Novel method for extracting Scutellaria baicalensis and topical and oral preparations containing the extract
The two-step extraction method for Scutellaria baicalensis produces an extract that effectively promotes hyaluronic acid production, inhibits MMPs, suppresses melanin production, and acts as a potent antioxidant, addressing the need for stable materials with these properties.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NIPPON MENARD COSMETIC CO
- Filing Date
- 2024-12-02
- Publication Date
- 2026-06-12
AI Technical Summary
There is a need for safe, highly stable materials that promote hyaluronic acid production, cell proliferation, MMP inhibition, melanin production suppression, and antioxidant effects, but currently, no materials that fully satisfy this need have been provided.
The extract of Scutellaria baicalensis is obtained by a two-step extraction process using a pretreatment agent of liquid water followed by extraction with water, lower alcohols, or liquid polyhydric alcohols, with a temperature difference of 20°C or more between the steps, enhancing hyaluronic acid production, cell proliferation, MMP inhibition, melanin production inhibition, and antioxidant effects.
The extract demonstrates significant hyaluronic acid production promotion, cell proliferation enhancement, MMP inhibition, melanin production suppression, and strong antioxidant properties, making it effective for preventing and treating various skin and health issues.
Smart Images

Figure 2026095897000001 
Figure 2026095897000002 
Figure 2026095897000003
Abstract
Description
Technical Field
[0001] The present invention relates to a novel method for extracting Celosia cristata and external and internal preparations containing the extract thereof.
Background Art
[0002] Fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form the dermal connective tissue, maintaining the firmness of the skin. It is considered that as a result of this connective tissue losing its contractile force and further its elastic force, wrinkles and sagging of the skin occur.
[0003] Particularly, hyaluronic acid is known as a high-molecular polysaccharide widely distributed in connective tissues, presenting in a gel-like form in the dermis and maintaining the elasticity of the skin. Therefore, it is considered that the alteration and decrease of hyaluronic acid are important in skin aging. Also, because hyaluronic acid is a high-molecular substance, there has been a problem that even when a cosmetic containing it is directly applied to the skin, it is difficult to be absorbed. Thus, hitherto, skin external preparations that can promote the production of collagen and hyaluronic acid by the cells themselves by activating fibroblasts have been explored (Patent Document 1).
[0004] In addition, hyaluronic acid is also present in joints and is known to function to alleviate the impact of joint loads and to smooth the movement of joints. Hyaluronic acid is produced from synovial membranes in joints and is the main component of synovial fluid, and is also a constituent component of articular cartilage aggrecan. Hyaluronic acid plays an important role in water retention, lubrication of articular cartilage, cell adhesion, and immunomodulation.
[0005] The hyaluronic acid concentration in synovial fluid of a normal human is approximately 2.3 mg / mL, but in rheumatoid arthritis, the hyaluronic acid concentration in synovial fluid decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 1). Furthermore, it is known that a decrease in hyaluronic acid content occurs in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 2). In the above diseases, increasing the amount of hyaluronic acid in synovial fluid is considered to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that injecting sodium hyaluronate into the joints of patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 3). However, treatment for the above diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.
[0006] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, leading to opacity within the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for foods and medicines containing hyaluronic acid production promoters that can be used daily to prevent and improve physiological floaters.
[0007] Generally, the proliferation and division capacity of epidermal keratinocytes decreases with age, and the epidermal layer itself thins (Non-Patent Literature 4). Biological factors such as Epidermal Growth Factor (EGF) and female hormones (estrogen) act on the proliferation of epidermal keratinocytes in the skin, but their secretion decreases with age. This decline in the metabolic function of epidermal keratinocytes due to aging slows down the rate of skin turnover, causing rough skin and skin aging. In addition, the accumulation of keratinocytes that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin within the epidermis, causing hyperpigmentation and dullness of the skin. Furthermore, it is known that wound healing in the epidermis is also slowed. In order to prevent or improve the progression of these phenomena, there has been much research into ingredients that promote the proliferation of epidermal keratinocytes and proposals for topical skin preparations.
[0008] Furthermore, the skin is exposed daily to various physical and chemical stresses, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function deteriorates, and various signs of skin aging become apparent. Wrinkles are one such sign of skin aging. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also called fine wrinkles, are temporary wrinkles that occur due to a decrease in the amount of water in the stratum corneum of the epidermis caused by skin dryness. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanisms of their formation include a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and the promotion of collagen breakdown due to an increase in matrix metalloproteinases (MMPs).
