] Example 2 - Protective oligonucleotides that enhance crRNA stability without compromising activity and enhance crRNA potency Inspired by the design of short DNA / RNA heteroduplex oligonucleotides (HDOs) (Nishina et al., Nature Communications, 2015) and by the well-established observation that double-stranded RNA is more resistant to nuclease degradation than single-stranded RNA (Lam et al., Molecular Therapy Nucleic Acids, 2015), we attempted to enhance crRNA stability by designing short, fully chemically stabilized oligos that could protect the unmodified region of C20 (Figure 2A). We expected that during pairing of the crRNA repeat region with the tracrRNA anti-repeat region, the protective oligos would be displaced by the invasion of the tracrRNA strand, so that the crRNA / tracrRNA complex required for Cas9 editing could still form. The formation of the crRNA / tracrRNA duplex would simultaneously induce the dissociation of the protective oligos. We found that oligos equal to or longer than 12 nt could protect C20 from nuclease degradation in FBS when annealed to C20 (Figure 2B). We confirmed that the protected oligos did not interfere with SpyCas9 activity by electroporating the C20-protected oligo complexes into stable cell lines (Figure 2C).
[0157] Protective oligos to enhance crRNA potency To test whether the protected oligos that enhanced C20 stability could also increase its potency, we electroporated C20-protected oligo complexes at non-saturating doses and found that the protected oligos significantly enhanced the potency of C20 (Figures 3A and 3B).
[0158] Example 3 - Conjugation to protected oligos enhanced cellular uptake without interfering with crRNA activity The addition of conjugates such as N-acetylgalactosamine (GalNac) and cholesterol (TegChol) to therapeutic oligonucleotides is crucial to achieve potent and targeted in vivo delivery. To test whether conjugation interferes with crRNA activity, we synthesized both crRNA and protected oligos with either GalNac or cholesterol conjugation and tested their activity via electroporation into stable cell lines. It was found that direct conjugation of cholesterol to C20 significantly impaired the activity, whereas C20 with cholesterol-conjugated protected oligo showed no reduction in its activity (Figure 4A). C20 with cholesterol conjugation showed a significant reduction in editing efficiency, whereas conjugation of cholesterol to the protected oligonucleotide did not interfere with its activity (Figure 4B).
[0159] To directly visualize the enhanced cellular uptake of C20 by conjugated protected oligos in vivo, Cy3-labeled C20 was delivered to adult mouse brains by intrastriatal (IS) injection with and without cholesterol- or DHA-conjugated protected oligos. Compared to unconjugated protected oligos, both cholesterol- and DHA-conjugated protected oligos were found to significantly enhance the biodistribution and cellular uptake of C20 (Figure 4C). These data support that protected oligos allow for various types of conjugation and can be used as delivery vehicles to enhance cellular uptake of crRNA without interfering with Cas9 activity. Furthermore, we demonstrated that our engineered crRNA-protected oligo complexes can be efficiently uptaken into cultured mammalian cells without the use of transfection reagents (Figure 4D).
[0160] Example 4 - Chemically modified crRNA with varying phosphorothioate content To test whether C20-protected oligo complexes can be passively taken up into cells (simply by adding them to the medium, without electroporation or transfection), escape endosomes, and support editing, the stable cell line shown in Figure 1B was incubated with 1.5 μm C20-protected oligos targeting an inactivated GFP reporter. Optimal duplex stability between the protected oligo and the crRNA may be necessary for efficient editing (Figure 6). An editing efficiency of about 7% was observed (Figure 5). Because cholesterol is crucial for siRNA uptake into cultured cells [Ly et al., Molecular Therapy Nucleic Acids 2020], further enhancement of editing efficiency is achievable using cholesterol-conjugated protected oligos as shown in Figure 4A.
