Epstein-Barr virus vaccine

JP2025524459A5Pending Publication Date: 2026-06-15BAVARIAN NORDIC AS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575454
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-29
Filing Date
2023-06-29
Publication Date
2026-06-15

Smart Images

  • Figure 00000040_0000
    Figure 00000040_0000
  • Figure 00000041_0000
    Figure 00000041_0000
  • Figure 00000041_0001
    Figure 00000041_0001
Patent Text Reader

Abstract

The present invention relates to a virus vector-based vaccine for the delivery of antigens targeting infectious diseases. Specifically, the present invention relates to recombinant modified vaccinia virus Ankara (MVA) encoding antigens of Epstein-Barr virus (EBV) that cause infectious mononucleosis (IM) and different cancer types. The present invention further relates to the medical use of recombinant MVA in the prevention of diseases caused by EBV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of vaccines. More specifically, the present invention relates to a virus vector-based vaccine for the delivery of antigens targeting infectious diseases. In particular, the present invention relates to a recombinant modified vaccinia virus Ankara (MVA) encoding antigens of Epstein-Barr virus (EBV) that cause infectious mononucleosis (IM) and different cancer types. The present invention also relates to a recombinant MVA encoding some EBV antigens such as EBV glycoproteins and transcriptional transactivators. The present invention further relates to the medical use of recombinant MVA in the prevention of diseases caused by EBV.

Background Art

[0002] Epstein-Barr virus (EBV) is an oncogenic gammaherpesvirus that causes acute infectious mononucleosis (AIM) and is associated with the development of several human malignancies. Approaches for the development of EBV vaccines are limited, in part, due to the oncogenic potential of the EBV genome and the lack of animal models for testing vaccine candidates. The EBV envelope glycoprotein, gp350 / 220, has been proposed as a vaccine antigen. However, in small-scale Phase I / II clinical trials, vaccination with either a vector construct expressing gp350 / 220 or a purified recombinant gp350 protein reduced the incidence of acute infectious mononucleosis (AIM) in young adults but did not prevent EBV infection. Importantly, recombinant EBVΔgp350 / 220 can infect both epithelial cells and primary B cells in vitro. Previous studies have shown that immunity against gp350 / 220 can limit infection, while the low success rate when using gp350 / 220 as a single vaccine antigen requires an innovative approach utilizing multiple EBV proteins.

[0003] At least four EBV gp350 / 220 vaccine candidates have been tested in "clinical trials", for example, vaccinia vectors expressing gp350 / 220 (Gu et al., 1995 (Phase I Chinese cohort, EBV-naive children aged 1 - 3 years), and recombinant gp350 (unspliced variant) in CHO cells (3-dose regimen adjuvanted with ASO4) (Jackman et al., 1999, Moutchen et al., 2007. (Phase I / II) Safety and immunogenicity in EBV-naive Belgians aged 18 - 37 years; Sokal et al., 2007. Phase I randomized, double-blind placebo-controlled in EBV-naive Belgians aged 16 - 25 years; Rees et al., 2009. Phase I in children waiting for organ transplantation with chronic kidney disease (UK)), etc. However, none of these vaccine candidates achieved complete blockade of EBV infection.

[0004] In particular, the EBNA1 antigen, LMP2 antigen, and gp350 / 220 antigen have been developed as vaccine candidates against EBV infection and EBV+ cells, tested independently in various clinical trials, and have yielded promising results.

[0005] Candidate vaccines in clinical trials include MVA vectors expressing EBNA-1 and LMP1 or LMP2 (Taylor et al, 2004 construction of the MVA vector expressing EBNA1 and or LMP2, Hui et al., 2013 - EBNA1-LMP2 (Phase I targeting NPC patients in China), Taylor et al, 2014 EBNA1-LMP2 (Phase I trial in UK patients with EBV-positive cancers), and adoptive transfer of PBMCs for the treatment of PTLD and NPC (Louis, et al., 2009, 2010, Heslop et al. 1996 T cells adoptive Transfer; and Chia et al., 2012 Phase I targeting NPC patients in China. Transducing dendritic cells with an adenovirus vector expressing ΔLMP1-LMP2). In a recent Phase I clinical trial of a recombinant modified vaccinia Ankara (MVA) vector encoding a deletion of the Gly-Ala region from the EBNA1 sequence fused to LMP2 as a vaccine candidate, strong EBV-specific CD4+ and CD8+ T cell responses were induced in humans. However, the strategies used to deliver these two important EBV antigens, which are known to have oncogenic potential, can pose major health risks, especially in immunosuppressed individuals. Furthermore, these vaccine candidates cannot generate neutralizing antibodies to eliminate reactivation or new EBV infections due to the selection of non-structural viral proteins as antigens.

[0006] Therefore, there is an urgent need for a safe EBV vaccine that prevents EBV infection and / or limits the symptoms of EBV disease, which would also reduce the burden of EBV-induced malignancies by preventing infection or at least better controlling it. SUMMARY OF THE INVENTION

[0007] The object of the present invention is to provide a vaccine against EBV infection and related diseases. In particular, it is an object to provide such a vaccine that involves an antibody response against T cells as well as vaccine candidates.

[0008] The inventors have found that a multivalent EBV vaccine based on the MVA-BN vaccine vector induces strong antibody and T cell responses. The compositions and techniques disclosed herein meet the needs in the art.

[0009] In one aspect, the present invention relates to a recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2, and BARF1. In some embodiments, the T cell antigens include EBNA1, EBNA2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA leader protein, latent membrane protein 1 (LMP1), and LMP2. In some embodiments, the MVA further includes BRLF1 and BZLF1 proteins.

[0010] In a related aspect, the present disclosure relates to a pharmaceutical composition comprising a therapeutically effective amount of a recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, and any other known EBV envelope glycoproteins, such as gM, gN, BMRF2, BDLF2, BDLF3, BILF2, BILF1, and BARF1. In some embodiments, the T cell antigens include Epstein-Barr virus nuclear antigen 1 (EBNA1), EBNA2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA leader protein, and / or LMP1 and LMP2. In some embodiments, the MVA further includes BRLF1 and BZLF1 proteins.

[0011] In some embodiments, the vaccine composition or the pharmaceutical composition further comprises one or more additional pharmaceutically acceptable antigens. In some embodiments, the pharmaceutical composition further comprises one or more adjuvants. In some embodiments, the vaccine composition or the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.

[0012] In related aspects, the invention relates to a method of inducing an immune response in a subject, the method comprising administering a pharmaceutical composition to a subject in need thereof, the immune response being a broad antibody or T cell response against an EBV antigen in a human subject.

[0013] In related aspects, the invention relates to a method of preventing or treating an EBV infection or a condition associated with EBV infection, the method comprising administering a prophylactically or therapeutically effective amount of the above poxvirus or pharmaceutical composition to a subject in need thereof.

[0014] In related aspects, the invention relates to an immunization regimen comprising administering a prophylactically or therapeutically effective amount of MVA, or one or more doses of the pharmaceutical composition described above, to a subject in need thereof.

[0015] In related aspects, the invention relates to a recombinant poxvirus or pharmaceutical composition for use in a method of preventing or treating an EBV infection or a condition associated with an EBV infection.

[0016] In related aspects, the invention relates to a recombinant poxvirus or pharmaceutical composition for use in a method of inducing an immune response in a subject, the method of inducing an immune response in a subject comprising obtaining an immune response against one or more EBV antigens in a human subject by administering the pharmaceutical composition of the invention to a subject in need thereof.

[0017] These and other objects of the invention will be described in more detail together with the detailed description of the invention.

[0018] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate some embodiments of the invention and, together with the description, serve to explain the principles of the invention.

Brief Description of the Drawings

[0019]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

[0020] Brief Description of the Sequences SEQ ID NO: 1 shows the nucleic acid sequence (1455 nucleotides) of the gp350 multimer. SEQ ID NO: 2 shows the nucleic acid sequence of gH (2121 nucleotides). SEQ ID NO: 3 shows the nucleic acid sequence of gL (414 nucleotides). SEQ ID NO: 4 shows the nucleic acid sequence of BZLF1-BRLF1 (2283 nucleotides). SEQ ID NO: 5 shows the nucleic acid sequence of EBNA-3A (2892 nucleotides). SEQ ID NO: 6 shows the DNA sequence of one loxP V site. SEQ ID NO: 7 shows the nucleic acid sequence of the Pr13.5 long promoter. SEQ ID NO: 8 shows the nucleic acid sequence of the PrS promoter. SEQ ID NO: 9 shows the nucleic acid sequence of the PrH5m promoter. SEQ ID NO: 10 shows the nucleic acid sequence of the Pr1328 promoter. DETAILED DESCRIPTION OF THE INVENTION

[0021] Next, exemplary embodiments of the present invention are described in detail, and examples thereof are shown in the accompanying drawings.

[0022] Expression systems, vectors, viruses, vaccine / pharmaceutical compositions for use in preventing or treating EBV infections are provided herein. The single multivalent EBV subunit vaccine described in detail below stimulates both humoral (antibody) immunity and T cell-mediated immunity, and can elicit both preventive and therapeutic antiviral responses against EBV infections and EBV-related malignancies. As contemplated by the present invention, by expressing at least two EBV envelope proteins and at least one T cell antigen, it is aimed to increase the breadth of antibodies against EBV and the T cell immune response, thereby increasing the protective effect of the vaccine.

[0023] EBV uses multiple glycoproteins to initiate host cell invasion and infection, and targets these glycoproteins as potential prophylactic vaccine candidates. gp350, gB, gp42, and the gH / gL complex or the BMRF2 / BDLF2 complex are adhesion / fusion glycoproteins that mediate EBV entry into host cells. They are expressed on virions and in infected cells and stimulate humoral and cellular immune responses in human and animal models. The gp350-cell receptor interaction initiates EBV attachment to B cells and causes endocytosis of the virion. This interaction enhances, but is not essential for, infection. All previous clinical trials using the gp350 protein as the sole target protein to induce neutralizing antibodies have failed.

[0024] Antibodies provide the first line of defense of the adaptive immune system against viral infection. Neutralizing antibodies (nAbs) against EBV envelope glycoproteins are present in humans, may prevent neonatal infection, and are generated in response to human immunization. However, limited evidence of persistent EBV infection and immune selection of viral antigenic variants indicates that in vivo neutralization of EBV infection is suboptimal. Therefore, it is important to develop a multivalent EBV vaccine that stimulates both arms of the immune system to induce strong humoral and cellular responses.

[0025] The ability of gB and gH / gL antibodies to neutralize infection is well conserved among herpes simplex virus-1, cytomegalovirus, and Kaposi's sarcoma-associated herpesvirus. Furthermore, gB functions as a fusion machinery, and the gp42 and gH / gL complexes confer host cell specificity that mediates EBV entry into B cells and epithelial cells, respectively. Importantly, the gp42 protein is unique to EBV, and recombinant EBV lacking gp42 or gH does not infect either epithelial cells or primary B cells.

[0026] Although the specific functions of some viral protein subunits have been studied, the selection of appropriate viral protein subunits is highly important and unpredictable for the production of effective vaccines. The major EBV surface glycoprotein gp350 / 220 (gp350) has been proposed as an important antigen, but attempts over the past 40 years to develop a strong gp350-based vaccine have shown limited success. In four independent Phase I / II clinical trials, vaccination with vector constructs expressing gp350, or purified recombinant unspliced variant gp350 soluble protein, did not prevent EBV infection, but infectious mononucleosis decreased in young adults.

[0027] The selection of an appropriate platform is also important and unpredictable. Vaccinia virus (MVA) as disclosed herein allows for the inclusion of multiple selected surface glycoproteins and intracellular T cell antigens in a multivalent vaccine.

[0028] Similar to other herpesviruses, EBV uses multiple surface glycoproteins to enter various cell types. Therefore, to overcome the limitation of using only gp350 to prevent EBV infection, it is necessary to include multiple glycoproteins in the vaccine. Disclosed herein is a platform for expressing and presenting multiple EBV surface glycoproteins (gp350, gB, gp42, or gH / gL) to induce antibodies that can neutralize EBV infection in vivo.

[0029] Current opinion in the art is that protection against EBV depends not only on the induction of nAbs but also on the induction of CD4+ and CD8+ T cell immune responses specific for viral latent antigens (EBNA-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-LP, LMP1, or LMP2). Therefore, current EBV vaccine candidates have focused on enhancing such responses.