[0009] Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanism, and treatment methods. Dermal wrinkles caused by UV radiation and aging are difficult to improve with the use of moisturizing cosmetics.
[0010] To date, several agents have been reported for the purpose of improving dermal wrinkles caused by ultraviolet radiation, including a skin wrinkle prevention and improvement agent containing hydrolyzed almond as an active ingredient (Patent Document 2), and a wrinkle improvement agent for ultraviolet irradiation containing extracts of Jochokei, Tenki, and Kisenosa as active ingredients (Patent Document 3).
[0011] MMPs play a major role in the stromal invasion, intravascular invasion, and angiogenesis of cancer cells. The stroma is mainly composed of type I collagen, and the movement of cancer cells requires the destruction of the matrix by stromal collagenases, etc. For metastasis to be completed, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMPs are also involved at this stage (Non-Patent Literature 5). Therefore, substances that have inhibitory activity against MMPs are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer diseases. In addition, inhibition of MMPs is useful in the prevention, treatment, and improvement of various diseases caused by increased MMP levels, such as ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.
[0012] Collagenase (MMP-1), belonging to the MMP group, is an enzyme produced by fibroblasts and chondrocytes, and plays a major role in promoting collagen degradation. Collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, gums, and skin. When collagen molecules are cleaved at one point by collagenase, the normally stable collagen molecules denature into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer, ulcer formation, osteoporosis, periodontitis, and other problems.
[0013] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 4), raspberry extract (Patent Document 5), and lactoferrin (Patent Document 6). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.
[0014] Generally, skin pigmentation such as age spots, freckles, and sunburn is thought to be caused by hormonal abnormalities or ultraviolet radiation stimulating melanin-producing cells in the skin to excessively produce melanin, which then deposits in the skin. One known method to prevent such pigmentation is to suppress the excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and other substances have been used as whitening agents, both internally and externally, for the treatment of pigmentation (Patent Document 7).
[0015] Furthermore, the skin is located in the outermost layer of the body and is an organ that is easily subjected to the effects of ultraviolet rays and other factors, generating reactive oxygen species, and is constantly exposed to this oxidative stress. On the other hand, reactive oxygen species scavenging enzymes exist within skin cells, and as long as the amount of reactive oxygen species generated does not exceed their capacity, they protect skin cells from damage caused by reactive oxygen species. However, it is known that the activity of reactive oxygen species scavenging enzymes within skin cells decreases with age, and when damage caused by reactive oxygen species exceeds this defense response, the skin is oxidized, cellular function deteriorates, and aging progresses. In addition, it is thought that in organs other than the skin, when exposed to reactive oxygen species that exceed their scavenging capacity, functional decline occurs, leading to aging, or the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, reactive oxygen species scavenging agents and antioxidants have been investigated with the aim of protecting the body from damage caused by reactive oxygen species, and foods, cosmetics, quasi-drugs, and pharmaceuticals containing reactive oxygen species scavenging enzymes such as SOD and catalase, SOD-like active substances, and other reactive oxygen species scavenging agents and antioxidants have been developed (Patent Documents 8 and 9).
[0016] Scutellaria baicalensis, also known as golden flowering flower, is a perennial herb belonging to the genus Scutellaria in the Lamiaceae family. The herbal medicine "Ougon" is the root of the golden flowering flower with the outer layer removed, and is known for its antipyretic, detoxifying, bile secretion promoting, gastric juice secretion inhibiting, antibacterial, and lipid metabolism improving effects, and is used in many traditional Chinese medicine formulas. [Prior art documents] [Patent Documents]
[0017]
Patent Document 1
Patent Document 2
Patent Document 3
Patent Document 4
Patent Document 5
Patent Document 6
Patent Document 7
Patent Document 8
Patent Document 9
Non-Patent Document
[0018]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
[0020] Due to these circumstances, the inventors conducted diligent studies and found that the extract of Scutellaria baicalensis obtained by an extraction method comprising a first step of obtaining an extraction residue of Scutellaria baicalensis by extracting Scutellaria baicalensis with a pretreatment agent consisting of liquid water, and a second step of obtaining an extract of Scutellaria baicalensis by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or more higher than the extraction temperature of the first step, has excellent hyaluronic acid production promoting effect, cell proliferation promoting effect, MMP inhibitory effect, melanin production inhibitory effect, and antioxidant effect, and is also excellent in stability, thus completing the present invention.