[0161] Example 5 - In vivo genome editing in adult mouse CNS by co-delivery of AAV and self-delivered crRNA We tested whether the C20-protected oligo complexes could assist genome editing by co-delivery with AAV in vivo. We chose to test it in the double transgenic reporter mouse model Cas9 / mTmG+ / +. This mouse model was generated by crossing homozygous Cas9+ / + mice68 with homozygous mTmG+ / + reporter mice (Muzumdar et al. Genesis. 45:593-605. 2007). The Cas9+ / + mouse model constitutively expresses SpyCas9, and the only transgene delivered by the AAV vector is tracrRNA, simplifying the experimental process. The mTmG+ / + reporter consists of loxP sites on either side of a membrane-targeted tdTomato (mT) cassette that constitutively expresses red fluorescence, and a downstream membrane-targeted EGFP (mG) that cannot be expressed until the mT cassette is deleted (Figure 7A).
[0162] First, scAAV9 expressing tracrRNA was injected into the brains of adult Cas9 / mTmG+ / + mice by IS injection. Two weeks later, another IS injection was performed to deliver unmodified C20 targeting two loxP sites to create a block deletion of the mT cassette and allow mG expression. Then, GFP expression was detected by performing immunohistochemistry (IHC) on formalin-fixed mouse brain sections using an anti-EGFP antibody.
[0163] We chose to test both cholesterol and DHA conjugations, as well as both cleavable and stable linkers to the protected oligos. We also included C20 with a protected oligo without any conjugation, and C20 without a protected oligo as a control.
[0164] IHC staining using anti-EGFP antibody revealed that C20 without protective oligo did not produce any editing in the brain. At the same time, only a few EGFP-positive cells were observed around the injection site with C20 and unconjugated protective oligo. In contrast, C20 with either DHA or cholesterol conjugation, as well as C20 with either cleavable or stable linker, produced more efficient editing with a broader distribution (Figure 7B), which was consistent with the in vivo distribution results quantified in Figure 4B. Within 1 mm around the injection site, 2 Upon quantifying the percentage of EGFP-positive cells within the 3′-HT2+ / 3′-TNFα domain, it was found that DHA conjugation performed better than cholesterol conjugation, and having a cleavable linker further improved distribution and editing efficiency (Figure 7C).
[0165] Example 6 - Chemically modified crRNA with varying phosphorothioate content Adult wild-type B6 mice were used to test C20 targeting the mouse Pcsk9 gene with 14- or 16-nucleotide protection oligos with trivalent GalNac conjugates. Non-targeting control C20 and PBS were also included as controls. First, adult mice were injected with AAV expressing either SpyCas9-ABE8e and tracrRNA (Figure 8A) or SpyCas9 nuclease and tracrRNA (Figure 8B) via retro-orbital (RO) injection and incubated for 5 weeks to allow effector protein expression and accumulation. Then, C20 was injected with and without GalNac-conjugated protection oligos via a single RO injection at 80 mg / kg. Genomic DNA was extracted from mouse liver tissues and editing efficiency was evaluated by performing targeted amplicon deep sequencing. Low but significant editing was seen at the targeted genomic locus by C20 with both lengths of protection oligos, whereas no editing was observed in non-targeted control C20 injected mice (Figures 8A and 8B).
[0166] We next tested whether our codelivery approach could generate therapeutically relevant editing by testing it in a mouse model of HT1. The HT1 mouse model used in this study is Fah PM / PM The mouse has a G to A point mutation in the last nucleotide of exon 8 of the Fah gene, which encodes fumarylacetoacetate hydrolase. This point mutation results in the skipping of exon 8, causing FAH deficiency (Figure 8C). Because FAH catalyzes one step in the tyrosine catabolic pathway, FAH deficiency leads to the accumulation of toxic fumarylacetoacetate and succinylacetoacetate, resulting in damage to multiple organs. Fah PM / PM Mice can be treated with 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), an inhibitor of an upstream enzyme in the tyrosine degradation pathway, to prevent the accumulation of the toxin. Without such treatment, the mice would rapidly lose weight and die. Previously, several studies have shown that Fah PM / PMWe show that a point mutation in mice can be corrected by SpyCas9-ABE delivered by either lipid nanoparticles carrying mRNA and sgRNA or by hydrodynamic tail vein injection of plasmids.
