Application of compounds or traditional Chinese medicine extracts in the preparation of nucleic acid delivery reagents and related products

Lipid components from traditional Chinese medicines enhance nucleic acid delivery to target cells, addressing the degradation and stability issues of small RNAs, enabling effective therapeutic applications.

JP7874575B2Active Publication Date: 2026-06-16ベイジン バイシーフーカン ファーマシューティカル テクノロジー(ビーエスジェイファーマ)カンパニーリミテッド
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2023046711
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-03-29
Filing Date
2023-03-23
Publication Date
2026-06-16
Estimated Expiration
2038-03-29

Smart Images

  • Figure 0007874575000037
    Figure 0007874575000037
  • Figure 0007874575000038
    Figure 0007874575000038
  • Figure 0007874575000039
    Figure 0007874575000039
Patent Text Reader

Abstract

To provide the use of a compound for manufacturing a reagent for efficient in vivo delivery of nucleic acid molecules, including small RNA, to a target organ and a target cell.SOLUTION: The invention provides the use of a compound derived naturally (including a traditional Chinese medicine extract) or synthetically for the manufacture of a nucleic acid delivery reagent, where the compound is represented, e.g., by the formula in the figure.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to various compounds that can be extracted from or synthesized from traditional Chinese medicines and that can promote nucleic acid delivery. It also relates to the use of the extracted compounds or various compounds thereof to promote the absorption and entry of nucleic acids, such as sRNA, into target cells, and to promote in vivo entry into target sites of a subject that requires it. In recent decades, the concept of using nucleic acid molecules, including RNA molecules, as therapeutic agents has become a clinically realistic concept. In fact, nucleic acid molecules have a number of properties suitable for therapeutic agents. Nucleic acid molecules can fold into complex three-dimensional structures that allow binding to proteins, small molecules, or other nucleic acids, and some can even form catalytic centers. Small interfering RNA (siRNA) as an effector molecule of RNAi has shown increasing promise as a therapeutic agent. Currently, various siRNA drugs have entered clinical trials and show good development promise. Generally, siRNA, miRNA, and other non-coding small RNAs are synonymously called small nucleic acids or small RNAs (sRNAs). However, nucleic acid molecules are easily degraded and have a relatively short half-life in vivo, so they are generally considered poor choices as therapeutic agents. Therefore, a method for efficiently delivering nucleic acid molecules, including small RNAs, in vivo to target organs and target cells to achieve their biological activities and therapeutic or preventive effects is an issue to be considered by those skilled in the art.

Background Art

Background Art

[0002] In recent decades, the concept of using nucleic acid molecules, including RNA molecules, as therapeutic agents has become a clinically realistic concept. In fact, nucleic acid molecules have a number of properties suitable for therapeutic agents. Nucleic acid molecules can fold into complex three-dimensional structures that allow binding to proteins, small molecules, or other nucleic acids, and some can even form catalytic centers. Small interfering RNA (siRNA) as an effector molecule of RNAi has shown increasing promise as a therapeutic agent. Currently, various siRNA drugs have entered clinical trials and show good development promise. Generally, siRNA, miRNA, and other non-coding small RNAs are synonymously called small nucleic acids or small RNAs (sRNAs). However, nucleic acid molecules are easily degraded and have a relatively short half-life in vivo, so they are generally considered poor choices as therapeutic agents. Therefore, a method for efficiently delivering nucleic acid molecules, including small RNAs, in vivo to target organs and target cells to achieve their biological activities and therapeutic or preventive effects is an issue to be considered by those skilled in the art.

[0003] Therefore, a method for efficiently delivering nucleic acid molecules, including small RNAs, in vivo to target organs and target cells to achieve their biological activities and therapeutic or preventive effects is an issue to be considered by those skilled in the art. To achieve their biological activities and therapeutic or preventive effects, a method for efficiently delivering nucleic acid molecules, including small RNAs, in vivo to target organs and target cells is an issue to be considered by those skilled in the art. [Overview of the project]

[0004] The inventors, after conducting extensive tests, unexpectedly found that some traditional Chinese medicines (Rhodiola) • Rhodiola crenulata, Taraxacum mongolicum, A Andrographis paniculata, and honeysuckle [Lon Some lipid components (including icera japonica) and lipids derived from traditional Chinese medicines are divided into smaller parts. Absorption of nucleic acids, such as child RNA, into target cells and / or target regions that require them. We discovered that it can promote entry. In this invention, the lipid component is synthetic.

[0005] Specifically, in one embodiment, the present application has the following structure extracted from traditional Chinese medicine This relates to compounds for producing nucleic acid delivery reagents, and to the use of such compounds.

[0006] [ka] In the formula, L1, L2, or L3 does not exist, or L1, L2, and L3 are: Each is independent of the others: -C(O)O-CH2-, -CH(OH)-, -C(O)-NH-CH2 -, -CH2-OC(O)-, -CH2-NH-C(O)-, -C(O)O-, -C( O)NH-, -OC(O)-, -NH-C(O)-, -CH2-,

[0007] [ka] Selected from the group consisting of, However, there can be no more than two L1, L2, and L3. Regarding the divalent groups L1 and L2, the dash "-" on the left is connected to groups A and B respectively, and the dash "-" on the right is connected to the central carbon atom. Regarding the divalent group L3, the dash "-" on the left is connected to the central carbon atom, and the dash "-" on the right is connected to group Q. Regarding the divalent group L3, the dash "-" on the left is connected to the central carbon atom, and the dash "-" on the right is connected to group Q. A, B, and Q are each independently selected from the group consisting of H, -OH, C alkyl, C 1~20 alkenyl, C 1~20 alk enyl, C 1~20 heteroalkyl, C 1~20 heteroalkenyl, -NH2, and -NR3 + where R is H or C 1~6 alkyl, and n is an integer 0, 1, 2, 3, or 4.

[0008] In one embodiment of the use, in the structure of the compound, L1 is absent or L1 is selected from -C(O)O-CH2- and -CH(OH )-. L2 is absent or L2 is selected from -C(O)O- and -C(O)NH-. L3 is absent or L3 is selected from -C(O)O-, -CH2-OC(O)-, - CH2-, and

[0009]

Chemical formula

[0010] In one embodiment, the compound has the following formula.

[0011] [ka]

[0012] In one embodiment, in the structure of the compound, A is H, C 10~20 Alkyl and C 10~20 Selected from a group consisting of alkenyls Re, B is H, -NH2, C 10~20 Alkyl, and C 10~20 Composed of alkenils Selected from the group, Q is H, -OH, C 10~20 Alkyl, and C 10~20 Alkenil, and -NR3 + A selection is made from the group consisting of H or C. 1~4 It is alkyl.

[0013] In one embodiment, in the structure of the compound, A is H, linear C 15~18 Alkyl groups, and linear C 15~18 From the alkenyl group Selected from the group, B is H, -NH2, linear C 15~18 Alkyl groups, and linear C 15~18 Alkeni Selected from the group consisting of lu groups, Q is H, -OH, straight chain C 15~18 Alkyl groups, and linear C 15~18 Alkenil Base, and -NR3 + A selection is made from the group consisting of H or C. 1~4Alkyl the law of nature, The alkenyl groups of A, B, and Q have 1 to 5 double bonds.

[0014] In one embodiment, in structures A, B, and Q, the alkenyl group has 1 to 3 double bonds It exists and is in a Z configuration.

[0015] In one embodiment, the compound is given by the following formula:

[0016] [ka] Selected from, During the ceremony, A is a linear C 15~18 Alkyl and linear C chains 15~18 Selected from alkenyl groups , B is a linear C 15~18 Alkyl and linear C chains 15~18 Selected from alkenyl groups , Q is H, -OH, straight chain C 15~18 Alkyl groups, and linear C 15~18 Alkenil Base, and -NR3 + Selected from the group consisting of, where R is H or methyl, L3 is -C(O)O-.

[0017] In one embodiment, the compound is lysolecithin, ceramide, diglyceride, phosphatidyl Ethanolamine, phosphatidylcholine, triglycerides, monogalactosyl diglycerides Lido, sphingosine, phosphatidylethanol, monoacylglycerol, fatty acids, It is platelet-activating factor, or dimethylphosphatidylethanolamine.

[0018] In one embodiment, the compound is a lipid shown in Table 1.

[0019] In one embodiment, the compounds are numbered 11, 12, 41, 71, 38, and As shown in Table 1 as No. 64, No. 40, No. 37, No. 39, No. 60, or No. 62 It is a lipid.

[0020] In a second aspect, the present application relates to the use of combinations comprising any one or more of the above compounds. Regarding the production of nucleic acid delivery reagents. Preferably, one or more lipids are used to produce nucleic acid delivery reagents. Select from Table 1. Preferably, the combination is number 11, number 12, number 41, number 71, number 38, number 64, number 40, number 37, number 39, number 60, or number 6 2. Any one of the lipids listed in Table 1, or any other lipid in Table 1. Or, including combinations thereof with multiple other elements.

[0021] In a third aspect, the present application relates to the use of traditional Chinese medicine for manufacturing nucleic acid delivery reagents. do.

[0022] In one embodiment, the traditional Chinese medicine is Rhodiola crenulata, Dandelion mongolica, and Apricot. Selected from Drographis paniculata and honeysuckle herbal medicine decoction pieces.

[0023] In one embodiment, the reagent contains a compound extracted from a traditional Chinese medicine. Preferably, The drug is one or more of the above compounds, preferably any one selected from Table 1. It contains one or more lipids. Preferably, the reagents are number 11, number 12, number 41, number 41. Number 71, Number 38, Number 64, Number 40, Number 37, Number 39, Number 60, or Number One of the lipids listed as 62 in Table 1, or any other lipid listed in Table 1. This includes any one or more of the above in combination.

[0024] In one embodiment, the compound is extracted by decoction of traditional Chinese medicine. Another embodiment In terms of form, the compound is made by soaking traditional Chinese medicine pieces in water, followed by intense heating and slow fermentation. The herbal medicine is extracted by sequentially carrying out the following heating processes, and then the heated herbal soup is concentrated. Then, chloroform-methanol, chloroform, and water are added in order and stirred, and chloroform Obtain the Loform layer.

[0025] In one embodiment, the compound has the structure shown in any one of the embodiments described above. ru.

[0026] In one embodiment, the compound is lysolecithin, ceramide, diglyceride, phosphatidyl Ethanolamine, phosphatidylcholine, triglycerides, monogalactosyl diglycerides Lido, (neurogenic) sphingosine, phosphatidylethanol, monoacylglycerol These are fatty acids, platelet-activating factors, or dimethylphosphatidylethanolamine.

[0027] In one embodiment, the compound is selected from Table 1.

[0028] In one embodiment, the compounds are numbered 11, 12, 41, 71, 38, and As shown in Table 1 as No. 64, No. 40, No. 37, No. 39, No. 60, or No. 62 It is a lipid.

[0029] In one embodiment, delivery is either in vitro cell delivery or in vivo gastrointestinal delivery. Includes.

[0030] In one embodiment, use involves the preparation of a lipid nucleic acid mixture.

[0031] In one embodiment, the lipid nucleic acid mixture is prepared by boiling, or by reverse-phase evaporation, or It is manufactured by direct mixing.

[0032] In one embodiment, the temperature in the boiling method is preferably from about 25°C to about 100°C. The temperature range is from 80°C to approximately 100°C, while the temperature range for reverse-phase evaporation is from approximately 25°C to approximately 70°C. Preferably, the temperature is about 55°C.

[0033] In a fourth aspect, the present application relates to compounds and nucleic acids of any one of the structures of the embodiments described above. The present invention relates to a pharmaceutical composition containing the above compounds. Preferably, the pharmaceutical composition contains any one of the above compounds. Alternatively, it may contain one or more lipids, preferably selected from Table 1. The pharmaceutical compositions are number 11, number 12, number 41, number 71, number 38, number 64, number Lipids shown in Table 1 as 40, number 37, number 39, number 60, or number 62. Any one of the above, or any one or more of the other lipids shown in Table 1 and This includes combinations with other related chemical substances.

[0034] In one embodiment, the pharmaceutical composition contains lipids and nucleic acids, at least partially also It exists as a mixture of lipids and nucleic acids.

[0035] In one embodiment, the lipid nucleic acid mixture in the pharmaceutical composition is prepared by boiling or reverse phase It is produced by evaporation or by direct mixing.

[0036] In one embodiment, the temperature of the pharmaceutical composition in the boiling method is from 25°C to about 100°C. Preferably, the temperature is between approximately 80°C and 100°C. The temperature in reverse-phase evaporation is between approximately 25°C and approximately Up to 70°C, preferably about 55°C.

[0037] In a fifth aspect, the present application relates to a kit comprising the lipids and nucleic acids of the above-described embodiments, Lipids and nucleic acids are provided separately in the first and second containers, respectively. The first and second containers may be the same or different in the kit. Regarding the above, preferably the kit contains one or more of the above compounds, preferably, It contains one or more lipids selected from 1. Preferably, the kit contains number 11, number 11, number 11, 12, number 41, number 71, number 38, number 64, number 40, number 37, number 39, number Any one of the lipids shown in Table 1 as number 60 or 62, or shown in Table 1 Any combination of one or more other lipids, or any one of them This includes combinations thereof with multiple lipids and other related chemicals.

[0038] In one embodiment, the pharmaceutical composition contains lipids and nucleic acids, at least partially or The entire mixture is manufactured into a lipid nucleic acid mixture immediately before use.

[0039] In one embodiment, the lipid nucleic acid mixture in the pharmaceutical composition is prepared by boiling or reverse phase It is produced by evaporation or by direct mixing.

[0040] In one embodiment, the temperature of the pharmaceutical composition in the boiling method is from 25°C to about 100°C. Preferably, the temperature is about 100°C, and the temperature in reverse-phase evaporation is preferably from about 25°C to about 70°C. The temperature is approximately 55°C.

[0041] In a sixth aspect, the present application relates to a method for delivering nucleic acids into target cells, and the implementation described above A method comprising providing nucleic acids in the form of a pharmaceutical composition or kit of any one of the following forms. To relate to.

[0042] In the seventh aspect, the present application provides for delivering nucleic acids in vivo to targets that require them. A method for providing nucleic acids in the form of any one of the above-described pharmaceutical compositions or kits. Regarding methods that include this.

[0043] In one embodiment, the subject of the above method is a human or an animal such as a mammal.

[0044] In one embodiment, the above method involves introducing nucleic acids into the target blood circulation or target tissue / cells. It is delivered in vivo.

[0045] In one embodiment, the above method involves any one of the above embodiments of a pharmaceutical composition or kit This includes delivering the substance directly to the target that requires it via the digestive tract.

[0046] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Nucleic acids and lipids are manufactured for topical administration and / or injection.

[0047] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Nucleic acids and lipids are manufactured for digestive, respiratory, and / or injectable administration.

[0048] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Nucleic acids and lipids are manufactured for oral administration, inhalation administration, and / or injection.

[0049] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Nucleic acids are small RNA molecules.

[0050] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Nucleic acids have a stem-loop structure.

[0051] In any one of the above-described aspects or embodiments, for example, in a pharmaceutical composition or kit Small RNA molecules are 14-32 bp or 18-24 bp long, for example, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2 They have lengths of 9, 30, 31, and 32 bp.

[0052] In any one of the above-described aspects or embodiments, the pharmaceutical composition, kit, or compound It can be administered orally.

[0053] In any one of the above-described aspects or embodiments, nucleic acids are used to treat cancer, such as stomach cancer or lung cancer. It can be used to treat diseases such as cancer.