[0030] The major limitations of vaccines in previous preclinical and clinical trials are that none of the vaccines create sterile immunity (i.e., complete blockade of viral infection), and most strategies target only one arm of the immune system, either humoral or T cell-mediated. Even when both arms of the immune system are targeted by a single vaccine, such as the use of EBV DNA packaging variants, vaccine candidates have problems with limited immunogenicity, safety concerns, and the inability to induce a strong CD8+ T cell response.

[0031] Accordingly, disclosed herein is a novel single prophylactic and therapeutic multivalent poxvirus / MVA vaccine comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the MVA vaccine comprises two, three, four, five, or more EBV envelope glycoproteins. In some embodiments, the MVA vaccine comprises two or more T cell antigens. In some embodiments, the MVA envelope glycoproteins include gp350, gB, gp42, gH, gL, and any other known EBV envelope glycoproteins, such as gM, gN, BMRF2, BDLF2, BDLF3, BILF2, BILF1, and BARF1. In some embodiments, the T cell antigen includes EBNA-3A or any other EBV antigen. In some embodiments, the MVA vaccine comprises six selected proteins including three EBV envelope glycoproteins: gp350, gH, and gL, and one T cell antigen: EBNA3A. In some embodiments, in addition to the EBV envelope glycoproteins and T cell antigens, the MVA further comprises BRLF1 and BZLF1 proteins. In some embodiments, the MVA vaccine further comprises one or more adjuvants.

[0032] In some embodiments, disclosed herein is a single vector that co-expresses two or more EBV envelope glycoproteins including gp350, gB, gp42, gH, and gL, where each glycoprotein is separated from another glycoprotein. Generally, the antigenicity of the expressed vaccine glycoproteins should be as similar as possible to their counterparts in the EBV virion. Non-structural EBV proteins that function as T cell targets are modulators of host cell functions and it is necessary to inactivate their respective activities to avoid undesirable effects of the vaccine.

[0033] In some embodiments disclosed herein, the expressed EBV envelope glycoproteins, T cell antigens, and other proteins can be expressed by any suitable expression vector including plasmid vectors and viral vectors. In some embodiments, a modified vaccinia virus Ankara vector can be used for co-expression of two or more EBV envelope glycoproteins. The individual glycoproteins and other vaccine target proteins can be linked by cleavage sequences such that the co-expressed glycoproteins and other proteins can self-cleave and self-assemble into two or more glycoprotein and other complexes.

[0034] According to the embodiments described herein, an immunization regimen is provided. The immunization regimen includes MVA containing two or more EBV envelope glycoproteins and one or more T cell antigens. The immunization regimen can be administered via prime / boost homologous (e.g., using only the same vaccine type) vaccination. The immunization regimen may be administered in a dose vaccination schedule that includes two or more immunizations, and may be administered at intervals of one week to twelve months. Other suitable immunization schedules or regimens known in the art may be used according to the embodiments described herein by those of ordinary skill in the art.

[0035] In some embodiments, nucleic acid sequences encoding two or more EBV envelope glycoproteins are assembled into a single vector using a linker sequence inserted between nucleic acid sequences encoding two or more subunits.

[0036] The vaccine compositions described herein may contain a therapeutically effective amount of the MVA described herein and may further contain a pharmaceutically acceptable carrier by standard methods. Examples of acceptable carriers include physiologically acceptable solutions such as sterile saline and sterile buffered saline.

[0037] In some embodiments, the vaccine or pharmaceutical composition can be used in combination with a pharmaceutically effective amount of an adjuvant to enhance the anti-EBV effect. Any immunological adjuvant that itself does not have a specific antigenic effect but can stimulate the immune system and increase the response to the vaccine can be used as the adjuvant. Many immunological adjuvants mimic evolutionarily conserved molecules known as pathogen-associated molecular patterns (PAMPs) and are recognized by a set of immune receptors known as Toll-like receptors (TLRs). Examples of adjuvants that can be used according to the embodiments described herein include Alum, Freund's complete adjuvant, Freund's incomplete adjuvant, double-stranded RNA (TLR3 ligand), LPS, LPS analogs such as monophosphoryl lipid A (MPL) (TLR4 ligand), flagellin (TLR5 ligand), lipoproteins, lipopeptides, single-stranded RNA, single-stranded DNA, imidazoquinoline analogs (TLR7 and TLR8 ligands), CpG DNA (TLR9 ligand), LibiAdjuvant (monophosphoryl lipid A / dicorynoycolate trehalose), glycolipids (α-GalCer analogs), unmethylated CpG islands, oil emulsions, liposomes, virosomes, saponins (active fractions of saponins such as QS21), muramyl dipeptide, alums, aluminum hydroxide, squalene, BCG, cytokines such as GM-CSF and IL-12, chemokines such as MIP1-α and RANTES, activating cell surface ligands such as CD40L, N-acetylmuraminyl-L-alanyl-D-isoglutamine (MDP), and thymosin α1. The amount of adjuvant used can be appropriately selected according to the degree of symptoms such as skin flexibility, pain, erythema, fever, headache, and myalgia, which can be expressed as part of the immune response in humans or animals after administration of this type of vaccine.

[0038] In further embodiments, as discussed above, the use of the vaccine of the invention with various other adjuvants, drugs, or additives can enhance the therapeutic effect achieved by administration of the vaccine or pharmaceutical composition. Pharmaceutically acceptable carriers can contain minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such additives should be non-toxic to human or other mammalian subjects at the dosages and concentrations used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and their salts, antioxidants such as ascorbic acid, low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptides), proteins (e.g., serum albumin, gelatin, and immunoglobulins), amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine), monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and its derivatives, glucose, mannose, and dextrin), chelating agents (e.g., EDTA), sugar alcohols (e.g., mannitol and sorbitol), counterions (e.g., sodium), non-ionic surfactants (e.g., polysorbate and poloxamer); antibiotics; and PEG.

[0039] The vaccines or pharmaceutical compositions containing MVA described herein can be stored as aqueous solutions or lyophilized products in unit dose or multi-dose containers such as sealed ampoules or vials.

[0040] The expression systems, vectors, and vaccines described herein can be used to treat or prevent any EBV infection or EBV infection-related condition, such as EBV+ lymphoma, carcinoma, PTLD, multiple sclerosis, etc., among other diseases.

[0041] In some embodiments, the vaccine composition or pharmaceutical composition described herein is administered by intranasal or respiratory inhalation, or by intravascular (i.v.) (e.g., intra-arterial, intravenous, and portal vein), subcutaneous (s.c.), intracutaneous (i.c.), intradermal (i.d.), or intraperitoneal (i.p.) injection directly into a local site, a suspension of MVA prepared by suspending MVA in PBS (phosphate buffered saline), saline, or other formulations. The vaccines or pharmaceutical compositions of the present invention can be administered multiple times. More specifically, after the first administration, one or more additional vaccinations may be given as boosters. With one or more booster administrations, the desired effect can be enhanced. After administration of the vaccine or pharmaceutical composition, booster immunization with the pharmaceutical composition containing MVA described herein may be performed.

[0042] Definitions Before the present invention is described in detail below, it is to be understood that, since the specific methodologies, protocols, and reagents described herein can vary widely, the invention is not limited thereto. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the invention, which is defined only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0043] As used herein, it should be noted that the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a nucleic acid" includes one or more of such nucleic acid sequences, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that can be modified or substituted for the methods described herein.

[0044] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood as referring to every element in that series. One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0045] As used herein, the conjunction "and / or" between a plurality of recited elements is to be understood to include both alternative and combined choices. For example, if two elements are joined by "and / or", a first alternative refers to the first element being applicable without the second element. A second alternative refers to the second element being applicable without the first element. A third alternative refers to the first and second elements being applicable together. Any one of these alternatives is included in this meaning and thus understood to satisfy the requirements of the term "and / or" as used herein. The ability to apply multiple alternatives simultaneously is also included within the scope of its meaning and is therefore understood to satisfy the requirements of the term "and / or".

[0046] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise," and variations such as "comprises" and "comprising," will be understood to mean the inclusion of a stated integer or step, or group of integers or steps, but not the exclusion of other integers or steps, or group of integers or steps. When used in the context of a describing aspect or embodiment of the invention, the term "comprising" is modifiable and thus can be replaced with the term "containing" or "including," or, as used herein, the term "having." Similarly, all of the foregoing terms (comprising, containing, including, having), whenever used in the context of a describing aspect or embodiment of the invention, include the terms "consisting of" or "consisting essentially of," each of which carries a specific legal meaning depending on the jurisdiction.

[0047] As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0048] The term "virus" refers to viruses, viral particles, and viral vectors. This term includes wild-type viruses, recombinant and non-recombinant viruses, live viruses, and live-attenuated viruses.

[0049] The term "recombinant MVA" as used herein refers to an MVA that contains an exogenous nucleic acid sequence inserted into its genome that is not naturally present in the parental virus. Thus, a recombinant MVA refers to an MVA that is produced by artificially combining two or more segments of nucleic acid sequences of synthetic or semi-synthetic origin that are not present in nature or are joined to another nucleic acid in an arrangement not found in nature. The artificial combination is most commonly achieved by artificially manipulating isolated nucleic acid segments using established genetic engineering techniques. Generally, the "recombinant MVA" described herein refers to an MVA that is produced by standard genetic engineering methods and thus, for example, a recombinant MVA is an MVA in which a gene has been manipulated or a gene has been modified. Thus, the term "recombinant MVA" includes an MVA in which at least one recombinant nucleic acid has been incorporated into its genome, preferably in the form of a transcription unit (e.g., MVA-BN). A transcription unit may contain a promoter, enhancer, terminator, and / or silencer. The recombinant MVA of the present invention can express a heterologous antigenic determinant, polypeptide, or protein (antigen) upon induction of a regulatory element, such as a promoter.

[0050] The "percent sequence homology (%) or percent sequence identity (%)" with respect to a nucleic acid sequence described in this specification is defined as the percentage of nucleotides within a candidate sequence that are identical to the nucleotides within a reference sequence (i.e., the nucleic acid sequence from which it is derived), after aligning the sequences and introducing gaps (which are conventional steps for performing sequence alignment to assess homology or identity), and, if necessary, so as to maximize the percent sequence identity and also not considering any conservative substitutions as part of the sequence identity. The alignment for determining the percent nucleotide sequence identity or percent sequence homology can be performed in a variety of ways within the skill of the art, using publicly available computer software such as, for example, software such as BLAST, ALIGN, or Megalign (DNASTAR). Those of ordinary skill in the art can determine appropriate parameters for measuring the alignment. This includes any algorithm necessary to achieve the maximum alignment over the full length of the sequences being compared.

[0051] For example, suitable alignment of nucleic acid sequences is provided by the following local homology algorithm: Smith and Waterman, (1981), Advances in Applied Mathematics 2:482-489. This algorithm can be applied to amino acid sequences by using a scoring matrix developed as follows: Dayhoff, Atlas of Protein Sequences and Structure, M.O. Dayhoff ed., 5 suppl.3:353-358, National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov (1986), Nucl. Acids Res. 14(6):6745-6763. An exemplary implementation of this algorithm for determining percent identity of sequences in the "BestFit" utility application is provided by the Genetics Computer Group (Madison, Wis.). The default parameters for this method are described in the Wisconsin Sequence Analysis Package Programs Manual, Version 8 (1995) (available from Genetics Computer Group, Madison, Wis.). In the context of the present invention, a preferred method for determining percent identity is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif.). From this set of packages, the Smith-Waterman algorithm can be used, in which case the default parameters are used for the scoring table (e.g., gap open penalty: 12, gap extension penalty: 1, gap: 6). From the generated data, "sequence identity" is reflected in the "match" value.Other suitable programs for calculating the percent identity or percent similarity between arrays are generally known in the art. For example, another alignment program is BLAST, which is used with default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expectation value = 10; matrix = BLOSUM62; description = 50 sequences; rearrangement = HIGH SCORE; database = non-redundant; GenBank+EMBL+DDBJ+PDB+GenBank CDS translation+Swiss protein+Spupdate+PIR. Details of these programs can be found at the Internet address http: / / http: / / blast.ncbi.nlm.nih.gov / .

[0052] As used herein, the term "CD4+ or CD8+ T cell response" refers to a T cell immune response characterized by observing a high proportion of immunogen-specific CD4+ T cells or CD8+ T cells within the population of total responsive T cells after vaccination. The total immunogen-specific T cell response can be determined by an IFN-γ ELISPOT assay. The immunogen-specific CD4+ or CD8+ T cell immune response can be determined by an ICS assay.

[0053] The term "adjuvant" is defined as one or more substances that cause stimulation of the immune system. In this regard, adjuvants are used to enhance the immune response to the plasmids and / or MVA vectors of the present application.

