Modified epidermal growth factor receptor and its use in cell tracking

The engineered EGFRt with enhanced stability and expression addresses the challenges of low expression and immunogenicity in genetically modified cells, enabling effective selection, tracking, and depletion, thereby improving safety and efficacy.

JP7848138B2Active Publication Date: 2026-04-20OSPEDALE SAN RAFFAELE SRL +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022569013
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-05-14
Filing Date
2021-05-14
Publication Date
2026-04-20
Estimated Expiration
2041-05-14

AI Technical Summary

Technical Problem

Existing methods for selecting, tracking, and depleting genetically engineered cells, such as those expressing EGFRt, face challenges due to low expression levels and immunogenicity, especially when driven by weak promoters, posing safety concerns.

Method used

Development of an engineered epidermal growth factor receptor (eEGFRt) with enhanced stability and surface expression, utilizing an atypical signal peptide, engineered cytoplasmic tail, and optimized open reading frame sequence to improve protein translation, enabling effective selection, tracking, and depletion using low-dose monoclonal antibodies.

Benefits of technology

The eEGFRt marker allows for efficient in vitro and in vivo recovery and depletion of genetically modified cells, enhancing safety by eliminating low-expression cells and reducing adverse effects of administered antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007848138000028
    Figure 0007848138000028
  • Figure 0007848138000029
    Figure 0007848138000029
  • Figure 0007848138000030
    Figure 0007848138000030
Patent Text Reader

Abstract

A polynucleotide comprising a nucleotide sequence encoding an epidermal growth factor receptor (EGFR) extracellular epitope operably linked to: (a) an NGFR or EGFR SFR alpha signal peptide; (b) an EGFR or NGFR transmembrane domain; and / or (c) an NGFR or EGFR cytoplasmic tail.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a modified epidermal growth factor receptor (EGFR). In particular, the present invention relates to the use of modified EGFR in selecting, depleting, and tracking a population of cells engineered to express the modified EGFR.

Background Art

[0002] The administration of genetically engineered cells, for example, the adoptive transfer of engineered T cells, or the transplantation of engineered hematopoietic stem cells or hematopoietic progenitor cells, is a powerful tool for treating, for example, infectious diseases, neoplastic diseases, and genetic diseases.

[0003] The selection of engineered cells prior to administration to a subject, and thus the reduction or elimination of cells lacking a therapeutic effect, is required in some cases. In addition, tracking engineered cells after injection and depleting or eliminating them in the case of toxicity is an advantageous ability of genetically engineered cell products.

[0004] Several strategies have been used to select genetically engineered cells in vitro or to track and deplete genetically engineered cells in vivo. In vitro selection by the use of heterologous enzymes has been employed, but such an approach has problems related to immunogenicity. Human cell surface proteins such as ΔNGFR, CD34, CD19, CD20, and CD4, as well as CD90, have also been used as surrogate markers for the identification of ex vivo genetically modified cells. However, none of these candidates are ideal because they are not specific to engineered hematopoietic cells. Indeed, they are expressed in various tissues including the blood compartment, making it difficult to track specific modified cells and exacerbating the toxicity of the treatment in the case of depletion.

[0005] A functionally inactive truncated version of the human epidermal growth factor receptor (EGFRt) has been proposed as a candidate for selection, tracking, and depletion of modified cells (Wang et al. (2011) Blood 118(5): 1255-1263). EGFR is not expressed by hematopoietic cells. To generate EGFRt, the wild-type receptor retained its intact cetuximab binding site, but the removal of two extracellular domains and its cytoplasmic tail rendered it unable to bind to ligands and transmit signals.

[0006] EGFRt must be expressed at high levels on the cell surface for optimal functionality, such as enabling complete elimination of transplanted cells and avoiding the use of high-dose monoclonal antibodies that can lead to harmful side effects. However, in some situations, such as when using conventional transcription promoters, the expression of previous EGFRt constructs is low.

[0007] This issue is particularly relevant when cells are transduced with bidirectional or dicistronic vectors (i.e., expressing two gene products from the same transcript, such as via an internal ribosome entry sequence (IRES)), or when EGFRt is fused to another therapeutic product (i.e., via an autocleavage peptide), or when EGFRt expression is linked to a low-expression target locus by gene editing. This represents a significant safety concern when cells need to be selected, tracked in vivo, and depleted in case of adverse events. [Overview of the Initiative] [Problems that the invention aims to solve]

[0008] Therefore, especially in situations where introduced constructs may be under the control of weak expression regulatory systems, there is a significant need in this field for means of selecting, depleting, and tracking genetically modified cells. [Means for solving the problem]

[0009] The inventors have developed an engineered epidermal growth factor receptor that exhibits increased stability and expression on the cell surface, even when its expression is driven by a weak promoter.

[0010] The inventors have optimized EGFRt to produce enhanced EGFRt (eEGFRt) by utilizing (i) an atypical signal peptide to efficiently drive protein translation into the endoplasmic reticulum; (ii) an engineered cytoplasmic tail to stabilize and increase cell surface recycling of EGFR protein; and / or (iii) optimization of the open reading frame sequence to increase protein translation. By applying these modifications, the inventors have demonstrated improved utility of the eEGFRt marker for genetically modified low-expression cells by enabling in vitro recovery of genetically modified cells and their depletion in vitro and in vivo by administration of low-dose monoclonal antibodies. This improvement enhances the safety profile of engineered cells in the event of adverse events by eliminating low-expression cells and reducing the risk of undesirable effects of the administered depletion antibody.

[0011] In one embodiment, the present invention is as follows: (a) NGFR or GMS SFR alpha-signal peptide; (b) EGFR or NGFR transmembrane domains; and / or (c) NGFR or EGFR cytoplasmic tail, In addition, recycling signals may be used in some cases. The present invention provides a polynucleotide containing a nucleotide sequence that is functionally linked to an extracellular epidermal growth factor receptor (EGFR) epitope.

[0012] In some embodiments, the cytoplasmic tail comprises the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39); or (ii) RRRHIVRK (SEQ ID NO: 40); or a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions.

[0013] In some embodiments, the EGFR extracellular epitope comprises one or more EGFR extracellular domains or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain III or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain IV or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain III and EGFR domain IV or a portion thereof.

[0014] In some embodiments, the EGFR extracellular epitope is a truncated epidermal growth factor receptor (EGFRt).

[0015] In another embodiment, the present invention relates to a polynucleotide comprising a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), the following: (a) a nucleotide sequence encoding an NGFR signal peptide; and / or (b) A nucleotide sequence encoding a polypeptide containing the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39); or (ii) RRRHIVRK (SEQ ID NO: 40); or a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions. The present invention provides polynucleotides further comprising the present invention.

[0016] In some embodiments, (a) The NGFR signal peptide contains an amino acid sequence that is at least 70% identical to SEQ ID NO: 4; and / or (b) The nucleotide sequence encoding the NGFR signal peptide has at least 70% identity with SEQ ID NO: 5.

[0017] In some embodiments, EGFRt includes EGFR domain III and EGFR domain IV. In some embodiments, EGFRt further includes an EGFR transmembrane domain or an NGFR transmembrane domain, preferably an EGFR transmembrane domain. In some embodiments, EGFRt does not include EGFR domain I, EGFR domain II, the EGFR juxtamembrane domain, or the EGFR tyrosine kinase domain.

[0018] In some embodiments, EGFRt includes an amino acid sequence having at least 70% identity to SEQ ID NO: 2.

[0019] In some embodiments, the nucleotide sequence encoding EGFRt has at least 70% identity to SEQ ID NO: 3.

[0020] In some embodiments, the polynucleotide (a) encodes an amino acid sequence having at least 70% identity to SEQ ID NO: 17; and / or (b) includes a nucleotide sequence having at least 70% identity to SEQ ID NO: 16.

[0021] In some embodiments, the polynucleotide (a) encodes an amino acid sequence having at least 70% identity to SEQ ID NO: 19 or 21; and / or (b) includes a nucleotide sequence having at least 70% identity to SEQ ID NO: 18 or 20.

[0022] In some embodiments, the polynucleotide (a) encodes an amino acid sequence having at least 70% identity to SEQ ID NO: 23 or 25; and / or (b) includes a nucleotide sequence having at least 70% identity to SEQ ID NO: 22 or 24.

[0023] In some embodiments, the nucleotide sequence encoding EGFRt is functionally ligated to a weak promoter.

[0024] In some embodiments, the polynucleotide further comprises a transgene.

[0025] In some embodiments, polynucleotides, such as those containing a transgene and / or EGFRt coding sequence, are intended for insertion by gene editing.

[0026] In some embodiments, the transgene encodes a chimeric antigen receptor.

[0027] In another embodiment, the present invention provides an EGFRt protein encoded by the polynucleotide of the present invention.

[0028] In another embodiment, the present invention provides a viral vector comprising the polynucleotide of the present invention.

[0029] In some embodiments, the viral vector is a lentiviral vector, an adeno-associated virus (AAV) vector, or an adenovirus vector.

[0030] In another embodiment, the present invention provides cells comprising the polynucleotide or viral vector of the present invention.

[0031] In another aspect, the present invention provides polynucleotides, viral vectors, or cells for therapeutic use.

[0032] In another aspect, the present invention provides the use of the polynucleotide, viral vector, or cell of the present invention for the manufacture of pharmaceuticals.

[0033] In another aspect, the present invention relates to a method for selecting transduced cells, (a) Transduction of a population of cells with the polynucleotide or viral vector of the present invention; (b) A step of bringing the transduced cell population into contact with an EGFRt binder; and (c) Steps to select cells bound to the EGFRt binder. This provides a method that includes this.

[0034] In another aspect, the present invention relates to a method for depleting transduced cells, (a) Transduction of a population of cells with the polynucleotide or viral vector of the present invention; and (b) The step of bringing the transduced cell population into contact with the EGFRt binder. This provides a method that includes this.

[0035] In some embodiments, the EGFRt conjugate is functionally linked to a depleting agent. In some embodiments, the cell population from step (b) is brought into contact with a depleting agent bound to the EGFRt conjugate. In some embodiments, the binding of the EGFRt conjugate to EGFRt expressed on the cell surface causes cell death. In some embodiments, the depleting agent kills the cells to which the EGFRt conjugate is bound.

[0036] In another aspect, the present invention relates to a method for tracking transduced cells, (a) Transduction of a population of cells with the polynucleotide or viral vector of the present invention; (b) A step of contacting a transduced cell population with an EGFRt binder functionally linked to a detectable label; and (c) Steps to detect cells bound to the EGFRt binder. This provides a method that includes this.

[0037] In some embodiments, the method is either in vitro or ex vivo.

[0038] In some embodiments, the EGFRt conjugate is an antibody. In some embodiments, the EGFRt conjugate is cetuximab.

[0039] In some embodiments, the depletion agent includes a toxin. In some embodiments, the depletion agent includes a saporin.

[0040] In another aspect, the present invention provides a treatment method comprising a method for selecting transduced cells, a method for depleting transduced cells, and / or a method for tracking transduced cells. [Brief explanation of the drawing]

[0041] [Figure 1-1] EGFRt modification improved protein surface expression after the CD40LG gene editing procedure, enabling in vitro enrichment and in vitro / in vivo depletion of the manipulated cells. (A) Schematic diagram of three corrective donor templates used to edit CD4+ T lymphocytes. Inserted into intron 1 of the CD40LG locus was a corrective donor template with a 500 bp homologous arm consisting of a splice acceptor (SA), followed by CD40LG cDNA from exons 2 to 5, and its endogenous 3'UTR and polyA. The IRES sequence and either the subsequent EGFRt gene (i), eEGFRt 1 gene (ii), or eEGFRt 2 gene (iii) were cloned between the cDNA sequence and the 3'UTR sequence. Upon editing, the CD40LG endogenous promoter drives the expression of both the CD40LG gene and the EGFRt / modified EGFRt gene. [Figure 1-2] (B) A representative flow cytometry dot plot showing EGFR gene expression in edited CD4+ inactivated T cells, along with relative mean fluorescence intensity (MFI). (C) Histogram plot showing the percentage of eEGFRt+ edited cells before (eEGFRt 1 / eEGFRt 2 bars) and after (eEGFRt 1+ / eEGFR 2+ bars) immunomagnetic enrichment. The eEGFR 1- and eEGFR 2- bars represent the percentage of eEGFRt+ cells retained in the negative fraction after the selection procedure. [Figure 1-3](D) Histogram plot showing the percentage of eEGFR+ modified cells after in vitro treatment with assembled immunotoxin (black bar), antibody only (red bar), or toxin only (green bar). (E) Time course of the percentage of eEGFRt+ T cells recovered in peripheral blood (PB) of xenografted NSG mice treated with cetuximab intraperitoneal injection (red line) or not treated (blue line). The percentage of eEGFRt+ cells was evaluated by both flow cytometry analysis (i) and digital droplet PCR molecular assay (ii). [Figure 2A] EGFRt modification improves protein surface expression after transduction by a bidirectional lentiviral vector. (A) Schematic diagram of a bidirectional lentiviral vector that expresses either tEGFR (Figure 2Ai) or a modified EGFRt (eEGFRt1-Figure 2Aii) driven by a minimal CMV promoter in sense under the control of the hPGK promoter. [Figure 2B] (B) Representative flow cytometry dot plots showing EGFR gene expression in transduced T cells are shown along with relative mean fluorescence intensity (MFI). [Figure 3] EGFRt modifications with recycling signals did not further improve EGFR protein expression after gene editing procedures. Representative flow cytometry dot plots showing EGFRt gene expression in edited CD4+ inactivated (basal level) or activated (stimulated) T cells. [Figure 4] EGFRt modification without recycling signals improved EGFR surface expression after gene editing procedures. Representative flow cytometry dot plots showing the time course of EGFRt gene expression in edited CD4+ inactivated (basal level) T cells, along with relative mean fluorescence intensity (MFI), are shown. [Figure 5-1]Edited T cells can be specifically depleted by utilizing the clinically suitable selector EGFRt. (A) Representative plots showing EGFRt expression in bulk-edited CD4+ T cells derived from male HD at 0 and 8 hours after Pma / ionomycin stimulation. Cells were edited using the three constructs shown in Figure 1A. (B) Percentage of reporter+ cells in the T cell subpopulation 17 days after CD40LG editing in male HD-derived CD4+ T cells, measured by FACS analysis. Cells were edited using donor templates with NGFR (n=7), eEGFRt 1 (also called EGFR variant 1; n=7), or eEGFRt 2 (also called EGFR variant 2; n=4). Paired Wilcoxon test. EGFR variant 2 was not included in the analysis because n=4. [Figure 5-2] (C) Population composition of bulk-edited T cells from male HD-derived UT T cells (n=14) or (B). LME model, followed by post-hoc analysis. EGFR-modified type 2 was not included in the analysis because n=4. Mean ± SEM. (D) Time course of CD40L surface expression after PMA / ionomycin stimulation as measured by RFI (normalized for reporter cells; left panel) and percentage of edited or unedited T cells from (B) (right panel) (n=4 for each group except reporters - n=12). (E) IgG+ secretory B cells evaluated by ELISPOT assay. B cells were isolated from HD PB and co-cultured with male HD-selected NGFR / EGFR+, NGFR / EGFR-, and UT T cells, then rested (R) or stimulated with beads (B) or PMA / ionomycin (PI). B cells cultured alone (-) or in the presence of sCD40L (+) were used as negative and positive controls, respectively (n=2 for each group). [Figure 5-3](F) Analysis of B cell proliferation capacity by Cell Trace dilution assay in allogeneic sorted B cells isolated from HD PB and co-cultured with male HD T cells from (E). B cells cultured alone (-) or in the presence of sCD40L (+) were used as negative and positive controls, respectively (n=2 for each group). (G) Representative plots showing hEGFRt expression in bulk edited CD4+ T cells derived from male HD 3 days after treatment with immunotoxin (left), antibody (center), or toxin (right). (H) Histograms showing the percentage of hEGFRt+ T cells 3 days after treatment with 5 nM or 1 nM immunotoxin, antibody, or toxin, as measured by FACS analysis. Friedman test with Dunn's multiple comparison. Different dose conditions were used as the unified group for statistical analysis. [Modes for carrying out the invention]

[0042] As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including” or “includes”; or “containing” or “contains,” and are comprehensive or open-ended, not excluding additional unenumerated members, elements, or steps. The terms “comprising,” “comprises,” and “comprised of” also include the term “consisting of.”