[0054] In any one of the above-described aspects or embodiments, a lipid combination may be used, The lipid combination is one of the following: Lipid combination number 8:number 41 = 6:1; number 38: Number 41 = 6:1 lipid combination; Number 39: Number 41 = 6:1 lipid combination; Number 40: Number 41 = 6:1 lipid combination; Number 38: Number 12: Number 41: Number 29 = 1: Lipid combination of 1:2:1; number 40: number 12: number 41 = 2:4:3 lipid combination; number Lipid combination of No. 12: No. 41 = 1:6; Lipid combination of No. 12: No. 41 = 1:1; No. Lipid combination of No. 12: No. 41 = 6:1; No. 40: No. 12: No. 41 = 2:2:2 Lipid combination; Number 4: Number 12: Number 41 = 1:1:1 lipid combination; Number 1: Number 2: Number 3: Number 19: Number 35 = 1:1:1:1:1 DG combination; Number 6: Number 9: Number 10: Number 13: Number 15: Number 16: Number 18: Number 20: Number 21: Number 22: Number 23: Number 24: Number 25: Number 26: Number 27: Number 28: Number 32: Number 33 = 1: 1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1:1 TG combination; Number 36: Number 37 = 1:1 LPC combination; Number 11: Number 12 = 1:1 PC combination ;Number 8:Number 38 = 1:1 PE combination;Number 4:Number 14 = 1:1 Cer combination; Number 17: Number 30: Number 31 = 1:1:1 So combination; does not include numbers 5 and 7. Equal volume combinations of numbers 1-36; equal volume combinations of numbers 1-36 excluding numbers 5, 7, and 34. Combinations; numbers that do not include numbers 5, 7, 1, 2, 3, 19, or 35. 1-36 equal volume combinations; numbers 5, 7, 6, 9, 10, 13, 15, number 16, number 18, number 20, number 21, number 22, number 23, number 24, number Numbers 1-36, excluding 25, 26, 27, 28, 32, and 33, etc. Volume combinations; equal volume combinations of numbers 1-36, excluding numbers 5, 7, 36, and 37. Equal volume combinations of numbers 1-36, excluding numbers 5, 7, 11, and 12; number 5. Equal volume combinations of numbers 1-36, excluding numbers 7 and 8; numbers 5, 7 and 4, Equal volume combinations of numbers 1-36, excluding number 14; excluding numbers 5, 7, and 29. Equivolute combinations of numbers 1 to 36; lipid combinations of number 1:number 34 = 2:1; number 1:the aforementioned D Lipid combination with G = 2:1; Number 1: Lipid combination with the aforementioned TG combination = 2:1; Number 1 : The aforementioned LPC combination = 2:1 lipid combination; number 1: number 8 = 2:1 lipid combination; number 1: Number 12 = Lipid combination of 2:1; Number 1: The aforementioned Cer combination = Lipid combination of 2:1; Number 1: The aforementioned So combination = 2:1 lipid combination; Number 1: Number 29 = 2:1 lipid combination ; Number 1: Number 8: Number 12 = 1:1:1 lipid combination; Number 8: Number 34 = 2:1 lipid combination Lipid combination; No. 8: The aforementioned DG combination = 2:1 Lipid combination; No. 8: The aforementioned TG combination = 2 :1 lipid combination; No. 8: The aforementioned LPC combination = 2:1 lipid combination; No. 8: No. 37 =4:1 lipid combination; No. 8: No. 12 = 2:1 lipid combination; No. 8: The aforementioned Cer combination Combination = 2:1 lipid combination; No. 8: The aforementioned So combination = 2:1 lipid combination; No. 8: No. Lipid combination of No. 31 = 6:1; No. 8: No. 29 = 2:1 lipid combination; No. 12: No. 34 = 2:1 lipid combination; No. 12: The aforementioned DG combination = 2:1 lipid combination; No. 12 : The aforementioned TG combination = 2:1 lipid combination; No. 12: The aforementioned LPC combination = 2:1 lipid combination Combination; Number 12: Number 8 = 2:1 lipid combination; Number 12: The aforementioned Cer combination = 2:1 Lipid combination; No. 12: The aforementioned So combination = 2:1 Lipid combination; No. 12: No. 29 = 2 Lipid combination of 1; number 12: number 8: number 1&2=2:1:1 Lipid combination; number 12 Lipid combination of number 8:number 15=2:1:1;number 12:number 8:number 36&37=2 :1 lipid combination; number 12: number 8: number 11 = 2:1:1 lipid combination; number 1 2: Number 8: Number 12 = 2:1:1 lipid combination; Number 12: Number 8: Number 4 = 2:1: Lipid combination 1; number 12: number 8: number 31 = 2:1:1 Lipid combination; number 12: number Number 8: Number 29 = 2:1:1 lipid combination; Number 12: Number 8: Number 34 = 3:2:1 Lipid combination; number 12: number 8: number 34 = 4:2:3 lipid combination; number 12: number 8 Lipid combinations: Number 2 = 4:2:3; Number 12: Number 8: Number 2 = 16:8:3 Combination; Number 12: Number 8: Number 32 = 4:2:3 lipid combination; Number 12: Number 8: Number 37 = 4:2:3 lipid combination; Number 12: Number 8: Number 11 = 4:2:3 lipid combination ; Number 12: Number 8: Number 38 = Lipid combination of 4:2:3; Number 12: Number 8: Number 4 = Lipid combination of 4:2:3; number 12: number 8: number 31 = Lipid combination of 4:2:3; number 12: Number 8: Number 29 = Lipid combination of 4:2:3; Number 12: Number 8: Number 29: Number 31 = 2:1:1:1 lipid combination; number 12: number 8: number 29: number 31: number 34 =4:2:2:2:5 lipid combination; number 12: number 8: number 29: number 31: number 2= Lipid combination of 4:2:2:2:5; number 12: number 8: number 29: number 31: number 32 = Lipid combination of 4:2:2:2:5; number 12: number 8: number 29: number 31: number 11 = Lipid combination of 4:2:2:2:5; Number 12: Number 8: Number 29: Number 31: Number 37 = Lipid combination of 4:2:2:2:5; number 12: number 8: number 29: number 31: number 38 = Lipid combination 4:2:2:2:5; number 12: number 8: number 29: number 31: number 4 = 4 Lipid combination of :2:2:2:5; Number 12: Number 8: Number 29: Number 31: Number 4: Number 1: Number 16 = Lipid combination of 2:1:1:3:2:2:3; Number 1: Number 8: Number 12: Lipid combinations of numbers 1 & 2 = 2:2:2:3; Number 1: Number 8: Number 12: Number 15 = 2: Lipid combination of 2:2:3; Number 1: Number 8: Number 12: Number 36 & 37 = 2:2:2:3 Lipid combinations; number 1: number 8: number 12: number 12 = 2:2:2:3 lipid combinations; number Lipid combination of No. 1: No. 8: No. 12: No. 4 = 2:2:2:3; No. 1: No. 8: No. 12: Number 31 = Lipid combination of 2:2:2:3; Number 1: Number 8: Number 12: Number 29 = Lipid combination 2:2:2:3; Lipid combination #8:#34:#1&2=2:1:1 ; Lipid combination of number 8: number 34: number 15 = 2:1:1; number 8: number 34: number 36 &37=2:1:1 lipid combination; Number 8: Number 34: Number 12=2:1:1 lipid combination Se; Number 8: Number 34: Number 4 = 2:1:1 lipid combination; Number 8: Number 34: Number 31 =2:1:1 lipid combination; number 8: number 34: number 29=2:1:1 lipid combination; number Lipid combination of No. 8: No. 31: No. 34 = 12:3:5; No. 8: No. 31: No. 2 = 1 Lipid combination of 2:3:5; number 8: number 31: number 37 = 12:3:5 lipid combination; number Lipid combination of No. 8: No. 31: No. 11 = 12:3:5; No. 8: No. 31: No. 12 = Lipid combination of 12:3:5; number 8: number 31: number 4 = Lipid combination of 12:3:5; number Lipid combination of No. 8: No. 31: No. 29 = 12:3:5; No. 8: No. 31: No. 32 = Lipid combination of 12:3:5; number 8: number 4: number 34 = Lipid combination of 12:3:5; number Lipid combination of No. 8: No. 4: No. 2 = 12:3:5; No. 8: No. 4: No. 37 = 12: Lipid combination of 3:5; number 8: number 4: number 12 = 12: 3:5 lipid combination; number 8: Lipid combination of number 4:number 31=12:3:5; number 8:number 4:number 29=12:3: 5 lipid combinations; number 8: number 4: number 32 = 12:3: 5 lipid combinations; number 38: number No. 34 = 2:1 lipid combination; No. 38: No. 1 = 2:1 lipid combination; No. 38: No. Lipid combination of 2=2:1; number 38: number 1&2=2:1 lipid combination; number 38: number 15 = 2:1 lipid combination; number 38: number 32 = 2:1 lipid combination; number 38: number 37 = 2:1 lipid combination; number 38: number 37 = 4:1 lipid combination; number 38: number 11=2:1 lipid combination; number 38: number 12=2:1 lipid combination; number 38: number Lipid combination 11&12=2:1; number 38: Lipid combination 12=4:1; number 38 : Number 8 = 2:1 lipid combination; Number 38: Number 4 = 2:1 lipid combination; Number 38: S o(30) = 2:1 lipid combination; number 38: number 31 = 2:1 lipid combination; number 38 : Number 29 = 2:1 lipid combination; Number 1: Number 38: Number 12: Number 34 = 2:2:2 Lipid combination of 3; Number 1: Number 38: Number 12: Number 15 = Lipid combination of 2:2:2:3 Se; Number 1: Number 38: Number 12: Number 37 = 2:2:2:3 lipid combination; Number 1: Number Lipid combination of No. 38: No. 12: No. 8 = 2:2:2:3; No. 1: No. 38: No. 12 : Number 4 = 2:2:2:3 lipid combination; Number 1: Number 38: Number 12: Number 31 = 2: Lipid combination of 2:2:3; Number 1: Number 38: Number 12: Number 29 = 2:2:2:3 fat Lipid combination; number 38: number 34: number 1 = 2:1:3 Lipid combination; number 38: number 34 : Number 15 = Lipid combination of 2:1:3; Number 38: Number 34: Number 37 = Lipid combination of 2:1:3 Lipid combination; number 38: number 34: number 12 = 2:1:3 Lipid combination; number 38: number 3 4: Number 8 = Lipid combination of 2:1:3; Number 38: Number 34: Number 4 = Lipid combination of 2:1:3 Lipid combination; number 38: number 34: number 31 = 2:1:3; number 38: number 34 : Number 29 = Lipid combination of 2:1:3; Number 38: Number 12: Number 1 = Lipid combination of 2:1:3 Combination; Number 38: Number 12: Number 2 = 4:1:3 lipid combination; Number 38: Number 12: Lipid combination #15 = 2:1:3; Lipid combination #38: #12: #37 = 2:1:3 Combination; Number 38: Number 12: Number 8 = 2:1:3 lipid combination; Number 38: Number 12: Lipid combination #4 = 2:1:3; Lipid combination #38: #12: #31 = 2:1:3 Combination; Number 38: Number 12: Number 29 = Lipid combination of 2:1:3; Number 38: Number 12: Lipid combinations of number 1: number 15: number 34 = 22:22:22:33:36; number 38: Lipid combinations of number 12:number 1:number 15:number 37 = 22:22:22:33:36; Lipid ratio 38:12:1:15:4 = 22:22:22:33:36 Combinations; Number 38: Number 12: Number 1: Number 15: Number 31 = 22:22:22:33: 36 lipid combinations; number 38: number 12: number 1: number 15: number 29 = 22:22:2 Lipid combination 2:33:36; number 38: number 34: number 37: number 1 = 44:22:3 Lipid combination 3:36; Number 38: Number 34: Number 37: Number 15 = 44:22:33: 36 lipid combinations; number 38: number 34: number 37: number 12 = 44:22:33:36 Lipid combinations; number 38: number 34: number 37: number 4 = 44:22:33:36 lipids Combination; Lipid combination number 38:number 34:number 37:number 31 = 44:22:33:36 Se; Lipid combination of number 38: number 12: number 4: number 34 = 44:22:33:36; number Lipid combination of No. 38: No. 12: No. 4: No. 1 = 44:22:33:36; No. 38: Lipid combinations number 12: number 4: number 15 = 44:22:33:36; number 38: number 1 2: Number 4: Number 37 = 44:22:33:36 lipid combination; Number 38: Number 12: Number Number 4: Number 37 = Lipid combination of 8:2:5:3; Number 38: Number 12: Number 4: Number 31 =44:22:33:36 lipid combination; number 38:number 12:number 4:number 29=44 Lipid combinations of :22:33:36; number 38: number 12: number 4: number 29: number 34 = Lipid combination 88:44:66:72:135; number 38: number 12: number 4: number 29 : Number 1 = Lipid combination of 88:44:66:72:135; Number 38: Number 12: Number 4 : Number 29: Number 15 = Lipid combination of 88:44:66:72:135; Number 38: Number 12: Number 4: Number 29: Number 37 = 88:44:66:72:135 lipid combinations; number Number 38: Number 12: Number 4: Number 29: Number 31 = 88:44:66:72:135 fat quality Combination; Number 38: Number 12: Number 4: Number 2 = 20:10:15:9 lipid combination; number Number 38: Number 12: Number 4: Number 6 = Lipid combination of 20:10:15:9; Number 38: Number Lipid combination of No. 12: No. 4: No. 17 = 20:10:15:9; No. 38: No. 12: Lipid combination of number 4: number 29 = 20:10:15:9; number 38: number 12: number 4: Lipid combination number 34 = 20:10:15:9; Number 38: Number 12: Number 4: Number 37 =20:10:15:9 lipid combination; number 38: number 12: number 31: number 34=2: A 1:3:3 lipid combination; number 38: number 12: number 31: number 1 = 2:1:3:3 lipids Lipid combination; number 38: number 12: number 31: number 15 = 2:1:3:3 lipid combination; number Number 38: Number 12: Number 31: Number 37 = Lipid combination of 2:1:3:3; Number 38: Number 12: Number 31: Number 4 = Lipid combination of 2:1:3:3; Number 38: Number 12: Number 31 : Number 29 = Lipid combination of 2:1:3:3; Number 38: Number 34: Number 37: Number 31: Lipid combination number 1 = 88:44:66:72:135; number 38: number 34: number 37 : Number 31: Number 15 = Lipid combination of 88:44:66:72:135; Number 38: Number Lipid combinations of 34:number 37:number 31:number 12 = 88:44:66:72:135; Number 38: Number 34: Number 37: Number 31: Number 4 = 88:44:66:72:135 Lipid combination; Number 38: Number 34: Number 37: Number 31: Number 29 = 88:44:66: Lipid combination 72:135; Number 38: Number 37: Number 34 = Lipid combination 4:2:3; Lipid combination of number 38: number 37: number 1 = 4:2:3; number 38: number 37: number 2 = Lipid combination of 4:2:3; Number 38: Number 37: Number 1&2 = Lipid combination of 4:2:3; Lipid combinations of numbers 38:37:2 = 32:8:5; numbers 38:37:3 Lipid combination 2 = 32:8:5; Lipid combination 38:37:15 = 4:2:3 Se; Number 38: Number 37: Number 32 = Lipid combination of 4:2:3; Number 38: Number 37: Number Lipid combination #8 = 4:2:3; Lipid combination #38:#37:#11 = 4:2:3 Se; Number 38: Number 37: Number 12 = Lipid combination of 4:2:3; Number 38: Number 37: Number Lipid combination of numbers 11 & 12 = 4:2:3; numbers 38:37:12 = 4:1:1 Lipid combination; number 38: number 37: number 4 = 4:2:3 lipid combination; number 38: number 3 7: Number 30 = Lipid combination of 4:2:3; Number 38: Number 37: Number 31 = 4:2:3 Lipid combination; number 38: number 37: number 29 = 4:2:3 lipid combination; number 8: number 3 7: Number 32 = Lipid combination of 4:1:2; Number 8: Number 37: Number 2 = Lipid combination of 4:1:2 Combination; Lipid combination number 38:number 37:number 15:number 34 = 64:16:10:45 Se; Lipid combination of number 38: number 37: number 15: number 1 = 64:16:10:45; number Lipid combination of No. 38: No. 37: No. 15: No. 12 = 64:16:10:45; No. 3 8: Number 37: Number 15: Number 4 = Lipid combination of 64:16:10:45; Number 38: Number Lipid combination of No. 37: No. 15: No. 31 = 64:16:10:45; No. 38: No. 3 7: Number 15: Number 29 = Lipid combination of 64:16:10:45; Number 38: Number 2: Number Lipid combination #37 = 4:2:3; Lipid combination #38:#2:#31 = 4:2:3 Se; Number 38: Number 2: Number 29 = Lipid combination of 4:2:3; Number 38: Number 2: Number 3 Lipid combination 4 = 4:2:3; Number 38: Number 2: Number 32 = 4:2:3 lipid combination; Lipid combination of number 38:number 2:number 12=4:2:3;number 38:number 2:number 12= Lipid combination 4:5:1; Number 38: Number 2: Number 4 = Lipid combination 4:2:3. One implementation. In terms of morphology, lipid numbers 1&2, 11&12, or 36&37 are all arbitrary. Lipid numbers 1 and 2 in any ratio, lipid numbers 11 and 12 in any ratio This can represent lipid numbers 36 and 37 in terms of their percentages.

[0055] Furthermore, this application relates to a compound having the structure of the following formula, a combination of the compound or a composition, Methods for using compounds, combinations, or compositions for nucleic acid delivery, and nucleic acid delivery The present invention provides the use of compounds, combinations, or compositions for the manufacture of reagents.

[0056] [ka] During the ceremony, L1, L2, or L3 does not exist, or L1, L2, and L3 are each Independently, -C(O)O-CH2-, -CH(OH)-, -CH2-OC(O), -C( Selected from the group consisting of O)O- and -C(O)NH-, However, there can be no more than two L1, L2, and L3. Regarding the divalent groups L1 and L2, the dash "-" on the left indicates that they are linked to groups A and B, respectively. The dash "-" on the right is linked to the central carbon atom. Regarding the divalent group L3, the dash on the left "-" is attached to the central carbon atom, and the dash on the right The dash "-" is connected to the base Q, A, B, and Q are H, -OH, C 10~20 Alkyl, C 10~20 Alkenil, -NH2 and -NR3 + Selected from the group consisting of H or C 1~6 Alkyl That is the case.

[0057] In one embodiment, the compound may have the following structure:

[0058] [ka] During the ceremony, A is a linear C 10~20 Alkyl and linear C chains 10~20 A group consisting of alkenyl groups They were selected, B is a linear C 10~20 Alkyl and linear C chains 10~20 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 15~20 Alkyl and linear C chains15~20 A group consisting of alkenyl groups They were selected, B is a linear C 15~20 Alkyl and linear C chains 15~20 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 15~18 Alkyl and linear C chains 15~18 A group consisting of alkenyl groups They were selected, B is a linear C 15~18 Alkyl and linear C chains 15~18 A group consisting of alkenyl groups They were selected, Q is -OH

[0059] In another embodiment, the compound may have the following structure:

[0060] [ka] During the ceremony, A is a linear C 10~20 Alkyl and linear C chains 10~22 A group consisting of alkenyl groups They were selected, B is a linear C 10~20 Alkyl and linear C chains 10~22 A group consisting of alkenyl groups They were selected, Q is a linear C 10~20 Alkyl and linear C chains 10~22 A group consisting of alkenyl groups They were selected, Preferably, A is a linear C 15~18 Alkyl and linear C chains 15~22 A group consisting of alkenyl groups They were selected, B is a linear C 15~18 Alkyl and linear C chains 15~22 A group consisting of alkenyl groups They were selected, Q is a linear C 15~18 Alkyl and linear C chains 15~22 A group consisting of alkenyl groups They were selected, Preferably, A is a linear C 15~18 Alkyl and linear C chains 15~20 A group consisting of alkenyl groups They were selected, B is a linear C 15~18 Alkyl and linear C chains 15~20 A group consisting of alkenyl groups They were selected, Q is a linear C 15~18 Alkyl and linear C chains 15~20 A group consisting of alkenyl groups It will be selected.

[0061] In another embodiment, the compound may have the following structure:

[0062] [ka] During the ceremony, A is a linear C 10~20 Alkyl and linear C chains 10~20 A group consisting of alkenyl groups They were selected, B is a linear C 10~20 Alkyl and linear C chains 10~20 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 15~20 Alkyl and linear C chains 15~18 A group consisting of alkenyl groups They were selected, B is a linear C 15~18 Alkyl and linear C chains 15~18 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 15~20 It is an alkyl group, B is a linear C 15~18 It is an alkyl group, Q is -OH.

[0063] In another embodiment, the compound may have the following structure:

[0064] [ka] During the ceremony, A is a linear C 10~20 Alkyl and linear C chains 10~20 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 10~20 Alkyl and linear C chains 15~18 A group consisting of alkenyl groups They were selected, Q is -OH, Preferably, A is a linear C 15~20 It is an alkyl group, Q is -OH.

[0065] In any aspect or embodiment of this application, the compound is the compound described above. That's fine.

[0066] In any aspect or embodiment of this application, a compound, extract, or composition is synthesized by It may be imported, derived from nature, or extracted from traditional Chinese medicine.

[0067] The technical solution provided by this application significantly improves the highly efficient target delivery of nucleic acids. This can result in low encapsulation rates, poor safety, poor stability, complex manufacturing processes, and uneven production of the product. Conventional nucleic acids, including those that require improvements in quality, low reproducibility, and targeting. This can overcome the drawbacks of liposomes.

[0068] [Table 1-1(1)] [Table 1-1(2)] [Table 1-1(3)]

[0069] [Table 1-2(1)] [Table 1-2(2)] [Table 1-2(3)] [Table 1-2(4)]

[0070] [Table 1-2(5)] [Table 1-2(6)] [Table 1-2(7)] [Table 1-2(8)] [Table 1-2(9)]

[0071] Definition of Terms The terms used herein refer to the bond between the substituent and its parent moiety. A single dash "-" (or horizontal line) before and / or after indicates the level of connection. Alternatively, it may have a double dash "=" and a single dash "-" (or a horizontal line). The dash indicates a single bond, the double dash indicates a double bond, and the presence of a single or double dash indicates a double bond. If it is not present, it is understood that a single bond is formed between the substituent and its parent part. In addition, substituents are interpreted as moving "from left to right" unless otherwise indicated by the dash. It should be done, for example, C1-C6 alkoxycarbonyloxy groups and -OC(O )OC1~C6 alkyl groups refer to the same functional group.

[0072] The term "alkyl," as used herein, refers to a straight-chain or branched saturated hydrocarbon chain. As described herein, alkyl groups consist of 1 to 20 carbon atoms (i.e. , C1-20 alkyl), 1-8 carbon atoms (i.e., C1-8 alkyl), 1-6 1 to 4 carbon atoms (i.e., C1-6 alkyl), or 1 to 4 carbon atoms (i.e., It has C1-4 alkyl groups. In one embodiment, the alkyl group is C10-20 alkyl group. In one embodiment, the alkyl group is a C15-20 alkyl group. Alkyl groups are C15-C18 alkyl groups, i.e., C15, C16, C17, C1 It is an 8-alkyl group.

[0073] The term "alkenyl," as used herein, refers to at least one carbon-carbon double bond. It contains 2 to 20 carbon atoms (i.e., C2 to 20 alkenyls) and 2 to 8 carbon atoms. A carbon atom (i.e., C2-8 alkenyl), 2-6 carbon atoms (i.e., C2-6 alkenyl) an aliphatic group having 2 to 4 carbon atoms (i.e., C2-4 alkenyl) or a C2-4 alkenyl This refers to... In one embodiment, the alkenyl group is a C10-20 alkenyl group. In this state, the alkenyl group is a C15-20 alkenyl group. In one embodiment, The C15-C18 alkenyl group is a C15-C18 alkenyl group, i.e., C15, C16, C17, C18 alkenyl group. It is a nyl group.

[0074] The terms "heteroalkyl" and "heteroalkenyl" are used herein, Each of these is an alkyl and an alkenyl as defined above, and one or more Alky This refers to ions and alkenyls. For example, one, two, or three carbon atoms independently, the same Alternatively, they may be substituted with different heteroatomic groups. These are examples of heteroatomic groups. However, not limited to -NR1-, -O-, -S-, -S(O)-, and -S(O)2- Examples include, where R1 is H, an alkyl group. Examples of heteroalkyl groups include, - OCH3, -CH2OCH3, -SCH3, -CH2SCH3, -NR1CH3, and -CH2NR1CH3 is one example, where R1 is hydrogen or alkyl.

[0075] The term "reverse-phase evaporation" as used herein refers to the process of adding an aqueous solution of nucleic acid to an organic solvent solution of lipids. The mixture is then subjected to sonication, evaporated to remove the organic solvent, and then hydrated to obtain a lipid nucleic acid mixture. It refers to doing something.

[0076] The term “boiling method” (also called “heating method”) as used herein refers to the boiling method of a lipid in an organic solvent solution. Adding this to an aqueous solution of nucleic acids and boiling it at approximately 100°C for 30 minutes yields a lipid nucleic acid mixture. The method is not limited to heating by boiling, but includes other heating or heating methods known in the art. Steps can also be used.

[0077] Reverse-phase evaporation and boiling methods are carried out under controlled temperature and mixing conditions. The processing time and temperature can be easily determined by those skilled in the art. For example, reverse-phase evaporation. The temperature is preferably between about 25°C and about 70°C, more preferably between about 30°C and about 65°C. The temperature range is more preferably from about 40°C to about 60°C, and particularly about 55°C. The boiling temperature is preferably from about 25°C to about 100°C, more preferably from about 50°C to about Up to 100°C, more preferably from about 95°C to about 100°C, and particularly preferably from about 80°C. The temperature range is up to 100°C.