[0167] First, AAV expressing SpyCas9-ABE8e and tracrRNA was injected by RO injection. Five weeks later, Fah PM / PM Mice were given a single 80 mg / kg RO injection of C20 bearing a pre-validated spacer sequence targeting a point mutation with a 14- or 16-nucleotide trivalent GalNac-conjugated protection oligo. Mice were fed NTBC throughout to maintain their weight and allow time for genome editing to occur. Three mice from each group were then sacrificed, liver genomic DNA was extracted, and editing efficiency was measured by targeted amplicon deep sequencing, in addition to detecting FAH-positive hepatocytes via IHC staining using an anti-FAH antibody. For the remaining mice from each group, cycles of NTBC non-administration and administration (7-10 days without administration, followed by 2 days with administration) were repeated for 3 months to expand FAH-positive hepatocytes, and the weight of the mice was monitored to test whether genome editing by the co-delivery approach of the present invention could correct the phenotype of this mouse model (Figure 8D).
[0168] Before NTBC cessation, low but significant on-target editing was observed in the co-delivery treatment group (Figure 8E). After NTBC cessation, PBS-injected mice rapidly lost weight, losing less than 80% of their body weight, and were humanely sacrificed after moribundity. Mice treated with SpyCas9-ABE8e and tracrRNA-expressing AAV, as well as C20 with protective oligos, gradually gained weight over time (Figure 8F). Next, after 3 months of NTBC cycles, mice were sacrificed, and IHC staining was performed on liver sections using anti-FAH antibodies. Proliferation of FAH-positive hepatocytes was observed in liver tissues treated with AAV co-delivery (Figure 8G). These data support that in vivo genome editing in the liver can be achieved and provide therapeutic benefits by systemically delivering C20 and GalNac-conjugated protective oligos together with effector proteins and tracrRNA-expressing AAV.
[0169] Example 6 - Optimizing the dosing regimen to improve editing efficiency The editing efficiency achieved in the liver, although significant, was low. We next attempted to improve the efficiency by optimizing the dosing regimen. The asialoglycoprotein receptor (ASGPR), which is expressed on the surface of hepatocytes and is responsible for the uptake of GalNac-conjugated oligos, has a recycling time of approximately 10-15 min. Data from previous studies have also shown that hepatocytes can only take up a limited amount of GalNac-conjugated molecules after bolus intravenous injection due to ASGPR saturation. In our initial study of 77, we injected a single dose of 80 mg / kg C20 with GalNac-conjugated protected oligos, far exceeding the available ASGPR capacity. We concluded that by splitting the oligos into three consecutive RO injections per day at one-third of the previous dose (26 mg / kg) instead of a single high dose, more oligos could be delivered to hepatocytes, and therefore the editing efficiency could be increased (Figure 9A).
[0170] To test this idea, we first RO-injected AAVs expressing SpyCas9-ABE8e and tracrRNA into B6 mice. Then, 5 weeks later, we performed 3 daily consecutive RO injections of C20 targeting the Pcsk9 gene complexed with a 14-nt GalNac-conjugated protection oligo at 26 mg / kg. We then harvested mouse liver genomic DNA and performed targeted amplicon deep sequencing to measure editing efficiency. We found that compared to a single dose of 80 mg / kg oligo, 3 daily consecutive doses of 26 mg / kg significantly improved editing efficiency (Figure 9B). In addition, we did not observe any signs of toxicity in the liver upon re-administration, and oligo-treated mice were in good health, similar to PBS-injected mice. These data indicate that repeated administration of crRNA is possible and can be well tolerated, and optimization of the dosing regimen may further improve editing efficiency.