[0054] The term "recombinant" molecule refers to a molecule generated using molecular biology techniques. Thus, a "recombinant DNA molecule" refers to a DNA molecule composed of segments of DNA that have been joined together by molecular biology techniques. As used herein, "recombinant protein" or "recombinant polypeptide" refers to a protein molecule expressed using a recombinant DNA molecule.

[0055] When referring to the relationship between nucleic acid sequences and / or amino acid sequences, the terms "operable combination" and "operably linked" refer to linking (i.e., fusing) the sequences in-frame so that the sequences perform their intended functions. For example, operably linking a promoter sequence to a nucleotide sequence of interest refers to linking the promoter sequence and the nucleotide sequence of interest in such a way that the promoter sequence can direct the synthesis of the nucleotide sequence of interest and / or the polypeptide encoded by the nucleotide sequence of interest.

[0056] "Epstein - Barr virus", "EBV", "human herpesvirus 4", and "HHV - 4" interchangeably refer to the oncogenic human herpesvirus. EBV is the cause of infectious mononucleosis (AIM, also known as glandular fever). It is associated with, for example, the following specific forms of cancer: Hodgkin lymphoma, Burkitt lymphoma, nasopharyngeal carcinoma, and diseases associated with human immunodeficiency virus (HIV) (e.g., hairy leukoplakia and central nervous system lymphoma). EBV infects B cells and epithelial cells of the immune system. When the initial lytic infection of the virus is controlled, EBV can potentially persist within the individual's B cells for the remainder of the individual's life through a complex life cycle that includes alternating latent and lytic phases.

[0057] "Symptoms of EBV infection" include the presence of infectious mononucleosis (AIM, also called glandular fever) and / or EBV - associated cancer. "EBV - associated cancer" refers to cancers (e.g., Hodgkin lymphoma, Burkitt lymphoma, nasopharyngeal carcinoma, cervical cancer, hairy leukoplakia, and central nervous system lymphoma) that are at least partially caused and / or exacerbated by EBV infection.

[0058] The terms "antigen", "immunogen", "antigenic", "immunogenic", "antigenic activity", and "immunologically active" when referring to a molecule refer to any substance capable of inducing a specific humoral and / or cellular immune response. In certain embodiments, an antigen comprises at least a portion or extracellular domain.

[0059] "EBV antigen" refers to an antigen derived from EBV (e.g., "gB, gH, gL, and gp350 / 220") and a tumor-related EBV antigen.

[0060] The term "EBV envelope glycoprotein" includes gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2, and BARF1. The term "T cell antigen" refers to EBNA1, EBNA2, EBNA3a, EBNA3b, EBNA3c, EBNA leader protein, and LMP2.

[0061] The term "gp350 / 220" is a major EBV envelope protein. The interaction between EBV gp350 / 220 and complement receptor type 2 (CR2) CD21 and / or (CR1) CD35 on B cells is necessary for cell adhesion and the initiation of latent infection (SEQ ID NO: 1).

[0062] The term "gH" refers to the glycoprotein gp85 precursor of human herpesvirus 4, exemplified by SEQ ID NO: 2, NCBI reference sequence: YP_401700.1.

[0063] The terms "gL" and "BKRF2" are used interchangeably and are exemplified by SEQ ID NO: 3, NCBI reference sequence: YP_001129472.1.

[0064] The term "BZLF1-BRLF1 fusion" refers to a transcriptional activator of EBV early genes and is exemplified by SEQ ID NO: 4.

[0065] "EBNA-3A" is exemplified by SEQ ID NO: 5, NCBI reference sequence: YP_401677.1.

[0066] "Tumor-associated EBV antigens" are EBV antigens associated with tumors in subjects infected with EBV. Exemplary tumor-associated EBV antigens include EBNA1, LMP1, LMP2, and BARF1, as described in Lin et al., "CD4 and CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in nasopharyngeal carcinoma patients." Cancer Immunol Immunother. July 2008;57(7):963-75, Kohrt et al., "Dynamic CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in patients with Epstein-Barr virus-negative Hodgkin’s disease," Oncol Res. 2009;18(5-6):287-92; Parmita et al., "Humoral immuno response to Epstein-Barr virus encoded tumor associated proteins and their putative extracellular domains in nasopharyngeal carcinoma patients and regional controls," J Med Virol. April 2011;83(4):665-78.

[0067] Physiologically acceptable "carriers" and "diluents" for vaccine preparation include water, saline, human serum albumin, oil, polyethylene glycol, aqueous dextrose solution, glycerin, propylene glycol, or other synthetic solvents. The carrier can be a liquid carrier (such as water, saline, culture medium, saline, aqueous dextrose solution, and glycol) or a solid carrier (such as carbohydrates exemplified by starch, glucose, lactose, sucrose, and dextran, antioxidants exemplified by ascorbic acid and glutathione, and hydrolyzed proteins).

[0068] The term "expression vector" refers to a nucleotide sequence that contains a desired coding sequence and the appropriate nucleic acid sequences necessary for the expression (i.e., transcription into RNA and / or translation into polypeptide) of the coding sequence operably linked in a particular host cell. Examples of expression vectors include, but are not limited to, plasmids, phagemids, shuttle vectors, cosmids, viruses, chromosomes, mitochondrial DNA, plastid DNA, and nucleic acid fragments thereof. Nucleic acid sequences used for expression in prokaryotes include a promoter, optionally an operator sequence, a ribosome binding site, and in some cases other sequences. Eukaryotic cells are known to use promoters, enhancers, and termination and polyadenylation signals.

[0069] The "mammalian subject" includes humans, non-human primates, mice, sheep, cows, ruminants, rabbits, pigs, goats, horses, dogs, cats, AVC, etc.

[0070] Subjects "in need of" reducing one or more symptoms of a disease and / or subjects "in need of" specific treatment (such as immunization) for a disease include subjects showing and / or at risk of showing symptoms of one or more diseases. For example, a subject can be at risk based on family history, genetic factors, environmental factors, etc. This term includes animal models of the disease. Thus, administering a composition (for reducing the disease and / or reducing one or more symptoms of the disease) to a subject in need of reducing the disease and / or reducing one or more symptoms of the disease includes prophylactic administration of the composition (i.e., before the disease and / or one or more symptoms of the disease become detectable) and / or therapeutic administration of the composition (i.e., after the disease and / or one or more symptoms of the disease become detectable). The compositions and methods of the present invention are also useful for subjects "at risk" of a disease, i.e., referring to subjects susceptible to and / or manifesting one or more symptoms of the disease. This predisposition can be genetic (e.g., a specific genetic tendency to manifest one or more symptoms of a disease such as a genetic disease) or can be due to other factors (e.g., environmental conditions, exposure to harmful compounds present in an environment containing carcinogens, etc.). The term "subject at risk" includes a "subject suffering from" the disease, i.e., a subject experiencing one or more symptoms of the disease. The present invention is not intended to be limited to any specific sign or symptom. Thus, the present invention is intended to include subjects showing at least one of the indicators (e.g., signs and symptoms) associated with a specific disease and experiencing any range of diseases (from subclinical symptoms to advanced diseases).

[0071] "An amount effective as an immunogen" refers to the amount of the molecule that induces and / or increases the production of an "immune response" (i.e., production of specific antibodies and / or induction of a cytotoxic T lymphocyte (CTL) response) in a host upon vaccination with the molecule.

[0072] "Antibody" refers to immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) and / or a part thereof containing a "variable domain" (also referred to as "Fv region") that specifically binds to an antigen.

[0073] The terms "specifically bind" and "specific binding" when referred to in connection with the binding of an antibody to a molecule (e.g., a peptide) or the binding of a cell (e.g., a T cell) to a peptide refer to the interaction of the antibody or cell with one or more epitopes on the molecule, where the interaction depends on the presence of a particular structure on the molecule. For example, if an antibody is specific for epitope "A" on a molecule, in a reaction containing a label "A" and the antibody, the presence of a protein containing epitope A (or free unlabeled A) reduces the amount of labeled A bound to the antibody. In one embodiment, the level of binding of an antibody to a molecule is determined using the "IC50", i.e., the "half maximal inhibitory concentration". This refers to the concentration of a substance (e.g., an inhibitor, an antagonist, etc.) that produces 50% inhibition of a given biological process or a component of a process (e.g., an enzyme, an antibody, a cell, a cell receptor, a microorganism, etc.). It is generally used as a measure of the potency of an antagonist substance.

[0074] As used herein, the term "effective amount" refers to the amount of a composition that produces a desired effect. For example, a cell population can be infected with an effective amount of a viral vector to test its effect in vitro (e.g., cell culture), or to produce a desired therapeutic effect ex vivo or in vivo. An effective amount of a composition can be used to produce a prophylactic or therapeutic effect in a subject, e.g., prevention or treatment of a target condition, alleviation of symptoms associated with the condition, or a desired physiological effect. In such cases, the effective amount of the composition is an "effective therapeutic amount", "effective therapeutic concentration", or "effective therapeutic dose". The exact effective amount or effective therapeutic amount is the amount of the composition that produces the most effective result with respect to the effectiveness of treatment in a given subject or population of cells. This amount can vary depending on various factors including the properties of the composition (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological state of the subject (including age, sex, disease type and stage, general health, responsiveness to a given dose, and type of agent), or cells, the nature of the pharmaceutically acceptable carrier(s) in the formulation, as well as the route of administration. Furthermore, the effective amount or effective therapeutic amount can differ depending on whether the composition is administered alone or in combination with another composition, drug, therapy, or other treatment method or modality. Those of ordinary skill in clinical and pharmacological arts can determine the effective amount or effective therapeutic amount through routine experimentation, i.e., by observing the response of the cells or subject to the administration of the composition and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy, 21st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, Pa., 2005, which is incorporated herein by reference as if fully set forth herein.

[0075] As used herein, "treating" or "treatment" of a condition can refer to preventing the condition, delaying the onset or rate of onset of the condition, reducing the risk of developing the condition, preventing or delaying the onset of symptoms associated with the condition, alleviating or terminating symptoms associated with the condition, causing complete or partial regression of the condition, or some combination thereof. Treatment can also mean prophylactic or preventive treatment of the condition.

[0076] As used herein, the term "infection" refers to the entry of a pathogen that causes a disease into a host. A pathogen that causes a disease is considered "infectious" if it can enter the host and replicate or proliferate within the host. Examples of infectious agents include viruses such as EBV and certain species of adenovirus, prions, bacteria, fungi, protozoa, and the like. "EBV infection" specifically refers to the entry of EBV into a host organism such as the cells and tissues of the host organism.

[0077] As used herein, the term "inducing an immune response" when used in connection with the methods described herein includes causing in a subject in need of a desired immune response or effect against EBV or an EBV infection. "Inducing an immune response" also includes providing a therapeutic immunity for treating against a pathogen, i.e., EBV. As used herein, the term "therapeutic immunity" or "therapeutic immune response" means that a vaccinated subject infected with EBV can control an infection by the pathogen, i.e., the EBV against which the vaccination was performed.

[0078] As used herein, the term "inducing a broad antibody response" is defined as inducing antibodies against multiple, preferably multiple epitopes on multiple viral envelope proteins. Similarly, "inducing a broad T cell response" is defined as inducing CD4 and CD8 T cell lymphocytes with multiple specificities for multiple viral antigens, including at least one, preferably multiple viral proteins, defined as T cell antigens. Collectively, by combining these two expressions, it is possible to "induce a broad immune response".

[0079] The phrase "pharmaceutically acceptable" means that a carrier or excipient does not substantially cause undesirable or harmful effects in the subject to which they are administered at the dosages and concentrations used. A "pharmaceutically acceptable carrier or excipient" is any inert substance that is combined with an active molecule, such as a virus, to prepare a suitable or convenient dosage form.

[0080] The term "homologous prime-boost vaccination" refers to a vaccination regimen in which the first (priming) administration and any subsequent boost administrations use the same recombinant MVA described herein.

[0081] The term "heterologous prime-boost vaccination" refers to a vaccination regimen in which only the first (priming) administration or only a subsequent boost administration uses the recombinant MVA described herein.