[0078] The nucleic acids described herein are DNA and RNA, preferably small RNA molecules, for example, 1 Lengths of 4-32 bp, 16-28 bp, 18-24 bp, especially 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 1. Contains small RNA molecules with a length of 32 bp. [Brief explanation of the drawing]

[0079] [Figure 1] Effects of 12 lipids on the absorption and entry of nucleic acid (HJT-sRNA-m7) into cells (human gastric cancer cell line NCI-N87) (reverse-phase vaporization method). [Figure 2] The 27 monolipids promote the entry of nucleic acids into the MRC-5 cell line (reverse-phase vaporization). [Figure 3] The 23 monolipids promote the entry of nucleic acids into the MRC-5 cell line (boiling method). [Figure 4] The 23 monolipids promote the entry of nucleic acids into the A549 cell line (boiling method). [Figure 5]Lipid combinations can promote the entry of nucleic acids into the MRC-5 cell line (reverse-phase vaporization). [Figure 6] Lipid combinations can promote the entry of nucleic acids into the A549 cell line (reverse-phase vaporization). [Figure 7] Lipid combinations can promote the entry of nucleic acids into the MRC-5 cell line (boiling method). [Figure 8] Lipid combinations can promote the entry of nucleic acids into the A549 cell line (boiling method). [Figure 9] Various types of lipid combinations promote the entry of nucleic acids into the Caco-2 cell line (reverse-phase vaporization method). [Figure 10] Various types of lipid combinations promote the entry of nucleic acids into the Caco-2 cell line (boiling method). [Figure 11A] Single lipids (numbers 11 and 12) facilitate the entry of nucleic acids with various sequences into various cells. [Figure 11B] Single lipids (numbers 11 and 12) facilitate the entry of nucleic acids with various sequences into various cells. [Figure 11C] Single lipids (numbers 11 and 12) facilitate the entry of nucleic acids with various sequences into various cells. [Figure 12] Fluorescence in situ hybridization experiments demonstrate that nucleic acids can enter the cytoplasm with the assistance of a single lipid. [Figure 13] The single lipids (numbers 11 and 12) facilitate the entry of nucleic acids into cells and their targeting of the gene's 3'UTR region. [Figure 14] Single lipids (numbers 11 and 12) facilitate the entry of nucleic acids into the bloodstream and lungs via the digestive tract. [Figure 15] Lipid combinations prepared by reverse-phase evaporation and boiling promote the entry of nucleic acids from the digestive tract into the bloodstream and lungs. [Figure 16] Various types of lipid combinations deliver single-stranded nucleic acids into MRC-5. [Figure 17A] The lipid combination delivers single-stranded nucleic acid into MRC-5 or Caco-2 cells. [Figure 17B] The lipid combination delivers single-stranded nucleic acid into MRC-5 or Caco-2 cells. [Figure 18] The lipid combination delivers single-stranded nucleic acid into cells. [Figure 19] The lipid combination delivers single-stranded nucleic acid into cells. [Figure 20] The lipid combination delivers single-stranded nucleic acid into cells. [Figure 21] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 22] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 23] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 24] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 25] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 26] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 27] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 28] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 29] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 30] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 31] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 32] The lipid combination delivers single-stranded nucleic acid into A549 cells. [Figure 33] The lipid combination delivers double-stranded nucleic acid into MRC-5 cells. [Figure 34]Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 35] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 36] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 37] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 38] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 39] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 40] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 41] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 42] Lipid combinations deliver double-stranded nucleic acids into A549 cells. [Figure 43] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 44] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 45] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 46] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 47] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 48] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 49] Lipid combinations deliver double-stranded nucleic acids into MRC-5 cells. [Figure 50] Lipid combinations facilitate the entry of nucleic acids into the lungs via the digestive tract. [Figure 51] Number 8 (PE): Number 12 (PC) (v:v=1:2) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells. [Figure 52]No. 8 (PE): No. 12 (PC) (v:v = 1:2) mediates the entry of siRNA into A549 cells. [Figure 53] No. 8 (PE): No. 12 (PC) (v:v = 1:2) mediates the entry of siRNA into A549 cells. [Figure 54] No. 8 (PE): No. 12 (PC) (v:v = 1:2) mediates the entry of siRNA into THP-1 cells. [Figure 55] No. 8 (PE): No. 12 (PC): No. 2 (DG) (v:v:v = 2:4:3) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells. [Figure 56] No. 8 (PE): No. 12 (PC): No. 2 (DG) (v:v:v = 2:4:3) lipid mixture mediates the entry of XRN2 siRNA into A549 cells and inhibits gene expression. [Figure 57] No. 8 (PE): No. 12 (PC): No. 4 (Cer) (v:v:v = 1:2:1) lipid mixture mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 58] No. 8 (PE): No. 12 (PC): No. 4 (Cer) (v:v:v = 1:2:1) lipid mixture mediates the entry of NFκB siRNA into THP-1 cells and inhibits gene expression (boiling method). [Figure 59] No. 8 (PE): No. 12 (PC): No. PC(11) (v:v:v = 1:2:1) lipid mixture mediates the entry of XRN2 siRNA into A549 cells and inhibits gene expression. [Figure 60] No. 8 (PE): No. 12 (PC): No. LPC(37) (v:v:v = 1:2:1) lipid mixture mediates the entry of XRN2 siRNA into A549 cells and inhibits gene expression. [Figure 61] No. 8 (PE): No. 12 (PC): No. MG(34) (v:v:v = 2:3:1) lipid mixture mediates the entry of CPSF4 siRNA into A549 cells and inhibits gene expression. [Figure 62] The lipid mixture of numbers 38 (PE), 37 (LPC), and 32 (TG) (v:v:v=32:8:5) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 63] The lipid mixture of numbers 38 (PE), 37 (LPC), and 32 (TG) (v:v:v=32:8:5) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression. [Figure 64] Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer): Number 31 (So): Number 29 (FA): Number 16 (TG) (v:v:v:v:v:v:v=2:1:2:2:3:1:3) mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 65] The lipid mixture (v:v:v:v:v:v:v=2:1:2:2:3:1:3) mediates the entry of XRN2 siRNA into A549 and the inhibition of gene expression (boiling method). [Figure 66] Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Number 4 (Cer) (v:v:v:v:v=2:4:2:2:2:5) is anti-fibrotic HJT small molecule RNA into MRC-5 cells. Mediates the entry of HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRNA-m7 (boiling method). [Figure 67] Lipid mixtures number 8 (PE): number 12 (PC): number 31 (So): number 29 (FA): number 4 (Cer) (v:v:v:v:v=2:4:2:2:5) can effectively deliver nucleic acids into cells. [Figure 68] Cell number 38 (PE): Cell number 37 (LPC) (v:v=4:1) mediates the entry of anti-fibrotic HJT small RNA molecules HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 69] Lipid mixture number 38 (PE): number 37 (LPC) (v:v=4:1) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression (boiling method). [Figure 70] The lipid mixture of numbers 38 (PE):12 (PC):2 (DG) (v:v:v=4:1:3) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression. [Figure 71] The lipid mixture of numbers 38 (PE), 37 (LPC), and 12 (PC) (v:v:v=4:1:1) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression (reverse-phase evaporation). [Figure 72] The lipid mixture of numbers 4 (Cer): 12 (PC): 38 (PE): 37 (LPC) (v:v:v:v=5:2:8:3) mediates the entry of anti-fibrotic small RNA molecules HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 73] The lipid mixture of numbers 4 (Cer), 12 (PC), 38 (PE), and 37 (LPC) (v:v:v:v=5:2:8:3) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression (boiling method). [Figure 74] No. 38 (PE): No. 2 (DG): No. 31 (So) (v:v:v=4:2:3) The lipid mixture mediates the entry of anti-fibrotic small RNAs HJT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 75] The lipid mixture of numbers 38 (PE):2 (DG):31 (So) (v:v:v=4:2:3) mediates the entry of XRN2 siRNA into A549 cells and the inhibition of gene expression (boiling method). [Figure 76] Lipid number 41 delivers double-stranded RNA into A549 cells using different preparation methods (boiling or reverse-phase evaporation). [Figure 77] Lipid number 41 delivers double-stranded RNA into MRC-5 cells using different preparation methods (boiling or reverse-phase evaporation). [Figure 78] Lipid number 41, when boiled, delivers single-stranded RNA into A549 and MRC-5 cells. [Figure 79] The efficiency of nucleic acid delivery by lipids will be determined using digital PCR (ddPCR) technology. [Figure 80] The efficiency of nucleic acid delivery by lipids was determined using flow cytometry. [Figure 81] The localization of nucleic acids delivered to cells by lipids is observed using confocal fluorescence microscopy. [Figure 82] The efficiency of nucleic acid delivery by lipids was determined by Western blotting assay. [Figure 83] Single lipid number 41 mediates the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells (boiling method). [Figure 84] The effects of lipid combination 1 (number 8 + number 41 = 6:1) and lipid combination 2 (number 38 + number 41 = 6:1) on nucleic acid delivery. [Figure 85] The effects of lipid combination 3 (number 39 + number 41 = 6:1) and lipid combination 4 (number 40 + number 41 = 6:1) on nucleic acid delivery. [Figure 86] The effect of lipid combination 5 (38+12+41+29=1:2:1:1) on nucleic acid delivery. [Figure 87] The effect of lipid combination 6 (40(PE)+12(PC)+41(So)=2:4:3) on nucleic acid delivery. [Figure 88] The effects of lipid combination 7 (12(PC)+41(So)=1:6) and lipid combination 8 (12(PC)+41(So)=1:1) on nucleic acid delivery. [Figure 89] The effects of lipid combination 9 (12(PC)+41(So)=6:1) and lipid combination 10 (40(PC)+12(PC)+41(So)=2:2:2) on nucleic acid delivery. [Figure 90]The effect of lipid combination 11 (4(Cer)+12(PC)+41(So)=1:1:1) on nucleic acid delivery. [Figure 91] Lipid 38, when boiled, delivers double-stranded RNA into A549 and MRC-5 cells. [Figure 92] Lipid 38, when boiled, delivers single-stranded RNA to A549 cells and MRC-5 cells. [Figure 93] The efficiency of nucleic acid delivery by lipids was determined using digital PCR (ddPCR) technology. [Figure 94] The efficiency of nucleic acid delivery by lipids was determined using flow cytometry. [Figure 95] The location of nucleic acids delivered to cells by lipids is observed using confocal fluorescence microscopy. [Figure 96] Lipid 64 delivers double-stranded RNA into A549 cells using different preparation methods (boiling or reverse-phase evaporation). [Figure 97] The efficiency of nucleic acid delivery by lipids, as determined by flow cytometry technology. [Figure 98] Localization of nucleic acids delivered to cells by lipids, as observed by confocal fluorescence microscopy. [Figure 99] The efficiency of nucleic acid delivery by lipids, as determined by digital PCR (ddPCR) technology. [Figure 100] Location of nucleic acids delivered to cells by lipids, as observed by confocal fluorescence microscopy. [Figure 101] Efficiency of nucleic acid delivery by lipids, as determined by Western blotting assay. [Figure 102] The single phosphatidylethanolamine lipid 40 mediates the entry of the anti-fibrotic double-stranded RNA HJT-sRNA-m7 into MRC-5 cells, thereby downregulating fibronectin protein expression levels. [Figure 103] Lipid 38, prepared by boiling, delivers single-stranded RNA into A549 and MRC-5 cells. [Figure 104]Lipid 39, prepared by different methods (boiling or reverse-phase evaporation), delivers double-stranded RNA into A549 cells. [Figure 105] The efficiency of nucleic acid delivery by lipids, as determined by digital PCR (ddPCR) technology. [Figure 106] Lipid 60, prepared by different methods (boiling or reverse-phase evaporation), delivers double-stranded RNA into A549 cells. [Figure 107] Lipid 62 prepared by different methods (boiling or reverse-phase evaporation) delivers double-stranded RNA into A549 cells. [Figure 108] Lipid number 41 promotes the entry of small RNA molecules into the bloodstream and protects them from degradation in the blood. [Figure 109] Lipid number 41 promotes the entry of small RNA molecules into gastric cells and protects them from degradation in the stomach. [Figure 110] Lipid number 41 promotes the entry of small RNA molecules into small intestinal cells and protects them from degradation in the small intestine. [Figure 111] Lipid number 41 promotes the entry of small RNA molecules into the liver and protects them from degradation in the liver. [Figure 112] Single PE (number 38) effectively delivers single-stranded sRNA nucleic acid into mouse blood via oral administration. [Figure 113] Single PE (number 40) effectively delivers single-stranded sRNA nucleic acid into mouse blood via oral administration. [Figure 114] Single PE (number 64) effectively delivers single-stranded sRNA nucleic acid into mouse blood via oral administration. [Figure 115] Single PE (number 71) effectively delivers single-stranded sRNA nucleic acid into mouse blood via oral administration. [Figure 116] Lipids effectively deliver single-stranded nucleic acids into MRC-5 cells under various temperature gradients. [Modes for carrying out the invention]

[0080] The following is a further description of this application, but no limitation is intended in any way. Any modifications made based on the teachings of this application are not covered by this application. Enter.

[0081] In this application, the lipid-soluble component is obtained by the Bligh & Dyer method, and traditional Chinese medicine (Rodio La crenulata, Mongolian dandelion, Andrographis paniculata, and watermelon Lipid components were extracted from vines and identified by HPLC-MS / MS (total of 138). Lipid components were identified using positive mode (125 components) and negative mode (13 components). Of these, 71 (see Tables 1-1 to 1-3) were used in the preparation of the lipid nucleic acid mixture. We observed whether these were able to promote the cellular absorption and entry of exogenous nucleic acids. The lipids used in this application were either commercially purchased or commercially synthesized. It should be noted that this was not directly extracted from traditional Chinese herbal medicine. Yes. Surprisingly, the inventors have found that various lipids effectively facilitate the absorption and entry of nucleic acids into cells. It is possible to form a lipid nucleic acid mixture that promotes this (see Figures 1-116), and in clinical settings We found that this has the potential to increase the efficiency of nucleic acid drug delivery. Further research is required in this application. This lipid-nucleic acid mixture was shown to enhance the efficiency of nucleic acid absorption and entry in different cell lines. However, differences were observed in different cell lines (see Figures 1-10). This is due to the targeted drug delivery. This opens up new possibilities. Furthermore, nucleic acid delivery using such lipid nucleic acid mixtures is Not column-specific, but corresponding to different sequences and the size of small RNA molecules (for example) It is possible to deliver nucleic acid fragments having approximately 20 bp (see Figure 11). In addition, Fluorescence in situ hybridization (FISH) revealed that the lipids derived from the decoction were detected. The lipid nucleic acid mixture formed by the substance effectively promotes the entry of exogenous nucleic acids into the cytoplasm. It was confirmed that this is possible (see Figure 12). Surprisingly, the inventors also found that boiling and The lipid nucleic acid mixture prepared by reverse-phase vaporization is introduced into the bloodstream and target tissues in a non-invasive manner. Nuclear sRNAs and other nuclei via aggressive pathways (e.g., gastrointestinal, respiratory, and local administration) We discovered that it is possible to facilitate the entry of acid (see Figures 14-15). Surprisingly, the present invention's lipids promote the entry of nucleic acids such as sRNA into cells. It is possible to regulate (e.g., inhibit) the expression of those target sequences, but non-target sequences Since it does not show such a regulatory effect on the column, it is suggested that it is a target-specific regulation. We discovered that it can be used as a means of delivering nucleic acid drugs (see Figure 13). (see).

[0082] Based on the above unexpected discovery, the inventors have arrived at this application.

[0083] In one embodiment, this application relates to chemicals extracted from traditional Chinese medicine to facilitate nucleic acid delivery. It is a compound containing lysolecithin, ceramide, diglyceride, and phosphatidylethanolamine. Phosphatidylcholine, triglycerides, monogalactosyl diglycerides, sphing Gosine, phosphatidylethanol, monoacylglycerol, fatty acids, platelet activator Selected from the group consisting of the following, preferably dimethylphosphatidylethanolamine: This provides compounds selected from the lipids shown in Table 1. In one embodiment, the lipids are They are non-natural, for example, synthetic or produced by fermentation.

[0084] In one embodiment, lipids are used to deliver nucleic acids into target cells. Another embodiment In terms of morphology, lipids are transported to the target that needs them, as well as through their blood circulation and / or It is used to deliver nucleic acids to target sites / intracellular spaces.

[0085] In a preferred embodiment, the lipid is phosphatidylcholine, for example, 1-stearoyl- 2-Oleoyl-sn-glycerol-3-phosphocholine(PC(18:0 / 18:2) , namely lipid number 11 in Table 1 and 1-palmitoyl-2-oleoyl-sn-glyc Cerol-3-phosphocholine (PC(16:0 / 18:2), i.e., lipid number 1 in Table 1) 2) is selected. These two phosphocholines (PCs) efficiently encapsulate nucleic acids. or, it enables the entry of nucleic acids into cells. In one embodiment, lipids It may also be lipid number 41 in Table 1, i.e., sphinganin (d22:0), and nucleic acid It is possible to efficiently encapsulate substances or promote the entry of nucleic acids into cells.

[0086] In another embodiment, the present application provides a pharmaceutical composition comprising the above-mentioned lipids and nucleic acids. Preferably Nucleic acids are small RNA molecules.

[0087] In one embodiment, the pharmaceutical composition of this application is administered via a non-invasive route (e.g., topical administration) and / Or for administration by injection, for example, for the gastrointestinal tract, respiratory tract, and / or for administration by injection. For example, it can be prepared for oral administration, inhalation, and / or injection. In combination, invasive routes are preferred (e.g., including intramuscular, subcutaneous, intravenous, intraarterial, and intraperitoneal routes). Injection, and injection into target tissue; otherwise, non-invasive routes are preferred.

[0088] In another embodiment, the pharmaceutical composition of this application comprises at least a portion of lipids and nucleic acids or The entire mixture can be prepared in the form of a lipid nucleic acid mixture. Various methods have been widely disclosed, and a suitable method for producing lipid nucleic acid mixtures is available in practice. It can be selected according to necessity.

[0089] In a third aspect, the present application relates to a kit comprising lipids and nucleic acids as described herein, Lipids and nucleic acids are provided separately in a first container and a second container, respectively. A kit is provided. The first container and the second container may be the same or different. In some embodiments, at least some or all of the lipids and nucleic acids may be used. It is prepared as a lipid-nucleic acid mixture immediately before use.

[0090] In a fourth aspect, the present application relates to a method for delivering nucleic acids into a target tissue / intracellular space, This specification provides a method provided in the form of a pharmaceutical composition or kit as described herein.

[0091] In a fifth aspect, the present application provides for the delivery of nucleic acids in vivo into subjects that require them. A method that provides nucleic acids in the form of a pharmaceutical composition or kit as described herein, for example For example, delivering nucleic acids in vivo into the target blood circulation or target tissue / intracellular space, for instance Lipids and nucleic acids can be administered via non-invasive routes (e.g., local administration) and / or injection. For example, by gastrointestinal tract, respiratory tract, and / or injection, for example, by oral administration, inhalation, and The method provides administration by / or injection.

[0092] In a sixth aspect, this application relates to diseases / disorders that can be prevented and / or treated with nucleic acids. Methods for preventing and / or treating harm, including the pharmaceutical compositions described herein. or providing the kit to those who need it, for example, lipids and nucleic acids , by non-invasive routes (e.g., local administration) and / or by injection, for example, the gastrointestinal tract , respiratory, and / or injection, for example, by oral administration, inhalation, and / or injection It provides a method of administration that is more readily available. Surprisingly, it offers a non-invasive route of administration (e.g., orally). Administration (including gastrointestinal and respiratory methods such as gastric tube feeding and inhalation) can lead to the entry of nucleic acids and It can significantly enhance effectiveness.

[0093] In a seventh aspect, the present application relates to a method for manufacturing a pharmaceutical composition or kit, and above This provides the use of pharmaceutical compositions and / or kits in the method described herein. Furthermore, it is used in the various methods described above. Lipids , pharmaceutical compositions, and / or A kit is also available.

[0094] In various embodiments of this application, the nucleic acid may be small RNA, for example, small molecule RNA is 14-32 bp, 16-28 bp, and 18-24 bp in length, especially 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, They may have lengths of 29, 30, 31, or 32 bp. In addition, small RNA molecules may, for example, The material may be a single-stranded or double-stranded structure having a stem-loop configuration. For example, nucleic acids have the following sequence: ugagguagua gguugugugg uugu It may also be HJT-sRNA-m7 containing aagc.

[0095] In one embodiment, the pharmaceutical composition or kit or compound of this application is used to treat cancer, for example, stomach cancer. It can be used to treat diseases such as lung cancer.

[0096] In one embodiment, the pharmaceutical composition, kit, or compound of this application is NCI-N87. Cells (gastric cancer cells), MRC-5 cells (pulmonary fibroblasts), and A549 cells (lung cancer cells) The proliferation of ) is treated in vitro or in vivo, for example, to inhibit it. It can be used.

[0097] In various embodiments of this application, the lipid nucleic acid mixture is prepared by various methods, for example, reverse-phase evaporation. Alternatively, it can be obtained by boiling. In reverse-phase evaporation, an aqueous solution of nucleic acids is used with an organic solvent for lipids. The lipid nucleic acid is added to the solution, sonicated, evaporated to remove the organic solvent, and then hydrated. A mixture is obtained. The boiling method described in this application involves adding an organic solvent solution of lipids to an aqueous solution of nucleic acids. This refers to adding the substance and boiling it at approximately 100°C for 30 minutes to obtain a lipid nucleic acid mixture. (Reverse-phase evaporation method) The boiling method is carried out under controlled temperature and mixing conditions. Suitable processing time and The temperature can be easily determined by those skilled in the art. For example, the temperature for reverse-phase evaporation is Ideally, from about 25°C to about 70°C, more preferably from about 30°C to about 65°C. The temperature may be in the range of approximately 40°C to approximately 60°C, and is particularly preferably approximately 55°C. It is also acceptable to do so. The temperature for the boiling method (also called the heating method) is preferably from about 25°C to about 100°C. Up to ℃, more preferably from about 50℃ to about 100℃, more preferably from about 95℃ to about 1 The temperature may be in the range up to 00°C, and is particularly preferably about 100°C. [Examples]

[0098] The following examples are merely illustrative of the invention disclosed herein and do not extend to the scope of the appended claims. It should not be interpreted as limiting.

[0099] [Table 2]

[0100] Examples of lipids shown in Table 1 as numbers 1 to 32 1. Extraction of lipids from traditional Chinese medicine 1.1 Decoction of traditional Chinese herbal medicines 1) 100g of herbal medicine decoction pieces (Ningbo Haishu Qiancao Bio Rhodiola crenulata purchased from technology Co.,Ltd.; Be Mongolian dandelion purchased from Ijing Tongrentang pharmacy. Add honeysuckle (Andrographis paniculata) to 1000 mL of ddH2O. It was then soaked for 30 minutes.

[0101] 2) Heat the herbal medicine decoction pot vigorously for 15 minutes, then heat slowly for 20 minutes. It was boiled for a while.

[0102] 3) Heat 400 mL of herbal soup and evaporate it using a rotary evaporator at 60°C and 60 rpm. It was added to the DATA and concentrated to 100 mL.

[0103] 1.2 Lipid extraction 1) 600 ml of chloroform-methanol mixture (chloroform:methanol = 1: 2. The herbal soup (rotary evaporator) obtained from step 1.1 above is used to make the herbal soup (rotary evaporator) Add to (concentrated by) chloroform:methanol:water = 1:2:0.8 The mixture was stirred for 10-15 minutes.

[0104] 2) Add 200 mL of chloroform to the Erlenmeyer flask and stir for 10 minutes. Then they mixed it.

[0105] 3) Add 200 mL of ddH2O to an Erlenmeyer flask and add chloroform. A methanol:water ratio of 2:2:1:8 was used, and the mixture was stirred for 10 minutes.

[0106] 4) The liquid in the upper layer and the insoluble material in the intermediate layer were removed to obtain the lower chloroform layer. It was stored at 40°C.

[0107] 1.3 HPLC-MS / MS Identification of Lipid Components Device settings 1) Chromatography settings: Instrument: Ultimate3000; Column: Kinetex C18 (100 x 2.1 mm, 1.9 μm); Column temperature: 45°C; Mobile phase A: Acetonitrile:Water (V / V, 6 0:40), solution containing 10 mmol / L ammonium formate, mobile phase B: acetonitrile : Isopropanol (10:90, V / V), 10 mmol / L ammonium formate and Solution containing 0.1% formic acid. Flow rate: 0.4 mL / min; Injection volume: 4 μl.

[0108] 2) Mass spectrometry parameters: a) Positive mode: Heater temperature 300℃, sheath gas flow rate 45arb, auxiliary gas Sweep gas flow rate, 1 arb, spray voltage, 3.0 kV, capillary Rally temperature: 350℃, S-lens RF level: 30%. Scan range: 200~150 0.