[0171] Example 7 - Optimizing the dosing regimen to improve in vivo editing efficiency Next, the mechanism of protected oligo activity was further investigated. We compared the activity of C20 with protected oligonucleotides of different lengths, i.e., protected oligonucleotides annealing to different regions of C20 (Figure 10). We found that short protected oligos, such as 10 nucleotides (PO1), enhanced C20 potency, but to a lesser extent than the protected oligonucleotide of 14 nucleotides (PO7), likely due to a lower melting temperature limiting the extent of C20 protection. Conversely, we found that longer POs (up to 22 nucleotides for PO16, with the nucleotide sequence 5'-GCACAAAAAACNNNNNNNNNNNN-3') reduced the potency of C20, likely due to strong binding affinity that inhibits early tracrRNA annealing, and / or protected oligo substitution. Furthermore, the position at which the protected oligo is attached is also important (Figure 10A). A 16-nt protection oligo (B10 with the sequence 5'-ACCAUAGCUCUAAAAC-3'), which does not leave a foothold for the initial tracrRNA annealing, also reduced activity, consistent with our hypothesis that the protection oligo must be displaced by the tracrRNA before C20 becomes active (Figure 10A). Finally, we found that the protection oligo did not inhibit or enhance the potency of the fully modified and stabilized crRNA (C40), implying that the enhanced potency conferred by the protection oligo resulted in the stabilization of C20 (Figure 10B).
Claims
1. Protected oligonucleotide, (a) A sequence complementary to CRISPR RNA (crRNA), (b) comprising at least one chemically modified nucleotide, The protective oligonucleotide can bind to the crRNA, and The protective oligonucleotide, upon binding, confers nuclease resistance to the crRNA.
2. The protected oligonucleotide according to claim 1, wherein the at least one chemically modified nucleotide includes modifications of a ribose group, a phosphate group, a nucleic acid base, or a combination thereof.
3. The protected oligonucleotide according to claim 2, wherein the modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2(2'-amino), 4'-thio, bicyclic nucleotide, locked nucleic acid (LNA), 2'-(S)-constrained ethyl (S-cEt), constraint MOE, and 2'-O,4'-C-aminomethylene-bridged nucleic acid (2',4'-BNANC).
4. It further comprises at least one site that is bonded to the protective oligonucleotide, optionally, The at least one of the aforementioned sites is attached to the 5' end and / or the 3' end of the protective oligonucleotide, The at least one of the sites increases the cellular uptake of the protective oligonucleotide, or The protective oligonucleotide according to any one of claims 1 to 3, wherein the at least one site promotes the specific tissue distribution of the protective oligonucleotide.
5. The aforementioned at least one site is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endogenous cannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains. The at least one of the aforementioned sites is selected from the group consisting of cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanic acid (DCA), litcholic acid (LA), N-acetylgalactosamine (GalNAc), amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3, or The protective oligonucleotide according to claim 4, wherein at least one of the sites is bonded to the protective oligonucleotide via a linker, and optionally the linker is selected from the group consisting of ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, and block copolymers.
6. The at least one site is linked to the protective oligonucleotide via a linker, and the at least one site is a modified lipid, optionally, The modified lipid is a branched lipid, The modified lipid is a branched lipid of formula I, Formula I: X-MC(=Y)M-Z-[L-MC(=Y)MR]n, During the ceremony, X is the site that links the lipid to the guide RNA, Each Y is independently oxygen or sulfur, and each M is independently CH2, NH, O, or S. Z is a branching group that allows two or three ("n") strands to bind to chemically modified guide RNA. L is any linker part, and Each R is independently a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group with a length of 2 to 30 atoms. The modified lipid is a head-modified lipid, or The modified lipid is the head-modified lipid of formula II, Formula II: X-MC(=Y)M-Z-[L-MC(=Y)MR]n-L-KJ, During the ceremony, X is the site that links the lipid to the guide RNA, Each Y is independently either oxygen or sulfur. Each M is independently CH2, NH, N-alkyl, O, or S. Z is a branching group that allows two or three ("n") strands to bind to chemically modified guide RNA. Each L is an independent, arbitrary linker part. R is a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group with a length of 2 to 30 atoms. K is a phosphate, sulfate, or amide, and The protected oligonucleotide according to claim 4, wherein J is an aminoalkane or a quaternary aminoalkane group.