[0082] As used herein, "TCID 50 " refers to the 50% tissue culture infective dose given as TCID 50 . TCID 50 can be determined using various methods known to those skilled in the art, such as, for example, a 50% tissue culture infective dose (TCID 50 ) assay. TCID 50The assay is a method for titrating the infectivity of a modified vaccinia virus Ankara (MVA) vector using 10-fold dilutions in a 96-well format, as described in Example 2 of WO 03 / 053463. The infectivity of poxviruses such as MVA can be determined by various methods known to those skilled in the art, such as flow cytometry-based assays or tissue culture infectious dose 50 (TCID 50 ) assays. In one exemplary embodiment, the titration of MVA is performed in a TCID 50 -based assay using 10-fold dilutions in a 96-well format. At the endpoint of the assay, infected cells are visualized using an anti-vaccinia virus antibody and an appropriate staining solution. Primary CEF cells are prepared and cultured for 2-3 days at a predetermined density using T flasks in RPMI containing 10% serum and 1% gentamicin, trypsinized, and seeded into 96-well plates at a density of 1×10 5 cells / mL using RPMI containing 7% serum. The expected titer of the sample indicates the number of 10-fold serial dilutions, for example from 1 to 10, performed on a deep-well plate using 100 μL for transfer to the next well. After dilution, 100 μL per well of the 96-well plate is seeded. The cells are incubated at 34-38 °C and 4-6% CO2 for 5 days to allow infection and virus replication.

[0083] Five days after infection, the cells are stained with an MVA-specific antibody. For detection of the specific antibody, a horseradish peroxidase (HRP)-conjugated secondary antibody is used. The MVA-specific antibody can be, for example, an anti-vaccinia virus antibody, rabbit polyclonal, or IgG fraction (Quartett, Berlin, Germany #9503-2057). The secondary antibody can be, for example, an anti-rabbit IgG antibody, or an HRP-conjugated goat polyclonal (Promega, Mannheim, Germany, #W4011). The secondary antibody is visualized using a precipitating TMB substrate. All wells containing cells with a positive color reaction are scored as TCID 50Mark as positive for the calculation of . The titer is calculated using the Spearman-Kaerber method. The data can also be expressed as the logarithm of the virus titer, which is the relative difference from the time point T = 0 to any given time point.

[0084] Another method for quantifying virus concentration is by virus plaque assay, which is a standard method well known to those skilled in the art for determining virus concentration in terms of infectious dose. Briefly, a confluent monolayer of host cells is infected with viruses at various dilutions and covered with a semi-solid medium. Virus plaques are formed when the virus infects the cells of the cell monolayer, and the number of plaques can be counted in combination with the dilution factor to calculate the number of plaque-forming units per sample volume (pfu / mL). pfu / mL represents the number of infectious particles in the sample. Due to the distinct differences in assay methods and principles, TCID 50 and pfu / mL or other infectious assay results are not necessarily equivalent. For MVA, both methods (TCID 50 and virus plaque assay) can be used. Generally, the dosage of the MVA vector for clinical administration to humans is provided in pfu or TCID 50 . The dosage of the adenovirus vector can also be given in pfu or TCID 50 . Regarding administration to humans, generally, the dosage of the adenovirus vector is expressed in virus particles (vp), and the concentration is expressed in vp / mL.

[0085] Another assay that can be used to determine the infectivity titer of the MVA suspension is a flow cytometry-based assay or FACS assay. In this assay, the infectivity titer is calculated based on the number of infected cells after inoculation of an MVA-permissive cell monolayer while increasing the dilution factor of the MVA virus. Secondary spread of MVA in the permissive cell line prevents the formation of infectious progeny virions, but is circumvented by the addition of the drug rifampicin, which allows viral gene expression necessary for the production of viral antigens for virus-specific staining of infected cells. All dilutions that result in 10 - 30% of infected cells, as determined by vaccinia virus-specific antibody staining and flow cytometry, are suitable for the calculation of the infectivity titer given in infectious units (infU).

[0086] In some embodiments, the vaccines or pharmaceutical compositions described herein can be used in combination with other known pharmaceuticals such as immunostimulatory peptides and antibacterial agents (synthetic antibacterial agents). The vaccine or pharmaceutical composition can further comprise other drugs and additives. Examples of drugs or additives that can be used in combination with the vaccines or pharmaceutical compositions described herein include drugs that assist in the intracellular uptake of the compositions or vaccines disclosed herein, liposomes, and other drugs and / or additives that promote transfection (e.g., fluorocarbon emulsifiers, cochleates, nanotubes, gold particles, biodegradable microspheres, and cationic polymers).

[0087] Several documents are cited throughout this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) is hereby incorporated by reference in its entirety, whether supra or infra. In the event of a conflict or inconsistency between the incorporated material and this specification, this specification shall prevail over any such material. No part of this specification shall be construed as an admission that the present invention has no right to antedate such disclosure by virtue of prior invention.

[0088] Epstein-Barr virus (EBV) and current approaches Epstein-Barr virus (EBV) is an oncogenic herpesvirus that infects more than 95% of the adult population worldwide. It has been associated with the development of various types of lymphoproliferative diseases (LPDs), lymphomas, and carcinomas. Annually, EBV infections are estimated to cause approximately 200,000 cancers worldwide. In low-income settings, primary EBV infections typically occur early in childhood and are mostly asymptomatic. However, in malaria-endemic regions, acquisition in children increases the risk of EBV-positive Burkitt lymphoma (BL). In high-income settings, primary EBV infection often is delayed until adolescence and causes acute infectious mononucleosis (AIM) in 50 - 70% of adolescents. Although this disease is self-limiting, long-lasting AIM or chronic active EBV infection can result in fatal outcomes or significantly increase the risk of developing EBV-positive Hodgkin lymphoma. EBV is also highly associated with nasopharyngeal carcinoma and gastric carcinoma, reflecting the epithelial tropism of the virus. Among infected individuals, EBV is controlled by T cells and usually remains latent in memory B cells. However, under immunosuppressive conditions, the virus can reactivate, increasing the expansion of EBV-infected cells, the potential for new infections, and the transformation of infected B cells as seen in BL, EBV-positive post-transplant lymphoproliferative disorder (PTLD), and AIDS-related B-cell lymphomas. The management of EBV-related diseases is problematic because diagnosis, monitoring, and treatment are difficult. At a meeting held at the National Institutes of Health (NIH) in 2011, participants agreed on the urgent need for a safe and effective vaccine to prevent and / or treat EBV-related diseases. Several strategies for generating EBV vaccines based on the viral glycoproteins 350 / 220 (gp350 / 220), latent membrane proteins (LMP1-2), and Epstein-Barr nuclear antigen 1 (EBNA-1) are currently in the experimental and / or clinical trial phases. However, most of these strategies have a low safety profile and are designed to induce the production of neutralizing antibodies (nAbs) against EBV envelope proteins (preventive) or T-cell responses against potential EBV antigens (therapeutic).None of the currently proposed vaccines address both arms of immunity with a single candidate vaccine. The inventors' vaccine generates a multivalent vaccine using an MVA platform incorporating a plurality of selected viral surface glycoproteins in addition to an intracellular T cell antigen.

[0089] Antibodies (Abs) provide the first line of defense against viral infection. Neutralizing Abs directed against EBV envelope glycoproteins are present in humans, and maternal nAbs prevent neonatal infection, and they have been shown to be induced in response to immunization in both humans and other animals. However, limited evidence of persistent EBV infection and immune selection of viral antigenic variants indicates that in vivo neutralization of EBV infection is not optimal. This was observed in four independent Phase I / II clinical trials where vaccination with either a vector construct expressing gp350 / 220 or a purified recombinant unspliced variant gp350 soluble protein did not prevent infection, but the incidence of AIM decreased by over 70% in young adults. Importantly, primary B cells can be infected with recombinant EBV lacking gp350 / 220, suggesting that additional viral ligands may mediate EBV infection in the absence of gp350 / 220. These observations indicate that using gp350 / 220 as the sole immunogen (monovalent vaccine) to target viral neutralization is too simplistic and can account for the variability in success rates by using only this protein in EBV vaccine development.

[0090] In EBV infection, the attachment protein EBVgp350 / 220 binds to the B cell receptors CD21 and CD35, initiating the first contact between the virus and the host cell and subsequently inducing endocytosis of the virion. This interaction enhances infection but is not essential. Fusion between the viral envelope and the cell membrane is a necessary step in the entry of all human herpesviruses. In the case of EBV, the viral glycoproteins required for fusion between the viral envelope and the host cell receptor are glycoprotein B (gB), the complex of gH and gL (gH / gL), and gp42. These complexes mediate infection and confer host cell specificity. EBV entry into B cells is mediated by gB, gH / gL, and gp42. On the other hand, entry into epithelial cells is facilitated by the interaction between gB and gH / gL. It is important to note that co-expression of EBV gH and gL is required for the transport of gH to the cell surface, which results in the formation of a stable gH / gL complex. Recently, integrin has been identified as an epithelial receptor for EBV gH / gL, and this interaction initiates fusion in a two-step cascade. Recombinant EBV lacking gH does not infect epithelial cells or primary B cells.

[0091] Abs against EBV gH / gL are not robustly produced in vivo during natural infection (presumably due to masking by the immunodominant gp350 / 220), but immunization of mice with recombinant gH can generate Abs that enhance immunogenicity and can block EBV infection. The ability of gH / gL Abs to neutralize infection is well conserved in herpes simplex virus-1, cytomegalovirus, and Kaposi's sarcoma herpesvirus (KSHV). Monoclonal Abs against the gH protein or the gH / gL complex block EBV infection, indicating a crucial role for gH / gL in EBV infection. So far, specific nAbs against EBV gL or -gB have not been reported. NAbs directed against EBV gp42 have been identified.

[0092] T cell-mediated responses are effective in controlling persistent EBV infection, as demonstrated by some form of immunosuppression that usually precedes EBV-related lymphomas and PTLD. Furthermore, adoptive transfer of EBV-specific T cells can induce remission in transplant patients.

[0093] The current hypothesis is that protection against EBV depends on inducing an immune response of CD4 + and CD8 + T cells, and the development of EBV therapeutic vaccine candidates has focused on enhancing such responses. In EBV-infected individuals, EBNA1-specific CD4 + and CD8 + T cells are detected at high frequencies, and both T cell subsets may be effective in controlling the growth of EBV-immortalized B cells. In particular, the EBNA1 antigen, the LMP2 antigen, and the EBV gp350 / 220 antigen have been developed as vaccine candidates against EBV + cells and EBV infections, and have been independently tested in various clinical trials, yielding promising results. In a recent Phase I clinical trial using a recombinant modified vaccinia virus Ankara vector encoding EBNA1 lacking the Gly-Ala region fused to LMP2 (known to impair the presentation of cis-linked sequences) as a vaccine candidate, strong EBV-specific CD4 + and CD8 +T cell responses were induced. However, the strategies used to deliver these two important EBV antigens (DNA vaccines) with known oncogenic potential can pose major health risks, such as inducing an antibody response against DNA or inducing DNA integration at undesirable locations within the host genome, especially causing uncontrolled cell proliferation in immunosuppressed individuals. Furthermore, these vaccine candidates cannot eliminate reactivated EBV infection by inducing nAbs or prevent new EBV infections. Since the amount of protein produced and secreted in vivo is not regulated, there is also a risk of vaccine resistance. EBV DNA packaging mutants and dysfunctional virions lacking major tumor proteins have also been proposed as alternative strategies.

[0094] Poxvirus Poxviruses are generally enveloped viruses and are large viruses with double-stranded DNA. Poxviruses belong to the family Poxviridae and currently include 71 known viruses classified into 16 genera. (Virus Taxonomy: Published in 2017). Two of the most well-known orthopoxviruses are the variola virus, the causative agent of smallpox, and the vaccinia virus, which enabled the eradication of smallpox through conversion to a vaccine.

[0095] Poxviruses such as vaccinia virus are known to those skilled in the art and have been used to generate recombinant vaccines in the fight against infectious organisms and more recently cancer (Mastrangelo et al. J Clin Invest. 2000;105(8):1031 - 1034).

[0096] Within the context of the present disclosure, the poxvirus preferably includes orthopoxvirus. Examples of orthopoxvirus include, but are not limited to, variola virus, vaccinia virus, cowpox virus, and monkey pox virus. Preferably, the orthopoxvirus is vaccinia virus.

[0097] The term "vaccinia virus" can refer to various strains or isolates of replicating vaccinia virus (VACV), including, for example, Ankara, VACV Western Reserve (WR), VACV Copenhagen (VACV-COP), Temple of Heaven, Paris, Budapest, Dairen, Gam, MRIVP, Per, Tashkent, TBK, Tian Tan, Tom, Bern, Patwadanga, BIEM, B-15, EM-63, IHD-J, IHD-W, Ikeda, DryVax (also known as VACV Wyeth or New York City Board of Health [NYCBH] strain), NYVAC, ACAM1000, ACAM2000, Vaccinia Lister (also known as Elstree), LC16mO, LC16m8.