[0043] Chimera Selector The inventors have developed engineered cell surface proteins that can be used for the selection, depletion, and tracking of cells on which they express. These proteins, which may be referred to herein as “chimeric selectors,” contain an extracellular epitope of the epidermal growth factor receptor (EGFR) and exhibit increased stability and expression on the cell surface, even when their expression is driven by a weak promoter. The EGFR extracellular epitope can be selectively conjugated by an anti-EGFR antibody, such as cetuximab.

[0044] In one embodiment, the present invention is as follows: (a) NGFR or GMS SFR alpha-signal peptide; (b) EGFR or NGFR transmembrane domains; and / or (c) NGFR or EGFR cytoplasmic tail, In addition, recycling signals may be used in some cases. This provides a polynucleotide containing a nucleotide sequence that is functionally linked to an extracellular epidermal growth factor receptor (EGFR) epitope.

[0045] In some embodiments, the cytoplasmic tail comprises the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39); or (ii) RRRHIVRK (SEQ ID NO: 40); or a variant of (i) or (ii) having up to three (or fewer) amino acid substitutions, additions, or deletions.

[0046] In some embodiments, the EGFR extracellular epitope comprises one or more EGFR extracellular domains or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain III or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain IV or a portion thereof. In some embodiments, the EGFR extracellular epitope comprises EGFR domain III and EGFR domain IV or a portion thereof.

[0047] In some embodiments, the EGFR extracellular epitope is a truncated epidermal growth factor receptor (EGFRt).

[0048] Epidermal growth factor receptor (EGFR) The epidermal growth factor receptor (EGFR), also known as ErbB1 and HER1, is a cell surface receptor for members of the epidermal growth factor family of extracellular ligands.

[0049] An example of a human EGFR sequence is shown below: [ka]

[0050] Mature wild-type EGFR may contain four extracellular domains (from N-terminus to C-terminus) called domains I, II, III, and IV; a transmembrane domain; a near-membrane domain; a tyrosine kinase domain; and a regulatory region (see Ferguson, KM (2008) Annu Rev Biophys 37: 353-373). Those skilled in the art can easily identify the domains in the EGFR sequence using known sequence comparison tools.

[0051] For example, the EGFR domain in SEQ ID NO: 1 may be as follows, based on amino acid numbering following the convention that the N-terminal methionine of SEQ ID NO: 1 is assigned to residue 1: signal peptide (amino acids 1-24); domain I (amino acids 25-189); domain II (amino acids 190-334); domain III (amino acids 335-504); domain IV (amino acids 505-644); transmembrane domain (amino acids 645-667); near-membrane domain (amino acids 668-709); tyrosine kinase domain (amino acids 710-977); and regulatory region (amino acids 978-1210). Those skilled in the art can easily determine similar domains in homologous proteins by performing sequence alignment to SEQ ID NO: 1.

[0052] Functionally inactive truncated versions of the epidermal growth factor receptor have been previously proposed as candidates for the selection, tracking, and depletion of modified cells (Wang et al. (2011) Blood 118(5): 1255-1263). In Wang et al., to generate truncated EGFR, the wild-type receptor was rendered unable to bind ligands and transmit signals by removing two extracellular domains (domains I and II) and its cytoplasmic tail (containing the near-membrane domain and tyrosine kinase domain).

[0053] The inventors have developed an improved truncated epidermal growth factor receptor that exhibits increased stability and expression on the cell surface, even when its expression is driven by a weak promoter.

[0054] In one embodiment, the present invention relates to a polynucleotide comprising a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), the following: (a) a nucleotide sequence encoding an NGFR signal peptide; and / or (b) A nucleotide sequence encoding a polypeptide containing the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39) or (ii) RRRHIVRK (SEQ ID NO: 40) or a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions. The present invention provides polynucleotides further comprising the present invention.

[0055] In another embodiment, the present invention relates to a polynucleotide comprising a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), the following: (a) a nucleotide sequence encoding a GMS SFR alpha signal peptide; and / or (b) A nucleotide sequence encoding a polypeptide containing the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39) or (ii) RRRHIVRK (SEQ ID NO: 40) or a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions. The present invention provides polynucleotides further comprising the present invention.

[0056] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt) and a nucleotide sequence encoding an NGFR signal peptide.

[0057] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt) and a nucleotide sequence encoding a GMS SFR alpha signaling peptide.

[0058] In some embodiments, the polynucleotide comprises a polypeptide containing a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt) and the amino acid sequence of KRWNRGIL (SEQ ID NO: 39), or a nucleotide sequence encoding a variant thereof having three or fewer amino acid substitutions, additions, or deletions. In some embodiments, the polynucleotide comprises a polypeptide containing a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt) and the amino acid sequence of RRRHIVRK (SEQ ID NO: 40), or a nucleotide sequence encoding a variant thereof having three or fewer amino acid substitutions, additions, or deletions.

[0059] The amino acid sequences of KRWNRGIL (SEQ ID NO: 39) or RRRHIVRK (SEQ ID NO: 40) may be referred to herein as a "cytoplasmic tail" or "cytoplasmic domain." KRWNRGIL (SEQ ID NO: 39) may be referred to herein as an NGFR cytoplasmic tail. RRRHIVRK (SEQ ID NO: 40) may be referred to herein as an EGFR cytoplasmic tail.

[0060] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), and the polynucleotide further comprises (a) a nucleotide sequence encoding an NGFR signal peptide; and (b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of KRWNRGIL (SEQ ID NO: 39) or a variant thereof having three or fewer amino acid substitutions, additions, or deletions.

[0061] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), and the polynucleotide further comprises (a) a nucleotide sequence encoding a GMS SFR alpha signal peptide; and (b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of KRWNRGIL (SEQ ID NO: 39) or a variant thereof having three or fewer amino acid substitutions, additions, or deletions.

[0062] Preferably, the EGFRt of the present invention is a truncated EGFR containing an EGFR extracellular epitope that can be selectively bound by an anti-EGFR antibody, such as cetuximab. Preferably, the EGFRt lacks signaling activity or trafficking activity.

[0063] In some embodiments, EGFRt includes EGFR domain III and EGFR domain IV. In some embodiments, EGFRt further includes an EGFR transmembrane domain or an NGFR transmembrane domain, preferably an EGFR transmembrane domain.

[0064] In some embodiments, EGFRt comprises EGFR domain III, EGFR domain IV, and EGFR transmembrane domain. In some embodiments, EGFRt consists of EGFR domain III, EGFR domain IV, and NGFR transmembrane domain.

[0065] In some embodiments, EGFRt does not contain EGFR domain I. In some embodiments, EGFRt does not contain EGFR domain II. In some embodiments, EGFRt does not contain EGFR membrane-proximal domains. In some embodiments, EGFRt does not contain EGFR tyrosine kinase domains.

[0066] In some embodiments, EGFRt does not contain EGFR domain I, EGFR domain II, EGFR membrane proximity domain, or EGFR tyrosine kinase domain.

[0067] An example of an EGFRt amino acid sequence is as follows: [ka]

[0068] Examples of nucleotide sequences encoding EGFRt are as follows: [ka]

[0069] In some embodiments, EGFRt comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2. Preferably, EGFRt comprises an epitope recognizable by an antibody such as cetuximab. Preferably, EGFRt lacks signaling activity or trafficking activity.

[0070] In some embodiments, EGFRt comprises the amino acid sequence of SEQ ID NO: 2.

[0071] In some embodiments, EGFRt comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2 or a fragment thereof. Preferably, EGFRt or a fragment thereof contains an epitope recognizable by an antibody such as cetuximab. Preferably, EGFRt or a fragment thereof lacks signaling activity or trafficking activity.

[0072] In some embodiments, EGFRt comprises the amino acid sequence of SEQ ID NO: 2 or a fragment thereof. In some embodiments, EGFRt consists of the amino acid sequence of SEQ ID NO: 2 or a fragment thereof.

[0073] In some embodiments, the nucleotide sequence encoding EGFRt is codon-optimized. Preferably, the nucleotide sequence encoding EGFRt is a codon optimized for expression in humans.

[0074] In some embodiments, the nucleotide sequence encoding EGFRt has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 3. Preferably, EGFRt contains an epitope recognizable by an antibody such as cetuximab. Preferably, EGFRt lacks signaling or trafficking activity.

[0075] In some embodiments, the nucleotide sequence encoding EGFRt is SEQ ID NO: 3.

[0076] In some embodiments, the nucleotide sequence encoding EGFRt has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 3 or a fragment thereof. Preferably, EGFRt or a fragment thereof contains an epitope recognizable by an antibody such as cetuximab. Preferably, EGFRt or a fragment thereof lacks signaling activity or trafficking activity.

[0077] In some embodiments, the nucleotide sequence encoding EGFRt is SEQ ID NO: 3 or a fragment thereof.

[0078] Signal peptide The polynucleotide preferably comprises a nucleotide sequence encoding a signal peptide, such as an NGFR or GMS SFR alpha signal peptide, preferably an NGFR signal peptide.

[0079] The terms "GMS SFR alpha signal peptide" or "NGFR signal peptide," as used herein, may refer to signal peptides encoded by GMS SFR alpha or NGFR native coding sequences, respectively. Such signal peptides direct protein expression to the cell surface. Signal peptides can be cleaved from immature proteins during processing.

[0080] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding an NGFR signal peptide.

[0081] Examples of NGFR signal peptides are as follows: [ka]

[0082] Examples of nucleotide sequences encoding NGFR signal peptides are as follows: [ka]

[0083] In some embodiments, the NGFR signal peptide comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 4. Preferably, the NGFR signal peptide directs EGFRt expression to the cell surface.

[0084] In some embodiments, the NGFR signal peptide comprises the amino acid sequence of SEQ ID NO: 4.

[0085] In some embodiments, the nucleotide sequence encoding the NGFR signal peptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 5.

[0086] In some embodiments, the nucleotide sequence encoding the NGFR signal peptide is SEQ ID NO: 5.

[0087] In some embodiments, the NGFR signal peptide comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 4 or a fragment thereof. Preferably, the NGFR signal peptide or a fragment thereof directs EGFRt expression to the cell surface.

[0088] In some embodiments, the NGFR signal peptide comprises the amino acid sequence of SEQ ID NO: 4 or a fragment thereof. In some embodiments, the NGFR signal peptide consists of the amino acid sequence of SEQ ID NO: 4 or a fragment thereof.

[0089] In some embodiments, the nucleotide sequence encoding the NGFR signal peptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 5 or a fragment thereof.

[0090] In some embodiments, the nucleotide sequence encoding the NGFR signal peptide is SEQ ID NO: 5 or a fragment thereof.

[0091] In other embodiments, the polynucleotide comprises a nucleotide sequence encoding a GMS SFR alpha-signal peptide.

[0092] An example of a GMS SFR alpha signaling peptide is (Wang et al. (2011) Blood 118: 1255-1263): [ka]

[0093] Examples of nucleotide sequences encoding GMS SFR alpha signal peptides are as follows: [ka]

[0094] In some embodiments, the GMS SFR alpha-signal peptide comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6. Preferably, the GMS SFR alpha-signal peptide directs EGFRt expression to the cell surface.

[0095] In some embodiments, the GMS SFR alpha-signal peptide comprises the amino acid sequence of SEQ ID NO: 6.

[0096] In some embodiments, the nucleotide sequence encoding the GMS SFR alpha signal peptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7.

[0097] In some embodiments, the nucleotide sequence encoding the GMS SFR alpha signal peptide is SEQ ID NO: 7.

[0098] In some embodiments, the GMS SFR alpha-signal peptide comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 or a fragment thereof. Preferably, the GMS SFR alpha-signal peptide or a fragment thereof directs EGFRt expression to the cell surface.

[0099] In some embodiments, the GMS SFR alpha-signal peptide comprises the amino acid sequence of SEQ ID NO: 6 or a fragment thereof. In some embodiments, the GMS SFR alpha-signal peptide consists of the amino acid sequence of SEQ ID NO: 6 or a fragment thereof.

[0100] In some embodiments, the nucleotide sequence encoding the GMS SFR alpha signal peptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7 or a fragment thereof.

[0101] In some embodiments, the nucleotide sequence encoding the GMS SFR alpha signal peptide is SEQ ID NO: 7 or a fragment thereof.

[0102] In a preferred embodiment, a signal peptide (e.g., NGFR or GMS SFR alpha-signal peptide, preferably NGFR signal peptide) is functionally linked to EGFRt.

[0103] As used herein, the term “functionally linked” may mean that two components are linked together in a manner that enables both to perform functions without substantially interfering with each other. For example, a signal peptide can direct EGFRt expression to the cell surface.

[0104] For example, the signal peptide may be located at the amino terminus of EGFRt. In some embodiments, the signal peptide is located immediately to the amino terminus of EGFRt.

[0105] Cytoplasmic domain The polynucleotide preferably comprises a nucleotide sequence encoding a cytoplasmic tail. Preferably, the polynucleotide may comprise a polypeptide comprising the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39) or (ii) RRRHIVRK (SEQ ID NO: 40); or a nucleotide sequence encoding a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions.

[0106] In some embodiments, the variant of (i) or (ii) has three amino acid substitutions, additions, or deletions. In some embodiments, the variant of (i) or (ii) has two amino acid substitutions, additions, or deletions. In some embodiments, the variant of (i) or (ii) has one amino acid substitution, addition, or deletion.

[0107] An example of a nucleotide sequence encoding (i) is shown below: [ka]

[0108] Examples of nucleotide sequences encoding (ii) are as follows: [ka]

[0109] In some embodiments, the nucleotide sequence encoding (i) or (ii) has at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 or 9.

[0110] In some embodiments, the nucleotide sequence encoding (i) or (ii) is sequence number 8 or 9, respectively.

[0111] In some embodiments, the nucleotide sequence encoding (i) or (ii) has at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 or 9 or a fragment thereof.

[0112] In some embodiments, the nucleotide sequence encoding (i) or (ii) is sequence number 8 or 9 or a fragment thereof, respectively.