7. It is a double-stranded oligonucleotide, (a) CRISPR RNA (crRNA) comprising (i) a guide sequence portion that can hybridize to a target polynucleotide sequence, and (ii) a repeat sequence portion, (b) comprising a protective oligonucleotide complementary to the crRNA, The crRNA contains at least 50% modified nucleotides, and The protective oligonucleotide is the double-stranded oligonucleotide comprising at least one chemically modified nucleotide.
8. A genome editing system comprising a double-stranded oligonucleotide according to claim 7, a transactivated crRNA (tracrRNA) having an anti-repeating nucleotide sequence complementary to the repetitive sequence portion of the crRNA, or an AAV vector encoding the tracrRNA.
9. The crRNA modification pattern consists of the following: mN#mN#mN#mNmNmNmNmNmNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU(Sequence No. 3)(crRNA20); The double-stranded oligonucleotide according to claim 7, wherein rN = RNA, mN = 2'-O-methylRNA, fN = 2'-fluoroRNA, N#N = phosphorothioate bond, and N = any nucleotide.
10. The protective oligonucleotide includes a modification pattern selected from the group consisting of the following: mUmAmAmAmAmAmCmNmNmNmNmNmNmNmN (RC09); mAmAmAmAmCmNmNmNmNmN (RC01); mAmAmAmAmAmCmNmNmNmNmN (RC02); mAmAmAmAmCmNmNmNmNmNmN (RC03); mAmAmAmAmAmCmNmNmNmNmNmN (RC04); mUmAmAmAmAmAmCmNmNmNmNmNmN (RC05); mAmAmAmAmAmCmNmNmNmNmNmNmN (RC06); mUmAmAmAmAmAmCmNmNmNmNmNmNmN (RC07); mCmUmAmAmAmAmAmCmNmNmNmNmNmNmN (RC08); mCmUmAmAmAmAmAmCmNmNmNmNmNmNmNmN (RC10); mU#mA#mAmAmAmCmNmNmNmNmN#mN#mN (RC07-2PS); and mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN (RC07-3PS), A protected oligonucleotide according to claim 1, or a double-stranded oligonucleotide according to claim 7, wherein mN = 2'-O-methylRNA, N#N = phosphorothioate bond, and N = any nucleotide.
11. The double-stranded oligonucleotide according to claim 7, comprising a crRNA modification pattern selected from any of crRNA1 to 134 in Table 2.
12. The genome editing system according to claim 8, wherein the crRNA binds to the tracrRNA to form a guide RNA.
13. The genome editing system according to claim 12, wherein the guide RNA binds to a Cas9 nuclease selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).
14. A method for in vitro editing a target region of the genome within a cell, below: crRNA and, A protective oligonucleotide according to claim 1, wherein the protective oligonucleotide is complementary to the crRNA and capable of binding to the crRNA, One or more trans-activated crRNAs (tracrRNAs) and The process includes delivering a genome editing system to the cell comprising an RNA-induced nuclease or a polynucleotide encoding the RNA-induced nuclease, optionally, The expression of the genome is knocked out or knocked down, The method wherein the RNA-inducible nuclease or a polynucleotide encoding the RNA-inducible nuclease and the one or more tracrRNAs are delivered before the one or more crRNAs or the protective oligonucleotides.
15. The protective oligonucleotide according to claim 4, further comprising a linker that connects the 3' end of the protective oligonucleotide to the at least one site, wherein the linker is optionally cleavable.