[0021] In other words, the present invention encompasses the following inventions. (1) A method for extracting Scutellaria baicalensis, comprising: a first step of obtaining an extraction residue of Scutellaria baicalensis by extracting Scutellaria baicalensis with a pretreatment agent consisting of liquid water; and a second step of obtaining an extract of Scutellaria baicalensis by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols and liquid polyhydric alcohols, wherein the extraction temperature of the second step is 20°C or higher than the extraction temperature of the first step. (2) The method for extracting Scutellaria baicalensis according to (1), characterized in that the extraction temperature in the first step is 0 to 20°C, the extractant in the second step is water, and the extraction temperature in the second step is 70°C or higher than the extraction temperature in the first step. (3) A hyaluronic acid production promoter characterized by containing an extract of Scutellaria baicalensis obtained by the extraction method of Scutellaria baicalensis described in (1) or (2). (4) A cell proliferation promoter characterized by containing an extract of Scutellaria baicalensis obtained by the extraction method of Scutellaria baicalensis described in (1) or (2). (5) An MMP inhibitor characterized by containing an extract of Scutellaria baicalensis obtained by the extraction method of Scutellaria baicalensis described in (1) or (2). (6) A wrinkle-improving agent characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in (1) or (2). (7) A melanin production inhibitor characterized by containing an extract of Scutellaria baicalensis obtained by the extraction method of Scutellaria baicalensis described in (1) or (2). (8) A whitening agent characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in (1) or (2). (9) An antioxidant comprising an extract of Scutellaria baicalensis obtained by the extraction method of Scutellaria baicalensis described in (1), wherein the extractant in the second step is an aqueous ethanol solution or ethanol with an ethanol concentration of 25% by weight or more. A composition for the prevention and / or improvement of one or more diseases or symptoms selected from the group consisting of rheumatoid arthritis, suppurative arthritis, gouty arthritis, floaters, rough skin, skin aging, skin pigmentation, dullness of the skin, wound healing, dermal wrinkles, cancer, ulcer formation, arteriosclerosis, osteoporosis, periodontitis, and myocardial infarction, characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in (1)(1) or (2). [Effects of the Invention]
[0022] The present invention provides a hyaluronic acid production promoter, a cell proliferation promoter, an MMP inhibitor, a melanin production inhibitor (whitening agent), and an antioxidant, all of which contain an extract of Scutellaria baicalensis extracted by a specific method as an active ingredient. [Modes for carrying out the invention]
[0023] The Scutellaria baicalensis used in the present invention is a perennial herb native to northern China, cultivated in China, Japan, etc., and is commercially available as a crude drug "Huang Gong (Ougong)" using its roots. For the Scutellaria baicalensis used in the present invention, a part of the plant body such as its flowers, fruits, seeds, leaves, stems, roots, or the whole plant body (whole herb), or a mixture thereof can be used, but the root is particularly preferred, and the root excluding the periderm is most preferred. Also, the plant body may be used as it is, or may be subjected to treatments such as drying, pulverization, and mincing.
[0024] [Step 1: Extraction with a pretreatment agent] As the pretreatment agent, liquid water is used. Also, an acid or an alkali can be added to the above pretreatment agent to use a pH-adjusted pretreatment agent. There is no particular limitation on the amount of the pretreatment agent used. For example, it is preferably 3 to 100 times, more preferably 15 to 75 times, and particularly preferably 30 to 50 times with respect to the Scutellaria baicalensis (dry weight). The Scutellaria baicalensis used for extraction with the pretreatment agent may be used as it is, but it is preferable to perform treatments such as pulverization and mincing in terms of the efficiency of pretreatment. When pulverization or mincing is performed, it is preferably those passing through a sieve with a mesh size of 11.2 mm (2 mesh), more preferably those passing through a sieve with a mesh size of 7.47 mm (3 mesh), and most preferably those passing through a sieve with a mesh size of 5.55 mm (4 mesh). After extraction, filtration can be performed using filter paper, a mesh, a sieve, etc. The extraction residue recovered here is used in the following Step 2.