[0098] Modified vaccinia virus Ankara ("MVA") The attenuated, genetically modified vaccinia virus Ankara ("MVA") was generated by more than 570 serial passages on chicken embryo fibroblasts of the chick embryo vaccinia virus Ankara (CVA) strain (for a review, see Mayr, A., et al. Infection 3, 6-14 (1975)). These long-term passages resulted in an MVA virus genome with a deletion of approximately 27 kilobase genomic sequences compared to its parental CVA, such that the host cell range for replication in avian cells was described as highly restricted (Meyer, H. et al., J. Gen. Virol. 72, 1031-1038 (1991), Meisinger et al. J. Gen. Virol 88, 3249-3259 (2007)). The resulting MVA has been shown to be apathogenic in various animal models compared to its fully replication-competent parental source (Mayr, A. & Danner, K., Dev. Biol. Stand. 41:225-34 (1978)).

[0099] MV A viruses useful in the practice of the present invention include, but are not limited to, MVA-572 (deposited on January 27, 1994 as ECACC V94012707), MVA-575 (deposited on December 7, 2000 as ECACC V00120707), MVA-I721 (reference: Suter et al, Vaccine 2009), NIH clone 1 (deposited on March 27, 2003 as ATCC® PTA-5095), and MVA-BN (deposited on August 30, 2000 at the European Collection of Cell Cultures (ECACC) under the number V00083008).

[0100] More preferably, the MVA used according to the present invention includes MVA-BN and MVA-BN derivatives. MVA-BN is described in International PCT Publication WO 02 / 042480. "MVA-BN derivative" refers to any virus that exhibits essentially the same replication characteristics as MVA-BN described herein but shows differences in one or more portions of their genomes.

[0101] MVA-BN and MVA-BN derivatives are replication-incompetent, i.e., they are unable to replicate productively in vivo and in vitro. More specifically, while in vitro MVA-BN or MVA-BN derivatives have been described as being able to replicate productively in chicken embryo fibroblasts (CEF), they are described as being unable to replicate productively in the human keratinocyte cell line HaCat (Boukamp et al (1988), J. Cell Biol. 106:761-771), the human osteosarcoma cell line 143B (ECACC deposit number 91112502), the human embryonic kidney cell line 293 (ECACC deposit number 85120602), and the human cervical adenocarcinoma cell line HeLa (ATCC deposit number CCL-2). Furthermore, MVA-BN or MVA-BN derivatives have a virus amplification ratio that is at least 2-fold lower, more preferably 3-fold lower, than MVA-575 in Hela cells and HaCaT cell lines. Tests and assays of these properties of MVA-BN and MVA-BN derivatives are described in WO 02 / 42480 (US Patent Application No. 2003 / 0206926) and WO 03 / 048184 (US Patent Application No. 2006 / 0159699).

[0102] As explained in the previous paragraph, the terms "unable to replicate productively" or "lacking the ability to replicate productively" in human cell lines in vitro are described, for example, in WO 02 / 42480, which also teaches a method for obtaining MVAs having the desired properties as described above. The terms apply to viruses having a virus amplification rate in vitro of less than 1 on day 4 post-infection, using the assays described in WO 02 / 42480 or US Patent No. 6,761,893.

[0103] The term "failure to replicate productively" refers to a virus having a virus amplification rate in a human cell line in vitro as described in the previous paragraph, i.e., less than 1 at 4 days post-infection. The assays described in WO 02 / 42480 or US Patent No. 6,761,893 are applicable for determination of the virus amplification rate.

[0104] As described in the previous paragraph, the amplification or replication of a virus in a human cell line in vitro is typically expressed as the ratio of the amount of virus produced (yield) from the infected cells to the amount of virus used (input) to initially infect the cells (referred to as the "amplification rate"). An amplification rate of "1" defines an amplification state where the amount of virus produced from the infected cells is the same as the amount initially used to infect the cells, i.e., it means that the infected cells permit virus infection and proliferation. In contrast, an amplification rate less than 1, i.e., a decrease in the yield compared to the input amount, indicates a lack of productive replication and thus attenuation of the virus.

[0105] In a preferred embodiment of the present application, the MVA vector(s) comprise a nucleic acid encoding two or more EBV envelope glycoproteins and one or more T cell antigens.

[0106] The EBV antigen protein can be inserted into one or more intergenic regions (IGRs) of MVA. In an embodiment of the present application, the IGR is selected from IGR07 / 08, IGR44 / 45, IGR64 / 65, IGR88 / 89, IGR136 / 137, and IGR148 / 149. In an embodiment of the present application, five, four, three, or less than two IGRs of the recombinant MVA contain a heterologous nucleotide sequence encoding an epitope. The heterologous nucleotide sequence can, in addition to or instead of this, be inserted into a naturally occurring deletion site of the MVA genome, particularly one or more of its major deletion sites I, II, III, IV, V, or VI. In an embodiment of the present application, five, four, three, or less than two of the naturally occurring deletion sites of the recombinant MVA contain a heterologous nucleotide sequence encoding an epitope.

[0107] The number of insertion sites of MVA containing a heterologous nucleotide sequence encoding an antigenic determinant of an EBV protein can be 1, 2, 3, 4, 5, 6, 7, or more. In embodiments of the present application, the heterologous nucleotide sequence is inserted into 4, 3, 2, or fewer insertion sites. Preferably, 2 insertion sites are used. In embodiments of the present application, 3 insertion sites are used. Preferably, the recombinant MVA comprises at least 2, 3, 4, 5, 6, or 7 genes inserted into 2 or 3 insertion sites.

[0108] The recombinant MVA virus provided by the present invention can be produced by conventional methods known in the art. Methods for obtaining recombinant poxviruses or inserting foreign coding sequences into the poxvirus genome are well known to those skilled in the art. For example, methods of standard molecular biological techniques such as DNA cloning, DNA isolation, RNA isolation, Western blot analysis, RT-PCR and PCR amplification techniques are described in Molecular Cloning, A Laboratory Manual (2nd Ed.) (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and techniques for handling and manipulating viruses are described in Virology Methods Manual (B.W.J. Mahy et al. (eds.), Academic Press (1996)). Similarly, techniques and know-how for handling, manipulating and genetic recombination of MVA are described in Molecular Virology: A Practical Approach (A.J. Davison & R.M. Elliott (Eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993) (see, for example, Chapter 9: Expression of genes by Vaccinia virus vectors)) and Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998) (see, for example, Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vector)).

[0109] Various methods may be applicable to the production of the various recombinant MVAs disclosed in the present invention. The DNA sequences to be inserted into the virus can be placed in an E. coli plasmid construct in which DNA homologous to a section of the MVA DNA has been inserted. Alternatively, the DNA sequence to be inserted can be ligated to a promoter. The promoter-gene linkage can be positioned within the plasmid construct such that it is flanked by DNA homologous to the DNA sequences flanking the region of the MVA DNA containing the non-essential locus and containing the promoter-gene linkage. The resulting plasmid construct can be amplified by growing it in E. coli bacteria and isolated. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into a cell culture, for example, a cell culture of chicken embryo fibroblasts (CEF), and at the same time the culture can be infected with MVA. By performing recombination between the homologous MVA DNAs in each of the plasmid and the viral genome, an MVA modified by the presence of the foreign DNA sequence can be produced.

[0110] According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, can be infected with a poxvirus. Subsequently, the infected cells can be transfected with a first plasmid vector containing a foreign or heterologous gene(s), preferably under the transcriptional control of a poxvirus expression control element. As described above, the plasmid vector also includes sequences capable of directing the insertion of the foreign sequence into a selected portion of the poxvirus genome. Optionally, the plasmid vector also includes a cassette containing a marker gene and / or a selectable gene operably linked to a poxvirus promoter.

[0111] Suitable marker genes or selectable genes are, for example, genes encoding green fluorescent protein, β-galactosidase, neomycin - phosphotransferase or other markers. The use of a selection cassette or marker cassette simplifies the identification and isolation of the produced recombinant poxvirus. However, recombinant poxviruses can also be identified by PCR techniques. Thereafter, the recombinant poxvirus obtained as described above can be used to infect further cells, and the cells can be transfected with a second vector containing a second foreign or heterologous gene(s). For safety, this gene should be introduced into different insertion sites of the poxvirus genome, and also in the second vector, the sequences homologous to the poxvirus and that induce the integration of the second foreign gene(s) into the genome of the poxvirus are different. After homologous recombination has occurred, recombinant viruses containing two or more foreign or heterologous genes can be isolated. To introduce additional foreign genes into the recombinant virus, the infection and transfection steps can be repeated by using the recombinant virus isolated in the previous infection step and by using a further vector containing a further foreign gene(s) for transfection.

[0112] Alternatively, the above-described infection and transfection steps can be replaced, i.e., suitable cells can first be transfected with a plasmid vector containing a foreign gene, and then infected with a poxvirus. As a further alternative, each foreign gene can be introduced into a different virus, and all of the resulting recombinant viruses can be co-infected into cells, and recombinants containing all of the foreign genes can be screened for. A third alternative is the in vitro ligation of the DNA genome and foreign sequences and the reconstitution of a recombinant vaccinia virus DNA genome using a helper virus. A fourth alternative is homologous recombination between a vaccinia virus genome, such as MVA, cloned as a bacterial artificial chromosome (BAC) in E. coli or another bacterial species, and a linear foreign sequence flanked by a DNA sequence homologous to a sequence adjacent to the desired integration site within the vaccinia virus genome.

[0113] Heterologous EBV genes (e.g., glycoproteins, T cell antigens, and fusion proteins) can be under the control of (i.e., operably linked to) one or more poxvirus promoters. In embodiments of the present application, the poxvirus promoter is a Pr13.5 promoter, a PrS promoter, a PrH5m promoter, a Pr1328 promoter, a synthetic or natural early or late promoter, or a vaccinia virus ATI promoter.

[0114] Methods for producing non-recombinant and recombinant poxviruses Methods for obtaining a recombinant poxvirus (e.g., MVA) or for inserting an exogenous coding sequence into a poxvirus (e.g., MVA) genome are well known to those of skill in the art. For example, methods for standard molecular biology techniques (e.g., DNA cloning, DNA and RNA isolation, Western blot analysis, RT-PCR, and PCR amplification techniques) are described in Molecular Cloning, A laboratory Manual 2 ndIt is described in Ed. (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and the methods for handling and manipulating viruses are described in Virology Methods Manual (B.W.J. Mahy et al. (eds.), Academic Press (1996)). Similarly, the methods and know-how regarding the handling, manipulation, and genetic engineering of poxviruses are described below: Molecular Virology: A Practical Approach (A.J. Davison & R.M. Elliott (Eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993), see, for example, Chapter 9: Expression of genes by Vaccinia virus vectors); Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998), see, for example, Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vector); and Genetic Engineering, Recent Developments in Applications, Apple Academic Press (2011), Dana M. Santos, see, for example, Chapter 3: Recombinant-mediated Genetic Engineering of a Bacterial Artificial Chromosome Clone of Modified Vaccinia Virus Ankara (MVA)).The construction and isolation of recombinant MVA are also described below: Methods and Protocols, Vaccinia Virus and Poxvirology, ISBN 978-1-58829-229-2 (Staib et al.), Humana Press (2004), see, for example, Chapter 7.

[0115] Methods for generating and purifying virus-based materials (e.g., viral vectors and / or viruses) according to the present invention are known to those skilled in the art. The methods include infecting suitable cell cultures (e.g., chicken embryo fibroblasts (CEF cells) or cell lines (e.g., DF-1, duck, MDCK, quail or chicken-derived cell lines, and EB66 cells)) and then amplifying the virus under suitable conditions well-known to those skilled in the art. Serum-free culture conditions (e.g., media) and serum-containing culture methods can be used for virus production, but methods using animal substance-free materials (e.g., cell culture media) are preferred. The term "serum-free" medium refers to a cell culture medium that does not contain serum derived from animals or humans. As used herein, "animal substance-free" means any compound or collection of compounds that are not within animal cells within an organism (excluding the cells or cell lines used for the production and purification of virus-based materials) or produced by animal cells. Suitable cell culture media are known to those skilled in the art. These media contain salts, vitamins, buffers, energy sources, amino acids, and other substances. Examples of media suitable for serum-free culture of CEF cells include Medium 199 (Morgan, Morton and Parker; Proc Soc.Exp.Biol.Med.1950 Jan;73(1):1-8; available especially from Life Technologies) or VP-SFM (Invitrogen Ltd.), which is preferred. Serum-free methods for virus culture and virus amplification in CEF cells are described, for example, in WO 2004 / 022729. Upstream and downstream processes for the production and purification of virus materials are exemplarily described in WO 2012 / 010280. Further methods useful for purifying the virus of the present application are described below: WO 03 / 054175, WO 07 / 147528, WO 2008 / 138533, WO 2009 / 100521, and WO 2010 / 130753.Suitable methods for the propagation and purification of recombinant poxviruses in duck embryo-derived cells (e.g., but not limited to, EB66 cells) are described below: Leon et al. (Leon et al. (2016), The EB66 cell line is a valuable cell substrate for MVA-based vaccines production, Vaccine 34:5878-5885).