[0113] The cytoplasmic domain (e.g., (i), (ii), or variants thereof) may further contain the amino acid sequence alanine-serine (AS) at its C-terminus. Accordingly, the present invention further intends that SEQ ID NOs. 39 and 40 may be substituted with KRWNRGILAS (SEQ ID NOs. 41) and RRRHIVRKAS (SEQ ID NOs. 42), respectively. The "AS" sequence may be encoded by the nucleotide sequence GCTAGC. Accordingly, the present invention further intends that SEQ ID NOs. 8 and 9 may be substituted with AAGCGGTGGAACCGGGGCATCCTGGCTAGC (SEQ ID NOs. 43) and CGGCGGAGACACATCGTGCGGAAGGCTAGC (SEQ ID NOs. 44), respectively. The present invention further intends that SEQ ID NOs. 8 and 9 may be substituted with AAGCGGTGGAACCGGGGCATCCTGGCTAGC (SEQ ID NOs. 43) and CGGCGGAGACACATCGTGCGGAAGGCTAGC (SEQ ID NOs. 44), or fragments thereof.

[0114] Preferably, the amino acid sequences of (i) and (ii) or their variants are functionally linked to EGFRt. For example, the amino acid sequences of (i) and (ii) or their variants can increase the stability and expression of EGFRt on the cell surface.

[0115] For example, the amino acid sequences (i), (ii), or their variants may be located at the carboxyl terminus of EGFRt. In some embodiments, the amino acid sequences (i), (ii), or their variants are located immediately to the carboxyl terminus of EGFRt.

[0116] In preferred embodiments, the amino acid sequences (i), (ii) or their variants may be located at the carboxy terminus of the EGFRt transmembrane domain. In preferred embodiments, the amino acid sequences (i), (ii) or their variants may be located immediately to the carboxy terminus of the EGFRt transmembrane domain. In other embodiments, the amino acid sequences (i), (ii) or their variants may be linked to the carboxy terminus of the EGFRt transmembrane domain by a linker such as a linker peptide.

[0117] transmembrane domain In some embodiments, the polynucleotide includes a nucleotide sequence encoding the EGFR transmembrane domain. In some embodiments, the polynucleotide includes a nucleotide sequence encoding the NGFR transmembrane domain.

[0118] Examples of EGFR transmembrane domains are as follows: [ka]

[0119] Examples of nucleotide sequences encoding the EGFR transmembrane domain are as follows: [ka]

[0120] In some embodiments, the EGFR transmembrane domain comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10. Preferably, the EGFR transmembrane domain immobilizes EGFRt to the cell membrane.

[0121] In some embodiments, the EGFR transmembrane domain includes the amino acid sequence of SEQ ID NO: 10. In some embodiments, the EGFR transmembrane domain consists of the amino acid sequence of SEQ ID NO: 10.

[0122] In some embodiments, the nucleotide sequence encoding the EGFR transmembrane domain has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 11.

[0123] In some embodiments, the nucleotide sequence encoding the EGFR transmembrane domain is SEQ ID NO: 11.

[0124] In some embodiments, the EGFR transmembrane domain comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10 or a fragment thereof. In some embodiments, the EGFR transmembrane domain consists of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10 or a fragment thereof. Preferably, the EGFR transmembrane domain or a fragment thereof immobilizes EGFRt to the cell membrane.

[0125] In some embodiments, the EGFR transmembrane domain includes the amino acid sequence of SEQ ID NO: 10 or a fragment thereof. In some embodiments, the EGFR transmembrane domain consists of the amino acid sequence of SEQ ID NO: 10 or a fragment thereof.

[0126] In some embodiments, the nucleotide sequence encoding the EGFR transmembrane domain has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 11 or a fragment thereof.

[0127] In some embodiments, the nucleotide sequence encoding the EGFR transmembrane domain is SEQ ID NO: 11 or a fragment thereof.

[0128] Examples of NGFR transmembrane domains are as follows: [ka]

[0129] Examples of nucleotide sequences encoding the NGFR transmembrane domain are as follows: [ka]

[0130] In some embodiments, the NGFR transmembrane domain comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12. In some embodiments, the NGFR transmembrane domain consists of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12. Preferably, the NGFR transmembrane domain immobilizes EGFRt to the cell membrane.

[0131] In some embodiments, the NGFR transmembrane domain includes the amino acid sequence of SEQ ID NO: 12. In some embodiments, the NGFR transmembrane domain consists of the amino acid sequence of SEQ ID NO: 12.

[0132] In some embodiments, the nucleotide sequence encoding the NGFR transmembrane domain has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13.

[0133] In some embodiments, the nucleotide sequence encoding the NGFR transmembrane domain is SEQ ID NO: 13.

[0134] In some embodiments, the NGFR transmembrane domain comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12 or a fragment thereof. In some embodiments, the NGFR transmembrane domain consists of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12 or a fragment thereof. Preferably, the NGFR transmembrane domain or a fragment thereof immobilizes EGFRt to the cell membrane.

[0135] In some embodiments, the NGFR transmembrane domain includes the amino acid sequence of SEQ ID NO: 12 or a fragment thereof. In some embodiments, the NGFR transmembrane domain consists of the amino acid sequence of SEQ ID NO: 12 or a fragment thereof.

[0136] In some embodiments, the nucleotide sequence encoding the NGFR transmembrane domain has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13 or a fragment thereof.

[0137] In some embodiments, the nucleotide sequence encoding the NGFR transmembrane domain is SEQ ID NO: 13 or a fragment thereof.

[0138] Recycling Signal In some embodiments, the polynucleotide further comprises a nucleotide sequence encoding a recycling signal. In other embodiments, the polynucleotide does not include a nucleotide sequence encoding a recycling signal.

[0139] Examples of recycling signal sequences are shown below: [ka]

[0140] Examples of nucleotide sequences encoding recycling signals are shown below: [ka]

[0141] In some embodiments, the recycling signal comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14. Preferably, the recycling signal facilitates the reuse (recycling) of EGFRt to the cell membrane.

[0142] In some embodiments, the recycling signal includes the amino acid sequence of SEQ ID NO: 14.

[0143] In some embodiments, the nucleotide sequence encoding the recycling signal has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 15.

[0144] In some embodiments, the nucleotide sequence encoding the recycling signal is SEQ ID NO: 15.

[0145] In some embodiments, the recycling signal comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14 or a fragment thereof. Preferably, the recycling signal or a fragment thereof promotes the reuse (recycling) of EGFRt to the cell membrane.

[0146] In some embodiments, the recycling signal includes the amino acid sequence of SEQ ID NO: 14 or a fragment thereof. In some embodiments, the recycling signal consists of the amino acid sequence of SEQ ID NO: 14 or a fragment thereof.

[0147] In some embodiments, the nucleotide sequence encoding the recycling signal has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 15 or a fragment thereof.

[0148] In some embodiments, the nucleotide sequence encoding the recycling signal is SEQ ID NO: 15 or a fragment thereof.

[0149] Structures Examples of EGFRt structures of the present invention include the following: [Table 1] TIFF0007848138000017.tif249165TIFF0007848138000018.tif247164TIFF0007848138000019.tif52164

[0150] In some embodiments, the polynucleotide encodes an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 17, 19, 21, 23, or 25.

[0151] In some embodiments, the polynucleotide encodes the amino acid sequence of SEQ ID NOs. 17, 19, 21, 23, or 25.

[0152] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 16, 18, 20, 22, or 24.

[0153] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NOs. 16, 18, 20, 22, or 24.

[0154] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 16, 18, 20, 22, or 24.

[0155] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NOs. 16, 18, 20, 22, or 24.

[0156] In some embodiments, the polynucleotide encodes an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 17, 19, 21, 23, or 25, or a fragment thereof.

[0157] In some embodiments, the polynucleotide encodes the amino acid sequence of SEQ ID NOs. 17, 19, 21, 23, or 25, or a fragment thereof.

[0158] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 16, 18, 20, 22, or 24, or a fragment thereof.

[0159] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NOs. 16, 18, 20, 22, or 24, or a fragment thereof.

[0160] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 16, 18, 20, 22, or 24, or a fragment thereof.

[0161] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NOs. 16, 18, 20, 22, or 24, or a fragment thereof.

[0162] Further examples of EGFRt constructs include: [Table 2] TIFF0007848138000021.tif245165TIFF0007848138000022.tif248166TIFF0007848138000023.tif93165

[0163] In some embodiments, the polynucleotide encodes an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 29, 31, 33, or 35.

[0164] In some embodiments, the polynucleotide encodes the amino acid sequence of SEQ ID NOs. 29, 31, 33, or 35.

[0165] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 28, 30, 32, or 34.

[0166] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NOs. 28, 30, 32, or 34.

[0167] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 28, 30, 32, or 34.

[0168] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NOs. 28, 30, 32, or 34.

[0169] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 37 or 38.

[0170] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 37 or 38.

[0171] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 37 or 38.

[0172] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 37 or 38.

[0173] In some embodiments, the polynucleotide encodes an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 29, 31, 33, or 35, or a fragment thereof.

[0174] In some embodiments, the polynucleotide encodes the amino acid sequence of SEQ ID NOs. 29, 31, 33, or 35, or a fragment thereof.

[0175] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 28, 30, 32, or 34, or a fragment thereof.

[0176] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NOs. 28, 30, 32, or 34, or a fragment thereof.

[0177] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs. 28, 30, 32, or 34, or a fragment thereof.

[0178] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NOs. 28, 30, 32, or 34, or a fragment thereof.

[0179] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 37 or 38, or a fragment thereof.

[0180] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 37 or 38, or a fragment thereof.

[0181] In some embodiments, the polynucleotide consists of a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 37 or 38, or a fragment thereof.

[0182] In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 37 or 38, or a fragment thereof.

[0183] In some embodiments, the nucleotide sequence encoding EGFRt is functionally ligated to a promoter, preferably a weak promoter.

[0184] In some embodiments, the nucleotide sequence encoding EGFRt is functionally ligated to a bidirectional promoter. The bidirectional promoter may be further functionally ligated to the transgene.

[0185] In some embodiments, the polynucleotide further comprises IRES. In some embodiments, the nucleotide sequence encoding EGFRt is downstream of IRES.

[0186] Transgene In some embodiments, the polynucleotide further comprises a transgene. The polynucleotide may be, for example, a dicistronic vector or may contain a bidirectional promoter. The dicistronic vector may contain an IRES.

[0187] Preferably, the introduced gene produces a therapeutic effect.

[0188] In a preferred embodiment, the polynucleotide comprises a nucleotide sequence encoding a chimeric antigen receptor (CAR).

[0189] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a chimeric antigen receptor (CAR), and the polynucleotide further comprises a bidirectional promoter. The bidirectional promoter can, for example, control the expression of both the transgene and EGFRt.

[0190] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a chimeric antigen receptor (CAR), and the polynucleotide is a dicistronic vector. The dicistronic vector may include an IRES.

[0191] Chimeric antigen receptor (CAR) CARs typically consist of an extracellular ligand-binding domain linked to an intracellular signaling component, most commonly CD3ζ, either alone or in combination with one or more costimulatory domains, or a single-chain variable region fragment (scFv) of a monoclonal antibody. Spacers are often added between the extracellular antigen-binding domain and the transmembrane portion to optimize interaction with the target.

[0192] The CARs for use in the present invention may include the following: (i) Antigen-specific targeting domain; (ii) Transmembrane domain; (iii) at least one co-stimulatory domain, if applicable; and (iv) Intracellular signal transduction domain.

[0193] Preferably, the antigen-specific targeting domain includes an antibody or a fragment thereof, more preferably a single-chain variable region fragment.

[0194] Examples of transmembrane domains include the transmembrane domains of the T cell receptor complex, CD28, and CD8a zeta chains.

[0195] Examples of co-stimulatory domains include those derived from CD28, CD137(4-1BB), CD134(OX40), DaplO, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, and CD40.

[0196] In some embodiments, the co-stimulatory domain is a co-stimulatory domain derived from CD28.

[0197] Examples of intracellular signaling domains include human CD3ζ chains, FcyRIII, FcsRI, the cytoplasmic tail of Fc receptors, and cytoplasmic receptors with immunoreceptor tyrosine-based activation motifs (ITAMs).

[0198] The term “chimeric antigen receptor” (“CAR” or “CARs”), as used herein, refers to an engineered receptor that can confer antigen specificity to a cell (e.g., T cell, such as naive T cell, central memory T cell, effector memory T cell, or a combination thereof). CARs are also known as artificial T cell receptors, chimeric T cell receptors, or chimeric immune receptors.

[0199] The antigen-specific targeting domain provides the CAR with the ability to bind to a target antigen. The antigen-specific targeting domain preferably targets a clinically significant antigen for which it is desirable to induce an effector immune response.

[0200] An antigen-specific targeting domain can be any protein or peptide that has the ability to specifically recognize and bind to a biological molecule. The antigen-specific targeting domain includes any naturally occurring, synthetic, semi-synthetic, or recombinant binding partner for the biological molecule of interest.

[0201] Examples of antigen-specific targeting domains include antibodies or antibody fragments or derivatives, extracellular domains of receptors, ligands for cell surface molecules / receptors, or their receptor-binding domains.

[0202] In preferred embodiments, the antigen-specific targeting domain is an antibody or derived from an antibody. The antibody-derived targeting domain may be a fragment of an antibody, or a genetically engineered product of one or more fragments of an antibody, which are involved in binding to the antigen. Examples include variable regions (Fv), complementarity-determining regions (CDR), Fab, single-chain antibodies (scFv), heavy-chain variable regions (VH), light-chain variable regions (VL), and camelid antibodies (VHH).

[0203] In a preferred embodiment, the binding domain is a single-chain antibody (scFv). The scFv may be, for example, a mouse, human, or humanized scFv.

[0204] The term “complementarity-determining region” (“CDR”) in relation to an antibody or its antigen-binding fragment refers to a highly variable loop in the variable region of the antibody’s heavy or light chain. CDRs interact with antigen conformation and can largely determine binding to the antigen (although several framework regions are known to be involved in binding). The heavy chain variable region and the light chain variable region each contain three CDRs.

[0205] The “heavy chain variable region” (“VH”) refers to a fragment of the antibody's heavy chain containing three CDRs located between adjacent stretches known as the framework region (which is more conserved than the CDRs and forms a scaffold supporting the CDRs).

[0206] The "light chain variable region" ("VL") refers to a fragment of the antibody light chain containing three CDRs located between framework regions.

[0207] "Fv" refers to the smallest fragment of an antibody that has a complete antigen-binding site. An Fv fragment consists of a variable region of a single light chain bound to a variable region of a single heavy chain.

[0208] A "single-chain Fv antibody" ("scFv") refers to an engineered antibody consisting of a light-chain variable region and a heavy-chain variable region linked to each other directly or via a peptide linker sequence.

[0209] Antibodies that specifically bind to a target antigen can be prepared using methods well known in the art. Such methods include phage display, methods for generating human antibodies or humanized antibodies, or methods using transgenic animals or plants engineered to produce human antibodies. Phage display libraries of partially or completely synthesized antibodies are available and can be screened for antibodies or fragments thereof that can bind to target molecules. Phage display libraries of human antibodies are also available. After identification, the amino acid or polynucleotide sequences encoding the antibodies can be isolated and / or determined.

[0210] The CAR used in the present invention may also include one or more co-stimulatory domains. These domains may enhance cell proliferation, cell survival, and the development of memory cells.