[0025] [Step 2: Extraction with an extraction agent] As the extractant, one or more selected from the group consisting of water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.) are used. Preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used, and particularly preferably, water, a mixed polar solvent of water and ethanol, and a mixed polar solvent of water and 1,3-butylene glycol are used, but the choice can be made depending on the purpose, such as the yield and effectiveness of the extract. In particular, if you want to enhance the antioxidant effect, it is preferable to use an aqueous ethanol solution or ethanol with an ethanol concentration of 25% by weight or more, as it is difficult to obtain sufficient antioxidant effect with an aqueous ethanol solution with an ethanol concentration of less than 10% by weight. In addition, it is also possible to use an extractant to which an acid or alkali has been added to adjust the pH. There are no particular limitations on the amount of extractant used; for example, it should be 5 times or more, preferably 10 times or more, relative to the dry weight of Scutellaria baicalensis, but it is preferable to use 100 times or less for convenience in operations such as filtration and concentration after extraction. The extraction time can be appropriately selected depending on the type of extractant used and the pressure during extraction, but the extraction temperature must be at least 20°C higher than the extraction temperature with the pretreatment agent. In particular, when using water, it is preferable that the temperature be at least 70°C higher than the extraction temperature with the pretreatment agent, more preferably at least 80°C higher, and most preferably at least 90°C higher. Filtration can be carried out in the same manner as in the first step.
[0026] The extraction residue from the pretreatment agent may be dried before extraction with the extractant, or it may be extracted directly without drying. In the latter case, it is advisable to select the extraction solvent considering the effect of any water remaining in the extraction residue. The extraction method with the extractant is not particularly limited and can be carried out by methods such as stirring extraction or column extraction.
[0027] The extract obtained using the above extractant may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, or ethanol precipitation, to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.
[0028] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.
[0029] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.
[0030] For external use, the content of the above extract used in this invention is preferably 0.000001% by weight or more, and more preferably 0.00001 to 10% by weight, when converted to solid matter. Furthermore, 0.0001 to 5% by weight is most preferable. Below 0.000001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.
[0031] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.
[0032] Next, in order to describe the present invention in detail, examples of the production, formulation, and experimental use of the extract in the present invention will be given as examples, but the present invention is not limited thereto. In the production examples, % refers to weight percentage, and in the formulation examples, parts refer to parts by weight. [Examples]
[0033] Example of production method for Scutellaria baicalensis extract The Scutellaria baicalensis extract of the present invention was prepared according to Production Examples 1 to 4. Conventional Scutellaria baicalensis extracts were prepared according to Comparative Production Examples 1 to 3. The extraction material used was a pulverized product of the crude drug "Ogon" (the root of Scutellaria baicalensis with the periderm removed) (passed through a sieve with a mesh size of 11.2 mm).
[0034] (Manufacturing Example 1) Preparation of a hot water extract of pre-treated Scutellaria baicalensis 10 g of dried Scutellaria baicalensis was mixed with 40 times its weight in water and extracted at 5°C for 24 hours (the increase in the solid content of the extract stopped within 6 hours, indicating that no further extraction was possible). The resulting extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in water was added to the resulting dried residue and extracted at 95°C for 2 hours. The resulting extract was filtered through filter paper No. 5C, the filtrate was concentrated, and freeze-dried to obtain 0.5 g of a hot water extract of Scutellaria baicalensis.
[0035] (Comparative manufacturing example 1) Preparation of conventional hot water extract of Scutellaria baicalensis Ten times the weight of water was added to 10 g of dried Scutellaria baicalensis, and the extract was extracted at 95°C for 2 hours. The resulting extract was filtered through filter paper No. 5C, the filtrate was concentrated, and freeze-dried to obtain 3.7 g of hot water extract of Scutellaria baicalensis.
[0036] (Manufacturing Example 2) Preparation of a 50% ethanol extract of pre-treated Scutellaria baicalensis 10 g of dried Scutellaria baicalensis was mixed with 40 times its weight in water and extracted at 5°C for 24 hours (the increase in the solid content of the extract stopped within 6 hours, indicating that no further extraction was possible). The obtained extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in a 50% ethanol aqueous solution was added to the resulting dried residue. The mixture was immersed at 25°C for 7 days to extract the residue. The obtained extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.6 g of a 50% ethanol extract of Scutellaria baicalensis.