[0109] b) Negative mode: Heater temperature 300℃, sheath gas flow rate 45arb, auxiliary gas Sweep gas flow rate, 1 arb, spray voltage, 2.5 kV, capillary Rally temperature: 350℃, S-lens RF level: 60%. Scan range: 200~150 0.

[0110] 1.4 Identification of lipids derived from traditional Chinese medicine Lipid components were identified by HPLC-MS / MS. A total of 138 components were derived from traditional Chinese medicine. We identified several lipid components. Of these, 125 were positive mode and 13 were negative mode. Identification was performed using a specific mode. The following experiments were conducted on compound numbers 1-32 shown in Table 1. did.

[0111] Note that all lipids tested below were commercially purchased, as listed in Table 1-1. It should be noted that it was either created or commercially synthesized and used.

[0112] 2. Production of lipid nucleic acid mixtures 2.1 Reverse-phase evaporation method: Prepare a 600 μl solution of lipids in diethyl ether, and according to the lipid numbers shown in Table 1 They were grouped as follows: Diethyl ether solution corresponds to lipid group numbers 1 / 2 / 4 / 9 / 14 / 18 / 19 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 29 / 30 / 32 In the case of 0.017857 mg / mL, for lipid group numbers 3 / 8 / 10 / 11 / 12 / 13 0.035714 mg / mL, 0.0 for lipid group numbers 6 / 15 / 16 / 17 / 31. It had a concentration of 0.35714 mg / mL. The lipid solution was mixed with 120 μl of HJT-sRN. Add A-m7 single-stranded RNA to DEPC-treated aqueous solution (15 nmol) in a volume ratio of 5:1. Then, it was sonicated for 3 minutes. Diethyl ether was removed by evaporation at 55°C, and 600 μl of DEPC water was added for hydration to obtain the HJT-sRNA-m7 lipid mixture.

[0113] 2.2 Boiling method: Prepare a 60 μl chloroform solution of lipids and, according to the lipid numbers shown in Table 1, It became a loop. Chloroform solution is lipid group number 1 / 2 / 4 / 9 / 14 / 18 / 19 / 2 For 0 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 29 / 30 / 32, the length is 5m. g / mL, 10 mg / mL for lipid group numbers 3 / 8 / 10 / 11 / 12 / 13, lipid group In the case of numbers 6 / 15 / 16 / 17 / 32, the concentration was 1 mg / mL. The above lipid class Loloform solution is added to 600 μl of DEPC-treated water containing HJT-sRNA-m7 single-stranded RNA. Mix with the solution (15 nmol) and heat at 100°C for 30 minutes to obtain HJT-sRNA-m7 A lipid mixture was obtained.

[0114] 3. In vitro delivery experiment of lipid nucleic acid mixture 3.1 NCI-N87 cells (gastric cancer cells), MRC-5 cells (lung fibroblasts), A5 49 cells (lung cancer cells) were cultured until the logarithmic growth phase, and then 1 × 10⁻⁶ cells were cultured. 6 / 2mL medium / U MRC-5 cells were plated in 6-well plates at a cell density of 1. A549 cells were cultured in MEM medium (MEM, Gibco). NCI-N87 cells were cultured in RPMI-1640 medium (HyClone). The cells were cultured in (one). Then, they were incubated overnight at 37°C until the cells attached to the wall. Afterward, follow-up experiments were conducted.

[0115] 3.2 The experimental groups were as follows: 1) NC group: Refers to untreated cells. This group served as a negative control group.

[0116] 2) RNAimax treatment group: 2 μl RNAimax transfection reagent and Dilute each HJT-sRNA-m7 solution with 100 μl of opti-MEM medium. The two were then mixed, allowed to stand for 15 minutes, added to the cells, and then mixed again. HJT-s The final concentration of RNA-m7 was 200 nM. This group served as a positive control group. I did it.

[0117] 3) Free uptake group: HJT-sRNA-m7 solution was added directly (final concentration was 200 nucleotides). (It was M). This group served as a negative control group.

[0118] 4) Lipid nucleic acid mixture: A mixture of the lipids prepared in step 2 and HJT-sRNA-m7. The substance was added to the cells and mixed. The final concentration of RNA was maintained at 200 nM.

[0119] 3.3 After co-incubating with small RNA molecules for 3 hours, the cells were 2 hours in PBS. The cells were washed approximately three times. The cells were collected using TRIzol lysis buffer, and total RNA was extracted. The amount of small RNA molecules that have entered the cell is detected by RT-qPCR, and the localization of RNA is determined. The transformation was detected by fluorescence in situ hybridization. Prototypes for each detection method The call was as follows:

[0120] 3.3.1 RT-qPCR detection of small RNA molecules (Taqman probe method) 1) sRNA was reverse transcribed into cDNA. Reverse transcription kit (TaqMan(registered trademark)) Using the IcroRNA Reverse Transcription Kit (catalog number 4366597), sRNA is transcribed into cD The signal was reverse-transcribed to NA. The reverse transcription system was as follows: 100mM dNTP(dTTP) (containing) 0.15 μl, MultiScribe® reverse transcriptase 50 U / μl 1 .00μl, 1.5μl of 10x RT buffer, RNase inhibitor (20U / μl) 0.19 μl of nuclease-free H2O, 4.6 μl of RNA template (200 ng / μl) After mixing, it was added. Mix 3 μl of 5× Taqman probe primer and then mix. After briefly centrifuging, add the mixture, then keep it on ice for 5 minutes before proceeding with the PCR reaction. The mixture was loaded into a container. The reaction conditions were as follows: (1) 16°C, 30 minutes; (2) 42 (3) °C, 30 minutes; (4) 85 °C, 5 minutes; (5) 4 °C, reaction stop. After the reaction, 10 μl of R-free solution. Nase ddH2O was added to bring the final volume to 25 μl. Used in the reverse transcription process. The Taqman probe primer was synthesized by Invitrogen (U6: 4440887, HJT-sRNA-m7:4398987).

[0121] 2) Quantitative PCR amplification reaction: The qPCR reaction system consists of 5 μl of 2× TaqMan containing UNG. (Registered Trademark) Universal Master Mix II, 0.5 μl x 20 x Taqman Plastic The mixture contains an imager, 1 μl of cDNA obtained by reverse transcription, and 3.5 μl of RNase-free dH2O. It had a total volume of 10 μl. A LightCycler480 fluorescence quantitative PCR instrument was used. The following PCR reaction conditions were used: 2 minutes at 50°C, followed by 9 minutes for pre-denaturation. 5°C for 10 minutes, then PCR amplification cycle: (1) 95°C for 15 seconds; (2) 60°C, 60 seconds; (3) 60°C for 60 seconds; total of 40 cycles; finally, cool at 40°C for 10 seconds. The Taqman probes for amplification reactions were designed and synthesized by Invitrogen. (U6:4440887, HJT-sRNA-m7:4398987).

[0122] 3) Relative expression levels were calculated using the 2-ΔCt method. 3.3.2 RT-qPCR detection of small RNA molecules (SYBR green dye method) 1) sRNA was reverse transcribed into cDNA. Reverse transcription kit (high-volume cDNA reverse transcription kit) Using Applied Biosystems (catalog number 4368813), The sRNA was reversed to cDNA using the stem-loop method. The reverse transcription system is as follows: Mixture: RNA template (150 ng / μl) 10 μl, 10 × RT buffer, 2.0 μl, 25 ×dNTP mix (100mM) 0.8μl, U6 RT stem-loop primer 2 0.0 μl, HJT-sRNA-RT-m7 stem-loop primer 2.0 μl, Mul tiScribe® reverse transcriptase 1.0 μl, RNase inhibitor 1.0 μl, NUCT-free 1.2 μl of rease H2O was briefly centrifuged and then loaded into a PCR reactor. The conditions were as follows: (1) 25°C for 10 minutes; (2) 37°C for 120 minutes; ( 3) 85°C for 5 minutes; (4) 4°C to stop the reaction. After the reaction, 20 μl of RNase-free ddH 2O was added to bring the final volume to 40 μl. Stem-loop used in the reverse transcription process. The primers are manufactured by Beijing Tsingke Biotechnology Co. Synthesized by , Ltd. (U6 RT primer: GTCGTATCCAGTGCA GGGTCCGAGGTATTCGCACTGGATACGACAAAAATATG;H JT-sRNA-m7 RT stem-loop primer: GTCGTATCCAGTGC ACGCTCCGAGGTATTCGCACTGGATACGACGCTTACAA).

[0123] 2) Quantitative PCR amplification reaction: The qPCR reaction system uses 5 μL of 2×SYBR green master Mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer Imager (10 μM), 1 μl of cDNA obtained by reverse transcription, 3 μl of RNase-free dH2O It has a total volume of 10 μl, including the LightCycler480 fluorescence quantitative PCR instrument. The following PCR reaction conditions were used: 5 minutes at 95°C for pre-denaturation. Then PCR amplification cycle: (1) 95°C, 10 seconds; (2) 55°C, 10 seconds; (3 ) 72°C for 20 seconds; total 40 cycles; finally cooling at 40°C for 10 seconds. Amplification reaction Both forward and reverse primers are from Beijing Tsingke Bi. Designed and synthesized by otechnology Co.,Ltd. (U6 F plastic Primer: GCGCGTCGTGAAGCGTTC, U6 R Primer: GTCGAGG GTCCGAGGT, HJT-sRNA-m7 F primer: TCGCGCTGAGG TAGTAGGTT, HJT-sRNA-m7 R primer: GTGCACGCTCC GAGGT).

[0124] 3) Relative expression levels were calculated using the 2-ΔCt method. 3.3.3 Fluorescence in situ hybridization (FISH) of small RNA molecules 1) Remove the culture medium and wash three times with PBS (500 μl / well). 2) Fix with 4% paraformaldehyde at room temperature for 20 minutes (500 μl / well, P (Prepared with BS buffer). 3) Wash with 1×PBS (500 μl / well), then wash with fresh 1×PBS (500 μl / well) Immerse in (gel) for 5 minutes. 4) Remove PBS and sterilize the cells with PK (proteinase K) buffer at room temperature for 10 minutes. It was over-processed. 5) Wash with 1×PBS buffer (500 μl / well) and leave at room temperature for 10 minutes in 4% paraben solution. Fix with lumaldehyde (500 μl / well, prepared in PBS buffer). 6) Wash with 1×PBS and immerse in fresh 1×PBS (500 μl / well) for 5 minutes. . 7) The cells were treated with 0.1 M TEA at room temperature for 10 minutes. 8) Wash with 1×PBS (500 μl / well), then wash with fresh 1×PBS (500 μl / well) Immerse in (gel) for 5 minutes. 9) Place the culture plate in hybridization buffer (50% formamide, 5×SS). C, 5x Denhart, 250 μg / mL yeast RNA, 500 μg / mL herring sperm D Place in a hybridization cassette (NA) and pre-incubate at room temperature for 1 hour. did. 10) RNA probe (HJT-sRNA-m7 probe: 5'-GCTTACAAC) CACACAACCTACTACCTCA-3', Scrambled probe: 5'-CAG TACTTTTGTGTAGTACAA-3', U6 probe: 5'-TTTGCGTG Add TCATCCTTGCG-3') to the hybridization buffer (RNA pro The concentration of the oil was 0.1-0.2 ng / μl), and it was denatured at 85°C for 5 minutes, and then quickly... Place it on the ice. 11) Remove the pre-hybridization buffer from step 9 and put it into step 10 Replace the hybridization buffer with one containing the RNA probe, then halve the plate. Place in an ibridization cassette and incubate at 65°C overnight (12-16 hours). To do. 12) Preheat the 0.2×SSC solution to 65°C and infuse 1 mL of 0.2×SSC for 20 minutes each time. Wash three times with a washer (well). 13) Add 0.2× SSC solution (1 mL / well) at room temperature and let stand for 5 minutes. 14) Aspirate 0.2×SSC and add buffer B1 (0.1M Tris-HCl (pH 7). Add 4-7.5) and 150 mM NaCl) and wash twice at room temperature for 5 minutes each time. 15) Wash with PBS three times for 5 minutes each time. 16) Observe with a confocal microscope.

[0125] 3.4 Effects of traditional Chinese herbal extracts on the absorption and entry of nucleic acids into cells 1) Thirty lipids shown in Table 1 were selected for the experiment. The experimental groups were as shown in Table 1. The lipids were numbered according to their assigned lipid numbers. The lipid nucleic acid mixture was then reversed as described in step 2. The lipid nucleic acid mixture was prepared according to the phase evaporation method and the boiling method. In vitro delivery experiments were conducted using this method to determine the amount of intracellular RNA present.

[0126] The experimental results are shown in Figures 1-4. Figures 1-2 show lipid nucleic acid mixtures prepared by reverse-phase evaporation. However, we were able to successfully deliver nucleic acids to NCI-N87 and MRC-5 cells. This was shown. Figures 3-4 show that the lipid nucleic acid mixture prepared by the boiling method was MRC-5 and We demonstrated that we were able to successfully deliver nucleic acids to A549 cells.

[0127] 2) Furthermore, various lipids from Table 1 were combined. Diethyl acetate of 200 μl of the lipid combination -Tel solution (numbers 1 / 2 / 4 / 9 / 18 / 19 / 20 / 21 / 22 / 23 / 24 / 25 / For the lipid combination of 26 / 27 / 28 / 29, the dose is 0.00326 mg / mL, number 3 / 8 / For the lipid combination of 10 / 13, the concentration is 0.00652 mg / mL, corresponding to lipids numbered 5 / 16 / 17. (In the case of a combination, it has a concentration of 0.000652 mg / mL) and 3 μl of lipid combination Chloroform solution (numbers 1 / 2 / 4 / 9 / 18 / 19 / 20 / 21 / 22 / 23 / 24) For lipid combinations of / 25 / 26 / 27 / 28 / 29, the dosage is 5 mg / mL, numbers 3 / 8 / 10. For lipid combination number 13, it is 10 mg / mL, and for lipid combination number 15 / 16 / 17... A solution (having a concentration of 1 mg / mL) was prepared. The above lipids were mixed in equal volumes to form a mixed lipid. As described below, lipid nucleic acid mixtures are obtained by reverse-phase evaporation and boiling, respectively. The substance was prepared. Using the lipid nucleic acid mixture according to steps 3.1-3.3, in vitro Delivery experiments were conducted to determine the amount of intracellular RNA present.

[0128] Preparation of lipid combinations and nucleic acid mixtures by reversed-phase evaporation: 200 μl of a lipid combination diethyl ether solution was used to create a 5:1 ratio between the lipid solution and RNA. In this volume ratio, add to 40 μl of HJT-sRNA-m7 aqueous solution (5 μM) and microwave for 3 minutes. Wave treatment was performed. Diethyl ether was removed by evaporation at 55°C, and then hydrated for 2°C. 00 μl of DEPC water was added to obtain a lipid nucleic acid mixture.

[0129] Production of lipid combinations and nucleic acid mixtures by boiling method: 3 μl of lipid combination chloroform solution to 100 μl of HJT-sRNA-m7 aqueous solution The mixture was added to the liquid (2 μl) and heated at 100°C for 30 minutes.

[0130] The experimental results are shown in Figures 5-8. Figures 5-6 show the lipid combinations prepared by reverse-phase evaporation. We were able to successfully facilitate the entry of nucleic acids into target cells using a mixture of nucleic acids. This was demonstrated. Figures 7-8 show that a mixture of lipids and nucleic acids, prepared by boiling, enters the target cell. We demonstrated that we were able to successfully facilitate the entry of nucleic acids into the substance.

[0131] 3) Various types of lipids shown in Table 1, for example, TG mixtures and DG mixtures These are combined and used to prepare lipid nucleic acid mixtures by reverse-phase evaporation and boiling methods, respectively. In vitro delivery experiments were conducted using the lipid nucleic acid mixture according to steps 3.1-3.3. We performed this procedure to determine the abundance, intracellular localization, and target region of intracellular RNA.

[0132] Various types of lipids were combined as follows: Combination 1: Lipid numbers 1-32, numbers 1 / 2 / 3 / 4 / 6 / 8 / 9 / 10 / 13-32 Combinations, however, lipid numbers 5, 7, 11, and 12 are not included. Combination 2: Combination 1, which does not include lipid number 29. Combination 3: Combination 1, which does not include lipid numbers 1, 2, 3, and 19. Combination 4: Combination 1 does not include lipid numbers 4 and 14. Combination 5: Contains lipid numbers 6, 9, 10, 13, 15, 16, 18, 20-28, and 32. No combination 1, Combination 6: Combination 1 which does not include lipid number 8. Combination 7: Combination 1 does not include lipid numbers 17, 30, and 31. FA: Lipid number 29, DG combination: Combination of lipid numbers 1, 2, 3, and 19. Cer combination: Combination of lipid numbers 4 and 14. TG combinations: Lipid numbers 6, 9, 10, 13, 15, 16, 18, 20-28, 32 In combination, PE combination: Lipid number 8, SO combination: A combination of lipid numbers 17, 30, and 31.

[0133] The experimental results are shown in Figures 9-10. The results differ depending on the method (boiling or reverse-phase evaporation). Various types of lipid combinations (e.g., mixtures of TG, mixtures of DG, etc.) enter target cells. This demonstrated that it was possible to promote the entry of nucleic acids.

[0134] 4) Furthermore, nucleic acids that deliver nucleic acids having different sequences to lipid numbers 11 and 12 Selected for experiments to investigate the efficiency of nucleic acid localization and target gene regions. The protocol was as follows:

[0135] Soybean PC, lipid number 11 (18:0 / 18:2) and lipid number 12 (16:0 / 18 2) A mixture of various small RNA molecules (see Table 3 below) is subjected to reverse-phase evaporation. The solution was prepared and then added to the A549 cell line (the final concentration of sRNA was 200 nM). ). The negative control group (control) was directly added to the same concentration of sRNA. Positive control group (RNAi Lipofectamine RNAimax (transfection reagent) Transfected with 6 μl / well. The amount of sRNA in cells was measured after 3 hours. The sRNA was detected using an aqman probe, and its relative expression level was determined by the 2-ΔCt method. I calculated it.

[0136] The experimental results are shown in Figures 11-13. Figures 11A-C show the difference between the two lipids (lipids) compared to the control. Lipid number 11 (18:0 / 18:2) and lipid number 12 (16:0 / 18:2) are different We were able to effectively promote the entry of nucleic acid molecules having a specific sequence into various cells. Figure 12 shows lipid numbers 11 (18:0 / 18:2) and 12 (16: The nucleic acids delivered by 0 / 18:2) enter the cytoplasm and are mainly localized in the cytoplasm. This was shown. In addition, referring to Figure 13, the inventors unexpectedly found that lipid number 11 and Both numbers 12 promote the entry of small nucleic acid fragments and their target genes into the wild-type 3' They act on UTRs, and the phase of luciferase with wild-type 3'UTR of the target gene While it reduced the contrasting expression levels, it did not affect the mutated 3'UTR of those target genes. They discovered that this can be used as a means of delivering nucleic acid drugs.

[0137] 4. In vivo delivery experiments of lipid nucleic acid mixtures 4.1 Experimental Steps 1. Preparation of lipid-nucleic acid mixture: A mixture of lipid number 11 or number 12 and nucleic acid, Number 1 / 2 / 4 / 9 / 14 / 18 / 19 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 29 / 30 / 32, numbers 3 / 8 / 10 / 11 / 12 / 13, and number 6 / A mixture of lipid combinations 15 / 16 / 17 / 31 and nucleic acids was subjected to reverse-phase evaporation and boiling. Prepared as described (see steps 2.1-2.2).

[0138] 2. Gastric tube feeding was performed on 6-8 week old male C57 mice at a rate of 200 μl / animal, and I grouped them as shown below. (1) Control group (free uptake group): No treatment or HJT-sRNA-m 7 was administered. (2) Lipid number 11 (18:0 / 18:2) group: With gastric tube nutrition, lipid number 11 (18 :0 / 18:2) or lipid number 11 (18:0 / 18:2) and HJT-sRNA-m A mixture of 7 was administered. (3) Lipid number 12 (16:0 / 18:2) group: With gastric tube nutrition, lipid number 12 (16 :0 / 18:2) or lipid number 12 (16:0 / 18:2) and HJT-sRNA-m A mixture of 7 was administered.

[0139] 3. Sample collection: Six hours after gastric tube feeding, whole mouse blood (500 μl) and lung (110 mg) were collected. These were collected using either 1.5 mL of TRIzol-LS or 3 mL of TRIzol. It was then homogenized and frozen at -80°C for storage.

[0140] 4. Total RNA extraction: (1) TRIzol or TRIzol-LS lysis buffer (Sig Add ma Corporation to the cells, then let stand at room temperature for 5 minutes to allow them to fully absorb the solution. Dissolved (In the case of mouse lung tissue, 100 mg of TRIzol dissolved in 1.0 mL of TRIzol lysis buffer) The solution is added to the tissue, homogenized, and heated at 12,000 rpm for 10 minutes at 4°C. The heart was isolated, and unhomogenized tissue precipitates were removed. In the case of whole mouse blood, 1. Add 5 mL of TRIzol-LS lysis buffer to 500 μl of whole blood and incubate at 4°C for 10 minutes. (2) The mixture was centrifuged at 2,000 rpm to remove any uncleaved precipitate. Centrifuge at 12,000 rpm for 5 minutes at 4°C and discard the precipitate. (3) Chloroform Add TRIzol at a ratio of 200 μl / mL, vortex and mix, and leave at room temperature for 1 (4) Centrifuge at 12,000 rpm for 15 minutes at 4°C to separate the upper aqueous phase. Pipette into another centrifuge tube. (5) Repeat step 4, adding an equal volume of chloroform. Add to the upper aqueous phase, mix thoroughly, maintain at room temperature for 10 minutes, then refrigerate at 4°C for 15 minutes at 12°C. Centrifugation is performed at 00 rpm. (6) The upper aqueous phase is drawn out and transferred to a new EP tube. Add isopropanol at a ratio of 0.5 ml / mL TRIzol, mix, and leave at room temperature for 5 minutes. (7) Maintain for approximately 10 minutes. (7) Centrifuge at 12,000 rpm for 10 minutes at 4°C to remove the precipitate. Discard the contents. (8) Add 1 mL of 75% ethanol and gently shake the centrifuge tube. (9) Centrifuge at 8000g for 5 minutes at 4°C to remove the precipitate. Discard as much as possible. (10) Dry the RNA sample at room temperature for 5-10 minutes, then add 50 μl of DE Dissolve in PC-treated H2O.