[0211] Each co-stimulatory domain includes, for example, one or more co-stimulatory domains from the TNFR superfamily, CD28, CD137(4-1BB), CD134(OX40), DaplO, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-1, TNFR-II, Fas, CD30, CD40, or combinations thereof. Co-stimulatory domains derived from other proteins may also be used in conjunction with the CARs used in this invention.

[0212] The CARs used in the present invention may also include an intracellular signaling domain. This domain may be a cytoplasmic domain that transmits effector functional signals and can cause cells to perform their specialized functions. Examples of intracellular signaling domains include, but are not limited to, the ζ chain of a T cell receptor or any of its homologs (e.g., η chain, FcεR1γ and β chains, MB1(Igα) chain, B29(Igβ) chain, etc.), CD3 polypeptides (Δ, δ and ε), syk family tyrosine kinases (e.g., Syk, ZAP 70), src family tyrosine kinases (e.g., Lck, Fyn, Lyn), and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. The intracellular signaling domain may be a human CD3ζ chain, FcyRIII, FcsRI, a cytoplasmic tail of an Fc receptor, a cytoplasmic receptor having an immunoreceptor tyrosine-based activation motif (ITAM), or a combination thereof.

[0213] The CAR used in the present invention may also include a transmembrane domain. The transmembrane domain may include a transmembrane sequence derived from any protein having a transmembrane domain, including any type I, type II, or type III transmembrane protein. The transmembrane domain of the CAR used in the present invention may also include an artificial hydrophobic sequence. The transmembrane domain of the CAR used in the present invention may be selected to not dimerize. Examples of transmembrane (TM) regions used in CAR constructs include: 1) CD28 TM region (Pule et al, Mol Ther, 2005, Nov;12(5):933-41; Brentjens et al, CCR, 2007, Sep 15;13(18 Pt 1):5426-35; Casucci et al, Blood, 2013, Nov 14;122(20):3461-72); 2) OX40 TM region (Pule et al, Mol Ther, 2005, Nov;12(5):933-41); 3) 41BB TM region (Brentjens et al, CCR, 2007, Sep 15;13(18 Pt 1):5426-35); 4) CD3 zeta TM region (Pule et al, Mol Ther, 2005, Nov;12(5):933-41; Savoldo B, Blood, 2009, Jun 18;113(25):6392-402.);5)CD8a TM region (Maher et al, Nat Biotechnol, 2002, Jan;20(1):70-5.; Imai C, Leukemia, 2004, Apr;18(4):676-84; Brentjens et al, CCR, 2007, Sep 15;13(18 Pt 1):5426-35; Milone et al, Mol Ther, 2009, Aug;17(8):1453-64.).

[0214] gene editing In some embodiments, the polynucleotide or portion thereof is intended for insertion by gene editing.

[0215] In some embodiments, polynucleotides are donor vectors or donor templates (for example, in the context of gene editing).

[0216] In some embodiments, the transgene and / or EGFRt coding sequence are for insertion by gene editing.

[0217] In some embodiments, the polynucleotide further comprises an IRES sequence between the transgene and the nucleotide sequence encoding EGFRt. In some embodiments, the polynucleotide further comprises an IRES sequence between the transgene and the nucleotide sequence encoding EGFRt, a signal peptide and / or polypeptide (e.g., (i) or (ii), or a variant thereof).

[0218] In some embodiments, the polynucleotide does not include a promoter. For example, the expression of EGFRt and / or the transgene may be driven by an endogenous promoter in the cell genome into which the polynucleotide or the portion thereof is inserted.

[0219] For example, a polynucleotide may include a transgene, IRES, and EGFRt coding sequences (without the promoter, in some cases). Such a polynucleotide may be used, for example, in gene editing (e.g., inserted into the cell's genome, with the expression of the transgene and EGFRt optionally driven by an endogenous promoter). For example, gene editing may be applied to cells, such as T cells or hematopoietic stem cells or progenitor cells.

[0220] In a further exemplary context of CD40LG gene editing, the CD40LG gene is generally not expressed in hematopoietic stem cells or progenitor cells, and consequently, the IRES-EGFRt construct may also require the insertion of a promoter via the polynucleotide of the present invention or via another system (e.g., a TetO7 minimal promoter upstream of IRES).

[0221] The term "gene editing" refers to a type of genetic engineering in which nucleic acids are inserted, deleted, or replaced within a cell. Gene editing can be achieved using engineered nucleases that can be targeted to desired sites in polynucleotides (e.g., genomes). Such nucleases can produce site-directed double-strand breaks at desired locations, which can then be repaired through non-homologous end joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations.

[0222] Such nucleases can be delivered to target cells using vectors such as viral vectors.

[0223] Examples of suitable nucleases known in the art include zinc finger nucleases (ZFNs), activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems (Gaj, T. et al. (2013) Trends Biotechnol. 31: 397-405; Sander, JD et al. (2014) Nat. Biotechnol. 32: 347-55).

[0224] Meganuclease (Silve, G. et al. (2011) Cur. Gene Ther. 11: 11-27) can also be used as a suitable nuclease for gene editing.

[0225] The CRISPR / Cas system is an RNA-guided (guide) DNA binding system (van der Oost et al. (2014) Nat. Rev. Microbiol. 12: 479-92), where the guide RNA (gRNA) can be selected to allow the Cas9 domain to be targeted to a specific sequence. Methods for designing gRNAs are known in the art. Furthermore, modified forms of fully orthogonal Cas9 proteins, as well as Cas9 / gRNA ribonucleoprotein complexes and gRNA structures / compositions for binding to different proteins, have recently been developed to simultaneously and directionally target different effector domains to desired genomic sites in cells (Esvelt et al. (2013) Nat. Methods 10: 1116-21; Zetsche, B. et al. (2015) Cell pii: S0092-8674(15)01200-3; Dahlman, JE et al. (2015) Nat. Biotechnol. 2015 Oct 5. doi: 10.1038 / nbt.3390. [Epub ahead of print]; Zalatan, JG et al. (2015) Cell 160: 339-50; Paix, A. et al. (2015) Genetics 201: 47-54) Suitable for use in the present invention.

[0226] Polynucleotides The polynucleotides of the present invention may comprise DNA or RNA, preferably DNA. The polynucleotides of the present invention may be single-stranded or double-stranded. Preferably, the polynucleotides are isolated polynucleotides. Those skilled in the art will understand that numerous different polynucleotides can encode the same polypeptide as a result of genetic coding degeneracy. Furthermore, those skilled in the art will understand that, using common techniques, nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the present invention may be made to reflect the codon usage of any particular host organism in which the polypeptide of the present invention will be expressed.

[0227] The polynucleotides may be modified by any method available in the art. Such modifications may be carried out to enhance the in vivo activity or lifetime of the polynucleotides of the present invention.

[0228] Polynucleotides, such as DNA polynucleotides, can be prepared recombinantly, synthetically, or by any means available to those skilled in the art. Polynucleotides may also be cloned using standard techniques.

[0229] Longer polynucleotides are generally produced using recombinant methods, such as polymerase chain reaction (PCR) cloning techniques. This involves preparing a pair of primers (e.g., about 15–30 nucleotides) adjacent to the target sequence to be cloned, contacting the primers with mRNA or cDNA obtained from animal or human cells, carrying out a polymerase chain reaction under conditions that induce amplification of the desired region, isolating the amplified fragment (e.g., by purifying the reaction mixture using an agarose gel), and recovering the amplified DNA. The primers may be designed to contain appropriate restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector.

[0230] cell In another aspect, the present invention provides cells containing the polynucleotide of the present invention.

[0231] In some embodiments, the cells are T cells, lymphocytes, or stem cells, such as hematopoietic stem cells or induced pluripotent stem cells (iPS).

[0232] In some embodiments, the cells are hematopoietic stem cells or hematopoietic progenitor cells. In some embodiments, the cells are T cells.

[0233] For example, cells may be selected from the group consisting of CD4 cells, CD8 cells, Th0 cells, Tc0 cells, Th1 cells, Tc1 cells, Th2 cells, Tc2 cells, Th17 cells, Th22 cells, γ / δ T cells, natural killer (NK) cells, natural killer T (NKT) cells, double-negative T cells, naive T cells, memory stem T cells, central memory T cells, effector memory T cells, effector T cells, cytokine-induced killer (CIK) cells, hematopoietic stem cells, and pluripotent stem cells.

[0234] The cells may be those isolated from the subject.

[0235] The cells of the present invention may be provided for use in adoptive cell transfer. As used herein, the term “adoptive cell transfer” refers to the administration of a population of cells to a patient. Typically, the cells are T cells isolated from a subject, which are then genetically modified and cultured in vitro before being administered to the patient.

[0236] Adoptive cell transfer can be allogenic or autologous.

[0237] "Autologous cell transfer" means that the starting cell population (which is then transduced with the polynucleotide or vector according to the present invention) is obtained from the same subject to which the transduced cell population is administered. Autologous transfer has advantages because it avoids the challenges associated with immunological incompatibility and is available to subjects regardless of the availability of genetically compatible donors.

[0238] It should be understood that "allogeneic cell transfer" means that the starting cell population (which is then transduced with the polynucleotide or vector according to the present invention) is obtained from a different target than the target to which the transduced cell population is administered. Preferably, to minimize the risk of immunological incompatibility, the donor is genetically compatible with the target to which the cells are administered. Alternatively, the donor may be a mismatch with the patient and unrelated.

[0239] Vector In some embodiments, the polynucleotide is a vector. Preferably, the vector is a viral vector, such as a retroviral vector, a lentiviral vector, an adeno-associated virus (AAV) vector or an adenoviral vector. In some embodiments, the polynucleotide is a viral genome.

[0240] In another aspect, the invention provides a viral vector comprising the polynucleotide of the invention.

[0241] In some embodiments, the viral vector is a retroviral vector, a lentiviral vector, an adeno-associated virus (AAV) vector or an adenoviral vector.

[0242] In some embodiments, the viral vector is in the form of viral vector particles.

[0243] A vector is a tool that enables or facilitates the movement of something from one environment to another. In accordance with the present invention, by way of example, some vectors used in recombinant nucleic acid technology enable the movement of entities such as nucleic acid fragments (e.g., heterologous DNA fragments such as heterologous cDNA fragments) into target cells. Vectors can serve the purpose of maintaining heterologous nucleic acids (DNA or RNA) within cells, facilitating the replication of vectors containing nucleic acid fragments, and / or facilitating the expression of proteins encoded by nucleic acid fragments.

[0244] The vector comprising the polynucleotide used in the present invention can be introduced into cells using various techniques known in the art such as transfection, transduction and transformation.

[0245] Transfection refers to a general method of introducing nucleic acids into cells, including methods that use non-viral vectors to deliver polynucleotides to cells. Transduction may refer to a method of introducing nucleic acids into cells using viral vectors.

[0246] Retrovirus and lentiviral vectors Retroviral vectors may or may be derived from any suitable retrovirus. Numerous different retroviruses have been identified. Examples include mouse leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney's mouse leukemia virus (Mo-MLV), FBR mouse osteosarcoma virus (FBR MSV), Moloney's mouse sarcoma virus (Mo-MSV), Abelson's mouse leukemia virus (A-MLV), avian myelocytosis virus-29 (MC29), and avian erythroblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin, JM et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.

[0247] Retroviruses can be broadly divided into two categories: "simple" and "complex." These can be further divided into seven subgroups. Five of these subgroups represent carcinogenic retroviruses. The remaining two subgroups are lentiviruses and spumaviruses.

[0248] The basic structure of retroviral and lentiviral genomes shares many common features, such as the 5' LTR and 3' LTR. Between or within these are the gag, pol, and env genes, which encode packaging signals that enable the packaging of the genome, primer binding sites, integration sites that allow integration into the host cell genome, and packaging components (these are polypeptides necessary for the assembly of the viral particle). Lentiviruses have further features, such as the rev and RRE sequences in HIV, which allow for the efficient export of the integrated proviral RNA transcript from the nucleus to the cytoplasm of the infected target cell.

[0249] In proviruses, these genes are flanked at both ends by regions called long-terminal repeats (LTRs). LTRs are involved in the integration and transcription of proviruses. LTRs can also act as enhancer-promoter sequences, regulating the expression of viral genes.

[0250] The LTR itself is an identical sequence that can be divided into three elements: U3, R, and U5. U3 originates from a sequence specific to the 3' end of the RNA. R originates from a sequence repeated at both ends of the RNA. U5 originates from a sequence specific to the 5' end of the RNA. The sizes of the three elements can vary considerably between different retroviruses.

[0251] In the deficient retroviral vector genome, gag, pol, and env are either absent or non-functional.

[0252] In typical retroviral vectors, at least a portion of one or more protein-coding regions essential for replication may be removed from the virus. This results in a loss of replication in the viral vector. The portion of the viral genome may also be replaced by a library encoding candidate regulatory regions functionally linked to the regulatory control region and reporter portion in the vector genome, in order to generate a vector containing candidate regulatory regions that can transduce target host cells and / or integrate their genome into the host genome.

[0253] Lentiviral vectors are part of a larger group of retroviral vectors. A detailed list of lentiviruses can be found in Coffin, JM et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63. Briefly, lentiviruses are divided into primate and non-primate groups. Examples of primate lentiviruses, though not limited to them, include human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV), which are the causative agents of human acquired immunodeficiency syndrome (AIDS). Examples of non-primate lentiviruses include the prototype "slow virus" Visna / Maedivirus (VMV), as well as related canine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0254] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis, P et al. (1992) EMBO J. 11: 3053-8; Lewis, PF et al. (1994) J. Virol. 68: 510-6). In contrast, other retroviruses, such as MLV, cannot infect non-dividing or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissue.

[0255] A lentiviral vector, as used herein, is a vector comprising at least one component which may be derived from a lentivirus. Preferably, the component is involved in a biological mechanism by which the vector infects a cell, expresses a gene, or replicates.

[0256] Lentiviral vectors can be "primate" vectors. Lentiviral vectors can also be "non-primate" vectors (i.e., derived from viruses that do not primarily infect primates, especially humans). Examples of non-primate lentiviruses may be any member of the Lentiviridae family that does not naturally infect primates.

[0257] Examples of lentivirus-based vectors include those based on HIV-1 and HIV-2, which are listed below.

[0258] HIV-1 vectors contain cis-acting elements also found in simple retroviruses. Sequences extending within the gag open reading frame have been shown to be crucial for HIV-1 packaging. Therefore, HIV-1 vectors often contain the relevant gag region with a mutated translation start codon. Furthermore, most HIV-1 vectors also contain a portion of the env gene, including the RRE. Rev binds to the RRE, thereby enabling the transport of full-length or single-spliced ​​mRNA from the nucleus to the cytoplasm. In the absence of Rev and / or RRE, full-length HIV-1 RNA accumulates in the nucleus. Alternatively, the need for Rev and RRE can be reduced by using constitutive transport elements from certain simple retroviruses, such as the Mason-Pfizer monkey virus. The viral protein Tat is required for efficient transcription from the HIV-1 LTR promoter.

[0259] Most HIV-2-based vectors are very similar structurally to HIV-1 vectors. Similar to HIV-1-based vectors, HIV-2 vectors also require the RRE for efficient transport of full-length or singly spliced viral RNA.

[0260] Preferably, the viral vectors used in the present invention have a minimal viral genome.