[0037] (Comparative manufacturing example 2) Preparation of a conventional 50% ethanol extract of Scutellaria baicalensis To 10 g of dried Scutellaria baicalensis, an aqueous solution of 50% ethanol was added by 10 times its weight, and the mixture was steeped at 25°C for 7 days to extract the solution. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 3.7 g of a 50% ethanol extract of Scutellaria baicalensis.
[0038] (Manufacturing Example 3) Preparation of ethanol extract of pre-treated Scutellaria baicalensis 20 g of dried Scutellaria baicalensis was mixed with 40 times its weight in water and extracted at 5°C for 24 hours (the increase in the solid content of the extract stopped within 6 hours, indicating that no further extraction was possible). The obtained extract was filtered through filter paper No. 5C, the residue was dried, and 10 times its weight in ethanol was added to the resulting dried residue. The mixture was immersed at 25°C for 7 days to extract the residue. The obtained extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.3 g of ethanol extract of Scutellaria baicalensis.
[0039] (Comparative manufacturing example 3) Conventional preparation of ethanol extract of Scutellaria baicalensis 20 g of dried Scutellaria baicalensis was mixed with 10 times its weight in ethanol and steeped at 25°C for 7 days to extract the extract. The resulting extract was filtered through filter paper No. 5C, and then concentrated to dryness using an evaporator to obtain 0.4 g of ethanol extract of Scutellaria baicalensis.
[0040] (Production Example 4) Preparation of 1,3-butylene glycol extract of pre-treated Scutellaria baicalensis 10 g of dried Scutellaria baicalensis was mixed with 40 times its weight in water and extracted at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 6 hours, indicating that no further extraction was possible). The obtained extract was filtered through filter paper No. 5C, and the residue was dried. 10 times its weight in 1,3-butylene glycol was added to the resulting dried residue and immersed at 25°C for 7 days to extract the residue. The obtained extract was filtered through filter paper No. 5C to obtain 48.9 g of 1,3-butylene glycol extract of Scutellaria baicalensis. [Examples]
[0041] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of pre-treated Scutellaria baicalensis (Production Example 1) 0.1 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.
[0042] (Comparative formulation example 1) Conventional lotion In Formulation Example 1, the pre-treated hot water extract of Scutellaria baicalensis was replaced with a conventional hot water extract of Scutellaria baicalensis (Comparative Manufacturing Example 1), resulting in a conventional lotion.
[0043] (Prescription example 2) Cream Formulation Content (per portion) 1. 50% ethanol extract of pre-treated Scutellaria baicalensis (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain the product.
[0044] (Prescription example 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of pre-treated Scutellaria baicalensis (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.
[0045] (Prescription example 4) Gel Formulation Content (per portion) 1. Pre-treated Scutellaria baicalensis 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.
[0046] (Prescription example 5) Pack Formulation Content (per portion) 1. Pre-treated hot water extract of Scutellaria baicalensis (Production Example 1) 1.0 2. Pre-treated Scutellaria baicalensis 1,3-Butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.
[0047] (Prescription example 6) Foundation Formulation Content (per portion) 1. 50% ethanol extract of pre-treated Scutellaria baicalensis (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.
[0048] (Example prescription 7) Bath additive Formulation Content (per portion) 1. Ethanol extract of pre-treated Scutellaria baicalensis (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.
[0049] (Prescription example 8) Ointment Formulation Content (per portion) 1. Hot water extract of pre-treated Scutellaria baicalensis (Production Example 1) 5.0 2. 50% ethanol extract of pre-treated Scutellaria baicalensis (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.
[0050] (Prescription example 9) Powder Formulation Content (per portion) 1. Pre-treated hot water extract of Scutellaria baicalensis (Production Example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.
[0051] (Prescription example 10) Tablets Formulation Content (per portion) 1. Ethanol extract of pre-treated Scutellaria baicalensis (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.
[0052] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Ethanol extract of pre-treated Scutellaria baicalensis (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.
[0053] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of pre-treated Scutellaria baicalensis (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.