[0141] 5. RT-qPCR detection: As described in sections 3.3.1 and 3.3.2 above. Please refer to the instructions.

[0142] 4.2 Experimental Results Referring to Figure 14, the inventors unexpectedly found that lipid number 11 (18:0 / 18:2) Lipid number 12 (16:0 / 18:2) is obtained from the blood and (non-invasive) gastric tube nutrition. They discovered that they could promote the entry of small fragments of nucleic acids into the lungs. These are nucleic acid drugs. It can be used as a means of delivery. Surprisingly, by direct boiling The resulting lipid nucleic acid mixture achieved remarkable delivery effects.

[0143] Referring to Figure 15, the inventors have found that, surprisingly, a mixture of 28 lipids is (non-invasive). (Invasive) gastric tube feeding facilitated the entry of small fragments of nucleic acids into the bloodstream. They discovered that these can be used as a means of delivering nucleic acid drugs. Amazing. In particular, the mixture of lipids and nucleic acids obtained by the direct boiling method exhibits a remarkable delivery effect. Achieved.

[0144] Examples of lipids shown in Table 1 as numbers 1 to 71 method 1. Extraction of lipids from traditional Chinese medicine 1.1 Decoction of Chinese herbal medicine 1) 100g of herbal medicine decoction pieces (Beijing Tongrentang pharm Rhodiola crenulata, Dandelion mongolica, Honeysuckle, and A purchased from acy Add *Nandrographis paniculata* to 1000 mL of ddH2O and immerse for 30 minutes. did.

[0145] 2) Heat the herbal medicine decoction pot vigorously for 15 minutes, then heat slowly for 20 minutes. It was boiled for a while.

[0146] 3) Add 400 mL of heated herbal soup to the rotary evaporator and heat to 60°C. The solution was concentrated to 100 mL over 30 minutes at 60 rpm.

[0147] 1.2 Lipid extraction 1) Add chloroform to 160 ml of herbal soup (concentrated using a rotary evaporator). 600 mL of form-methanol mixture (chloroform:methanol = 1:2, v / v) Add the mixture to make a chloroform:methanol:water ratio of 1:2:0.8 and stir for 10-15 minutes. They were mixed together.

[0148] 2) Add 200 mL of chloroform to the Erlenmeyer flask and stir for 10 minutes. Then they mixed it.

[0149] 3) Add 200 mL of ddH2O to an Erlenmeyer flask and add chloroform. A methanol:water ratio of 2:2:1:8 was used, and the mixture was stirred for 10 minutes.

[0150] 4) Remove the liquid from the upper layer and the insoluble material from the middle layer, and remove the chloroform layer from the lower layer. It was removed from the container and stored at -40°C.

[0151] 1.3 HPLC-MS / MS Identification of Lipid Components Device settings 1) Chromatography settings: Instrument: Ultimate3000; Column: Kinetex C18 (100 x 2.1 mm, 1.9 μm); Column temperature: 45°C; Mobile phase A: Acetonitrile:Water (V / V, 6 0:40), solution containing 10 mmol / L ammonium formate, mobile phase B: acetonitrile : Isopropanol (10:90, V / V), 10 mmol / L ammonium formate and Solution containing 0.1% formic acid. Flow rate: 0.4 mL / min; Injection volume: 4 μl.

[0152] 2) Mass spectrometry parameters: a) Positive mode: Heater temperature 300℃, sheath gas flow rate 45arb, auxiliary gas Sweep gas flow rate, 1 arb, spray voltage, 3.0 kV, capillary Rally temperature: 350℃, S-lens RF level: 30%. Scan range: 200~150 0.

[0153] b) Negative mode: Heater temperature 300℃, sheath gas flow rate 45arb, auxiliary gas Sweep gas flow rate, 1 arb, spray voltage, 2.5 kV, capillary Rally temperature: 350℃, S-lens RF level: 60%. Scan range: 200~150 0.

[0154] 1.4 Identification of lipids derived from traditional Chinese medicine Lipid components were identified by HPLC-MS / MS. A total of 138 components were derived from traditional Chinese medicine. We identified several lipid components. Of these, 125 were positive mode and 13 were negative mode. The compounds were identified using a specific mode. The following experiments were performed on compounds 1-69 shown in Table 1. Furthermore, all lipids tested below were commercially purchased, as listed in Table 1-1. It should be noted that it was either created or commercially synthesized and used.

[0155] 2. Production of lipid nucleic acid mixtures 2.1 Reverse-phase evaporation method: Prepare a 100 μl solution of lipids in diethyl ether, and according to the lipid numbers shown in Table 1... They were grouped as follows (lipid concentrations are shown in the table below). 20 μl of lipid solution Add nucleic acid solution (HJT sRNA or siRNA) in a 5:1 volume ratio, and after 3 minutes, super The material was treated with sound waves. Diethyl ether was removed by evaporation at 55°C, and then hydrated. 100 μl of DEPC water was added to obtain a nucleic acid lipid mixture.

[0156] [Table 3]

[0157] 2.2 Boiling method: Add 100 μL of nucleic acid solution (HJT sRNA or siRNA) to 2-5 μL of lipid solution. Add to the liquid (concentration is shown in Table 1), mix, and bake at 80-100°C for 15-30 minutes. The mixture was heated to obtain a nucleic acid lipid mixture.

[0158] 3. In vitro delivery experiment of lipid nucleic acid mixture 3.1 Real-time quantitative PCR (RT-q) of intracellular expression of lipid-delivered nucleic acids PCR detection 3.1.1 MRC-5 cells (lung germ fibroblasts), A549 cells (human lung adenocarcinoma cells), Caco-2 cells (human colon adenocarcinoma cells) (Cell Resource Center of the Institute of Basic Medical Science From the Chinese Academy of Medical Sciences The purchased cells were cultured until the logarithmic growth phase, and then 6 × 10 5 Cell density of 1 mL of medium per well MRC-5 and Caco-2 cells were plated in 12-well plates at a temperature of 1°C. A549 cells were cultured in Eagle MEM medium (MEM, Gibco) and then cultured in Ham F-12 medium. The cells were cultured in soil (HyClone), then incubated overnight at 37°C, and the cells adhered to the wall. A follow-up experiment was conducted after the substance adhered to the surface.

[0159] 3.1.2 The experimental groups were as follows: 1) Naive group: This refers to untreated cells, and this group serves as a blank control group. They accomplished it.

[0160] 2) RNAimax treatment group: 2 μl Lipofectamine (trademark) RNAim ax transfection reagent (official name of Lipofectamine RNAiMAX) (Name: Invitrogen, Thermo Fisher Scientific) Mix the HJT-sRNA-m7 solution with 100 μl of Opti-MEM medium (Invitro (Purchased from gen, Thermo Fisher Scientific) The two solutions were diluted, then mixed, allowed to stand for 15 minutes, added to the cells, and then mixed. The final concentration of JT-sRNA-m7 was 100 nM. This group served as a positive control group. It fulfilled its purpose.

[0161] 3) Free uptake group: HJT-sRNA-m7 solution was added directly (final concentration was 100 nucleotides). (It was M). This group served as a negative control group.

[0162] 4) Lipid nucleic acid mixture: A mixture of the lipids prepared in step 2 and HJT-sRNA-m7. The substance was added to the cells and mixed. The final concentration of HJT-sRNA-m7 was 100 nM. Ta.

[0163] 3.1.3 After co-incubating with the cells for 12-24 hours, transfer the cells to PBS. The cells were washed twice. TRIzol lysis buffer (purchased from Sigma-Aldrich) was used to hydrate the cells. The HJT-sRNA-m7 that entered the cells was recovered using (the introduced material) and total RNA was extracted. The amount of [substance] was detected by RT-qPCR. The protocol was as follows:

[0164] 1) Extraction of total cellular RNA: A. Cells cultured in a 12-well plate (approximately 1 × 10⁻¹⁶) 6 For cells / wells Then, 1 mL of TRIzol lysis buffer was added to each well, and the wells were then placed on ice. All samples were then collected. After adding TRIzol, the mixture was allowed to stand at room temperature for 5 minutes to completely dissolve. B. Centrifuge at 12,000 rpm for 5 minutes at 4°C, discard the pellet, and then centrifuge again. Transfer TRIzol to the separation tube. C. Add chloroform at a ratio of 200 μL chloroform / mL TRIzol. Mix and let stand at room temperature for 5 minutes. D. Centrifuge at 4°C for 15 minutes at 12,000 rpm. E. Pipette the upper aqueous phase into another centrifuge tube and add 0.5 mL of isopropanol / Add isopropanol in the ratio of mL TRIzol and let stand at room temperature for 5-10 minutes. . F. Centrifuge at 4°C for 15 minutes at 12,000 rpm, discard the supernatant, and remove the RNA. This allows sediment to settle at the bottom of the tube. G. Add 1 mL of 75% ethanol, gently shake the tube, and hang the precipitate. To obscure. H. Centrifuge at 12,000 rpm for 10 minutes at 4°C, discard the supernatant, and add 1 mL of 75 Add % ethanol and gently shake the centrifuge tube to suspend the precipitate. I. Centrifuge at 12,000 rpm for 10 minutes at 4°C, discard the supernatant, and dry at room temperature. By dissolving the RNA sample in 50 μL of RNase-free H2O and measuring the OD value, Quantify the RNA concentration.

[0165] 2) The entire RNA was reverse transcribed into cDNA. Reverse transcription kit (high-volume cDNA reverse transcription kit) Using Applied Biosystems (catalog number 4368813), sRNA was reverse transcribed into cDNA using the stem-loop method (for example, stem-loop p RT-PCR, Nucleic Acids Res.2005 Nov 27;3 See 3(20):e179 for real-time quantification of microRNAs. This document is (Incorporated herein by reference). The reverse transcription system was as follows: template RNA (1 50 ng / μL) 10 μL, 10 × RT buffer 2.0 μL, 25 × dNTP mix (1 0.8 μL (00 mM), 2.0 μL U6 RT stem-loop primer, HJT-sR NA-m7 RT Stem-Loop Primer 2.0 μL, MultiScribe (trademark) ) Reverse transcriptase 1.0 μL, RNase inhibitor 1.0 μL, Nuclease-free H2O 1.2 After briefly centrifuging the μL sample, it was loaded into a PCR reactor. The reaction conditions were as follows: (1) 25℃, 10 minutes; (2) 37℃, 120 minutes; (3) 85℃, 5 minutes; ( 4) Stop the reaction at 4°C. After the reaction, add 20 μl of RNase-free ddH2O to the final volume. The product volume was set to 40 μl. The stem-loop primer used in the reverse transcription process was Beij Synthesized by ing Tsingke Biotechnology Co.,Ltd. (U6 RT primer, quantification of small RNA molecules by RT-qPCR reaction is relative Because it may only be a reference, a standard reference gene is used to calculate the relative expression level. (Using U6): GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACAAAAATATG;HJT-sRNA-m7 RT Tem-Loop Primer: GTCGTATCCAGTGCACGCTCCGAGGTAT TCGCACTGGATACGACGCTTACAA).

[0166] 3) Quantitative PCR amplification reaction: The qPCR reaction system is prepared using 5 μL of 2×SYBR green master. Mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer Imager (10 μM), 1 μl of cDNA obtained by reverse transcription, 3 μl of RNase-free dH2O It contained a total volume of 10 μl, including [the substance]. LightCycler480 fluorescence quantitative PCR The equipment was used. The PCR reaction conditions were as follows: 5 minutes at 95°C for pre-denaturation. minutes, then PCR amplification cycle: (1) 95°C for 10 seconds; (2) 55°C for 10 seconds; (3) 72°C for 20 seconds; a total of 40 cycles; finally, cool at 40°C for 10 seconds. Amplification reaction Both the forward and reverse primers are from Beijing Tsingke. Designed and synthesized by Biotechnology Co., Ltd. (U6 form Word primer: GCGCGTCGTGAAGCGTTC, U6 reverse primer: GTGCAGGGTCCGAGGT, HJT-sRNA-m7 forward primer: T CGCGCTGAGGTAGTAGGTT, HJT-sRNA-m7 reverse primer : GTGCACGCTCCGAGGT).

[0167] 4) The 2-ΔCt method (relative gene expression level = 2-(Ct target gene - Ct internal reference gene gene)) was used to calculate the relative amount of entry (single-stranded or double-stranded RNA).

[0168] 3.2 Real-time quantitative PCR (RT-qPCR) detection of mRNA expression level 3.2.1 THP-1 cells (human monocytes) were cultured until the logarithmic growth phase, and then plated in a 12-well plate at a cell density of 6×10 5 / 1 mL medium. THP-1 cells were cultured in RPMI-1640 medium (HyClone). The cells were incubated overnight at 37 °C and a tracking experiment was performed after the cells adhered to the wall.

[0169] 3.2.2 The experimental groups were as follows. [[ID=3,3]]1) Naïve group: Refers to untreated THP-1 cells, and this group served as a blank control group for this purpose.

[0170] 2) RNAiMAX treatment group: 2 μL of Lipofectamine™ RNAim ax transfection reagent (Invitrogen, Thermo Fisher Scientific) and nucleic acid solution (TNFα siRNA) were added to 100 μL of op ti-MEM medium (Invitrogen, Thermo Fisher Scient Dilute each separately with ific (a solution), then mix the two together, let stand for 15 minutes, and add to the cells. The samples were then mixed. The final nucleic acid concentration was 400 nM. This group was used as a positive control group. It fulfilled its role.

[0171] 3) Free uptake group: nucleic acid solution (TNFα siRNA) was added directly (final concentration was 4 (The level was 00 nM). This group served as a negative control group.

[0172] 4) Lipid and nucleic acid mixture: Add the lipid and nucleic acid mixture prepared in step 2 to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0173] 3.2.3 24 hours after treatment, the cells were treated with 1 μg / mL Escherichia coli (E. coli) LPS. (Lipopolysaccharide, LPS, Escherichia coli 0111) Stimulation with :B4, L4391, Sigma-Aldrich, and TRIzol 9 hours later Total RNA was extracted using a lysis buffer. TNF-α mRNA expression levels were then measured. (The target genes for the following examples, which vary on a case-by-case basis, are shown in the figure) are used in RT-qPC. The determination was made using the R (SYBR green dye method). The protocol was as follows:

[0174] 1) Extraction of total RNA from cells: The procedure is the same as the total RNA extraction method in Section 3.1.3. They were the same.

[0175] 2) The entire RNA was reverse transcribed into cDNA. Reverse transcription kit (high-volume cDNA reverse transcription kit) Using Applied Biosystems (catalog number 4368813), all RNA was reverse transcribed into cDNA. The reverse transcription system was as follows: template RNA (150 ng / μL) 10 μL, 10 × RT buffer 2.0 μL, 25 × dNTP mix (100 0.8 μL (m³), 2.0 μL random primer, MultiScribe (trademark) reverse 1.0 μL of transcriptase, 1.0 μL of RNase inhibitor, 3.2 μL of nuclease-free H2O. The mixture was briefly centrifuged and then loaded into a PCR reactor. The reaction conditions were as follows: (1) 25℃ for 10 minutes; (2) 37℃ for 120 minutes; (3) 85℃ for 5 minutes; (4) Stop the reaction at 4°C. After the reaction, add 20 μl of RNase-free ddH2O to determine the final volume. I made it 40 μl.

[0176] 3) Quantitative PCR amplification reaction: The total volume of the qPCR reaction system is 5 μL of 2×SYBR green Master mix, 0.5 μl forward primer (10 μM), 0.5 μl riba - Primer (10 μM), 1 μl of cDNA by reverse transcription, 3 μl of RNase-free It was 10 μl containing dH2O. A LightCycler480 fluorescence quantitative PCR instrument was used. It was used. The PCR reaction conditions were as follows: For pre-denaturation, 95°C for 5 minutes. Subsequently, PCR amplification cycle: (1) 95°C for 10 seconds; (2) 55°C for 10 seconds; (3) 72°C for 20 seconds; total of 40 cycles; finally, cool at 40°C for 10 seconds. The amplification reaction Both the Ward and Reverse Primers are from Beijing Qingke Biot. Designed and synthesized by echnology Co., Ltd. The primer sequence is The following was observed: Forward primer for internal reference gene UBC: CTGGAAGA TGGTCGTACCCTG, a reverse primer for the internal reference gene UBC: GGTCT TGCCAGTGAGTGTCT; Forward primer for the target gene TNF-α: CT GCCCCAATCCCTTTATT: Reverse primer for the target gene TNF-α: C CCAATTCTCTTTTTGAGCC.

[0177] 4) Relative expression levels were calculated using the 2-ΔCt method as described above.

[0178] 3.3 Western blot detection of protein expression levels 3.3.1 MRC-5 cells (lung germ fibroblasts) and A549 cells (human lung adenocarcinoma cells) ) are cultured until the logarithmic growth phase, and then 6 × 10 5 12 cells at 1 mL of medium per well - Plated in well plates. MRC-5 cells were placed in Eagle MEM medium (ME A549 cells were cultured in M ​​(Gibco) and then cultured in Ham F-12 medium (HyClone). They were then incubated overnight at 37°C, and after the cells attached to the wall, follow-up experiments were conducted. An experiment was conducted.

[0179] 3.3.2 The experimental groups were as follows: 1) Naive group: This refers to untreated cells, and this group serves as a blank control group. They accomplished it.

[0180] 2) RNAiMAX treated group: 2 μl of Lipofectamine® RNAim ax transfection reagent (Invitrogen, Thermo Fisher) Add the nucleic acid solution (Scientific) and 100 μl of opti-MEM medium (Inv Dilute with itrogen (Thermo Fisher Scientific) Then, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed. The final concentration was 400 nM. This group served as a positive control group.

[0181] 3) Free uptake group: Nucleic acid solution was added directly (final concentration was 400 nM). The group served as a negative control group.

[0182] 4) Lipid and nucleic acid mixture: Add the lipid and nucleic acid mixture prepared in step 2 to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0183] 3.3.3 24 hours after treatment, the cells were treated with a stimulant (double-stranded RNA virus mimetic). 1 μg / mL poly(I:C)(P1530, Sigma-Aldrich) or 3n The cells were stimulated with g / mL transforming growth factor TGFβ1 (Pepro Tech). After harvesting using a strong RIPA lysis buffer and incubating for a while, Western blotting was used to detect the protein expression levels of the related genes. The type of gene varies from case to case, as shown in the corresponding diagram. (REL-A tan) Protein expression levels were measured in A549 cells along with β-actin as an internal standard protein. Detected 24 hours after stimulation with (I:C), fibronectin and α-SMA Protein expression levels were compared between MRC-5 cells and GAPDH as an internal standard protein. The protein was detected 72 hours after stimulation with TGF-β1, and the corresponding knockdown gene protein was detected. Quality expression was determined using an siRNA delivery assay with β-actin as an internal standard protein. (Detected). The protocol was as follows:

[0184] 1) Collection of protein samples and determination of concentrations by BCA method. A. Discard the culture medium and add 1 mL of PBS buffer to each well of the 12-well plate. In addition, wash the cells once and add 100 μL of pre-cooled strong RIPA lysis buffer to each cell. Then, scrape the cells with a pipette tip, transfer them to a centrifuge tube, and leave on ice for 20 minutes to dissolve. Maintain it in that location. B. Centrifuge at 12,000 rpm for 10 minutes at 4°C, and transfer the supernatant to a new centrifuge tube. Move it to B. C. Thoroughly mix BCA reagents A and B (50:1, v / v) and prepare the BCA working solution. Prepare the liquid. D. Place 25 μL of freshly prepared BSA standard solution and the sample to be tested into 96 - Add to the well plate, add 200 μL of BCA working solution to each well, and mix thoroughly. Combine and incubate at 37°C for 30 minutes. E. Using an ultraviolet spectrophotometer (Synergy4 multi-function microplate reader) The absorbance at 562 nm is then measured, and the protein concentration in the sample is calculated using a standard curve. F. Ensure that the concentration of each sample is the same by using RIPA lysis buffer and loading buffer. Adjust the concentration of each sample with the solution. G. Denaturate at 95°C for 10 minutes.

[0185] 2) Western blot A. Gel preparation: Separation gel (lower layer gel) with a concentration of 10%, and a gel with a concentration of 5% A concentrated gel (upper layer gel) was used. A lane was created with 15-Welcomb, and an equal amount of protein was added. The quality was loaded into each lane. B. Protein electrophoresis: Add electrophoresis buffer and apply an initial voltage of 80V to the electrophoresis. Use. Once the bromophenol blue dye reaches the separation gel, increase the voltage to 120V. Allow the bromophenol blue dye to reach the bottom and pass through the separation gel completely. Continue gas electrophoresis. C. Wet transfer: The following order: Transfer pad (anode) - sponge - filter paper - gel - PVDF We fabricated an assembly consisting of a membrane, filter paper, sponge, and transfer pad (cathode), and then removed the assembly. Then, place the entire transfer device in a 4°C low-temperature chamber, set the constant current to 300mA, and 120 Perform a minute-long transfer. D. Blocking: After transfer, place the membrane in 3% BSA blocking solution and leave at room temperature for 1 hour. Block it. E. Primary antibody incubation: Hybridize the blocked PVDF membrane. Transfer to a smear bag containing the corresponding primary antibody (the primary antibody information was as follows). Add 3% BSA blocking solution, remove air bubbles from the bag, and incubate overnight at 4°C. To do.

[0186] [Table 4]

[0187] F. Membrane washing: Remove the PVDF membrane and wash it three times with TBST for 10 minutes each time. . G. Secondary antibody incubation: Discard TBST and apply horseradish peroxidase. (HRP) Goat anti-rabbit or goat anti-mouse secondary antibody (Hangzhou Li 3% B (purchased from anke Biotechnology Co., Ltd.) SA blocking solution (the dilution ratio of the secondary antibody was 1:5000) was added, and at room temperature 1 Allow time to incubate. H. Membrane washing: Wash the membrane three times with TBST for 10 minutes each time. I. Development: Western dermatology developer (1:1, V / V, Merck Millipor) e. Prepare the ECL chemical luminescence developer solution purchased from Millipore. Add the developed developing solution evenly to the membrane on the side where the protein is bound, then wrap it in plastic wrap. Carefully wrap the thin film and observe it after development. J. Analysis: The analysis was performed using ImageJ software.