[0116] Exemplary production of recombinant poxviruses For the production of the various recombinant MVA viruses disclosed herein, various methods may be applicable. The DNA sequence to be inserted into the virus can be placed in an E. coli plasmid construct in which DNA homologous to a section of poxvirus DNA is inserted. Alternatively, the DNA sequence to be inserted can be ligated to a promoter. The promoter-gene linkage can be positioned within the plasmid construct such that the promoter-gene linkage is flanked at both ends by DNA homologous to the DNA sequence adjacent to the region of poxvirus DNA containing the non-essential locus. The resulting plasmid construct can be amplified by growing it in E. coli bacteria and then isolated. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into a cell culture, such as chicken embryo fibroblasts (CEF), at the same time as the culture is infected with the MVA virus. Recombination between the homologous MVA virus DNA in the plasmid and the viral genome can generate poxviruses modified by the presence of the foreign DNA sequence, respectively.

[0117] According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, for example, can be infected with MVA virus. Subsequently, the infected cells may be transfected with a first plasmid vector containing a foreign or heterologous gene(s), such as one or more nucleic acids provided in the present disclosure (preferably under the transcriptional control of a poxvirus expression control element). As described above, the plasmid vector also includes a sequence capable of directing the insertion of an exogenous sequence into a selected portion of the MVA virus genome. Optionally, the plasmid vector also includes a cassette containing a marker and / or a selectable gene operably linked to a poxvirus promoter. The use of a selection cassette or a marker cassette simplifies the identification and isolation of the produced recombinant poxvirus. However, the recombinant poxvirus can also be identified by PCR techniques. Thereafter, the recombinant poxvirus obtained as described above can be used to infect additional cells, and the cells can be transfected with a second vector containing a second foreign or heterologous gene(s). In this case, this gene must be introduced into a different insertion site of the poxvirus genome, and the second vector also differs in the poxvirus homologous sequences that direct the integration of the second foreign gene(s) into the genome of the poxvirus. After homologous recombination has occurred, a recombinant virus containing two or more foreign or heterologous genes can be isolated. To introduce additional foreign genes into the recombinant virus, the infection and transfection steps can be repeated by using the recombinant virus isolated in the previous infection step and by using an additional vector containing an additional foreign gene(s) for transfection.

[0118] Vaccines, Compositions, Medicaments and Immunogenic Compositions This application also relates to pharmaceutical compositions and vaccines comprising one or more EBV antigens, polynucleotides, and / or vectors encoding one or more EBV antigens according to this application. Any of the EBV antigens, polynucleotides (including RNA and DNA), and / or vectors of this application described herein can be used in the pharmaceutical compositions and vaccines of this application.

[0119] According to embodiments of this application, the polynucleotides in the vaccine composition can be linked or separate, such that the EBV antigens expressed from such polynucleotides are fused together or produced as separate proteins, regardless of whether they are expressed from the same or different polynucleotides. In one embodiment, the first and second polynucleotides are present in separate viral vectors used in combination in either the same or separate compositions, such that the proteins expressed are also separate proteins but are used in combination. In another embodiment, the EBV antigens encoded by the first and second polynucleotides can be expressed from the same viral vector.

[0120] In certain embodiments of this application, the first vector is a first viral vector and the second vector is a second viral vector. Preferably, each of the first and second viral vectors is an MVA vector comprising an expression cassette comprising a polynucleotide encoding an EBV antigen of this application, with an upstream sequence operably linked to the polynucleotide encoding the EBV antigen, comprising a promoter sequence, preferably the Pr13.5 promoter sequence of SEQ ID NO: 7, the PrS promoter of SEQ ID NO: 8, the PrH5m promoter of SEQ ID NO: 9, or the Pr1328 promoter of SEQ ID NO: 10, from the 5' end to the 3' end.

[0121] The composition of the present application can also include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is non-toxic and should not interfere with the effectiveness of the active ingredient. The pharmaceutically acceptable carrier can include one or more excipients such as binders, disintegrants, swelling agents, suspending agents, emulsifying agents, wetting agents, lubricants, flavoring agents, sweeteners, preservatives, dyes, solubilizing agents, and coatings. The detailed nature of the carrier or other materials can depend on the route of administration, for example, intramuscular, intradermal, subcutaneous, oral, intravenous, dermal, intramucosal (e.g., intestinal), intranasal, or intraperitoneal routes. In the case of liquid injections, for example, suspensions, solutions, suitable carriers and additives include water, glycols, oils, alcohols, preservatives, coloring agents, etc. For solid oral preparations such as powders, capsules, caplets, gelcaps, and tablets, suitable carriers and additives include starches, sugars, diluents, granulating agents, smoothing agents, binders, disintegrants, etc. For nasal sprays / inhalation mixtures, the aqueous solution / suspension can include water, glycols, oils, emollients, stabilizers, wetting agents, preservatives, aromatics, flavoring agents, etc. as suitable carriers and additives.

[0122] The composition of the present application can be formulated in any substance suitable for administration to a subject to facilitate administration and improve effectiveness, including but not limited to oral (intestinal) administration and parenteral injection. Parenteral injections include intravenous injection or infusion, subcutaneous injection, intradermal injection, and intramuscular injection. The composition of the present application can also be formulated for other routes of administration including transmucosal, ocular, rectal, long-acting implant, sublingual administration, sublingual, administration bypassing the portal circulation from the oral mucosa, inhalation, or intranasal administration.

[0123] In a preferred embodiment of the present application, the composition of the present application is formulated for parenteral injection, preferably for subcutaneous injection, intradermal injection, or intramuscular injection, more preferably for intramuscular injection.

[0124] According to embodiments of the present application, the composition for administration usually contains a pharmaceutically acceptable carrier, such as a buffered physiological saline and the like, for example, a buffered solution in an aqueous carrier such as phosphate buffered saline (PBS). The composition may contain pharmaceutically acceptable substances as necessary to approach physiological conditions such as pH adjustment and buffering agents. In a typical embodiment, the composition of the present application containing plasmid DNA can contain phosphate buffered saline (PBS) as a pharmaceutically acceptable carrier. The plasmid DNA can be present, for example, at a concentration of 0.5 mg / mL to 5 mg / mL, 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, or 5 mg / mL, etc., preferably 1 mg / mL.

[0125] The composition of the present application can be formulated as a vaccine (also referred to as an "immunogenic composition") according to methods well known in the art. Such compositions can include adjuvants that enhance the immune response. The optimal ratio of each component in the formulation can be determined by techniques well known to those skilled in the art in consideration of the present disclosure.

[0126] In embodiments of the present application, the adjuvant is included in the composition of the present application or an immunogenic combination, or is co-administered with the composition of the present application or an immunogenic combination. The use of the adjuvant is optional and can further enhance the immune response when the composition is used for vaccine purposes. Adjuvants suitable for co-administration or inclusion in the composition according to the present application should preferably be those that are likely to be safe, well-tolerated, and effective in humans. The adjuvant can be a small molecule or an antibody, including but not limited to immune checkpoint inhibitors (e.g., anti-PD1, anti-RIM-3, etc.), Toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor Bioscience), mutant IRF3 and IRF7 genetic adjuvants, STING agonists (Aduro), FLT3L genetic adjuvants, IL-12 genetic adjuvants, and IL-7-hyFc.

[0127] Embodiments of the present application also relate to methods of making the compositions and immunogenic combinations of the present application. According to embodiments of the present application, a method of generating a composition or immunogenic combination comprises mixing an isolated polynucleotide encoding an EBV antigen, vector, and / or polypeptide of the present application with one or more pharmaceutically acceptable carriers. Those skilled in the art will be familiar with conventional techniques used to prepare such compositions.

[0128] Method for inducing / enhancing an immune response In another general aspect, the present application relates to a method for use in a subject in need of inducing a broad immune response against Epstein - Barr virus (EBV), the method comprising administering to the subject an immunologically effective amount of a composition or immunogenic composition of the present application. Any of the compositions and immunogenic combinations of the present application described herein can be used in the methods of the present application.

[0129] The present application provides an improved method of priming and enhancing an immune response against an EBV - antigenic protein or an immunogenic polypeptide thereof in a human subject by using a combination of MVA vectors.

[0130] In a general aspect of the present application, a method of inducing a broad immune response in a human subject comprises administering a pharmaceutical composition to a subject in need thereof, the broad immune response being a broad - spectrum antibody or T - cell response against an EBV antigen in the human subject.

[0131] In another general aspect of the present application, a method of preventing or treating an EBV infection or a condition associated with EBV infection comprises administering a therapeutically effective amount of a poxvirus or the above - mentioned pharmaceutical composition to a subject in need thereof.

[0132] In another general aspect of the present application, a recombinant poxvirus or a pharmaceutical composition for use in a method of preventing or treating an EBV infection or a condition associated with EBV infection is provided.

[0133] In another general aspect of the present application, there is provided a recombinant poxvirus or pharmaceutical composition for use in a method of inducing an immune response in a subject to obtain a broad immune response against EBV antigens in a human subject by administering the pharmaceutical composition of the present invention to a subject in need thereof.

[0134] In an embodiment of the present application, the broad immune response includes a broad antibody response against EBV antigenic proteins in a human subject.

[0135] Preferably, the broad immune response further includes a CD4+ response or a CD8+ T cell response against EBV antigenic proteins in a human subject. The CD4+ T cell response generated by the method according to an embodiment of the present application can be, for example, an increase or induction of a dominant CD4+ T cell response against EBV antigenic proteins, and / or an increase or induction of polyfunctional CD4+ T cells specific for EBV antigenic proteins in a human subject. Polyfunctional CD4+ T cells express multiple cytokines, such as two or more of IFN-gamma, IL-2, and TNF-alpha. The CD8+ T cell response generated by the method according to an embodiment of the present application can be, for example, an increase or induction of polyfunctional CD8+ T cells specific for EBV antigenic proteins in a human subject.

[0136] More preferably, the broad immune response resulting from the method according to an embodiment of the present application includes a CD4+ T cell response, an antibody response, and a CD8+ T cell response against EBV antigenic proteins in a human subject.

[0137] Typically, the administration of the compositions and immunogenic combinations according to embodiments of the present application is for the therapeutic purpose of generating an immune response against EBV after EBV infection or after the onset of symptoms characteristic of EBV infection, i.e., for therapeutic vaccination.

[0138] Method of delivery The compositions and immunogenic combinations of the present application can be administered to a subject by any method known in the art in view of the present disclosure, including but not limited to parenteral administration (e.g., intramuscular, subcutaneous, intravenous, or intradermal injection), oral administration, transdermal administration, and nasal administration. Preferably, the compositions and immunogenic combinations are administered parenterally (e.g., by intramuscular injection or intradermal injection) or transdermally.

[0139] In some embodiments of the present application where the composition or immunogenic combination comprises one or more viral vectors, the administration can be by injection through the skin, e.g., intramuscular or intradermal injection, preferably intramuscular injection.

[0140] In other embodiments of the present application where the composition or immunogenic combination comprises one or more DNA plasmids, the administration method is transdermal. Transdermal administration can be combined with epidermal ablation to facilitate the delivery of the DNA plasmid to cells. For example, a dermatological patch can be used for epidermal ablation. When the skin patch is removed, the composition or immunogenic combination can deposit on the ablated skin.

[0141] The delivery method is not limited to the above-described embodiments, and any means for intracellular delivery can be used. Other methods of intracellular delivery contemplated by the methods of the present application include, but are not limited to, liposome encapsulation, nanoparticles, and the like.

[0142] Adjuvant In some embodiments of the present application, the method of inducing an immune response against EBV further comprises administering an adjuvant.

[0143] In embodiments of the present application, the adjuvant may be present in the immunogenic combination or composition of the present application or may be administered in a separate composition. The adjuvant can be, for example, a small molecule or an antibody. In the present application, examples of the use of suitable adjuvants include immune checkpoint inhibitors (e.g., anti-PD1, anti-RIM-3, etc.), Toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor Bioscience), mutant IRF3 and IRF7 genetic adjuvants, STING agonists (Aduro), FLT3L genetic adjuvants, IL-12 genetic adjuvants, and IL-7-hyFc, but are not limited thereto.