[0261] It should be understood that a "minimal viral genome" is one in which the viral vector has been engineered to remove non-essential elements and retain essential elements in order to provide the functionality necessary to infect a target host cell, transduce, and deliver the nucleotide sequence of interest. Further details of this strategy can be found in WO 1998 / 017815.

[0262] Preferably, the plasmid vector used to produce the viral genome in the host cell / packaging cell has sufficient lentiviral genetic information to allow packaging of the RNA genome into viral particles that can infect target cells in the presence of packaging components but cannot replicate independently to produce infectious viral particles in the final target cell. Preferably, the vector lacks (is defective for) functional gag-pol and / or env genes and / or other genes essential for replication.

[0263] However, the plasmid vector used to produce the viral genome in the host cell / packaging cell also contains transcriptional regulatory control sequences operably linked to the lentiviral genome to direct transcription in the host cell / packaging cell. These regulatory sequences may be native sequences associated with the transcribed viral sequences (i.e., the 5'U3 region), or they may be heterologous promoters, such as another viral promoter (e.g., the CMV promoter), etc.

[0264] The vector may be a self-inactivating (SIN) vector in which viral enhancer and promoter sequences are deleted. SIN vectors can be generated in vivo and transduced into non-dividing cells with similar potency to wild-type vectors. Transcriptional inactivation of the long-terminal repeat (LTR) in SIN proviruses should prevent mobilization by the reproducible virus. This should also allow for regulated gene expression from the internal promoter by eliminating any cis-effect of the LTR.

[0265] The vector may be deficient in integration. Deficient lentiviral vectors (IDLVs) can be prepared, for example, by packaging the vector with a catalytically inactive integrase (e.g., HIV integrase with the D64V mutation in the catalytic site; Naldini, L. et al. (1996) Science 272: 263-7; Naldini, L. et al. (1996) Proc. Natl. Acad. Sci. USA 93: 11382-8; Leavitt, AD et al. (1996) J. Virol. 70: 721-8), or by modifying or deleting the essential att sequence from the vector LTR (Nightingale, SJ et al. (2006) Mol. Ther. 13: 1121-32), or by a combination of the above.

[0266] Adeno-associated virus (AAV) vector AAV vectors may contain the AAV genome or its fragments or derivatives.

[0267] The AAV genome is a polynucleotide sequence that can encode functions required for the generation of AAV particles. These functions include those that operate in the AAV replication and packaging cycle in host cells, such as the capsid formation of the AAV genome onto the AAV particle. Naturally occurring AAVs are replication-deficient and rely on the supply of trans helper functions for the completion of the replication and packaging cycle. Therefore, the AAV genome of the AAV vector of the present invention is typically replication-deficient.

[0268] The AAV genome may be in a single-stranded form, either positive-sense or negative-sense, or in a double-stranded form. The use of a double-stranded form allows for bypassing the DNA replication step in target cells, thereby promoting the expression of the transgene.

[0269] The AAV genome may be obtained from any naturally occurring serotype, isolate, or clade of AAV. Therefore, the AAV genome may be the entire genome of a naturally occurring AAV. As is well known to those skilled in the art, naturally occurring AAVs can be classified according to various biological systems.

[0270] Generally, AAVs are referred to in terms of their serotypes. Serotypes correspond to variant subspecies of AAV, which have specific reactivity that can be used to distinguish them from other variant subspecies based on the expression profile of their capsid surface antigens. Typically, viruses with a particular AAV serotype do not efficiently cross-react with neutralizing antibodies specific to any other AAV serotype.

[0271] AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11, as well as recombinant serotypes such as Rec2 and Rec3, which have recently been identified from primate brains.

[0272] In some embodiments, the AAV is serotype AAV1, AAV6, AAV6.2, AAV7, AAV9, rh10, rh39, or rh43. In some embodiments, the AAV vector particle contains serotype AAV1, AAV6, AAV6.2, AAV7, AAV9, rh10, rh39, or rh43 capsid protein. In some embodiments, the AAV vector particle is serotype AAV1, AAV6, AAV6.2, AAV7, AAV9, rh10, rh39, or rh43 vector particle.

[0273] In some embodiments, the AAV is the AAV9;AAV9 PHP.B;AAV9 PHP.eB; or AAVrh10 serotype. In some embodiments, the AAV vector particle contains the AAV9;AAV9 PHP.B;AAV9 PHP.eB; or AAVrh10 serotype capsid protein.

[0274] The capsid protein may be an artificial or mutant capsid protein.

[0275] As used herein, the term “artificial capsid” means that the capsid particle contains an amino acid sequence that does not exist in nature, or contains an amino acid sequence that has been manipulated (e.g., modified) from a naturally occurring capsid amino acid sequence.

[0276] In other words, an artificial capsid protein contains mutations or variations in its amino acid sequence compared to the parental capsid sequence when the artificial capsid amino acid sequence and the parental capsid amino acid sequence from which it is derived are aligned. Methods for sequence alignment are well known in the art and are referenced herein.

[0277] An overview of AAV serotypes can be found in Choi et al. (2005) Curr. Gene Ther. 5:299-310 and Wu et al. (2006) Molecular Therapy 14:316-27. The sequences of the AAV genome for use in this invention, or the sequences of elements of the AAV genome including ITR sequences, rep, or cap genes, are the following accession numbers for the whole AAV genome sequence: Adeno-associated virus 1 NC_002077, AF063497; Adeno-associated virus 2 NC_001401; Adeno-associated virus 3 NC_001729; Adeno-associated virus 3B NC_001863; Adeno-associated virus 4 NC_001829; Adeno-associated virus 5 Y18065, AF085716; Adeno-associated virus 6 NC_001862; Tuscan AAV ATCC VR-865 AY186198, AY629583, NC_004828; Tuscan AAV strain DA-1 NC_006263, AY629583; Bovine AAV This may originate from NC_005889 or AY388617.

[0278] AAVs are sometimes referred to in terms of clades or clones. This refers to the phylogenetic relationships of naturally occurring AAVs, and typically refers to a phylogenetic group of AAVs that can be traced back to a common ancestor and include all of its descendants. Furthermore, AAVs may be referred to in terms of specific isolates, i.e., genetic isolates of specific AAVs found in nature. The term genetic isolate describes a population of AAVs that has undergone limited genetic mixing with other naturally occurring AAVs, thereby defining a population that is distinct enough to be recognized at the genetic level.

[0279] Those skilled in the art can select a suitable serotype, clade, clone, or isolate of AAV for use in the present invention based on their common general knowledge.

[0280] AAV serotypes determine the tissue specificity of AAV virus infection (or tropism).

[0281] Typically, the AAV genome of a naturally occurring serotype, isolate, or clade of AAV contains at least one reverse-terminal repeat (ITR) sequence. The ITR sequence provides a functional origin for replication by acting cis-wise, enabling vector incorporation and excision from the cell's genome. In preferred embodiments, one or more ITR sequences are adjacent to the nucleotide sequences disclosed herein. The AAV genome may also contain packaging genes, e.g., rep and / or cap genes encoding the packaging function of AAV particles. The rep gene encodes one or more of the proteins Rep78, Rep68, Rep52, and Rep40 or their variants. The cap gene encodes one or more capsid proteins, e.g., VP1, VP2, and VP3 or their variants. These proteins constitute the capsid of the AAV particle.

[0282] Promoters are functionally linked to each of the packaging genes. Specific examples of such promoters include the p5, p19, and p40 promoters (Laughlin et al. (1979) Proc. Natl. Acad. Sci. USA 76:5567-5571). For example, the p5 and p19 promoters are typically used to express rep genes, while the p40 promoter is typically used to express cap genes.

[0283] As discussed earlier, the AAV genome used in the AAV vector of the present invention may therefore be the entire genome of naturally occurring AAV. For example, an AAV vector or vector particle can be prepared in vitro by using a vector containing the entire AAV genome. However, although such a vector can, in principle, be administered to a patient, this is rarely done in practice. Preferably, the AAV genome is derivatized for administration to a patient. Such derivatization is standard practice in the art, and the present invention encompasses the use of any known derivative of the AAV genome, and derivatives that can be produced by applying techniques known in the art. Derivatization of the AAV genome and AAV capsid is outlined in Coura and Nardi (2007) Virology Journal 4:99, as well as in Choi et al. and Wu et al. (see above).

[0284] Derivatives of the AAV genome include any terminal cut or modified form of the AAV genome that enables the expression of a transgene from the AAV vector of the present invention in vivo. Typically, it is possible to cut the AAV genome extensively while retaining the minimum viral sequence but preserving the above-mentioned function. This is preferred for safety reasons, as it reduces the risk of recombination between the vector and wild-type virus and avoids the induction of a cellular immune response in target cells due to the presence of viral gene proteins.

[0285] Typically, the derivative comprises at least one reverse-terminal repeat (ITR), preferably more than one ITR, for example, two or more ITRs. One or more of the ITRs may originate from AAV genomes with different serotypes, or they may be chimeric ITRs or mutant ITRs. Preferred mutant ITRs have a deletion of trs (terminal degradation sites). This deletion allows for continuous replication of the genome to create a single-stranded genome containing both the coding and complementary sequences, i.e., a self-complementary AAV genome. This allows for bypassing DNA replication in target cells and thus enables accelerated transgene expression.

[0286] In some embodiments, the AAV vector includes at least one, for example, two, AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 ITRs. In some embodiments, the AAV vector includes at least one AAV9 ITR.

[0287] In some embodiments, the AAV vector includes two AAV9 ITRs.

[0288] One or more ITRs are preferably adjacent at both ends to the nucleotide sequence disclosed herein. The inclusion of one or more ITRs is preferable to promote concatemer formation of the vector of the present invention in the nucleus of the host cell, for example, after the conversion of the single-stranded vector DNA to double-stranded DNA by the action of host cell DNA polymerase. The formation of such an episomal concatemer protects the vector construct for the lifetime of the host cell, thereby enabling sustained expression of the transgene in vivo.

[0289] In preferred embodiments, the ITR element is the only sequence retained from the natural AAV genome in the derivative. Therefore, the derivative preferably does not contain the rep and / or cap genes of the natural genome, nor any other sequences of the natural genome. This is preferable for the reasons mentioned above, and also to reduce the possibility of vector integration into the host cell genome. Furthermore, reducing the size of the AAV genome increases flexibility in incorporating other sequence elements (e.g., regulatory elements) into the vector, in addition to the transgene.

[0290] Therefore, the following portion: one reverse-terminal repeat (ITR) sequence, replication (rep) and capsid (cap) genes, may be removed from the derivatives of the present invention. However, in some embodiments, the derivatives may further include one or more rep and / or cap genes or other viral sequences of the AAV genome. Naturally occurring AAV is frequently incorporated into specific sites on human chromosome 19 and exhibits negligible random incorporation, allowing the vector's incorporation ability to be maintained in a therapeutic setting.

[0291] If the derivative contains capsid proteins, i.e., VP1, VP2, and / or VP3, the derivative may be a chimeric, shuffled, or capsid-modified derivative of one or more naturally occurring AAVs. In particular, the present invention encompasses the provision of capsid protein sequences derived from different serotypes, clades, clones, or isolates of AAV into the same vector (i.e., pseudotype vectors). Thus, in one embodiment, the AAV vector is in the form of pseudotype AAV vector particles.

[0292] Chimeric, shuffled, or capsid-modified derivatives are typically selected to provide AAV vectors with one or more desired functionalities. Therefore, compared to AAV vectors containing naturally occurring AAV genomes, such as the AAV2 genome, these derivatives may exhibit improved gene delivery efficiency, reduced immunogenicity (humoral or cellular), altered tropism range, and / or improved targeting of specific cell types. Improved gene delivery efficiency may be achieved through improved receptor or co-receptor binding on the cell surface, improved internal migration, improved trafficking into the cell and nucleus, improved uncoating of viral particles, and improved conversion of single-stranded genomes to double-stranded forms. Improved efficiency may also relate to altered tropism ranges or targeting of specific cell populations, ensuring that the vector dose is not diluted by administration to tissues that do not require it.

[0293] Chimeric capsid proteins include those created by recombination between two or more capsid coding sequences of naturally occurring AAV serotypes. This can be carried out, for example, by a marker rescue method in which a non-infectious capsid sequence of one serotype is co-transfected with a capsid sequence of a different serotype, and directed selection is used to select the capsid sequence with the desired properties. These capsid sequences of different serotypes can be modified intracellularly by homologous recombination to create novel chimeric capsid proteins.

[0294] Chimeric capsid proteins also include those created by manipulating the capsid protein sequence to transfer specific capsid protein domains, surface loops, or specific amino acid residues between two or more capsid proteins, for example, between two or more capsid proteins of different serotypes.

[0295] Shuffled or chimeric capsid proteins may similarly be prepared by DNA shuffling or by error-prone PCR. Hybrid AAV capsid genes can be prepared by randomly fragmenting the sequence of the relevant AAV gene, for example, the sequence encoding the capsid proteins of several different serotypes, and then subsequently reconstructing the fragments using a self-priming polymerase reaction, which may also result in cross-reaction in regions with sequence homology. A library of hybrid AAV genes prepared by shuffling several serotype capsid genes in this way can be screened to identify viral clones with desired functionality. Similarly, a diverse library of mutants may be prepared by randomly mutating the AAV capsid gene using error-prone PCR, and these can then be selected for desired properties.

[0296] The capsid gene sequence may also be genetically modified to introduce specific deletions, substitutions, or insertions relative to the natural wild-type sequence. In particular, the capsid gene can be modified by inserting sequences of unrelated proteins or peptides into the open reading frame of the capsid code sequence, or at the N- and / or C-terminus of the capsid code sequence.

[0297] Unrelated proteins or peptides may, advantageously, act as ligands for specific cell types, thereby providing improved binding to target cells or improving the specificity of the vector's targeting to a particular cell population. Alternatively, unrelated proteins may facilitate the purification of viral particles as part of the production process, i.e., they may act as epitopes or affinity tags. The insertion site is typically selected so as not to interfere with other functions of the viral particle, such as internal migration or trafficking. Those skilled in the art can identify suitable insertion sites based on their common general knowledge.

[0298] The present invention further includes providing AAV genome sequences in an order and arrangement different from those of the natural AAV genome. The present invention also includes the substitution of one or more AAV sequences or genes with sequences from another virus or with a chimeric gene consisting of sequences from two or more viruses. Such a chimeric gene may consist of sequences derived from two or more related viral proteins from different virus species.

[0299] The AAV particles of the present invention include a transcapsidized form in which an AAV genome or derivative having an ITR of one serotype is packaged within a capsid of a different serotype. The AAV particles of the present invention also include a mosaic form in which a mixture of unmodified capsid proteins derived from two or more different serotypes constitutes the viral capsid. Furthermore, the AAV particles also include a chemically modified form having ligands adsorbed to the capsid surface. For example, such ligands include antibodies for targeting specific cell surface receptors.

[0300] The AAV vector may contain multiple copies (e.g., 2, 3, etc.) of the nucleotide sequence referred to herein.

[0301] Adenovirus vector Adenoviruses are double-stranded linear DNA viruses that do not use RNA intermediates. There are more than 50 different human serotypes of adenoviruses, which are divided into six subgroups based on genetic sequence homology. The natural targets of adenoviruses are the epithelium of the respiratory tract and gastrointestinal tract, and they generally cause only mild symptoms. Serotypes 2 and 5 (which have 95% sequence homology) are the most commonly used in adenovirus vector systems and are usually associated with upper respiratory tract infections in young people.