[0188] 4. In vivo delivery experiments of lipid nucleic acid mixtures 4.1 Experimental Steps 1) Preparation of lipid nucleic acid mixture: Boiling method was used. 400 μL of HJT-sRNA-m7 (5 nmol) DEPC-treated solution of single-stranded RNA, with 9 μL or 18 μL of lipid combination (Lipid PE (number 38) & LPC (number 37) & TG (number 32), 4:2:3, V / V) The following were added to each of the two components (V), mixed, and heated at 100°C for 30 minutes.

[0189] 2) Intragastric administration of RNA to 6-8 week old male C57BL / 6J wild-type mice: HJT- An aqueous solution of sRNA-m7, or a mixture solution of lipids and HJT-sRNA-m7, is administered to the gastric tube. 400 μL / animal was administered using a nutrient needle (HJT-sRNA-m7, 5 nmol / Animals). The groups were as follows: A. Control group (naive group): Mice that received no treatment whatsoever. B. Negative control group (lipid group): 9 μL lipid combination (lipid PE (number 38) & LPC ( Intragastric administration of (number 37) & TG (number 32), 4:2:3, V / V / V), C. Free uptake group: Direct intragastric administration of HJT-sRNA-m7 single-stranded RNA solution. D. Lipid and nucleic acid mixtures: Lipid combinations and HJT-sRNA-m7 single-stranded RN Intragastric administration of mixture A.

[0190] 3) Sample collection: Three hours after intragastric administration, the entire mouse lung was dissolved with 3 mL of TRIzol. Then, it was homogenized and frozen at -80°C.

[0191] 4) Total RNA extraction: A. Add 3.0 mL of TRIzol lysis buffer to mouse lung tissue and homogenize it. It was ground and centrifuged at 12,000 rpm for 10 minutes at 4°C, but could not be homogenized. Remove tissue deposits. B. Add chloroform at a ratio of 200 μl / mL TRIzol and shake thoroughly. Mix and let stand at room temperature for 15 minutes. Centrifuged at 12,000 rpm for 15 minutes at 4°C, and the upper aqueous phase was separated into another centrifuge tube. Pipette into the pipette. D. Repeat the above steps, add an equal amount of chloroform to the upper aqueous phase, and mix thoroughly. Then, maintain at room temperature for 10 minutes. E. Centrifuge at 4°C for 15 minutes at 12,000 rpm. F. Remove the upper aqueous phase and transfer it to a new EP tube, then add 0.5g of isopropanol. Add TRIzol in a ratio of ml / mL, mix, and maintain at room temperature for 5-10 minutes. G. Centrifuge at 12,000 rpm for 15 minutes at 4°C, and discard the supernatant. H. Add 1 mL of 75% ethanol, gently shake the centrifuge tube, and allow to precipitate. To suspend something. I. Centrifuge at 12,000 rpm for 10 minutes at 4°C, and discard the supernatant. J. Dry the RNA sample at room temperature for 5-10 minutes, then dissolve it in 50 μl of DEPC-treated H2O. I understand.

[0192] 5) HJT-sRNA by RT-qPCR (SYBR Green Universal Dye Method) -m7 abundance is detected.

[0193] Unless otherwise specified, single-stranded HJT-sRNA-m7 solution is in DEPC-treated aqueous solution. This refers to single-stranded HJT-sRNA-m7. Double-stranded HJT-sRNA-m7 solution is DEP This refers to double-stranded HJT-sRNA-m7 in a C-treated aqueous solution.

[0194] [Example 1-1] Delivery of single-stranded nucleic acids into MRC-5 cells by various types of lipid combinations 1. Experimental group 1) Naive group: Untreated MRC-5 cells

[0195] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and A DEPC-treated aqueous solution of single-stranded HJT-sRNA-m7 is mixed with 100 μl of opti-MEM. Dilute each in culture medium, then mix the two together, let stand for 15 minutes, and add to the cells. The samples were then mixed. The final concentration of single-stranded HJT-sRNA-m7 was 200 nM.

[0196] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 2 (It was 00 nM).

[0197] 4) Lipid nucleic acid mixture: 3 μL of a single lipid or lipid combination treated by boiling A mixture of HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration was 200 nM.

[0198] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of monolipid to 100 μL of single-stranded HJT-sRNA-m7 solution. Chloroform solution of lipids or lipid combinations (lipid numbers 1 / 2 / 5 mg / mL concentration) 4 / 9 / 14 / 18 / 19 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / A chloroform solution of 29 / 30 / 32 and lipid number 3 with a concentration of 10 mg / mL. Chloroform solution of / 8 / 10 / 11 / 12 / 13 / 33 / 34 / 35 / 36, 1 mg / Add a chloroform solution of lipids number 6 / 15 / 16 / 17 / 31 at a concentration of mL. It was heated at 100°C for 30 minutes. a) Lipid combinations: b) MG (monoglyceride): 3 μL, lipid number 34, c) DG (Diglyceride): Equivolute chloroform of lipid numbers 1 / 2 / 3 / 19 / 35 3 μL mixture of solution, d) TG (Triglycerides): Equivolute lipid numbers 6 / 9 / 10 / 13 / 15 / 16 / 1 Chloroform on 8 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 32 / 33 3 μL mixture of solution, e) LPC (Lysophosphatidylcholine): Equivolute chloroform of lipid numbers 36 / 37 3 μL mixture of solution, f) PC (phosphatidylcholine): Equivolute chloroform solution of lipid numbers 11 / 12 3 μL mixture, g)PE (phosphatidylethanolamine): Equivolute of chlorophosphate of lipid number 8 / 38 3 μL mixture of Lum solution, h) Cer (ceramide): Mix with 3 μL of chloroform solution of lipid number 4 / 14 in an equal volume. thing, i) So: Chloroform solution of lipid numbers 17 / 30 / 31 in isovolume of sphingosine. 3 μL mixture, j) FA (fatty acids): 3 μL of lipid number 29, k) Mixture: Equivolute chloroform solution of lipid numbers 1-36 (excluding numbers 5 / 7) 3 μL mixture, l) Mixture 1: Equivolent amounts of chlorophosphate of lipids numbered 1-36 (excluding numbers 5 / 7 / 34) 3 μL mixture of Lum solution, m) Mixture 2: Equivolute lipid numbers 1-36 (including numbers 5 / 7 / 1 / 2 / 3 / 19 / 35) A 3 μL mixture of (not) chloroform solution, n) Mixture 3: Equivolute lipid numbers 1-36 (numbers 5 / 7 / 6 / 9 / 10 / 13 / 15 / Includes 16 / 18 / 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 32 / 33 A 3 μL mixture of (not) chloroform solution, o) Mixture 4: Equivolute amounts of lipids numbered 1-36 (excluding numbers 5 / 7 / 36 / 37) 3 μL mixture of lolloform solution, p) Mixture 5: Equivolute amounts of lipids numbered 1-36 (excluding numbers 5 / 7 / 11 / 12) 3 μL mixture of lolloform solution, q) Mixture 6: Equivolute chloroform of lipid numbers 1-36 (excluding numbers 5 / 7 / 8) 3 μL mixture of solution, r) Mixture 7: Equivolutes of lipids numbered 1-36 (excluding numbers 5 / 7 / 4 / 14) 3 μL mixture of roform solution, s) Mixture 8: Equivolute chlorophosphate of lipid numbers 1-36 (excluding numbers 5 / 7 / 29) A 3 μL mixture of Lum's solution.

[0199] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 200 nM. It was added to cells. Twelve hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (SY Detection was performed using the BR Green Universal Dye Method. The protocol used was "Real-ti me PCR detection of intrace llular expression of nucleic acids deliv See "Edged by lipid". All experiments were conducted in triplicate.

[0200] Conclusion: The results showed that all of the above lipid combinations resulted in increased nucleic acid delivery into cells compared to the free uptake group. It is effective in this regard (see Figure 16) and has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. It was shown that it had the following characteristics: mediated by mixture 2, mixture 3, mixture 5, and mixture 7. Nucleic acids entered MRC-5 cells in larger quantities.

[0201] [Examples 1-2] Lipid combinations for the delivery of single-stranded nucleic acids into MRC-5 and Caco-2 cells 1. Experimental group: The cells to be tested were MRC-5 cells and Caco-2 cells. 1) Naive group: Untreated cells

[0202] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. The two were separated, mixed, allowed to stand for 15 minutes, added to the cells, and then mixed. Single-stranded HJT The final concentration of -sRNA-m7 was 200 nM.

[0203] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 2 (It was 00 nM).

[0204] 4) Treatment group with monolipids and nucleic acids: 3 μL of monolipids (number) treated by boiling. A mixture of (No. 1, 8, or 12) and HJT-sRNA-m7 single-stranded nucleic acid solution is prepared. The RNA was added to the cells and mixed. The final concentration of RNA was 200 nM.

[0205] 5) Treatment group with lipid combination mixture and nucleic acid mixture: 3 μL treated by boiling. The lipid combination (equal volumes of numbers 1 / 8 / 12 mixed) and one HJT-sRNA-m7 molecule. A mixture of nucleic acid chain solutions was added to the cells and mixed. The final RNA concentration was 200 nM. .

[0206] 6) Treatment groups with lipid combinations and nucleic acid mixtures: 3 μL lipid combinations treated by boiling. Combined (2 μL of single lipid number 1, 8, or 12 and 1 μL of the following types) A mixture of lipids (MG, DG, TG, LPC, Cer, So, or FA) and HJ A mixture of T-sRNA-m7 single-stranded nucleic acid solutions was added to the cells and mixed. RNA terminal concentration The intensity was 200 nM. In Figures 17A and 17B, the treatment groups are grouped together, numbered 1 and 2. μL + Mix 1μL, No. 8 2μL + Mix 1μL, and No. 12 2μL +Mix is ​​represented as 1 μL, and within the horizontal line, MG is number 1 or number 8 for 2 μL. 1 represents a single lipid of number 12 + 1 μL of MG, and DG is 2 μL of number 1 or number 8 or 1 represents a single lipid of number 12 + 1 μL of DG, and TG is 2 μL of number 1 or number 8 or The number 12 represents a single lipid + 1 μL of TG, and the LPC is 2 μL of number 1 or number 8. Or represents a single lipid of number 12 + 1 μL of LPC, and Cer represents 2 μL of number 1 or number 8 or number 12 single lipids + 1 μL of Cer, and 2 μL of So, number 1 or number 2 The single lipid is number 8 or number 12 + 1 μL of So, and FA is 2 μL of number 1 or number 12. This represented a single lipid of number 8 or 12 + 1 μL of FA.

[0207] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of single strand HJT-sRNA-m7 solution to 100 μL of single strand HJT-sRNA-m7 solution. Lipids (chloroform solution of lipid number 1 with a concentration of 5 mg / mL, 10 mg / mL concentration) Add a chloroform solution of lipids with lipid numbers 8 / 12 (or a lipid combination) and heat at 100°C. It was heated for 30 minutes. MG (monoglyceride): 2 μL of lipid number 34, DG (Diglycerides): Equivolute chloroform solution of lipid numbers 1 / 2 / 3 / 19 / 35 2 μL mixture of TG (Triglycerides): Equivolute lipid numbers 6 / 9 / 10 / 13 / 15 / 16 / 18 / Chloroform solution of 20 / 21 / 22 / 23 / 24 / 25 / 26 / 27 / 28 / 32 / 33 2 μL mixture of liquids, LPC (Lysophosphatidylcholine): Equivolute chloroform solution of lipid numbers 36 / 37 2 μL mixture of liquids, Cer (ceramide): A mixture of 2 μL of chloroform solution of lipid number 4 / 14 in equal volume. So: (Sphingosine): Equivolute chloroform solution of lipid numbers 17 / 30 / 31 2μL mixture, FA (fatty acid): Lipid number 29 in 2 μL.

[0208] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 200 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0209] Conclusion: The result was that for MRC-5 cells, the mixture (equal volumes of cells 1 / 8 / 12) , No. 1 2μL + No. 8 1μL, No. 1 2μL + No. 12 1μL, No. 1 2μ L+MG 1μL, number 8 2μL+MG 1μL, number 12 2μL+number 8 1μL The results showed that solution 12 (2 μL + 1 μL of So) delivered nucleic acids more efficiently. .

[0210] For Caco-2 cells, use a mixture (equal volumes of cells 1 / 8 / 12), 2 μL of cell 1 + cell 8. No. 8 1 μL, No. 1 2 μL + No. 12 1 μL, No. 1 2 μL + MG 1 μL, No. Product No. 8 2μL + MG 1μL, Product No. 12 2μL + Product No. 8 1μL, Product No. 12 2μL + LPC 1μL and No. 12 2μL + So 1μL deliver nucleic acids more efficiently. Ta.

[0211] [Examples 1-3] Delivery of single-stranded nucleic acids into cells by lipid combinations Cell types: A549, MRC-5, and Caco-2 cells. 1. Experimental group: 1) Naive group: Untreated cells

[0212] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0213] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0214] 4) Treatment group with monolipids and nucleic acids: 3 μL of monolipids (number) treated by boiling. A mixture of (No. 8 or No. 12) and HJT-sRNA-m7 single-stranded nucleic acid solution is applied to the cells. The solution was added and mixed. The final RNA concentration was 100 nM.

[0215] 5) Treatment group with lipid combination PC (number 12) & PE (number 8) and nucleic acid mixture: boiling A 2.25 μL lipid combination (PC (number 12) & PE (number 8)) was treated by boiling. A mixture of 2:1 (V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution is added to the cells. The samples were then mixed. The final RNA concentration was 100 nM.

[0216] 6) Treatment group with lipid combinations and nucleic acid mixtures: 3 μL of lipids treated by boiling. Combination (2.25 μL lipid combination PC (number 12) & PE (number 8) and 0.75 μL A mixture of the following types of lipids in L: DG, TG, LPC, PC, Cer, So, or FA. A mixture of the substance and HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM. In Figure 18, the mixed treatment group was 2.25 μL. This corresponds to the processing group within the horizontal line above "+0.75μL".

[0217] 2. Experimental Procedure 1) Boiling method conditions: Add a single lipid (10 μL) to 100 μL of single-stranded HJT-sRNA-m7 solution. (A chloroform solution of lipids number 8 / 12 with a concentration of mg / mL) or a lipid combination is added. It was then heated at 100°C for 30 minutes. DG (Diglyceride): Mix with 0.75 μL of chloroform solution of lipid number 1 / 2 in an equal volume. Compound, TG (triglycerides): 0.75 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): Equivolute chloroform solution of lipid numbers 36 / 37 0.75 μL mixture of liquids, PC (lysophosphatidylcholine): 0.75 μL of chloroform solution of lipid number 12 , Cer (ceramide): 0.75 μL of chloroform solution of lipid number 4, So: (Sphingosine): 0.75 μL of chloroform solution of lipid number 31, FA (fatty acid): Lipid number 29 in 0.75 μL.

[0218] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (SY Detection was performed using the BR Green Universal Dye Method. The protocol used was "Real-ti me PCR detection of intrace llular expression of nucleic acids deliv See "Edged by lipid". All experiments were conducted in triplicate.

[0219] Conclusion: The results showed that all of the above single lipids and lipid combinations were more effective than the free uptake group. It is effective for intracellular nucleic acid delivery (see Figure 18), improving the delivery efficiency of nucleic acid drugs in clinical settings. This demonstrated that it had the potential to increase.

[0220] For A549, MRC-5, and Caco-2 cells, use 2.25 μL of PC (number 1). 2) PE (number 8) + 0.75 μL of DG (equal volume of lipid number 1 / 2 in chloroform solution) The mixture of liquids achieved the best delivery efficiency.

[0221] [Examples 1-4] Delivery of single-stranded nucleic acids into cells by lipid combinations Cell types: A549, MRC-5, and Caco-2 cells. 1. Experimental group: 1) Naive group: Untreated cells

[0222] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0223] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0224] 4) Treatment group with monolipids and nucleic acids: 3 μL of monolipids (number) treated by boiling. A mixture of (No. 8 or No. 12) and HJT-sRNA-m7 single-stranded nucleic acid solution is applied to the cells. The solution was added and mixed. The final RNA concentration was 100 nM.

[0225] 5) Lipid combinations DG (number 1), PE (number 8), and PC (number 12), and nucleic acid mixtures. Treatment group: 3 μL of lipid combination (DG (number 1) & PE (number 1)) treated by boiling. No. 8) & PC (No. 12), 1:1:1, V / V / V) and HJT-sRNA-m7 A mixture of unstranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. Ta.

[0226] 6) Treatment group with lipid combinations and nucleic acid mixtures: 3 μL of lipids treated by boiling. Combinations (2 μL lipid combination DG (number 1) & PE (number 8) & PC (number 12) and 1 μL of the following types of lipids: DG, TG, LPC, PC, Cer, So, or FA Add the mixture of (compound) and HJT-sRNA-m7 single-stranded nucleic acid solution to the cells and mix. The final concentration of RNA was 100 nM. In Figure 19, the mixed treatment group was 2 μL of lipid. Quality combination DG (number 1) & PE (number 8) & PC (number 12) + 1 μL within the upper horizontal line Corresponds to a set of processes.

[0227] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of monolipid to 100 μL of single-stranded HJT-sRNA-m7 solution. Quality (chloroform solution of lipid number 1 with a concentration of 5 mg / mL, concentration of 10 mg / mL) Add a chloroform solution of lipids with lipid numbers 8 / 12 or a lipid combination, and bake at 100°C. It was heated for 30 minutes. DG (Diglyceride): A 1 μL mixture of an equal volume of chloroform solution with lipid number 1 / 2. TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): Equivolute chloroform solution of lipid numbers 36 / 37 1 μL mixture of liquids, PC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 12, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): Lipid number 29 in 1 μL.

[0228] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 was measured by RT-qPCR (SYBR Green). Detection was performed using the universal dye method. The protocol was "Real-time quan titative PCR detection of intracellular expression of nucleic acids delivered by Please refer to "sipid". All experiments were conducted in triplicate.

[0229] Conclusion: The results show that the above lipid combination is effective in delivering nucleic acids into cells compared to the free uptake group. It is effective (see Figure 19) and has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This showed that they had been doing so.

[0230] For A549, MRC-5, and Caco-2 cells, use 2 μL of DG (number 1) & P. E (number 8) & PC (number 12) + 1 μL of TG (number 15) achieves the best delivery efficiency. did.

[0231] [Examples 1-5] Delivery of single-stranded nucleic acids into cells by lipid combinations Cell types: A549, MRC-5, and Caco-2 cells. 1. Experimental group: 1) Naive group: Untreated cells

[0232] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0233] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0234] 4) Treatment groups for monolipids and nucleic acids: 3 μL of monolipid number 8 treated by boiling. A mixture of HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of NA was 100 nM.

[0235] 5) Treatment group for lipid combination PE (number 8) & MG (number 34) and nucleic acid mixture: boiling method 2.25 μL of lipid combination (PE (number 8) & MG (number 34), 2: 1. Add a mixture of V / V and HJT-sRNA-m7 single-stranded nucleic acid solution to the cells. The mixture was then combined. The final concentration of RNA was 100 nM.

[0236] 6) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2.25 μL of lipid combination PE (number 8) & MG (number 34) and 0.75 μL The following types of lipids: DG, TG, LPC, PC, Cer, So, or mixtures of FA) A mixture of HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of NA was 100 nM. In Figure 20, the mixed treatment group was "2.25 μL [lipid The processing group within the horizontal line above "Quality combination PE (number 8) & MG (number 34) + 0.75 μL" It corresponds to.

[0237] 2. Experimental Procedure 1) Boiling method conditions: Add a single lipid (10 μL) to 100 μL of single-stranded HJT-sRNA-m7 solution. Add a chloroform solution of lipid number 8 with a concentration of mg / mL or a lipid combination. It was heated at 100°C for 30 minutes. DG (Diglyceride): Mix with 0.75 μL of chloroform solution of lipid number 1 / 2 in an equal volume. Compound, TG (triglycerides): 0.75 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): Equivolute chloroform solution of lipid numbers 36 / 37 0.75 μL mixture of liquids, PC (lysophosphatidylcholine): 0.75 μL of chloroform solution of lipid number 12 , Cer (ceramide): 0.75 μL of chloroform solution of lipid number 4, So: (Sphingosine): 0.75 μL of chloroform solution of lipid number 31, FA (fatty acid): Lipid number 29 in 0.75 μL.

[0238] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0239] Conclusion: The results showed that the above single lipids and lipid combinations were absorbed into cells more effectively compared to the free uptake group. It is effective for nucleic acid delivery (see Figure 20) and improves the delivery efficiency of nucleic acid drugs in clinical settings. This demonstrated that there was a possibility of that happening.

[0240] For A549, MRC-5, and Caco-2 cells, use 2.25 μL of PE (number 8). )&MG (number 34) + 0.75 μL of So (number 31) achieved the best delivery efficiency. .

[0241] [Examples 1-6] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated A549 cells

[0242] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0243] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0244] 4) Treatment groups with single lipids and nucleic acids: 3 μL of single lipids treated by boiling A mixture of 38 and HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0245] 5) Treatment group with lipid combinations and nucleic acid mixtures: 3 μL of lipids treated by boiling. Combination (2 μL of single lipid number 38 and 1 μL of the following types of lipids: MG, DG, T) (A mixture of G, LPC, PC, PE, Cer, So, or FA) and HJT-sRNA - A mixture of single-stranded nucleic acid solutions (m7) was added to the cells and mixed. The final RNA concentration was 100 nucleotides. It was M.