[0054] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]
[0055] Experimental Example 1: Hyaluronic Acid Production Promotion and MMP Inhibition Test The mRNA expression levels of hyaluronic acid synthase (HAS2) and matrix metalloproteinase (MMP-1) were measured. Human dermal fibroblasts were placed in a φ60 mm dish in a 1 × 10⁶ dish. 5 Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to a final concentration of 1 or 10 μg / mL, and then total RNA was extracted. Total RNA was extracted from cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of HAS2 and MMP-1 mRNA were determined as a percentage of the expression level of the internal standard, GAPDH mRNA. The HAS2 expression rate was calculated as the ratio of the HAS2 mRNA expression level in the sample-added group to the HAS2 mRNA expression level in the control (no sample added) group. The MMP-1 expression rate was calculated similarly. The primers used to measure the expression levels of each gene are as follows.
[0056] Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 1) GCTGGATTACTGTGGCAATGAG(Sequence ID 2) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (Sequence ID 3) TGAGCATCCCCTCCAATACC(Sequence ID 4) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence ID 5) TCTTCTGGGTGGCAGTGATG (Sequence No. 6)
[0057] These experimental results are shown in Tables 1 and 2. As a result, the extract of Scutellaria baicalensis treated with the present invention showed excellent HAS2 expression promoting effect (hyaluronic acid production promoting effect) and MMP-1 expression suppressing effect (MMP inhibitory effect). Furthermore, in both effects, the extract of Scutellaria baicalensis treated with the present invention was significantly higher than that of conventional Scutellaria baicalensis extract. In particular, the HAS2 expression promoting effect of the extract of Scutellaria baicalensis treated with the present invention was the opposite of that of conventional Scutellaria baicalensis extract, and was an exceptionally remarkable and unpredictable effect.
[0058] [Table 1]
[0059] [Table 2]
[0060] Experimental Example 2: Cell Proliferation Promotion Test Human keratinocytes were cultured in DMEM culture medium containing 0.2% FBS in a 96-well plate, with 2 × 10⁶ cells per well. 3Cells were seeded individually, and each sample was added to achieve a final concentration of 0.1 or 1 μg / mL. The cells were then cultured at 37°C under 5% CO2 conditions for 5 days. Cell count was measured by staining. Specifically, after the culture period, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and thoroughly mixed. The absorbance at 650 nm was measured using a microplate reader. Cell proliferation rate was calculated as the ratio of the cell volume in the sample-added group to the cell volume in the control group (no sample added).
[0061] These experimental results are shown in Table 3. As a result, the extract of Scutellaria baicalensis treated with the present invention showed excellent cell proliferation promoting effects. Furthermore, the extract of Scutellaria baicalensis treated with the present invention was significantly more effective than the conventional extract of Scutellaria baicalensis. In particular, the conventional hot water extract of Scutellaria baicalensis (comparative production example 1) lost its effect as the sample concentration increased and even showed the opposite effect (cell proliferation inhibitory effect), but the hot water extract of Scutellaria baicalensis treated with the present invention (production example 1) showed an even greater cell proliferation promoting effect.
[0062] [Table 3]
[0063] Experimental Example 3: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were placed in a φ60mm dish in a 3×10 4Cells were seeded individually and cultured for 5 days at 37°C under 5% CO2 conditions in a MEM culture medium containing 10% FBS to which each sample was added to a final concentration of 1 μg / mL. After culturing, the cells were detached and centrifuged to obtain a pellet, which was then dissolved in PBS(-) by sonication. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265-275, 1951). In addition, to measure melanin content, 4N NaOH was added to the remaining cell lysate taken for protein quantification, and after heating at 60°C for 2 hours, the absorbance at 475 nm was measured using a microplate reader, and the amount of melanin was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in melanin content in the sample-added group to the control group (no sample added).
[0064] These experimental results are shown in Table 4. The Scutellaria baicalensis extract treated with the present invention was found to have excellent melanin production inhibitory effects. Furthermore, this effect was significantly higher in the Scutellaria baicalensis extract treated with the present invention compared to the conventional Scutellaria baicalensis extract.
[0065] [Table 4]
[0066] Experimental Example 4: Antioxidant Test The free radical scavenging and removal activity was evaluated. As a model for free radicals, α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), a stable free radical, was used. It was reacted with the sample at a constant ratio for a certain period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at 517 nm.