[0144] Prime / boost immunization method Embodiments of the present application also contemplate administering an immunologically effective amount of a composition or immunogenic combination to a subject and then, in a so-called prime boost, administering another dose of an immunologically effective amount of the composition or immunogenic combination to the same subject. Thus, in one embodiment, the composition or immunogenic combination of the present application is a prime vaccine used to prime an immune response. In another embodiment, the composition or immunogenic combination of the present application is a booster vaccine used to enhance an immune response. The prime vaccine and booster vaccine according to the embodiments of the present application can be used in the methods of the present application described herein. This general concept of prime-boost regimens is well known to those skilled in the vaccine art. Any of the compositions and immunogenic combinations of the present application described herein can be used as a prime vaccine and / or a booster vaccine for priming and / or boosting an immune response against EBV.

[0145] In embodiments of the present application, the composition or immunogenic combination of the present application can be administered at least once for priming immunization. The composition or immunogenic combination can be readministered to boost immunization. Further booster administrations of the composition or vaccine combination can optionally be added to the regimen as needed. An adjuvant may be present in the composition of the present application used to boost immunization, or may be present in another composition administered with the composition or immunogenic combination of the present application for immune boosting, or can be administered by itself as immune boosting. In those embodiments where an adjuvant is included in the regimen, the adjuvant is preferably used to boost immunization.

[0146] Exemplary and non-limiting examples of prime-boost regimens include administering a single dose of an immunologically effective amount of a composition or immunogenic combination to a subject to prime an immune response. It also includes subsequently administering another dose of an immunologically effective amount of the composition or immunogenic combination of the present application to boost the immune response, and the boost immunization is initially about 1 to 52 weeks (1 - 52), about 2 to 12 weeks (2 - 12), about 2 to 10 weeks (2 - 10), about 2 to 6 weeks (2 - 6), preferably about 4 weeks after the priming immunization is first administered, preferably about 8 weeks after the priming immunization is first administered. In embodiments of the present application, the boost immunization is administered at least 1 week after the priming immunization. In embodiments of the present application, the boost immunization is administered at least 2 weeks after the priming immunization. Optionally, about 10 to 14 weeks, preferably 12 weeks after the priming immunization is first administered, a further boost immunization of the composition or immunogenic combination, or another adjuvant, is administered.

[0147] Kit The present application also provides a kit comprising an immunogenic combination of the present application. The kit can comprise a first polynucleotide and a second polynucleotide in separate compositions, or the kit can comprise the first polynucleotide and the second polynucleotide in a single composition. The kit can further comprise one or more adjuvants or immunostimulants.

[0148] The ability to induce or stimulate an anti-EBV immune response upon administration in an animal or human subject can be evaluated either in vitro or in vivo using various assays that are standard in the art. For a general description of techniques available for assessing the initiation and activation of an immune response, see, e.g., Coligan et al. (1992 and 1994, Current Protocols in Immunology; ed. J Wiley & Sons Inc, National Institute of Health). Measurement of cellular immunity can be performed by measuring the cytokine profile secreted by activated effector cells, including those derived from CD4+ and CD8+ T cells (e.g., quantification of IL-10 or IFN gamma-producing cells by ELISPOT), by determining the activation state of immune effector cells (e.g., T cell proliferation assay by classical [3H] thymidine incorporation), and by measuring antigen-specific T lymphocytes in the sensitized subject (e.g., peptide-specific lysis in a cytotoxicity assay).

[0149] The ability to stimulate cellular and / or humoral responses can be determined by antibody binding and / or competition in binding (see, e.g., Harlow, 1989, Antibodies, Cold Spring Harbor Press). For example, the titer of antibodies produced in response to administration of a composition providing an immunogen can be measured by an enzyme-linked immunosorbent assay (ELISA). The immune response can also be measured by a neutralizing antibody assay. Here, virus neutralization is defined as the loss of infectivity through the reaction / inhibition / neutralization of the virus with specific antibodies. The immune response can be further measured by an antibody-dependent cell phagocytosis (ADCP) assay.

Example

[0150] The following detailed examples are intended to contribute to a better understanding of the present invention. However, the present invention is not limited by the examples. Other embodiments of the present invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein.

[0151] Example 1: Origin of the Inserted Gene Several genes of EBV, strain B95-8 were selected and inserted into the MVA-BN genome: BLLF1 encoding gp350, BXLF2 encoding gH, BKRF2 encoding gL, BRLF1, BZLF1, and EBNA-3A.

[0152] The EBV glycoproteins gp350, gH, and gL are required, inter alia, for entry into B cells and epithelial cells. They are also major targets of the antibody response. In MVA-mBN443, a truncated form (amino acids 1-434) of the gp350 protein that is secreted upon expression was fused to a synthetic multimerization domain derived from yeast GCN4. This gp350 multimer was inserted into the intergenic region (IGR) 88 / 89 of the MVA-BN genome, together with full-length versions of gH and gL.

[0153] The following three EBV-derived transgenes were modified to abolish their functional properties. Both BZLF1 and BRLF1 are transcriptional transactivators that control the switch from latent to lytic replication. Peptides of both proteins function as potent T cell antigens. In MVA-mBN443, some biologically active regions of BRLF1 and BZLF1 were removed, and a portion of the BZLF1 protein was shuffled to obtain a BZLF1-BRLF1 fusion protein. EBNA-3A is a nuclear protein that has the ability to bind to cellular transcriptional regulators. In MVA-mBN443, all six potential nuclear localization sites of EBNA-3A have been eliminated. Furthermore, several protein-protein interaction sites are deleted.

[0154] Finally, EBNA-3A was further modified with an N-terminal secretion tag (mouse Ig kappa chain V-J2-C signal peptide) and a C-terminal transmembrane domain (derived from human platelet-derived growth factor receptor beta isoform 2). Both the BZLF1-BRLF1 fusion and EBNA-3A were inserted into IGR44 / 45 of the MVA genome.

[0155] The gp350 protein sequence is based on GenBank entry YP401667.1, and the yeast-derived GCN4 sequence is based on 2IPZ_A. Both gH and gL show 100% identity with GenBank entries YP_401700.1 and YP_401678.1, respectively. The EBNA-3A sequence is based on GenBank entry YP_401669.1 and the BZLF1-BRLF1 fusion protein of GenBank sequences YP_401674.1 (BRLF1) and YP_401673.1 (BZLF1).

[0156] All of the above-described protein sequences were optimized at the nucleotide level according to human codon usage frequency and repetitive elements and nt stretches were removed. The coding sequences of all EBV-derived transgenes are described in the section of the brief description of the sequences. This sequence was used for the cloning of recombinant plasmids pBN640 and pBN654 containing gp350 multimer, gH, gL or BZLF1-BRLF1 fusion, and EBNA-3A cassette, respectively.

[0157] Example 2: loxP Site The NPTII-heGFP selection cassette in the intermediate recombinant MVA-mBN443A is flanked by two defined loxPV sites. After transfection of the CRE recombinase expression plasmid in cell culture, this site-specific recombinase catalyzes the precise excision of all DNA flanked by its target sequence loxPV, resulting in the complete removal of the selection cassette. The established process enables the reduction of working steps, time and labor, as well as the controlled deletion of the selection cassette.

[0158] Example 3: Origin of the Inserted Promoter The Pr13.5-long promoter disrupts the 124 bp intergenic region between 014L / 13.5L, drives the expression of the natural MVA13.5L gene, and shows very strong early expression caused by two early promoter core sequences (the novel naturally occurring tandem promoter of modified vaccinia virus Ankara drives very early gene expression and a strong immune response: PLoS One 2013, Aug 12;8(8):e73511). In recombinant MVA-mBN443, Pr13.5-long drives the expression of BZLF1-BRLF1-fusion and gp350-multimer.

[0159] Promoter PrS is a synthetic promoter designed from the consensus sequences of the early and late elements of the vaccinia virus promoter (Chakrabarti S, Sisler JR, Moss B. Compact, synthetic, vaccinia virus early / late promoter for protein expression. BioTechnologies. 1997;23(6):1094-7). PrS drives the expression of gH at both the early and late stages of infection with the recombinant virus MVA-mBN443.

[0160] Promoter PrH5m is a modified version of the vaccinia virus H5 gene promoter (Wyatt LS, Shors ST, Murphy BR, Moss B. Development of a replication-deficient recombinant vaccinia virus vaccine effective against parainfluenza virus 3 infection in an animal model. Vaccine. 1996;14(15):1451-8)). It drives the expression of gL at both the early and late stages of infection with the recombinant virus MVA-mBN443.

[0161] Pr1328 is a 100-bp native early promoter that drives the B2R gene of the vaccinia virus strain Western Reserve. This sequence is highly similar to the MVA168R promoter within MVA-BN, differing by only one nucleotide. In recombinant MVA-mBN443, Pr1328 drives the expression of EBNA-3A.

[0162] Example 4: Generation of Recombinant MVA An insert carrying gp350 multimer (under the control of the PrMVA13.5-long promoter) and the gH and gL genes (under the control of the PrS and PrH5m promoters) was generated by gene synthesis and inserted into pBNX202 containing the IGR88 / 89 adjacent region of MVA to obtain the recombinant plasmid pBN640 (Figure 5). For the recombinant plasmid pBN641 carrying the full-length gp350 gene under the control of the PrMVA13.5-long promoter, the respective full-length gp350 gene and the gH and gL genes (under the control of the PrS and PrH5m promoters) were generated by gene synthesis. The gp350-multi-gH-gL insert was removed from pBN640 containing the IGR88 / 89 adjacent region of MVA by SacII and MluI-HF restriction digestion and replaced with the PrMVA13.5-long-full-length-gp350 / PrS-gH / PrH5m-gL gene to obtain pBN641 (Figure 10).

[0163] An insert carrying the BZLF1-BRLF1 fusion (under the control of the PrMVA13.5-long promoter) and EBNA-3A (under the control of the Pr1328 promoter) was generated by gene synthesis and inserted into pBNX204 containing the IGR44 / 45 adjacent region of MVA to obtain the recombinant plasmid pBN654 (Figure 6).

[0164] Example 5: Additional plasmids required to generate MVA-mBN443 and MVA-mBN444 For the generation of recombinant MVA-mBN443 and MVA-mBN444, the selection cassette inserted by recombination with pBN654 was removed using the CRE / loxP system. For this purpose, an expression plasmid encoding CRE-recombinase (pBN274, Figure 7) was transfected into cell culture. CRE-recombinase is a site-specific recombinase that catalyzes the precise excision of all DNA sequences flanked by its target sequence loxP, resulting in the complete removal of the selection cassette.

[0165] Example 6: Generation of recombinant MVA-mBN443 To create a recombinant MVA-BN expressing the EBV-derived gp350 multimer, gH, gL, Zta (encoded by BZLF1), Rta (encoded by BRLF1), and EBNA-3A, a multi-step approach was selected.

[0166] In the first step, the recombinant virus MVA-mBN423A encoding the gp350 multimer and gH and gL in IGR88 / 89 was generated. A second recombinant virus MVA-mBN440A encoding the BZLF1-BRLF1 fusion and EBNA-3A in IGR44 / 45 was generated. Co-infection of two recombinant viruses MVA-mBN423A and MVA-mBN440A into CEF cells yielded the parental virus MVA-mBN443A containing all five transgenes and the selection cassette. Finally, removal of the selection cassette from MVA-mBN443A yielded MVA-mBN443B, which is recombinant and lacks the selection cassette. Recombinant plasmids for all recombinant viruses were constructed as described above.

[0167] For the generation of MVA-mBN423A, primary CEF cells were infected with MVA-BN and then transfected with the recombinant plasmid pBN640. After amplification and plaque purification under GPT selective conditions (including mycophenolic acid, xanthine, and hypoxanthine), the recombinant vaccine candidate MVA-mBN423A P11PP3#20 was obtained. For the generation of MVA-mBN440A, primary CEF cells were infected with MVA-BN and then transfected with the recombinant plasmid pBN654. Amplification and plaque purification under NPTII selective conditions (including G418) resulted in MVA-mBN440A P11PP3 #15. The final recombinant virus MVA-mBN443A P18PP5#28 was obtained by plaque purification following co-infection with MVA-mBN423A P11PP3#20 and MVA-mBN440A P11PP3#15. The final recombinant virus MVA-mBN443B P21PP5#68 lacking both selection cassettes was isolated after further amplification and plaque purification of MVA-mBN443A under non-selective conditions.