[0246] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of monolipid to 100 μL of single-stranded HJT-sRNA-m7 solution. Lipid (chloroform solution of lipid number 38 with a concentration of 10 mg / mL) or lipid combination The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): Lipid number 34 in 1 μL, DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 37, PC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 12, PE (phosphatidylethanolamine): 1 μL of chloroform solution of lipid number 8, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0247] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (SY Detection was performed using the BR Green Universal Dye Method. The protocol used was "Real-ti me PCR detection of intrace llular expression of nucleic acids deliv See "Edged by lipid". All experiments were conducted in triplicate.

[0248] Conclusion: The results show that for A549 cells, the above 2 μL of single lipid number 38 and 1 μL LPC (number 37), TG (number 15), PC (number 12), DG (number 1) are free Compared to the ingestion group, it demonstrated that it was more effective in delivering nucleic acids into cells (see Figure 21). ).

[0249] [Examples 1-7] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated A549 cells

[0250] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0251] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0252] 4) Lipid combinations DG (number 1), PE (number 38), and PC (number 12), and nucleic acid mixtures. Processing group of materials: 3 μL of lipid combination (DG (number 1) & PE (number 1)) processed by boiling. 38)&PC (number 12), 1:1:1, V / V / V) and HJT-sRNA-m7 A mixture of unstranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. Ta.

[0253] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of lipid combination DG (number 1) & PE (number 38) & PC (number 12) and 1 μL of the following types of lipids: MG, TG, LPC, PE, Cer, So, or FA mixture A mixture of the compound and HJT-sRNA-m7 single-stranded nucleic acid solution is added to the cells and mixed. The final concentration of RNA was 100 nM.

[0254] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. Mg (monoglyceride): 1 μL of lipid number 34, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 37, PE (phosphatidylethanolamine): 1 μL of chloroform solution of lipid number 8, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0255] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 was measured by RT-qPCR (SYBR Green). Detection was performed using the universal dye method. The protocol was "Real-time quan titative PCR detection of intracellular expression of nucleic acids delivered by Please refer to "sipid". All experiments were conducted in triplicate.

[0256] Conclusion: The results show that the above 2 μL lipid combination DG (number 1) & PE (number 38) & PC ( (No. 12) and 1 μL of TG (No. 15), Cer (No. 4), So (No. 31), F A (number 29), LPC (number 37), and PE (number 8) all compared to the free intake group. Therefore, it is effective in delivering nucleic acids into A549 cells (see Figure 22), and in clinical settings, nucleic acid drugs This demonstrated the potential to improve delivery efficiency.

[0257] [Examples 1-8] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated A549 cells

[0258] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0259] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0260] 4) Treatment groups of lipid combinations PE (number 38) & MG (number 34) and nucleic acid mixtures: boiling A 3 μL lipid combination (PE (number 38) & MG (number 34), 2:1) processed according to the law. A mixture of (V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution is added to the cells and mixed. The samples were combined. The final RNA concentration was 100 nM.

[0261] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of lipid combination PE (number 38) & MG (number 34) and 1 μL of the following type Lipids: DG, TG, LPC, PC, PE, Cer, So, or mixtures of FA) A mixture of HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration was 100 nM.

[0262] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 37, PC (phosphatidylcholine): 1 μL of chloroform solution of lipid number 12, PE (phosphatidylethanolamine): 1 μL of chloroform solution of lipid number 8, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0263] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. It was added to cells. 24 hours later, the amount of HJT-sRNA-m7 was measured by RT-qPCR (SYBR Green). Detection was performed using the universal dye method. The protocol was "Real-time quan titative PCR detection of intracellular expression of nucleic acids delivered by Please refer to "sipid". All experiments were conducted in triplicate.

[0264] Conclusion: The results show that all of the above lipid combinations are effective for nucleic acid delivery into cells (Figure 23). (See reference) It has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings, and the quality combination of 2 μL lipids PE (number 38) & MG (number 34) and 1 μL LPC (number 37) are best delivered. This demonstrated that the desired effect was achieved.

[0265] [Examples 1-9] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0266] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0267] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0268] 4) Treatment group of lipid combination PE (number 38) & PC (number 12) and nucleic acid mixture: boiling A 3 μL lipid combination (PE (number 38) & PC (number 12), 2:1) processed according to the law. A mixture of (V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution is added to the cells and mixed. The samples were combined. The final RNA concentration was 100 nM.

[0269] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of lipid combination PE (number 38) & PC (number 12) and 1 μL of the following type Lipids: (MG, DG, TG, LPC, PE, Cer, So, or a mixture of FA) A mixture of HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration was 100 nM.

[0270] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): Lipid number 34 in 1 μL, DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 37, PE (phosphatidylethanolamine): 1 μL of chloroform solution of lipid number 8, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): Lipid number 29 in 1 μL.

[0271] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0272] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 24). ), has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings, and 2 μL lipid combination PE ( (No. 38) &PC (No. 4) and 1 μL of Cer (No. 4) achieved the best results. This demonstrated that.

[0273] [Examples 1-10] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0274] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0275] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0276] 4) Lipid combination PE (number 38) & PC (number 12) & DG (number 1) & TG (number 1) 5) Treatment group of nucleic acid mixture: 3 μL of lipid combination (PE(number)) treated by boiling. No. 38) & PC (No. 12) & DG (No. 1) & TG (No. 15), 2:2:2:3, V A mixture of (V / V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells. The mixture was then combined. The final RNA concentration was 100 nM.

[0277] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2.2 μL of lipid combination PE (number 38) & PC (number 12) & DG (number 1) & T G (number 15) and 0.8 μL of the following types of lipids: MG, LPC, Cer, So, A mixture of (or FA) and HJT-sRNA-m7 single-stranded nucleic acid solution is administered to the cells. The solution was added and mixed. The final RNA concentration was 100 nM.

[0278] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): 0.8 μL of lipid number 34, LPC (Lysophosphatidylcholine): 0.8 μL of chloroform solution of lipid number 37 , Cer (ceramide): 0.8 μL of chloroform solution of lipid number 4, So: (Sphingosine): 0.8 μL of chloroform solution of lipid number 31, FA (fatty acid): Lipid number 29 in 0.8 μL.

[0279] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0280] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 25). (Photo), 2.2 μL of lipid combination PE (number 38) & PC (number 12) & DG (number 1) & TG (number 15), 2.2 μL of lipid combination PE (number 38) & PC (number 12) & DG (Number 1) & TG (Number 15), and 0.8 μL of LPC (Number 37) or So (Number 15) Model 31) demonstrated that it achieved relatively better delivery efficiency.

[0281] [Examples 1-11] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0282] 2) RNAimax-treated group: 2 μl RNAimax transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0283] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0284] 4) Lipid combinations PE (number 38), MG (number 34), LPC (number 37), and nucleic acids Mixture treatment group: 3 μL of lipid combination (PE (number 38) & MG) treated by boiling. (Number 34) & LPC (Number 37, 4:2:3, V / V / V) and HJT-sRNA - A mixture of single-stranded nucleic acid solutions (m7) was added to the cells and mixed. The final RNA concentration was 100 nucleotides. It was M.

[0285] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2.2 μL of lipid combination PE (number 38) & MG (number 34) & LPC (number 37)) and 0.8 μL of a mixture of the following types of lipids: DG, TG, PC, Cer, or So A mixture of the substance and HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0286] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. DG (Diglyceride): 0.8 μL of chloroform solution of lipid number 1 TG (triglycerides): 0.8 μL of chloroform solution of lipid number 15, PC (phosphatidylcholine): 0.8 μL of chloroform solution of lipid number 12, Cer (ceramide): 0.8 μL of chloroform solution of lipid number 4, So: (Sphingosine): 0.8 μL of chloroform solution of lipid number 31.

[0287] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0288] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 26). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings.

[0289] [Examples 1-12] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0290] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0291] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0292] 4) Lipid combinations PE (number 38) & PC (number 12) & Cer (number 4) and nucleic acid mixtures Treatment group of the mixture: 3 μL of lipid combination (PE (number 38) & PC () treated by boiling method Number 12)&Cer(Number 4), 4:2:3, V / V / V) and HJT-sRNA-m 7. A mixture of single-stranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. there were.

[0293] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2.2 μL of lipid combination PE (number 38) & PC (number 12) & Cer (number 4) and 0.8 μL of the following types of lipids: MG, DG, TG, LPC, So, or FA Add the mixture of (compound) and HJT-sRNA-m7 single-stranded nucleic acid solution to the cells and mix. The final concentration of RNA was 100 nM.

[0294] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): 0.8 μL of lipid number 34, DG (Diglyceride): 0.8 μL of chloroform solution of lipid number 1, TG (triglycerides): 0.8 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 0.8 μL of chloroform solution of lipid number 37 , So: (Sphingosine): 0.8 μL of chloroform solution of lipid number 31, FA (fatty acid): 0.8 μL of chloroform solution of lipid number 29.

[0295] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0296] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 27). (Photo), 2.2 μL of lipid combination PE (number 38) & PC (number 12) & Cer (number 4) Furthermore, 0.8 μL of FA (number 29) demonstrated that it achieved the best delivery effect.

[0297] [Examples 1-13] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0298] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0299] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0300] 4) Lipid combination PE (number 38) & PC (number 12) & Cer (number 4) & FA (number 29) Treatment group of nucleic acid mixture: 3 μL of lipid combination (PE( Number 38)&PC(Number 12)&Cer(Number 4)&FA(Number 29), 44:22:3 A mixture of 3:36 (V / V / V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution, The RNA was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0301] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. se (PE (number 38) & PC (number 12) & Cer (number 4) & FA (number 29) and 1 μL of a mixture of the following types of lipids and HJT-sRNA-m7 single-stranded nucleic acid solution The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0302] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): Lipid number 34 in 1 μL, DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, LPC (Lysophosphatidylcholine): 1 μL of chloroform solution of lipid number 37, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31.

[0303] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0304] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 28). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings.

[0305] [Examples 1-14] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0306] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0307] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0308] 4) Lipid combinations PE (number 38) & PC (number 12) & So (number 31) and nucleic acid mixtures Treatment group of the mixture: 3 μL of lipid combination (PE (number 38) & PC () treated by boiling method Number 12)&So(Number 31), 2:1:3, V / V / V) and HJT-sRNA-m 7. A mixture of single-stranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. there were.

[0309] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of PE (number 38) & PC (number 12) & So (number 31) and 1 μL of The following types of lipids: MG, DG, TG, LPC, Cer, or mixtures of FA) and H A mixture of JT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The concentration was 100 nM.

[0310] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, PC (phosphatidylcholine): 1 μL of chloroform solution of lipid number 12, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0311] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0312] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 29). ), 2 μL of lipid combination PE (number 38) & PC (number 12) & So (number 31) and The study showed that 1 μL of FA (number 29) achieved the best delivery effect.

[0313] [Examples 1-15] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0314] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0315] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0316] 4) Lipid combination PE (number 38) & MG (number 34) & LPC (number 37) & So (number Treatment group of No. 31) and nucleic acid mixture: 3 μL of lipid combination (PE) treated by boiling. (Number 38)&MG(Number 34)&LPC(Number 37)&So(Number 31), 44:22 A mixture of :33:36, V / V / V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution. The solution was added to the cells and mixed. The final RNA concentration was 100 nM.

[0317] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. se (2μL of PE (number 38) & MG (number 34) & LPC (number 37) & So (number 3 1) A mixture of 1 μL of the following types of lipids: DG, TG, PC, Cer, or FA. A mixture of the substance and HJT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0318] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, PC (phosphatidylcholine): 1 μL of chloroform solution of lipid number 12, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0319] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0320] Conclusion: The results showed that compared to the free uptake group, 1 μL of DG (number 1) and TG (number 15) PC (number 12), Cer (number 4), or FA (number 29), in 2 μL of PE (number 12). Adding No. 38, MG (No. 34), LPC (No. 37), and So (No. 31) will result in... This allows for efficient delivery of nucleic acids into cells (see Figure 30), enabling the delivery of nucleic acid drugs in clinical settings. It showed that it had the potential to improve efficiency. The addition of 1 μL of PC (number 12) This enabled us to achieve optimal nucleic acid delivery efficiency and enhance delivery efficiency.

[0321] [Examples 1-16] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0322] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0323] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0324] 4) Treatment groups of lipid combination PE (No. 38) & LPC (No. 37) and nucleic acid mixture: boiling 3 μL of lipid combination (PE (number 38) & LPC (number 37), 2) processed by boiling method A mixture of 1, V / V) and HJT-sRNA-m7 single-stranded nucleic acid solution is added to the cells. The mixture was then combined. The final RNA concentration was 100 nM.

[0325] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of PE (number 38) & LPC (number 37) and 1 μL of the following types of lipids) (A mixture of MG, DG, TG, PC, Cer, So, or FA) and HJT-sRN A mixture of A-m7 single-stranded nucleic acid solutions was added to the cells and mixed. The final RNA concentration was 100. It was nM.

[0326] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): Lipid number 34 in 1 μL, DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, TG (triglycerides): 1 μL of chloroform solution of lipid number 15, PC (phosphatidylcholine): 1 μL of chloroform solution of lipid number 12, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0327] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0328] Conclusion: The results show that the above lipid combination is effective in delivering nucleic acids into cells compared to the free uptake group. It is effective (see Figure 31) and has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This showed that 1 μL of TG (number 15) was mixed with 2 μL of lipid combination PE (number 38). By adding )&LPC (number 37), the best nucleic acid delivery effect was achieved.

[0329] [Examples 1-17] Delivery of single-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0330] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the single-stranded HJT-sRNA-m7 solution in 100 μl of Opti-MEM medium. After dissolving, the two were mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0331] 3) Free uptake group: Single-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0332] 4) Lipid combinations PE (number 38), LPC (number 37), TG (number 15), and nucleic acids Mixture treatment group: 3 μL of lipid combination (PE (number 38) & LP) treated by boiling. C (number 37) & TG (number 15), 32:8:5, V / V / V) and HJT-sRN A mixture of A-m7 single-stranded nucleic acid solutions was added to the cells and mixed. The final RNA concentration was 100. It was nM.

[0333] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of PE (number 38) & LPC (number 37) & TG (number 15) and 1 μL The following types of lipids: (MG, DG, PC, Cer, So, or mixtures of FA) and H A mixture of JT-sRNA-m7 single-stranded nucleic acid solution was added to the cells and mixed. The concentration was 100 nM.

[0334] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of single-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes. MG (monoglyceride): Lipid number 34 in 1 μL, DG (Diglyceride): 1 μL of chloroform solution of lipid number 1, PC (phosphatidylcholine): 1 μL of chloroform solution of lipid number 12, Cer (ceramide): 1 μL of chloroform solution of lipid number 4, So: (Sphingosine): 1 μL of chloroform solution of lipid number 31, FA (fatty acid): 1 μL of chloroform solution of lipid number 29.

[0335] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0336] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 32). ), it was shown to have the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. The combination of PE (number 38), LPC (number 37), and TG (number 15) efficiently breaks down nucleic acids. It was delivered into the cell. Other types of lipids were used in the lipid combination PE (number 38) & LPC (number 3) 7) Adding this to TG (number 15) did not enhance this effect.

[0337] [Example 2-1] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0338] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of strand HJTsRNA-m7 was 100 nM.

[0339] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0340] 4) Treatment group of monolipids and nucleic acids: 3 μL of monolipid number 38 treated by boiling. A mixture of HJT-sRNA-m7 double-stranded nucleic acid solution was added to the cells and mixed. The final concentration of NA was 100 nM.

[0341] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of single lipid number 38 and 1 μL of lipid numbers 8, 1, 2, 11, 12, 34, 37, 4, 30, 31, 29, 32, 1+2 (mixed in equal volumes), or 11+12 (mixed in equal volumes) A chloroform solution of a mixture (mixed in product) and HJT-sRNA-m7 double-stranded nucleic acid solution The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0342] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of single lipid to 100 μL of double-stranded HJT-sRNA-m7 solution. Lipid (chloroform solution of lipid number 38 with a concentration of 10 mg / mL) or lipid combination The mixture was added and heated at 100°C for 30 minutes.

[0343] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0344] Conclusion: The results show that the above single lipids and lipid combinations are effective for nucleic acid delivery into cells. (See Figure 33) This had the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This was shown. Single lipid number 38 effectively delivers nucleic acids into MRC-5 cells, and It showed an effect similar to the sfection reagent RNAiMAX. Even when other lipids were added to it, There was no further enhancement of the effect.

[0345] [Example 2-2] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0346] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0347] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0348] 4) Lipid combinations (number 38 & number 37, 2:1, V / V) and nucleic acid processing groups: boiling method A mixture of 3 μL of lipid combination and HJT-sRNA-m7 double-stranded nucleic acid solution treated by [method]. The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0349] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL lipid combination numbers 38 & 37 and 1 μL lipid combination numbers 8, 1, 2, 11) , 12, 34, 37, 4, 30, 31, 29, 32, 1+2 (mixed in equal volumes), or 1 A chloroform solution of a mixture of 1 + 12 (equal volumes) and HJT-sRNA-m7 A mixture of double-stranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. Ta.

[0350] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes.

[0351] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0352] Conclusion: The results show that the above single lipids and lipid combinations are effective for nucleic acid delivery into cells. (See Figure 34) This had the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This was shown. The lipid mixture of numbers 38 and 37 efficiently delivers nucleic acids into MRC-5 cells. Reached. Adding 1 μL of lipid to 2 μL of mixture No. 38 & No. 37 results in No. 11 Except for 34, this effect could be enhanced. In addition, surprisingly, 1 μL of lipid Adding number 32 to 2 μL of the mixture of numbers 38 and 37 yields the best results. The results were even better than those of RNAiMAX.

[0353] [Examples 2-3] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0354] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0355] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0356] 4) Lipid combination (PE (number 38) & PC (number 12) & Cer (number 4)) and nucleus Acid treatment group: 3 μL of lipid combination (PE (number 38) & PC (number 38)) treated by boiling. (No. 12)&Cer(No. 4), 4:2:3, V / V / V) and HJT-sRNA-m7 A mixture of double-stranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. .

[0357] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2.5 μL of PE (number 38) & PC (number 12) & Cer (number 4) and 0.5 μL of lipids (DG (number 2), TG (number 6), So (number 17), FA (number 29), A mixture of MG (number 34) and LPC (number 37) and HJT-sRNA-m7 A mixture of double-stranded nucleic acid solutions was added to the cells and mixed. The final concentration of RNA was 100 nM. .

[0358] 2. Experimental Procedure 1) Boiling method conditions: 3 μL of lipid combination solution in 100 μL of HJT-sRNA-m7 double-stranded solution The mixture was added and heated at 100°C for 30 minutes.

[0359] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0360] Conclusion: The results show that the above single lipids and lipid combinations are effective for nucleic acid delivery into cells. (See Figure 35) This had the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This was shown. 1 / 5 LPC (number 37) is PE (number 38) & PC (number 12) & C By adding er (number 4) to the mixture, the effect of nucleic acid delivery can be significantly enhanced. It's here. In addition, by adding DG (number 2) and TG (number 16), delivery is also possible. We were able to further enhance the effect.

[0361] [Examples 2-4] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0362] 2) RNAiMAX treatment group: 2 μl of RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0363] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0364] 4) Lipid combination (PE (number 38) & DG (number 2)) and nucleic acid processing group: Boiling method Further processed, 3 μL of lipid combination (PE (number 38) & DG (number 2), 2:1, V / V) A mixture of HJT-sRNA-m7 double-stranded nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0365] 5) Treatment groups of lipid combinations and nucleic acid mixtures: 3 μL of lipid combinations treated by boiling. (2 μL of PE (number 38) & DG (number 2) and 1 μL of other lipids number 37) (a mixture of 31, 29, 34, 12, or 4) and HJT-sRNA-m7 double-stranded nuclei A mixture of acid solutions was added to the cells and mixed. The final RNA concentration was 100 nM.

[0366] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 100°C for 30 minutes.

[0367] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR (S Detection was performed using the YBR Green Universal Dye method. The protocol used was "Real-t ime quantitative PCR detection of intrac ellular expression of nucleic acids deli See "verified by lipid". All experiments were conducted in triplicate.

[0368] Conclusion: The results show that the above single lipids and lipid combinations are effective for nucleic acid delivery into cells. (See Figure 36) This had the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This was shown. The lipid combination (2 μL of PE (number 38) & DG (number 2) mixture) was two We were able to effectively deliver the nucleic acid chain into A549 cells. Compared to this lipid combination... Then, 2 μL of PE (number 38) & DG (number 2) and number 3 were mixed in a 2:1 ratio. Lipid combinations of 7, 31, 12, or 4 could enhance delivery efficiency.

[0369] [Examples 2-5] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0370] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0371] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0372] 4) Lipid combinations (PE (number 38) & LPC (number 37), 4) processed by boiling method A mixture of 1, V / V) and HJT-sRNA-m7 double-stranded nucleic acid solution is added to the cells. The mixture was then combined. The final RNA concentration was 100 nM.

[0373] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 70°C for 30 minutes.

[0374] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0375] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 37). ), it has the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings, and transfection trials It was shown to have an effect similar to that of the drug RNAiMAX.

[0376] [Examples 2-6] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0377] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0378] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0379] 4) Lipid combination (PE (number 38) & PC (number 12), 4: 1. Add a mixture of V / V and HJT-sRNA-m7 double-stranded nucleic acid solution to the cells. The mixture was then combined. The final concentration of RNA was 100 nM.

[0380] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 70°C for 30 minutes.

[0381] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0382] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 38). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. This is better than or equal to the effect of RNAiMAX.

[0383] [Examples 2-7] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0384] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0385] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0386] 4) Lipid combination (PE (number 38) & PC (number 12) & DG) processed by boiling. (Number 2), 4:1:5, V / V / V) and double-stranded HJT-sRNA-m7 nucleic acid solution The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0387] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0388] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0389] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 39). ), it was shown to have the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. Combination (PE (number 38) & PC (number 12) & DG (number 2), 4:1:5, V / V / V) showed better efficacy than RNAiMAX in delivering double-stranded nucleic acids into A549 cells. I showed it.

[0390] [Examples 2-8] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0391] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0392] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0393] 4) Lipid combination (PE (number 38) & LPC (number 37) & D) processed by boiling method G (number 2, 32:8:5, V / V / V) and HJT-sRNA-m7 double-stranded nucleic acid lysis The liquid mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0394] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0395] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0396] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 40). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. The effect was similar to that of RNAiMAX.