[0067] Method for measuring free radical scavenging activity Each sample was added to 2 mL of 1.0 M acetate buffer (pH 5.5) to a final concentration of 20 μg / mL. To this, 2 mL of ethanol (99.5%) and 1 mL of 0.5 mM DPPH ethanol solution were added to prepare the reaction solution. For oil-soluble samples, the sample was added to 2 mL of ethanol (99.5%) to prepare the reaction solution. The mixture was then reacted at 37°C for 30 minutes, and the absorbance at 517 nm (A) was measured using water as a control. A blank absorbance (B) was also measured using purified water instead of the sample. The free radical scavenging and removal rate was calculated using the following formula. Free radical scavenging and removal rate (%) = (1 - A / B) × 100
[0068] These test results are shown in Table 5. The Scutellaria baicalensis extract treated with the present invention was found to be stable and possess excellent free radical scavenging activity (antioxidant activity). Here, conventional Scutellaria baicalensis extracts using hot water, 50% ethanol, and ethanol (comparative production examples 1, 2, and 3) each showed similar levels of antioxidant activity. On the other hand, the Scutellaria baicalensis extracts of the present invention (production examples 2 and 3), which were extracted with 50% ethanol or ethanol after removing components extracted with water, surprisingly showed significantly higher efficacy compared to the conventional Scutellaria baicalensis extracts (comparative production examples 2 and 3).
[0069] [Table 5]
[0070] Experimental Example 5: Usage Test The feel of the lotion was evaluated for Formulation Example 1 and Comparative Formulation Example 1 of the present invention.
[0071] Five panelists were divided into groups and blindly used each sample. They compared their experience using Formula Example 1 and Comparative Formula Example 1, and also evaluated the presence or absence of skin problems.
[0072] As a result, the lotion obtained using formulation example 1 had a better feel to it than comparative formulation example 1 and could be used safely without causing skin problems. Furthermore, there were no issues with the degradation of the formulation ingredients. [Industrial applicability]
[0073] Based on the above, the Scutellaria baicalensis extract of the present invention possesses excellent hyaluronic acid production promoting effects, cell proliferation promoting effects, MMP inhibitory effects, melanin production inhibitory effects, and antioxidant effects, and also exhibits excellent stability. Therefore, the Scutellaria baicalensis extract of the present invention can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.
Claims
1. A method for extracting Scutellaria baicalensis, comprising: a first step of obtaining an extraction residue of Scutellaria baicalensis by extracting Scutellaria baicalensis with a pretreatment agent consisting of liquid water; and a second step of obtaining an extract of Scutellaria baicalensis by further extracting the extraction residue with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, wherein the extraction temperature in the second step is 20°C or more higher than the extraction temperature in the first step.
2. The method for extracting Scutellaria baicalensis according to claim 1, characterized in that the extraction temperature in the first step is 0 to 20°C, the extractant in the second step is water, and the extraction temperature in the second step is 70°C or higher than the extraction temperature in the first step.
3. A hyaluronic acid production promoter characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in claim 1 or 2.
4. A cell proliferation promoter characterized by containing an extract of Scutellaria baicalensis obtained by the method for extracting Scutellaria baicalensis described in claim 1 or 2.
5. An MMP inhibitor characterized by containing an extract of Scutellaria baicalensis obtained by the method for extracting Scutellaria baicalensis described in claim 1 or 2.
6. A wrinkle-improving agent characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in claim 1 or 2.
7. A melanin production inhibitor characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in claim 1 or 2.
8. A skin whitening agent characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in claim 1 or 2.
9. An antioxidant comprising an extract of Scutellaria baicalensis obtained by the method for extracting Scutellaria baicalensis described in claim 1, wherein the extractant in the second step is an aqueous ethanol solution or ethanol with an ethanol concentration of 25% by weight or more.
10. A composition for the prevention and / or improvement of one or more diseases or symptoms selected from the group consisting of rheumatoid arthritis, suppurative arthritis, gouty arthritis, floaters, rough skin, skin aging, skin pigmentation, dullness of the skin, wound healing, dermal wrinkles, cancer, ulcer formation, arteriosclerosis, osteoporosis, periodontitis, and myocardial infarction, characterized by containing an extract of Scutellaria baicalensis obtained by the method of extracting Scutellaria baicalensis described in claim 1 or 2.