[0168] Serum-free VP-SFM medium was used at all stages. The generation of recombinant MVA-mBN443 is summarized in Figure 8.

[0169] Example 7: Generation of Recombinant MVA-mBN444 A multi-step approach was selected to create recombinant MVA-BN mBN444 expressing EBV-derived gp350 full-length (fl), gH, gL, Zta (encoded by BZLF1), Rta (encoded by BRLF1), and EBNA-3A (Figure 9).

[0170] In the first step, a recombinant virus MVA-mBN424A encoding full-length gp350 and gH and gL in IGR88 / 89 was generated. A second recombinant virus MVA-mBN440A encoding the BZLF1-BRLF1 fusion and EBNA-3A in IGR44 / 45 was generated. Co-infection of two recombinant viruses MVA-mBN424A and MVA-mBN440A into CEF cells yielded the parental virus MVA-mBN444A containing all five transgenes and the selection cassette. Finally, removal of the selection cassette from MVA-mBN444A gave MVA-mBN444B, a recombinant without the selection cassette. Recombinant plasmids for all recombinant viruses were constructed as described above.

[0171] For the generation of MVA-mBN424A, primary CEF cells were infected with MVA-BN and then transfected with the recombinant plasmid pBN641 (Figure 10). After amplification and plaque purification under GPT selective conditions (containing mycophenolic acid, xanthine and hypoxanthine), the recombinant vaccine candidate MVA-mBN424A P11PP3#16 was obtained. The generation of MVA-mBN440A was as described above. The final recombinant virus MVA-mBN444A P12PP5#26 was obtained by plaque purification following co-infection of MVA-mBN424A P11PP3#16 and MVA-mBN440A P11PP3#15. The final recombinant virus MVA-mBN444B P33PP9#89 lacking both selection cassettes was isolated after further amplification and plaque purification of MVA-mBN444A under non-selective conditions.

[0172] Serum-free VP-SFM medium was used at all stages. The generation of recombinant MVA-mBN444 is summarized in Figure 11.

[0173] Example 8: Induction of EBV gp350-specific IgG response BALB / c mice were given, on days 0 and 28, 8.25×10 7 per mouse of TCID 50Mice were immunized intramuscularly with two recombinant MVA - BN - EBV constructs, and the serum IgG antibody response against gp350 was analyzed by a multiplex ELISA - based assay using full - length gp350 as the capture antigen. Serum IgG specific for gp350 was already detectable on day 14 after the first immunization (Figure 12). Anti - gp350 IgG maintained very similar levels until day 26 after the first immunization. After the second immunization on day 28, the serum anti - gp350 IgG levels were significantly increased when determined on day 42, 14 days after the second immunization (Figure 12). The anti - gp350 levels induced by mBN444 encoding full - length gp350 were higher after the first immunization than those induced by mBN443 encoding a part of the extracellular domain of gp350 multimerized with the GCN - 4 domain (gp350 - multimer). After booster immunization was applied on day 28, no significant difference in anti - gp350 IgG titers induced by the two recombinant MVA - BN - EBV constructs could be distinguished at day 42.

[0174] Example 9: Induction of EBV gH / gL - specific IgG responses On days 0 and 28, 8.25×10 7 of TCID 50The same BALB / c mice immunized intramuscularly with two recombinant MVA-BN-EBV constructs were also analyzed for the serum IgG antibody response against the gH / gL complex. Since the authentic gH antigen and gL antigen cannot be expressed separately from each other and from the third complex component gp42, the gH / gL-specific IgG response was measured using a commercially available gH / gL / gp42 complex as the antigen in a multiplex ELISA assay. Serum IgG specific for gH / gL was already detectable on day 14 after the first immunization (Figure 13). Anti-gH / gL IgG maintained very similar levels until d26 after the first immunization. After the second immunization on day 28, the serum anti-gH / gL IgG levels were significantly increased 14 days after the second immunization, as determined on day 42 (Figure 13). The anti-gH / gL levels induced by mBN444 encoding full-length gp350 and mBN443 encoding gp350-multimer were very similar over the entire test period. The latter is an expected result since the expression cassettes for gH and gL are identical in both recombinant MVA-BN-EBV constructs. In summary, high levels of anti-gH / gL and anti-gp350 antibodies were induced by both constructs, indicating that all three antigens were expressed in immunogenic forms by both recombinant MVA constructs. In the case of the gH / gL complex, this is inferred from the fact that high levels of antibodies reacting with the authentic gH / gL / gp42 complex were induced, which is only achievable when gL and gH are co-expressed. This is because it requires correct folding with each other and transport to the surface of MVA-BN-EBV-infected cells accessible to the immune system.

[0175] Example 10: Induction of EBV neutralizing antibody response On days 0 and 28, 8.25×10 7 per mouse of TCID 50The same BALB / c mice immunized intramuscularly with two recombinant MVA-BN-EBV constructs were also analyzed for the induction of antibodies capable of neutralizing EBV in an EBV whole virus neutralization assay. No neutralizing antibodies could be detected at both time points (d14 and d26) after the first immunization, but a clear neutralizing titer was detected in the sera of both mouse groups 14 days after the second immunization (d42) (Figure 14). Thus, both MVA-BN-EBV constructs were able to induce a neutralizing antibody response against EBV.

[0176] Example 11: Induction of T cell responses against EBV gH, BRLF1 and EBNA-3A On day 0 and day 28, 8.25×10 7 of TCID 50The same BALB / c mice immunized intramuscularly with two recombinant MVA-BN-EBV constructs were also analyzed for the induction of T cells against two non-envelope antigens encoded in the EBV gH and MVA-BN-EBV constructs. As a control, the CD8 T cell response against the MVA protein E3L was identified. MVA-E3L contains the immunodominant CD8 T cell epitope of MVA in the MHC I H-2d haplotype present in BALB / c mice. Both constructs induced high and very comparable CD8 T cell responses against the MVA vector antigen E3L (Figure 15). Using peptide antigens defined against three EBV proteins, gH, BZLF1, and EBNA-3A, the induction of T cell responses against these three proteins was demonstrated after two immunizations with each of the two MVA-BN-EBV constructs (Figure 12). Thus, for both MVA-BN-EBV constructs, the expression of the gH, BZLF1, and EBNA-3C antigens was confirmed, and the immunogenicity of these recombinant antigens with respect to T cell induction was demonstrated. Combining the facts that i) gH may not induce antibodies if gL is not expressed, ii) an IgG antibody response against gp350 was observed (see above), and iii) the BRLF1 protein for which T cells were induced was expressed as a fusion protein with BZLF1, these findings indicate that all EBV transgenes were expressed by the two recombinant MVA-BN-EBV constructs and were immunogenic upon intramuscular injection of mice with these two recombinant MVA-BN-EBV constructs.

[0177] Sequence SEQ ID NO: 1 Nucleic acid sequence of the gp350 multimer (1455 nucleotides).

Chem.

[0178] SEQ ID NO: 2 Nucleic acid sequence of gH (2121 nucleotides).

Chem.

[0179] Nucleic acid sequence of SEQ ID NO: 3 gL (414 nucleotides).

Chem.

[0180] Nucleic acid sequence of SEQ ID NO: 4 BZLF1-BRLF1 (2283 nucleotides).

Chem.

[0181] Nucleic acid sequence of SEQ ID NO: 5 EBNA-3A (2892 nucleotides).

Chem.

Chem.

[0182] Nucleic acid sequence of SEQ ID NO: 6 one loxPV site. ATAACTTCGTATAGGATACTTTATACGAAGTTAT

[0183] Nucleic acid sequence of SEQ ID NO: 7 Pr13.5 long promoter. taaaaatagaaactataatcatataatagtgtaggttggtagtattgctcttgtgactagagactttagttaaggtactgtaaaaatagaaactataatcatataatagtgtaggttggtagta

[0184] Nucleic acid sequence of SEQ ID NO: 8 PrS promoter. aaaaattgaaattttattttttttttttggaatataa

[0185] Nucleic acid sequence of SEQ ID NO: 9 PrH5m promoter. taaaaattgaaaataaatacaaaggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataatttcattatcgcgatatccgttaagtttgtatcgta

[0186] Nucleic acid sequence of the promoter of SEQ ID NO: 10 Pr1328. tatattattaagtgtggtgtttggtcgatgtaaaatttttgtcgataaaaattaaaaaataacttaatttattattgatctcgtgtgtacaaccgaaatc

Claims

1. A recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens.

2. The poxvirus according to claim 1, wherein the two or more EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2, and BARF1.

3. The poxvirus according to claim 1, wherein the one or more T cell antigens include EBNA1, EBNA-2, EBNA-3a, EBNA-3b, EBNA-3c, EBNA leader protein, and LMP2.

4. The poxvirus according to claim 1, comprising gp350, EBNA-3A, gH, and gL.

5. Furthermore, the poxvirus according to any one of claims 1 to 4, comprising a BRLF1-BZLF1 fusion protein.

6. The poxvirus according to claim 2 or 4, wherein gp350 is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 1, and preferably gp350 comprises the sequence of SEQ ID NO:

1.

7. The poxvirus according to claim 3 or 4, wherein EBNA-3A is encoded in a nucleic acid sequence having at least 90% identity with SEQ ID NO: 5, and preferably EBNA-3A includes the sequence of SEQ ID NO:

5.

8. The poxvirus according to claim 2 or 4, wherein the gH is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 2, and preferably the gH includes the sequence of SEQ ID NO:

2.

9. The poxvirus according to claim 2 or 4, wherein the gL is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 3, and preferably the gL includes the sequence of SEQ ID NO:

3.

10. The poxvirus according to claim 5, wherein the BRLF1-BZLF1 fusion protein is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 4, and preferably the BRLF1-BZLF1 fusion protein comprises the sequence of SEQ ID NO:

4.

11. The poxvirus according to any one of claims 1 to 4, wherein the poxvirus is recombinant modified vaccinia virus ankara (MVA).

12. The poxvirus according to claim 11, wherein the MVA comprises MVA-BN or a derivative thereof.

13. The poxvirus according to claim 2 or 4, wherein the gp350, gH, and gL are inserted into the intergenetic regions (IGRs) 88 / 89 of the MVA genome.

14. The poxvirus according to claim 5, wherein the EBNA-3A and BRLF1-BZLF1 fusion is inserted into the intergenetic regions (IGRs) 44 / 45 of the MVA genome.

15. The poxvirus according to claim 5, wherein gp350, gH, gL, EBNA-3A, and BRLF1-BZLF1 fusion are each under the control of a separate promoter.

16. A pharmaceutical composition comprising a therapeutically effective amount of recombinant poxvirus according to any one of claims 1 to 4 and a pharmaceutically effective carrier.

17. The pharmaceutical composition according to claim 16, further comprising one or more adjuvants.

18. A pharmaceutical composition according to claim 16 for use in a method for inducing a broad immune response in a subject, wherein the method comprises administering the pharmaceutical composition to a subject requiring the method to obtain broad-spectrum antibodies and a T-cell response against EBV in the human subject.

19. The pharmaceutical composition according to claim 18, wherein the broad immune response includes an antibody response to the EBV antigen in the human subject.

20. The pharmaceutical composition according to claim 18, wherein the broad immune response includes the CD8+ T cell response to the EBV antigen in the human subject.

21. The pharmaceutical composition according to claim 18, wherein the broad immune response includes a CD4+ T cell response to the EBV antigen in the human subject.

22. A pharmaceutical composition according to claim 16 for use in a method for preventing or treating EBV infection or a condition associated with EBV infection, wherein the method comprises administering the pharmaceutical composition to a subject requiring the method.

23. The pharmaceutical composition according to claim 18, administered as a prime and boost dose.

24. The pharmaceutical composition according to claim 23, wherein the boost is performed 1 to 52 weeks after the prime administration, preferably 2 to 12 weeks after, more preferably 2 to 10 weeks after, and most preferably at least 2 to 6 weeks after, the method described above.

25. Recombinant poxvirus according to any one of claims 1 to 4, for use in a method for preventing or treating EBV infection or a condition associated with EBV infection.

26. The pharmaceutical composition according to claim 16 for use in a method for preventing or treating EBV infection or a condition associated with EBV infection.

27. Recombinant poxvirus according to any one of claims 1 to 4 for use in a method of inducing an immune response in a human subject, comprising administering the pharmaceutical composition according to claim 16 to a subject in need thereof to acquire a broad immune response to the EBV antigen.

28. The pharmaceutical composition according to claim 16 for use in a method of inducing an immune response in a human subject, comprising administering the pharmaceutical composition according to claim 16 to a subject in need thereof to acquire a broad immune response to the EBV antigen.