[0302] Adenoviruses have been used as vectors for gene therapy and heterologous gene expression. Their large (36kb) genome can accommodate foreign insertion DNA up to 8kb, and they efficiently replicate in complementary cell lines. 12 Adenoviruses can produce extremely high titers. Therefore, adenoviruses are one of the best systems for studying gene expression in primary non-replicating cells.

[0303] The expression of viral or exogenous genes from adenovirus genomes does not require replicating cells. Adenovirus vectors enter cells via receptor-mediated endocytosis. Once inside the cell, adenovirus vectors are rarely integrated into the host chromosome. Instead, adenovirus vectors function episomal (independently of the host genome) as linear genomes within the host nucleus. Therefore, the use of recombinant adenoviruses mitigates the problems associated with random integration into the host genome.

[0304] Selection, depletion, and tracking methods In another aspect, the present invention relates to a method for selecting transduced cells, (a) A step of transfecting a population of cells with the polynucleotide or viral vector of the present invention, (b) A step of bringing the transduced cell population into contact with an EGFRt binder, and (c) Steps to select cells bound to the EGFRt binder. This provides a method that includes this.

[0305] The selection method allows for the enrichment of cells containing EGFR epitopes or EGFRt.

[0306] In another aspect, the present invention relates to a method for tracking transduced cells, (a) A step of transfecting a population of cells with the polynucleotide or viral vector of the present invention, (b) A step of contacting a transduced cell population with an EGFRt binder functionally linked to a detectable label, and (c) Steps to detect cells bound to the EGFRt binder. This provides a method that includes this.

[0307] Preferably, the EGFRt conjugate binds substantially specifically to EGFRt. In some embodiments, the EGFRt conjugate is an antibody. Drugs and antibodies that bind to EGFRt are known in the art, including cetuximab. In some embodiments, the EGFRt conjugate is cetuximab.

[0308] Cell populations can be selectively purified from cells exhibiting a specific phenotype or characteristic, and from other cells that do not exhibit that phenotype or characteristic, or exhibit it to a lesser degree. For example, a population of cells expressing a specific marker (e.g., the EGFR epitope or EGFRt of the present invention) can be purified from a starting cell population.

[0309] It should be understood that "enriching" a cell population of a certain type increases the concentration of that cell type within the population. The concentrations of other cell types may simultaneously decrease.

[0310] Purification or concentration can result in a substantially pure cell population of cells from other species.

[0311] Purifying or concentrating a population of cells expressing a specific marker (e.g., the EGFR epitope or EGFRt of the present invention) can be achieved by using a drug that binds to the marker, preferably substantially specifically to the marker. The drug that binds to the cell marker may be an antibody, for example, an antibody that binds to the EGFR epitope or EGFRt of the present invention.

[0312] The term "antibody" refers to a complete antibody or antibody fragment capable of binding to a selected target, and includes Fv, ScFv, F(ab') and F(ab')2, monoclonal and polyclonal antibodies, engineered antibodies (including chimeric, CDR graft and humanized antibodies), and artificially selected antibodies produced using phage display or alternative technologies.

[0313] Furthermore, alternatives to classical antibodies, such as "avibodies," "avimers," "anticalins," "nanobodies," and "DARPin," may also be used in this invention.

[0314] Drugs that bind to specific markers may be labeled in such a way that they can be identified using any of the many techniques known in the art. Drugs may be labeled intrinsically or modified by conjugation of a label. “Conjugation” should be understood as the drug and label being functionally linked. This means that the drug and label are linked together so that they can perform their functions (e.g., binding to a marker, enabling fluorescent identification, or enabling separation when placed in a magnetic field) without substantially interfering with each other. Appropriate methods of conjugation are well known in the art and will be readily identifiable to those skilled in the art.

[0315] Labeling can, for example, enable the detection, or both, of a labeled drug and any cells to which it is bound, after purification from their environment (e.g., the drug may be labeled with magnetic beads or affinity tags such as avidin). Suitable detectable markers for use as labels include fluorophores (e.g., green, cherry, cyan, and orange fluorescent proteins) and peptide tags (e.g., His tags, Myc tags, FLAG tags, and HA tags).

[0316] Numerous techniques for isolating populations of cells expressing specific markers are known in the art. These include magnetic bead-based separation techniques (e.g., closed-circuit magnetic bead-based separation), flow cytometry, fluorescence-activated cell sorting (FACS), affinity tag purification (e.g., using affinity columns or beads, such as biotin columns for separating avidin-labeled agents), and microscopy-based techniques.

[0317] Furthermore, separation may also be performed using a combination of different techniques, for example, a separation step based on magnetic beads, followed by sorting of the resulting cell population for one or more additional (positive or negative) markers by flow cytometry.

[0318] For example, clinical-grade separation may be performed using the CliniMACS® system (Miltenyi). This is an example of separation technology based on closed-circuit magnetic beads.

[0319] Many techniques for detecting (and sometimes quantifying) populations of cells expressing specific markers are known in the art. These include flow cytometry, fluorescence-activated cell sorting (FACS), and microscopy-based techniques.

[0320] In another aspect, the present invention relates to a method for depleting transduced cells, (a) A step of transfecting a population of cells with the polynucleotide or viral vector of the present invention, and (b) The step of bringing the transduced cell population into contact with the EGFRt binder. This provides a method that includes this.

[0321] In some embodiments, cells to which the EGFRt conjugate binds are killed by antibody-dependent cell-mediated cytotoxicity (ADCC), for example, mediated by macrophages.

[0322] In some embodiments, the EGFRt binder is functionally linked to a depleting agent. In some embodiments, the cell population of step (b) is brought into contact with a depleting agent linked to the EGFRt binder. For example, the EGFRt binder may be functionally linked to biotin, and the depleting agent may include streptavidin, and vice versa.

[0323] The depletion agent can kill, preferably selectively, the cells to which the EGFRt binding agent is bound. In some embodiments, the depletion agent comprises a toxin. In some embodiments, the depletion agent comprises a saporin.

[0324] In some embodiments, the method is either in vitro or ex vivo.

[0325] Treatment method In another aspect, the present invention provides polynucleotides, viral vectors, or cells for therapeutic use.

[0326] In another aspect, the present invention provides a treatment method (therapy method) that includes a method of selection, depletion, or tracking of the present invention.

[0327] All references to treatment (therapy) in this specification include curative, palliative, and preventive treatments. Treatments of mammals, particularly humans, are preferred. Both human and veterinary treatments are within the scope of this invention.

[0328] Pharmaceutical compositions and injectable solutions The agents for use in this invention can be administered alone, but they are generally administered in mixtures with pharmaceutical carriers, excipients, or diluents, particularly for human treatment.

[0329] The pharmaceuticals of the present invention, such as vector particles, may be formulated into pharmaceutical compositions. These compositions may contain, in addition to the pharmaceuticals, pharmaceutically acceptable carriers, diluents, excipients, buffers, stabilizers, or other substances well known in the art. Such substances should be non-toxic and should not interfere with the effects of the active ingredient. The exact properties of the carrier or other substances can be determined by those skilled in the art depending on the route of administration, for example, intravenous or intra-arterial.

[0330] Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions usually contain a liquid carrier, such as water, petroleum, animal or vegetable oil, mineral oil, or synthetic oil. They may also contain saline solution, magnesium chloride, dextrose or other sugar solutions, or glycols, such as ethylene glycol, propylene glycol, or polyethylene glycol. In some cases, a surfactant, such as 0.001% pluric acid (PF68), may be used. In some cases, serum albumin may be used in the composition.

[0331] For injection, the active ingredient may be in the form of an aqueous solution that does not contain pyrogens and has appropriate pH, isotonicity, and stability. Those skilled in the art can successfully prepare a suitable solution using an isotonic vehicle such as sodium chloride injection, Ringer's injection, or lactated Ringer's injection. Preservatives, stabilizers, buffers, antioxidants, and / or other additives may be included as needed.

[0332] In the case of delayed release, the pharmaceutical may be included in a pharmaceutical composition formulated for sustained release, such as a microcapsule formed from a biocompatible polymer or a liposome carrier system by a method known in the art.

[0333] The handling of cell therapy products should preferably be carried out in accordance with the FACT-JACIE International Standards for cell therapy.

[0334] Administration In some embodiments, polynucleotides, vectors, or cells are administered systemically to the subject.

[0335] In some embodiments, polynucleotides, vectors, or cells are administered topically to the subject.

[0336] As used herein, the terms “systemic delivery” or “systemic administration” mean that the agent of the present invention is administered into the circulatory system, for example, to achieve broad distribution of the agent. In contrast, topical or local administration limits the delivery of the agent to a local area.

[0337] In some embodiments, polynucleotides, vectors, or cells are administered intravascularly, intravenously, or intraarterially.

[0338] Dosage Those skilled in the art can easily determine the appropriate dosage of the drug of the present invention for administration to a subject. Typically, a physician determines the most appropriate actual dosage for an individual patient, which depends on various factors including the activity of the particular compound used, its metabolic stability and duration of action, age, weight, overall health, sex, diet, mode and timing of administration, excretion rate, drug combination, severity of the particular symptoms, and the individual being treated. Of course, there may be individual cases where a higher or lower dose range is beneficial, and such cases fall within the scope of the present invention.

[0339] subject As used herein, the term “subject” refers to either a human or a non-human animal.

[0340] Examples of non-human animals include vertebrates, such as mammals, such as non-human primates (especially higher primates), dogs, rodents (e.g., mice, rats, or guinea pigs), pigs, and cats. Non-human animals may also be companion animals (pet animals).

[0341] Preferably, the subject is a human.

[0342] Mutants, derivatives, analogs, homologs, and fragments In addition to the specific proteins and nucleotides described herein, the present invention also encompasses their variants, derivatives, analogues, homologues, and fragments.

[0343] In relation to the present invention, a “variant” of any given sequence is a sequence in which a residue (amino acid residue or nucleic acid residue) of that particular sequence is modified such that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. Variant sequences can be obtained by the addition, deletion, substitution, modification, replacement, and / or mutation of at least one residue present in a naturally occurring polypeptide or polynucleotide.

[0344] As used herein, the term “derivative” includes, with respect to the proteins or polypeptides of the present invention, any substitution, mutation, modification, exchange, deletion and / or addition of one (or more) amino acid residues to or from the sequence thereof, provided that the resulting protein or polypeptide possesses at least one of its endogenous functions.

[0345] As used herein, the term “analog” includes, with respect to polypeptides or polynucleotides, any mimic, i.e., a chemical compound possessing at least one of the endogenous functions of the polypeptide or polynucleotide being mimicked.

[0346] Typically, amino acid substitutions may consist of, for example, one, two, three to ten, or twenty substitutions, provided that the modified sequence substantially retains the required activity or capacity. Amino acid substitutions may include the use of analogues that do not exist in nature.

[0347] The proteins used in this invention may similarly have deletions, insertions, or substitutions of amino acid residues that undergo silent changes to produce functionally equivalent proteins. Planned amino acid substitutions can be carried out based on similarities in terms of residue polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity, as long as their endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged head groups that have similar hydrophilic values ​​include asparagine, glutamine, serine, threonine, and tyrosine.

[0348] Conservative substitutions can be carried out, for example, according to the table below. Amino acids within the same block in the second column, and preferably within the same row in the third column, can be substituted for each other: [Table 3]

[0349] As used herein, the term "homolog" refers to a substance that has a certain degree of homology to a wild-type amino acid sequence or wild-type nucleotide sequence. The term "homology" can be considered equivalent to "identity."

[0350] In relation to the present invention, homologous sequences are considered to include amino acid sequences that may have at least 50%, 55%, 65%, 75%, 85%, or 90% identity with the target sequence, preferably at least 95%, 96%, 97%, 98%, or 99% identity. Typically, homologous sequences include the same active sites as the target amino acid sequence. While homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in relation to the present invention, homology is preferably expressed in terms of sequence identity.

[0351] In relation to the present invention, homologous sequences are considered to include nucleotide sequences that have at least 50%, 55%, 65%, 75%, 85%, or 90% identity with the target sequence, preferably at least 95%, 96%, 97%, 98%, or 99% identity. While homology can also be considered in terms of similarity, in relation to the present invention, homology is preferably expressed in terms of sequence identity.

[0352] Preferably, when referring to a sequence having percent identity with any one of the sequence numbers detailed herein, it refers to a sequence having the described percent identity over the entire length of the sequence number mentioned.

[0353] Homology comparisons can be performed visually or, more generally, using readily available sequence comparison programs. These publicly available computer programs can calculate the percentage homology or percentage identity between two or more sequences.

[0354] Percentage homology may be calculated for consecutive sequences; that is, one sequence is aligned with another, and each amino acid or nucleotide in one sequence is directly compared one residue at a time with its corresponding amino acid or nucleotide in the other sequence. This is called "gapless" alignment. Typically, such gapless alignment is performed for only a relatively small number of residues.

[0355] While this is a very simple and consistent method, it does not take into account that, for example, in a sequence pair that is otherwise identical, an insertion or deletion in an amino acid or nucleotide sequence may exclude the following residue or codon from the alignment, and therefore performing a global alignment may result in a significant decrease in percentage homology. As a result, most sequence comparison methods are designed to produce an optimal alignment that takes into account all possible insertions and deletions without excessively penalizing the overall homology score. This is achieved by attempting to maximize local homology by inserting "gaps" into the sequence alignment.

[0356] However, these more complex methods assign a "gap penalty" to each gap in an alignment so that, for the same number of identical amino acids or nucleotides, a sequence alignment with as few gaps as possible (reflecting a higher relevance between the two comparison sequences) achieves a higher score than a sequence alignment with many gaps. Typically, an "affine gap cost" is used, which imposes a relatively high cost for the presence of gaps and a smaller penalty for each subsequent residue within the gap. This is the most commonly used gap scoring system. A high gap penalty naturally produces an optimized alignment with fewer gaps. Most alignment programs allow you to modify the gap penalty. However, when using such software for sequence comparison, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for gaps and -4 for each extension.

[0357] Calculating maximum percentage homology therefore requires, firstly, the generation of an optimal alignment that takes gap penalties into account. A suitable computer program for performing such alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Develeux et al. (1984) Nucleic Acids Research 12:387). Examples of other software capable of performing sequence comparison include, but are not limited to, the BLAST package (see Ausubel et al. (1999) op. cit. - Ch. 18), FASTA (See Atschul et al. (1990) J. Mol. Biol. 403-410), and the GENEWORKS comparison toolset. Both BLAST and FASTA are available for offline and online searches (see Ausubel et al. (1999) op. cit., pages 7-58~7-60). However, for some applications, it is preferable to use the GCG Bestfit program. Another tool, BLAST 2 Sequences, can also be used for comparing protein and nucleotide sequences (FEMS Microbiol. Lett. (1999) 174(2):247-50; FEMS Microbiol. Lett. (1999) 177(1):187-8).

[0358] While the final percentage homology can be measured in terms of identity, the alignment process itself is not typically based on all-or-nothing pairwise comparisons. Instead, a scaled similarity score matrix is ​​usually used, which assigns a score to each pairwise comparison based on chemical similarity or evolutionary distance. A commonly used example of such a matrix is ​​the BLOSUM62 matrix (the default matrix for programs in the BLAST program suite). GCG Wisconsin programs typically use the public default value, or a custom symbol comparison table if one is provided (see the user manual for further details). For some applications, it is preferable to use the public default value for GCG packages or a default matrix such as BLOSUM62 for other software.

[0359] Once the software generates the optimal alignment, it is possible to calculate percentage homology, preferably percentage sequence identity. The software typically performs this as part of a sequence comparison, yielding a numerical result.

[0360] A "fragment" is also a variant, and this term typically refers to a selected region of a polypeptide or polynucleotide that is functionally or, for example, important in an assay. Therefore, a "fragment" refers to an amino acid sequence or nucleic acid sequence that is part of a full-length polypeptide or full-length polynucleotide.

[0361] Such mutants may be prepared using standard recombinant DNA techniques, such as site-directed mutagenesis. When insertions are performed, synthetic DNA encoding the insertion may be prepared along with 5' and 3' flanking regions corresponding to naturally occurring sequences on either side of the insertion site. These flanking regions contain convenient restriction sites corresponding to locations in the naturally occurring sequence, allowing the sequence to be cleaved with a suitable enzyme(s) and the synthetic DNA to be ligated to the cleavage site. The encoded protein is then produced by expressing the DNA according to the present invention. These methods are merely examples of many standard techniques known in the art for manipulating DNA sequences, and other known techniques are equally available.

[0362] Codon optimization The polynucleotides used in the present invention can be codon-optimized. Codon optimization has been previously described in WO 1999 / 41397 and WO 2001 / 79518. Different cells use certain codons differently. This codon bias corresponds to the bias in the relative abundance of certain tRNAs in a given cell type. It is possible to increase expression by modifying the codons in the sequence to match the relative abundance of the corresponding tRNA. Similarly, it is possible to decrease expression by deliberately selecting codons for which the corresponding tRNA is known to be rare in a given cell type. Thus, further degrees of translational control are available. Codon usage tables are known in the art for mammalian cells, as well as for various other organisms.

[0363] Those skilled in the art will understand that all features of the invention disclosed herein can be combined without departing from the scope of the disclosed invention.

[0364] Preferred features and embodiments of the present invention are described herein as non-limiting examples.

[0365] Unless otherwise specified, the implementation of this invention will utilize the prior arts of chemistry, biochemistry, molecular biology, microbiology, and immunology, which are within the scope of the skills of those skilled in the art. Such arts are described in the literature. For example, Sambrook, J., Fritsch, EF and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and supplementary issues) Current Protocols in Molecular Biology, Ch. 9, 13 and 16, John Wiley and Sons; Roe, B., Crabtree, J. and Kahn, A. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley and Sons; Polak, JM and McGee, J.O'D (1990) In Situ Hybridization: Principles and Practice, Oxford University Press; Gait, MJ (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and Lilley, DM and Dahlberg, JE (1992) Methods in Enzymology: DNA Structures Part See A:Synthesis and Physical Analysis of DNA, Academic Press. These general texts are incorporated herein by reference.

[0366] [Examples] [Example 1] result To evaluate the improvement of EGFRt protein surface expression, we used the advantages of gene editing techniques to correct the CD40LG gene, a mutation that causes X-linked immunodeficiency with hyperimmunoglobulin M (HIGM1). A corrective construct containing a codon-optimized version of CD40LG cDNA (exons 2 through 5) linked to an IRES sequence, an EGFRt (Figure 1Ai) or modified EGFRt (Figure 1Aii / iii) sequence, and subsequently the CD40LG endogenous 3'UTR and polyA was incorporated into the first intron of the CD40LG gene. In this strategy, the CD40LG promoter controls the expression of both the CD40LG gene and the EGFRt or modified EGFRt gene. Normally, CD40LG is expressed on the surface of CD4+ T cells only after lymphocyte activation, while this protein is undetectable at the basal level for two reasons: its protein translocation is strictly controlled, and, most importantly, the CD40LG promoter activation state is weak. Therefore, we investigated the enhancement of EGFRt stability and surface expression using inactivated CD4+ T cells edited with various corrective constructs containing EGFRt or modified EGFRt genes.

[0367] Modified EGFRt sequences were prepared by i) codon optimization of the open reading frame sequence to promote protein translation using a higher frequency codon usage, ii) introduction of a novel signal peptide, and iii) introduction of a novel 8-amino acid cytoplasmic tail obtained from either the dNGFR gene (Figure 1Aii) or the endogenous EGFR gene (Figure 1Aiii) to immobilize and stabilize the protein in the membrane.

[0368] The nucleotide sequence of the experimental construct includes the following: Unmodified EGFRt [ka]

[0369] Main components: SA.CD40LG IRES EGFRt with the original signal peptide (bold) CD40LG 3'UTR and PolyA

[0370] Modified EGFRt containing NGFR signaling peptide and NGFR cytoplasmic domain [ka]

[0371] Main components: SA.CD40LG IRES dNGFR signal peptide EGFRt (bold) dNGFR cytoplasmic domain (shaded) CD40LG 3'UTR and PolyA

[0372] Modified EGFRt containing NGFR signaling peptide and EGFR cytoplasmic domain [ka]

[0373] Main components: SA.CD40LG IRES dNGFR signal peptide EGFRt (bold) EGFR cytoplasmic domain (shaded) CD40LG 3'UTR and PolyA

[0374] When expressed using the CD40LG endogenous promoter, only the modified EGFRt (eEGFRt) protein was found to be measurable on the surface of edited, inactivated CD4+ T cells (Figure 1B), and surface protein expression was increased fivefold. Furthermore, since the eEGFRt protein was clearly detectable on the surface of CD4+ T cells, target cells could be enriched in vitro using immunomagnetic purification with biotinylated cetuximab (Figure 1C).

[0375] Further modified EGFRt sequences were prepared by incorporating both the transmembrane and cytoplasmic domains of dNGFR via a linker into the extracellular domain of EGFRt. To evaluate increased protein recycling on the cell surface, all constructs were tested with or without recycling signals (Figure 4). Briefly, it was found that the presence of a recycling signal in modified EGFRt did not improve EGFRt expression compared to codon-optimized sequences, either at the basal level or after T cell activation (Figure 3). However, in the complete absence of a recycling signal, all modified EGFRt genes showed stable, higher expression (measured as MFI) compared to the codon-optimized gene (1) at the basal level, improving EGFRt surface expression (Figure 4).

[0376] Next, we evaluated the depletion of eEGFRt+ edited cells in vitro by treating them with a specific immunotoxin consisting of a streptavidin-saporin (toxin) combined with biotinylated cetuximab (antibody). Using this method, we observed that the reduction rate of eEGFRt+ cells was 1.8 times higher when cultured in the presence of the combined immunotoxin compared to lymphocytes treated with the toxin alone or the antibody alone (Figure 1D). Finally, we evaluated the depletion of eEGFRt+ cells in vivo by xenotransplanting a large number of human edited T cells into Nod-Scid-gamma (NSG) mice. These mice possess limited macrophage functionality despite lacking T, B, and NK cells. Therefore, we hypothesized that treating the mice with cetuximab, which utilizes macrophage-mediated antibody-dependent cell-mediated cytotoxicity (ADCC), should deplete (at least partially) eEGFRt+ T cells. Accordingly, it was found that eEGFRt-expressing cells were removed from NSG mice after cetuximab treatment (Figure 1E).

[0377] Thus, by editing cells using a modified donor template, the EGFRt protein was expressed on the surface of edited T cells even without stimulation (Figure 5A). More importantly, similar gene editing efficiency (Figure 5B), culture composition (Figure 5C), regulation of CD40L expression (Figure 5D), and functionality (Figures 5E, F) were observed compared to the previous template. To assess whether edited cells could be depleted, strategies for selectively removing EGFRt-possessing cells using immunotoxins were explored in vitro. By culturing edited T cells in the presence of cetuximab conjugated with a toxin saporin, a protein synthesis inhibitor (cetuximab-SAP), or in the presence of antibodies and toxins alone as controls, substantial depletion of EGFRt-expressing lymphocytes (approximately 50%) was observed at both test doses (Figures 5G, H), confirming that EGFRt is suitable for the selection and depletion of edited cells.

[0378] To confirm the improvements obtainable in a different gene therapy environment, we utilized the advantages of lentiviral vectors. Two bidirectional lentiviral vectors were cloned, expressing either tEGFR (Figure 2Ai) or our modified version (eEGFRt 1, Figure 2Aii) driven by a minimal CMV promoter in the sense and antisense respectively. To mimic the situation of CAR-T cell therapy, these vectors were transduced into T cells and EGFRt expression was measured. eEGFRt protein surface expression increased up to 39-fold.

[0379] In conclusion, the modifications described can improve the use of the EGFRt selector gene even in low-expression cells, enabling in vitro recovery of modified cells and in vivo depletion of them, thereby enhancing the safety profile of the manipulated cells.

[0380] Materials and methods primary cells Peripheral blood mononuclear cells (PBMCs) were freshly purified from Buffy Coat by serial centrifugation using Ficoll. Buffy Coat was obtained as anonymous donation residue, used in accordance with the Declaration of Helsinki, under the signed in-house informed consent for blood product donation by healthy donors. CD4 T cells were isolated by immunomagnetic separation using a CD4 T cell isolation kit (Miltenyi Biotech) according to the manufacturer's instructions for use and stimulated with magnetic beads conjugated with anti-CD3 / anti-CD28 antibodies (Dynabeads human T-activator CD3 / CD28, Thermo Fisher) (cell:bead ratio, 1:3). Cells were maintained in Iskoff-modified Dulbecco's medium (IMDM; Corning) supplemented with 10% FBS (Euroclone), penicillin (100 IU / ml), streptomycin (100 μg / ml), 2% glutamine, and IL-7 (5 ng / ml; Preprotech) and IL-15 (5 ng / ml; Preprotech). After 6 days of culture, Dynabeads were removed. In all experiments, T cells were obtained from healthy male donors.

[0381] T cells were grown for 21 days for flow cytometry, functional analysis, and PMA / ionomycin stimulation. At the time indicated, EGFRt+ edited cells were enriched using biotinylated cetuximab antibody (clone number HU1, R&D System) with anti-biotin microbeads (Miltenyi Biotech) according to the manufacturer's instructions for use. Magnetic separation was performed using an LS column.

[0382] All cells were cultured at 37°C in a 5% CO2 humidified atmosphere.

[0383] Donor templates and nucleases The AAV6 donor template for HDR was generated from a construct containing an AAV2 terminal inversion sequence, prepared by TIGEM Vector Core using triple transfection, and purified by ultracentrifugation under a cesium chloride gradient. The lentivirus (LV) donor template for transduction was prepared using a third-generation self-inactivated transfer construct derived from HIV. The LV stock solution was prepared, and its titer was measured as previously described (Lombardo, A. et al. (2007) Nat Biotechnol 25:1298-306).

[0384] Ribonucleoproteins (RNPs) were constructed by incubating SpCas9 protein (Aldevron) and synthetic cr:tracrRNA (Integrated DNA Technologies) in a 1:2 molar ratio at 25°C for 10 minutes.

[0385] Genetic manipulation of primary cells After three days of stimulation, gene editing was performed on the primary cells. 10 6 Each primary T cell was washed with PBS and electroporated with 1.25 μM ribonucleoprotein (RNP-P3 Primary Cell 4D-Nucleofector X Kit, program DS-130; Lonza). 15 minutes after electroporation, 5 × 10⁶ cells were extracted. 4 AAV6 was transduced at a dose of vg / cell.

[0386] After two days of stimulation, LV transduction was performed. 10 6 Individual primary T cells were infected with IDLV at an MOI of 100.

[0387] Flow cytometry analysis Cell fluorescence analysis was performed using FACS Canto II (BD Pharmingen) with DIVA software, or FSC express software (v.6, De Novo Software). Dead cells were excluded from the analysis by including 7-aminoactinomycin (Sigma Aldrich) in the sample preparation for flow cytometry, as per the manufacturer's instructions.

[0388] Pma / ionomycin treatment Six to twelve days after electroporation, T cells were stimulated for 5 hours with phorbol-12-myristate-13-acetate (PMA, 10 ng / ml; Calbiomech) and ionomycin (500 ng / ml, Sigma-Aldrich) in cytokine-free medium, then washed and cultured in complete medium. Continuous flow cytometry analysis was performed to track CD40L surface expression on T cells for 24 / 48 hours or longer (0, 3, 6, 8, 24, and 48 hours after activation).

[0389] Ex vivo functional studies of edited T cells Naive B cells were isolated from peripheral blood mononuclear cells by immunomagnetic negative selection using the Human Naive B Cell Isolation Kit II (Miltenyi Biotec) according to the manufacturer's instructions for use. All cells were cultured in RPMI 1640 (CORNING) containing 1% penicillin / streptomycin (P / S) (Thermo Fisher Scientific), 20% FBS, 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) (all from Sigma-Aldrich), 1% L-glutamine (Life Technologies), and 55 µM 2-mercaptoethanol (Gibco-Life Technologies).

[0390] Prior to co-culturing, CD4 T cells were washed and rested overnight in a cytokine-free culture medium. Then, the T cells were activated over 5 hours using two different stimuli. 1. CD3 / CD28 Dynabeads (Gibco-Life Technologies) with a bead-to-cell ratio of 1:1 2. Phorbol myristate acetate (PMA 1 ng / mL, Sigma Aldrich) and ionomycin (500 ng / mL, Sigma Aldrich)

[0391] After removing Dynabeads and PMA / ionomycin and washing the cells with complete medium, B cells and T cells were co-cultured in 200 μL of previously described medium in a 96-well flat-bottom plate (CORNING) at a B cell:T cell ratio of 1:3.

[0392] T cells and B cells were maintained in culture medium for 5 days in the presence of IL-2 (50 ng / mL), IL-7 (5 ng / mL), and IL-15 (5 ng / mL) (all obtained from PeproTech). B cells were stimulated using various combinations of the following cytokines: IL-21 (100 ng / mL) (PeproTech), human Toll-like receptor 9 (TLR9) agonist CpG oligodeoxynucleotide (ODN) 1826 (2.5 ug / mL) (InvivoGen), anti-IgA+IgG+IgM (15 ug / mL, goat anti-human IgA+IgG+IgM) (Jackson ImmunoResearch), and soluble CD40L (3 ug / mL) (ENZO Life Sciences).

[0393] To evaluate B cell proliferation, naive B cells were labeled with CellTrace® Violet Cell Proliferation Kit (ThermoFisher Scientific) according to the manufacturer's instructions for use, and then co-cultured with T cells according to the previously described procedure. After 5 days of T / B co-culture, proliferation was analyzed by FACS.

[0394] Five days after co-culture, immunoglobulin-secreting cells were analyzed by the ELISPOT assay performed in plates containing nitrocellulose membranes (Merk Millipore) coated with anti-IgG or anti-IgM (both obtained from Southern Biotech). After blocking with PBS (CORNING) and 1% BSA (Sigma-Aldrich), serial dilutions of the total number of cells (0.5 × 10⁶) were analyzed. 4 from 0.25 × 10 4 The plates were then incubated overnight at 37°C with isotype-specific secondary antibodies (both obtained from Southern Biotech), followed by incubation with streptavidin-HRP (ThermoFisher), and finally, development using 3-amino-9-ethylcarbazole (Sigma Aldrich) as the chromogenic substrate. The plates were scanned and counted using an Automated ELISA-Spot Assay Video Analysis System (AELVIS) to determine the number of spots per well.

[0395] molecular analysis For digital droplet PCR (ddPCR) analysis, 5–50 ng of genomic DNA was analyzed using the QX200 Droplet Digital PCR System (Biorad) according to the manufacturer's instructions. HDR ddPCR primers and probes were designed for the junction between the donor sequence and the target locus, and for the control sequence used for normalization (human TTC5 gene, PrimePCR ddPCR Copy Number Assay, Biorad). The thermal conditions for annealing and extension were adjusted as follows: 55°C for 1 minute, 72°C for 2 minutes.

[0396] In vitro depletion In vitro depletion involved seeding 5,000 T cells / well in complete medium of 96-well round-bottom plates. αEGFR-SAP immunotoxin was prepared by combining biotinylated cetuximab antibody (clone number Hu1, R&D Systems) with streptavidin-SAP conjugate (2.3 saporin molecules per streptavidin, Advanced Targeting Systems) in a 1:1 molar ratio, and diluted to two doses (5 nM, 1 nM) in PBS immediately before use. Cells were added with either the immunotoxin or an equal amount of antibody alone or toxin alone for 3 days, after which lymphocytes were collected for flow cytometry analysis.

[0397] In vivo depletion On day 20 of culture, 10 x 10 6 Individual bulk edited CD4 T cells were intravenously injected into 7-10 week old male NSG mice. Sample size was determined by the total number of available edited cells. Two weeks after transplantation, half of the experimental mice were treated with 1 mg / mouse cetuximab (Erbitux; Merck, 5 mg / ml) by intraperitoneal injection for 4 days. Assignment to each experimental group of mice was random. The presence of gene-edited cells (by FACS and ddPCR) was monitored by continuous blood sampling from the mouse eyes. Mice were monitored and weighed weekly to finally observe the appearance of signs of graft-versus-host disease.

[0398] All publications referenced in the above specification are incorporated herein by reference. Various modifications and variations of the disclosed polynucleotides, proteins, vectors, cells, uses, and methods of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention is disclosed in relation to specific preferred embodiments, it should be understood that the invention described in the claims should not be unduly limited to such specific embodiments. In practice, various modifications of the disclosed embodiments for carrying out the present invention, which will be apparent to those skilled in the art, are included in the following claims. The present invention includes, for example, the following embodiments: [Embodiment 1] hereafter: (a) NGFR or GMS SFR alpha signal peptide, (b) EGFR or NGFR transmembrane domains, and / or (c) NGFR or EGFR cytoplasmic tails, which may include (i) KRWNRGIL (SEQ ID NO: 39); or (ii) RRRHIVRK (SEQ ID NO: 40); or cytoplasmic tails containing the amino acid sequences of mutants of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions. In addition, a recycling signal may be used depending on the circumstances. A polynucleotide comprising a nucleotide sequence functionally linked to an extracellular epidermal growth factor receptor (EGFR) epitope, wherein the EGFR extracellular epitope is optionally a truncated epidermal growth factor receptor (EGFRt). [Embodiment 2] A polynucleotide comprising a nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), (a) a nucleotide sequence encoding an NGFR signal peptide, and / or (b) A nucleotide sequence encoding a polypeptide containing the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39); or (ii) RRRHIVRK (SEQ ID NO: 40); or a variant of (i) or (ii) having three or fewer amino acid substitutions, additions, or deletions. Polynucleotides further containing these. [Embodiment 3] (a) The NGFR signal peptide comprises an amino acid sequence having at least 70% identity with SEQ ID NO: 4 or a fragment thereof, and / or (b) The nucleotide sequence encoding the NGFR signal peptide has at least 70% identity with SEQ ID NO: 5 or a fragment thereof. The polynucleotide according to Embodiment 1 or 2. [Embodiment 4] The polynucleotide according to any one of Embodiments 1 to 3, wherein EGFRt comprises EGFR domain III, EGFR domain IV, and EGFR transmembrane domain. [Embodiment 5] A polynucleotide according to any one of Embodiments 1 to 4, wherein EGFRt does not contain EGFR domain I, EGFR domain II, EGFR membrane-bound domain, or EGFR tyrosine kinase domain. [Embodiment 6] The polynucleotide according to any one of Embodiments 1 to 5, wherein EGFRt comprises an amino acid sequence having at least 70% identity with SEQ ID NO: 2 or a fragment thereof. [Embodiment 7] The polynucleotide according to any one of Embodiments 1 to 6, wherein the nucleotide sequence encoding EGFRt has at least 70% identity with SEQ ID NO: 3 or a fragment thereof. [Embodiment 8] (a) Encoding an amino acid sequence having at least 70% identity with SEQ ID NO: 17 or a fragment thereof, and / or (b) A nucleotide sequence having at least 70% identity with SEQ ID NO: 16 or a fragment thereof, A polynucleotide according to any one of Embodiments 1 to 7. [Embodiment 9] (a) Encoding an amino acid sequence having at least 70% identity with SEQ ID NO: 19 or 21 or a fragment thereof, and / or (b) A nucleotide sequence having at least 70% identity with SEQ ID NO: 18 or 20 or a fragment thereof, A polynucleotide according to any one of Embodiments 1 to 8. [Embodiment 10] (a) Encoding an amino acid sequence having at least 70% identity with SEQ ID NOs. 23 or 25 or fragments thereof, and / or (b) A nucleotide sequence having at least 70% identity with SEQ ID NOs. 22 or 24 or a fragment thereof, A polynucleotide according to any one of Embodiments 1 to 9. [Embodiment 11] A polynucleotide according to any one of Embodiments 1 to 10, wherein the nucleotide sequence encoding EGFRt is functionally linked to a weak promoter. [Embodiment 12] The polynucleotide according to any one of Embodiments 1 to 11, further comprising a transgene, and optionally having an IRES element between the transgene and the nucleotide sequence encoding EGFRt. [Embodiment 13] A polynucleotide according to any one of Embodiments 1 to 12, for example, comprising a transgene and / or an EGFRt coding sequence, which is for insertion by gene editing. [Embodiment 14] The polynucleotide according to Embodiment 12, wherein the introduced gene encodes a chimeric antigen receptor. [Embodiment 15] An EGFRt protein encoded by a polynucleotide as described in any one of Embodiments 1 to 14. [Embodiment 16] A viral vector comprising a polynucleotide as described in any one of Embodiments 1 to 14. [Embodiment 17] The viral vector according to Embodiment 16, which is a lentiviral vector, an adeno-associated virus (AAV) vector, or an adenovirus vector. [Embodiment 18] A cell comprising a polynucleotide according to any one of Embodiments 1 to 14 or a viral vector according to Embodiment 16 or 17. [Embodiment 19] A polynucleotide, viral vector, or cell according to any one of Embodiments 1 to 14 or 16 to 18 for therapeutic use. [Embodiment 20] A method for selecting transduced cells, (a) Transduction of a population of cells with a polynucleotide or viral vector according to any one of Embodiments 1 to 14, 16, or 17; (b) A step of bringing the transduced cell population into contact with an EGFRt binder, and (c) Steps to select cells bound to the EGFRt binder. A method that includes this. [Embodiment 21] A method for depleting transduced cells, (a) Transduction of a population of cells with a polynucleotide or viral vector according to any one of Embodiments 1 to 14, 16, or 17, and (b) The step of bringing the transduced cell population into contact with the EGFRt binder. A method comprising, optionally, (i) an EGFRt binder being functionally linked to a depleting agent, or (ii) bringing the cell population of step (b) into contact with a depleting agent that binds to the EGFRt binder, wherein the depleting agent kills the cells to which the EGFRt binder is bound. [Embodiment 22] A method for tracking transduced cells, (a) Transduction of a population of cells with a polynucleotide or viral vector according to any one of Embodiments 1 to 14, 16, or 17; (b) A step of contacting a transduced cell population with an EGFRt binder functionally linked to a detectable label, and (c) Steps to detect cells bound to the EGFRt binder. A method that includes this. [Embodiment 23] The method according to any one of Embodiments 20 to 22, which is an in vitro or ex vivo method. [Embodiment 24] The method according to any one of Embodiments 20 to 23, wherein the EGFRt conjugate is an antibody, and optionally the EGFRt conjugate is cetuximab. [Embodiment 25] The method according to any one of Embodiments 21, 23, or 24, wherein the depletion agent contains a toxin and optionally contains a saporin. [Embodiment 26] A treatment method comprising the method described in any one of Embodiments 21 to 25.

Claims

1. below: (a) A nucleotide sequence encoding an NGFR signal peptide or a nucleotide sequence encoding a GMCSFR alpha signal peptide, and (b) Nucleotide sequences encoding NGFR cytoplasmic tails or nucleotide sequences encoding EGFR cytoplasmic tails A polynucleotide containing a nucleotide sequence that is functionally linked to an extracellular epidermal growth factor receptor (EGFR) epitope.

2. The polynucleotide according to claim 1, wherein the cytoplasmic tail comprises the amino acid sequence of (i) KRWNRGIL (SEQ ID NO: 39) or (ii) RRRHIVRK (SEQ ID NO: 40).

3. The polynucleotide according to claim 1 or 2, further comprising a nucleotide sequence encoding a recycling signal having at least 90% identity with SEQ ID NO:

14.

4. The polynucleotide according to any one of claims 1 to 3, wherein the EGFR extracellular epitope is a truncated epidermal growth factor receptor (EGFRt).

5. The polynucleotide according to any one of claims 1 to 4, wherein an EGFR extracellular epitope is functionally linked to the EGFR transmembrane domain or the NGFR transmembrane domain.

6. A polynucleotide comprising a nucleotide sequence encoding truncated epidermal growth factor receptor (EGFRt), (a) Nucleotide sequence encoding NGFR signal peptide, and (b) (i) KRWNRGIL (SEQ ID NO: 39); or (ii) a nucleotide sequence encoding a polypeptide containing the amino acid sequence of RRRHIVRK (SEQ ID NO: 40) Polynucleotides further containing these.

7. (a) The NGFR signal peptide contains an amino acid sequence that is at least 90% identical to SEQ ID NO: 4, and / or (b) The nucleotide sequence encoding the NGFR signal peptide has at least 90% identity with SEQ ID NO: 5 The polynucleotide according to any one of claims 1 to 6.

8. The polynucleotide according to any one of claims 4 to 7, wherein EGFRt comprises EGFR domain III, EGFR domain IV, and EGFR transmembrane domain.

9. The polynucleotide according to any one of claims 4 to 8, wherein EGFRt does not contain EGFR domain I, EGFR domain II, EGFR membrane-bound domain, or EGFR tyrosine kinase domain.

10. The polynucleotide according to any one of claims 4 to 9, wherein EGFRt comprises an amino acid sequence having at least 90% identity with SEQ ID NO:

2.

11. The polynucleotide according to any one of claims 4 to 10, wherein the nucleotide sequence encoding EGFRt has at least 90% identity with SEQ ID NO:

3.

12. (a) Encoding an amino acid sequence that has at least 90% identity with SEQ ID NO: 17, and / or (b) A nucleotide sequence having at least 90% identity with SEQ ID NO: 16 The polynucleotide according to any one of claims 1 to 11.

13. (a) Encoding an amino acid sequence that has at least 90% identity with SEQ ID NO: 19 or 21, and / or (b) A nucleotide sequence having at least 90% identity with SEQ ID NO: 18 or 20, The polynucleotide according to any one of claims 1 to 12.

14. (a) Encoding an amino acid sequence that has at least 90% identity with SEQ ID NO: 23 or 25, and / or (b) A nucleotide sequence having at least 90% identity with SEQ ID NO: 22 or 24, The polynucleotide according to any one of claims 1 to 13.

15. The polynucleotide according to any one of claims 1 to 14, further comprising a transgene.

16. The polynucleotide according to claim 15, wherein the extracellular epitope of EGFR is a truncated epidermal growth factor receptor (EGFRt), and there is an IRES element between the transgene and the nucleotide sequence encoding EGFRt.

17. A polynucleotide according to any one of claims 1 to 16, for insertion by gene editing.

18. The polynucleotide according to claim 15 or 16, wherein the introduced gene encodes a chimeric antigen receptor.

19. An EGFRt protein encoded by a polynucleotide according to any one of claims 1 to 18.

20. A viral vector comprising a polynucleotide according to any one of claims 1 to 18.

21. The viral vector according to claim 20, which is a lentiviral vector, an adeno-associated virus (AAV) vector, or an adenovirus vector.

22. A cell comprising a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21.

23. A composition for therapeutic use comprising a polynucleotide according to any one of claims 1 to 18, a viral vector according to claim 20 or 21, or a cell according to claim 22.

24. A method for selecting transduced cells in vitro or ex vivo, (a) Transduction of a population of cells in vitro or ex vivo with a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21. (b) A step of bringing a transduced cell population into contact with an EGFRt binder in vitro or ex vivo, and (c) A step of selecting cells bound to an EGFRt binder in vitro or ex vivo. A method that includes this.

25. A composition for use in a method for depleting transduced cells, comprising a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21, wherein the method is (a) A step of transducing the polynucleotide or viral vector into a population of cells, and (b) The step of bringing the transduced cell population into contact with the EGFRt binder. A composition containing the following:

26. A composition for use in a method for tracking transduced cells, comprising a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21, wherein the method is (a) Transduction of the polynucleotide or viral vector into a population of cells, (b) A step of contacting a transduced cell population with an EGFRt binder functionally linked to a detectable label, and (c) Steps to detect cells bound to the EGFRt binder. A composition containing the following:

27. ​​A method for depleting transduced cells in vitro or ex vivo, (a) Transduction of a population of cells in vitro or ex vivo with a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21, and (b) The process of bringing the transduced cell population into contact with an EGFRt binder in vitro or ex vivo. A method including, (i) The EGFRt binder is functionally linked to a depleting agent, and the depleting agent kills the cells to which the EGFRt binder is bound, or (ii) The method further comprises bringing the cell population obtained in step (b) into contact in vitro or ex vivo with a depleting agent bound to the EGFRt conjugate, wherein the depleting agent kills the cells to which the EGFRt conjugate is bound.

28. A method for tracking transduced cells in vitro or ex vivo, (a) Transduction of a population of cells in vitro or ex vivo with a polynucleotide according to any one of claims 1 to 18 or a viral vector according to claim 20 or 21. (b) A step of contacting a transduced cell population with an EGFRt binder functionally linked to a detectable label in vitro or ex vivo, and (c) A step of detecting cells bound to the EGFRt binder in vitro or ex vivo. Methods that include...

29. The method according to any one of claims 24 and 27 to 28, wherein the EGFRt conjugate is an antibody.

30. The method according to claim 29, wherein the EGFRt binder is cetuximab.

31. The method according to claim 27, wherein the depletion agent contains a toxin.

32. The method according to claim 31, wherein the depletion agent comprises a saporin.

Citation Information

Patent Citations

  • Gene Tags of Introduced Genes and Methods of Using the Same

    JP2017518037A

  • Expression of novel cell tags

    WO2018226897A1

  • Modified epidermal growth factor receptor peptides for use in genetically-modified cells

    WO2019070856A1