[0397] [Examples 2-9] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0398] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0399] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0400] 4) Lipid combination (PE (number 8) & PC (number 12), 1:2) processed by boiling method Add a mixture of (V / V) and HJT-sRNA-m7 double-stranded nucleic acid solution to the cells and mix The samples were combined. The final RNA concentration was 100 nM.

[0401] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0402] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0403] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 41). ), it was shown to have the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. The combination (PE (number 8) & PC (number 12), 1:2, V / V) is from RNAiMAX. Furthermore, the delivery of double-stranded nucleic acids into A549 cells showed favorable effects.

[0404] [Examples 2-10] Delivery of double-stranded nucleic acids into A549 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0405] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0406] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0407] 4) Lipid combinations (PE (number 8) & LPC (number 37), 4: 1. Add a mixture of V / V and HJT-sRNA-m7 double-stranded nucleic acid solution to the cells. The mixture was then combined. The final concentration of RNA was 100 nM.

[0408] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0409] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0410] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 42). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings.

[0411] [Examples 2-11] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0412] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0413] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0414] 4) Lipid combination (PE (number 8) & PC (number 12), 1:2) processed by boiling method Add a mixture of (V / V) and HJT-sRNA-m7 double-stranded nucleic acid solution to the cells and mix The samples were combined. The final RNA concentration was 100 nM.

[0415] 5) Treatment groups of lipid combinations and double-stranded HJT-sRNA-m7 mixtures: Treatment by boiling method The lipid combination was processed as follows: 3 μL (2 μL PE (number 8) & PC (number 12) and 1 μL Other types of lipids (MG (number 34), DG (number 2), TG (number 32), LPC ( Number 37), PC (Number 11), PE (Number 38), Cer (Number 4), So (Number 31 A mixture of ), or FA (number 29)) and double-stranded HJT-sRNA-m7 nucleic acid solution The RNA was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0416] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0417] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0418] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 43). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. PE (Number 8) & PC (Number 12) can effectively deliver nucleic acids into cells, RN It showed significantly better effects than AiMAX. PE (number 8) & PC (number 12) Compare PE (number 8) & PC (number 12) and Cer (number 4) or PE (number The 2:1 ratio mixture in 38) was able to enhance this effect.

[0419] [Examples 2-12] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0420] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0421] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0422] 4) Lipid combination (PE (number 8) & PC (number 12) & DG () processed by boiling method Number 2), 8:16:3, V / V / V), and HJT-sRNA-m7 double-stranded nucleic acid solution The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0423] 5) Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 80°C for 30 minutes.

[0424] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0425] Conclusion: The results showed that the lipid combination (PE( Number 8)&PC(Number 12)&DG(Number 2), 8:16:3, V / V / V) is RNA It showed better delivery efficiency than iMAX (see Figure 44), demonstrating improved delivery efficiency of nucleic acid drugs in clinical settings. This demonstrated that it had the potential to improve [something].

[0426] [Examples 2-13] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0427] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0428] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0429] 4) Lipid combination and HJT-sRNA-m7 double-stranded nucleic acid solution treated by boiling. The mixture was added to the cells and mixed. The final RNA concentration was 100 nM. Mixture 1:PE (number 8):LPC (number 37):TG (number 32)-4:1:2 Mixture 2:PE (number 8):LPC (number 37):DG (number 2)-4:1:2 Mixture 3: PE (number 8): PC (number 12): So (number 31): FA (number 29) -1:2:1:1

[0430] 5) Experimental Procedure 1) Boiling method conditions: Add 2.5 μL of lipid to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 90°C for 15 minutes.

[0431] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0432] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 45). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. RN Compared to the AiMAX group, Mixture 1:PE (number 8):LPC (number 37):TG (number 8) 32)-4:1:2 and mixture 2:PE (number 8):LPC (number 37):DG (number 2)-4:1:2 showed equivalent delivery effect, but mixture 3:PE(number 8):PC(number 8) No. 12): So (No. 31): FA (No. 29)-1:2:1:1 has a better effect. I showed it.

[0433] [Examples 2-14] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Refers to untreated cells.

[0434] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0435] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0436] 4) Treatment groups for lipid combination mixtures and double-stranded HJT-sRNA-m7 mixtures: Boiling method Further processed, 3 μL lipid combination (PE (number 8):PC (number 12):So (number 3) 1): FA (number 29)-1:2:1:1) and HJT-sRNA-m7 double-stranded nucleic acid lysis The liquid mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0437] 5) Treatment groups of lipid combinations and double-stranded HJT-sRNA-m7 mixtures: Treatment by boiling method The lipid combination was processed in 3 μL (2 μL lipid combination mix and shown in Figure 46). 1 μL of other types of lipids, namely lipid numbers 34, 2, 32, 11, 37, 38, and A mixture of (4) and HJT-sRNA-m7 double-stranded nucleic acid solution is added to the cells. The mixture was then combined. The final RNA concentration was 100 nM.

[0438] 2. Experimental Procedure 1) Boiling method conditions: Add 3 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 90°C for 15 minutes.

[0439] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0440] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 46). ), it was shown to have the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. Material (PE (number 8): PC (number 12): So (number 31): FA (number 29) - 1:2 The 1:1 mixture showed better delivery efficacy than RNAiMAX. :PC(number 12):So(number 31):FA(number 29)-1:2:1:1) Adding to numbers 2, 38, or 4 in a 2:1 ratio results in a mixture (PE (number 8):PC ( Compared to (number 12):So(number 31):FA(number 29)-1:2:1:1), delivery We were able to enhance the effect.

[0441] [Examples 2-15] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0442] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0443] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0444] 4) Lipid combination (PE (number 8) & SO (number 31), 6:1) processed by boiling. Add a mixture of (V / V) and HJT-sRNA-m7 double-stranded nucleic acid solution to the cells and mix The samples were combined. The final RNA concentration was 100 nM.

[0445] 5) Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 90°C for 15 minutes.

[0446] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. 24 hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0447] Conclusion: The results showed that the lipid combination (PE (number 8) & So (number 31), 6:1, V / V) It showed better delivery efficacy than RNAiMAX (see Figure 47), and in clinical settings, nucleic acid drugs This demonstrated the potential to improve delivery efficiency.

[0448] [Examples 2-16] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0449] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0450] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0451] 4) Lipid combinations (PE (number 8) & So (number 31), 4:1, V / V) and HJT - Treatment group of sRNA-m7 mixture: 2 μL of lipid combination and H treated by boiling. A mixture of JT-sRNA-m7 double-stranded nucleic acid solution was added to cells and mixed. RNA terminal concentration The intensity was 100 nM.

[0452] 5) Treatment groups of lipid combinations and double-stranded HJT-sRNA-m7 mixtures: Treatment by boiling method The lipid combinations analyzed (PE (number 8) & SO (number 31), 4:1, V / V) and other Lipid types (MG (number 34), DG (number 2), LPC (number 37), PC (number 1) 2) PC (number 11), Cer (number 4), FA (number 29), or TG (number 32) (12:3:5, V / V, Figure 48) and mixture of HJT-sRNA-m7 double-stranded nucleic acid solution The mixture was added to the cells and mixed. The final RNA concentration was 100 nM.

[0453] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 90°C for 15 minutes.

[0454] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. Twelve hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0455] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 48). ), demonstrating the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. PE (Number 8): So (Number 31) (4:1, V / V) effectively delivers nucleic acids into cells. It was possible to achieve an effect similar to RNAiMAX. PE (number 8):So (number 3 1) and MG (number 34), DG (number 2), PC (number 12), PC (number 11), Alternatively, a mixture of TG (number 32) in a 12:3:5 ratio is PE (number 8):So (number 31) Compared to ), the effect of nucleic acid delivery can be enhanced, PE (number 8):So (number 31 PC (number 11) showed the best effect and was significantly better than RNAiMAX. .

[0456] [Examples 2-17] Delivery of double-stranded nucleic acids into MRC-5 cells via lipid combinations 1. Experimental group: 1) Naive group: Untreated cells

[0457] 2) RNAiMAX-treated group: 2 μl RNAiMAX transfection reagent and Dilute the double-stranded HJT-sRNA-m7 solution in 100 μl of opti-MEM medium. The two were then mixed, left to stand for 15 minutes, added to the cells, and then mixed again. The final concentration of the HJT-sRNA-m7 strand was 100 nM.

[0458] 3) Free uptake group: Double-stranded HJT-sRNA-m7 solution was added directly (final concentration was 1 (It was 00 nM).

[0459] 4) Lipid combinations (PE (number 8):Cer (number 4), 4:1, V / V) and HJT - Treatment group of sRNA-m7 mixture: 2 μL of lipid combination and H treated by boiling. A mixture of JT-sRNA-m7 double-stranded nucleic acid solution was added to cells and mixed. RNA terminal concentration The intensity was 100 nM.

[0460] 5) Treatment groups of lipid combinations and double-stranded HJT-sRNA-m7 mixtures: Treatment by boiling method The lipid combination (PE (number 8): Cer (number 4) and other types of lipids MG ( Number 34), DG (Number 2), LPC (Number 37), PC (Number 12), PC (Number 31 A mixture of ), FA (number 29), or TG (number 32), 12:3:5, V / V, Figure 4 9) The mixture of the double-stranded HJT-sRNA-m7 nucleic acid solution was added to the cells and mixed. The final concentration of RNA was 100 nM.

[0461] 2. Experimental Procedure 1) Boiling method conditions: Add 2 μL of lipid compound to 100 μL of double-stranded HJT-sRNA-m7 solution. The mixture was added and heated at 90°C for 15 minutes.

[0462] 2) Experimental conditions: The final concentration of HJT-sRNA-m7 was 100 nM. Added to cells. Twelve hours later, the amount of HJT-sRNA-m7 that entered the cells was measured by RT-qPCR. It was detected. The protocol is "Real-time quantitative PC R detection of intracellular expression See "of nucleic acids delivered by lipid". I want to do it. All experiments were conducted in sets of three.

[0463] Conclusion: The results show that the above lipid combination is effective for nucleic acid delivery into cells (see Figure 49). ), it was shown to have the potential to improve the delivery efficiency of nucleic acid drugs in clinical settings. The combination PE (number 8):Cer (number 4) effectively delivers nucleic acids into cells. It was possible and had an effect similar to RNAiMAX. PE (number 8):So (number 31), A mixture of DG (number 2), FA (number 29), or TG (number 32) in a 12:3:5 ratio. The compound enhances the effectiveness of nucleic acid delivery compared to PE (number 8):So (number 31). This was achieved, and FA (number 29) significantly improved the delivery effect of PE (number 8):So (number 31). We were able to improve performance (significantly better than RNAiMAX).

[0464] [Example 3] Lipid combinations promote nucleic acid entry into the lungs via the digestive tract. The lipid combinations were as follows: Lipid PE (number 38) & LPC (number 37) & TG (number 32), 4:2:3, V / V / V

[0465] 1. Preparation of lipid nucleic acid mixture Method: Boiling method 400 μL of HJT-sRNA-m7 (5 nmol) single-stranded RNA treated with DEPC in water. Add 9 μL or 18 μL of lipid combination (lipid PE (number 38) & LPC (number 37)) to the liquid. Add &TG (number 32, 4:2:3, V / V / V), mix, and bake at 100°C for 30 minutes. It was heated.

[0466] 2. Experiments on nucleic acid delivery via the gastrointestinal tract 6-8 week old male C57 mice were administered RNA via gastric tube feeding. HJTsRNA-m7 An aqueous solution of or a mixture of lipids and HJTsRNA-m7 is administered via a gastric tube feeding needle. The drug was administered at a dose of 00 μL / animal (HJTsRNA-m7, 5 nmol / animal). The groups were as follows: It was. (1) Control group (naive group): Mice that received no treatment whatsoever. (2) Negative control group (lipid group): 9 μL lipid combination (lipid PE (number 38) & LPC ( Administered via gastric tube nutrition in the following order: (number 37) & TG (number 32), 4:2:3, V / V / V) (3) Free uptake group: Direct administration of single-stranded HJTsRNA-m7 RNA via gastric tube feeding. , (4) Lipid and nucleic acid mixture group: Lipid combinations and single-stranded HJT-sRNA-m7 R Administration of a mixture of NA via gastric tube feeding.

[0467] Three hours after administration via gastric tube feeding, the entire lung of the mouse was dissolved with 3 mL of TRIzol. Total RNA was extracted, and the amount of HJT-sRNA-m7 was detected by RT-qPCR.

[0468] Conclusion: As shown in Figure 50, 9 μL or 18 μL of lipid combination (lipid PE( Number 38)&LPC(Number 37)&TG(Number 32), 4:2:3, V / V / V) are self Compared to the group that did not take up the substance, it significantly promoted the entry of small nucleic acid fragments into lung tissue. * is 0. (P values ​​less than 0.5). In this (non-invasive) administration via gastric tube nutrition, lipid combinations (lipids) PE (number 38) & LPC (number 37) & TG (number 32), 4:2:3, V / V / V) This can facilitate the entry of small nucleic acid fragments into lung tissue and can be used as a means of nucleic acid drug delivery. It was possible.

[0469] [Example 4] Functional experiment on intracellular delivery of double-stranded nucleic acids mediated by a lipid mixture derived from traditional Chinese medicine.

[0470] 1. Lipid mixture of numbers 8 (PE):12 (PC) (v:v=1:2) is a mixture of nucleic acids and cells. It mediated the process of entering the interior and functioning.

[0471] Experimental method: Western blot, the above "Western blot for protein expression levels" See "Detection".

[0472] 1) Lipid mixture No. 8 (PE): No. 12 (PC) (v:v=1:2) is MRC-5 It mediated the entry of anti-fibrotic double-stranded HJT-sRNA-m7 into cells.

[0473] As shown in Figure 51, by boiling and reverse-phase evaporation, number 8(PE): number 12(PC)(v:v=1:2) lipid mixture effectively delivers nucleic acids into cells and functions I was able to make it happen.

[0474] Naive group: Untreated MRC-5 cells, i.e., blank control group.

[0475] TGFβG1 group: MRC-5 cells were treated with TGFβ1 protein (final concentration of 3 ng / mL). The samples were stimulated and collected 72 hours later.

[0476] NC group: Lipid combinations of number 8 (PE): number 12 (PC) (v:v=1:2) and two A mixture of true-stranded NC mimetic cells was added to MRC-5 cells and thoroughly mixed. The final nucleic acid concentration was The concentration was 200 nM. After 24 hours, cells were tested for TGFβ1 protein (final concentration of 3 ng / mL). Samples were collected 72 hours after stimulation with TGFβ1.

[0477] M7 group: Lipid combinations of number 8 (PE): number 12 (PC) (v:v=1:2) and double-stranded A mixture with HJT-sRNA-m7 was added to MRC-5 cells and mixed. Nucleic acid terminal concentration The concentration was 200 nM. After 24 hours, cells were treated with TGFβ1 protein (3 ng / mL). The cells were stimulated with a specific concentration, and samples were collected after 72 hours.

[0478] 2) Lipid mixture No. 8 (PE): No. 12 (PC) (v:v=1:2) is A549 Fine It mediated the entry of siRNA into the vesicle.

[0479] As shown in Figures 52 and 53, by boiling, lipid number 8 (PE): number 1 2(PC)(v:v=1:2) lipid mixture effectively delivers nucleic acids into cells, We were able to knock down protein expression.

[0480] Naive group in Figure 52: Untreated cells, i.e., blank control group.

[0481] si-NC: Lipid combination of number 8 (PE): number 12 (PC) (v:v=1:2) Synthesized and distributed by si-NC (Guangzhou Ribobio Co., Ltd.) A mixture (of unknown cell class) was added to A549 cells and mixed. The final concentration was 400 nM. After 48 hours, the cells were collected and lysed with RIPA strong lysis buffer to extract the protein sample. I collected them.

[0482] Lipids of si-CPSF30::number 8(PE):number 12(PC)(v:v=1:2) The combination and the si-CPSF30 mixture were added to A549 cells and mixed. The final concentration was 400 nM. Cells were harvested after 48 hours and lysed using RIPA strong lysis buffer. The protein sample was collected after dissolution.

[0483] si-LAMP1: Lipid combination of number 8 (PE): number 12 (PC) (v:v=1:2) A mixture of and si-LAMP1 was added to A549 cells and mixed. The final concentration was 40. The concentration was 0 nM. After 48 hours, the cells were collected and lysed with RIPA strong lysis buffer. Protein samples were collected.

[0484] si-LAMP2: Lipid combination of number 8 (PE): number 12 (PC) (v:v=1:2) A mixture of 40 and si-LAMP2 was added to A549 cells and mixed. The final concentration was 40. The concentration was 0 nM. After 48 hours, the cells were collected and lysed with RIPA strong lysis buffer. Protein samples were collected.

[0485] The free uptake group shown in Figure 53: nucleic acid solution was added directly.

[0486] Lipo2000 group: 2μL Lipofectamine(trademark) 2000 transformer Infection reagents (Invitrogen, Thermo Fisher Scient ific) and si-NF-κB solutions were each mixed in 100 μL of opti-MEM medium. The solutions were diluted, mixed, maintained for 15 minutes, and then added to the cells. The final concentration of the nucleic acid solution was 40. The concentration was 0 nM. After 24 hours, the cells were stimulated with polyI:C (at a concentration of 1 μg / mL). (Then, 6 hours later, the protein sample was collected.)

[0487] Number 8 (PE): Number 12 (PC) (1:2): Number 8 (PE): Number 12 (PC) ( The 1:2 mixture was mixed with the si-NF-κB solution by heating and then added to the cells. Nucleic acid The final concentration of the solution was 400 nM. After 24 hours, cells were stimulated with polyI:C (concentration The concentration was 1 μg / mL), and the protein sample was collected 6 hours later.

[0488] Please refer to Table 2 for the types and sequences of the nucleic acids mentioned above.

[0489] 3) Lipid mixture No. 8 (PE): No. 12 (PC) (v:v=1:2) is THP-1 It mediated the entry of siRNA into cells. As shown in Figure 54, by boiling, number 8 (PE): number 12 (PC) (v Lipid mixtures (v=1:2) can effectively deliver nucleic acids into cells and enable them to function. Ta.

[0490] Naive group: Untreated cells, i.e., blank control group.

[0491] LPS group: No siRNA was used; however, LPS alone was added for stimulation. Final concentration The concentration was 1 μg / mL. RNA samples and cell supernatant were collected after 9 hours.

[0492] si-NC group: Lipid combination number 8 (PE): number 12 (PC) (v:v=1:2) A mixture of yo and si-NC was added to THP-1 cells and mixed. The final concentration was 400 nM. Yes. LPS was added at a final concentration of 1 μg / mL after 24 hours for stimulation, and the stimulation was 9 After several hours, the TRIzol lysate of the cells was collected, and the supernatant was collected for ELISA detection.

[0493] si-TNFα group: Lipid combination of number 8 (PE): number 12 (PC) (v:v=1:2) A mixture of 40 and si-TNFα was added to THP-1 cells and mixed. The final concentration was 40. The concentration was 0 nM. LPS was added after 24 hours at a final concentration of 1 μg / mL for stimulation. Nine hours after stimulation, TRIzol lysates of cells were collected, and the supernatant was taken for ELISA detection. They gathered.

[0494] 2. Number 8 (PE): Number 12 (PC): Number 2 (DG) (v:v:v=2:4:3) The lipid mixture mediated the entry and function of nucleic acids into cells.

[0495] 1) Number 8 (PE): Number 12 (PC): Number 2 (DG) (v:v:v=2:4:3) The lipid mixture mediated the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells. .

[0496] As shown in Figure 55, by boiling, numbers 8 (PE): number 12 (PC): number Lipid mixture No. 2 (DG) (v:v:v=2:4:3) contains anti-fibrotic HJTsRNA-m7 It effectively delivers this to MRC-5 cells to reduce fibronectin protein expression. I was able to do it.

[0497] 2) Number 8 (PE): Number 12 (PC): Number 2 (DG) (v:v:v=2:4:3) The lipid mixture allows XRN2 siRNA to enter A549 cells and inhibit gene expression. He facilitated the process.

[0498] As shown in Figure 56, by boiling, number 2 (DG) and number 8 (PE): Number 12 (PC): Number 20 (DG), to be added to a mixture of v:v:v=2:4:3 This allowed us to more effectively deliver nucleic acids into cells and enable them to function.

[0499] Naive group: Untreated A549 cells.

[0500] NC siRNA group: Prepared by boiling method, No. 8 (PE): No. 12 (PC): No. Cells It was added and mixed. The final concentration of nucleic acid was 400 nM.

[0501] XRN2 siRNA group: Prepared by boiling method, numbers 8 (PE): 12 (PC) Lipid mixture of number 2 (DG) (v:v:v=2:4:3) and XRN2 siRNA The mixture was added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0502] 3. Number 8 (PE): Number 12 (PC): Number 4 (Cer) (v:v:v=1:2:1 The lipid mixture mediated the entry and function of nucleic acids into cells.

[0503] 1) Number 8 (PE): Number 12 (PC): Number 4 (Cer) (v:v:v=1:2:1 ) The lipid mixture allows anti-fibrotic HJT-sRNA-m7 to enter MRC-5 cells and function. This was mediated by (boiling method).

[0504] As shown in Figure 57, by boiling, number 4 (Cer) and number 8 (PE): Lipid mixture of number 12 (PC): number 2 (DG) (v:v=1:2) with v:v:v=1: By adding it in a 2:1 ratio, anti-fibrotic HJTsRNA-m7 is introduced into MRC-5 cells. We were able to effectively deliver the protein and reduce fibronectin protein expression.

[0505] Naive group: Untreated cells.

[0506] TGF-β1 group: TGF-β1 protein is added at a final concentration of 3 ng / mL for stimulation. Furthermore, samples were collected 72 hours later.

[0507] NC group: Lipid combinations of numbers 38 (PE): 37 (LPC): 32 (TG) (v NC mimetic bodies were delivered using :v:v=32:8:5). After 24 hours, TGF-β 1. Add TGFb1 protein (final concentration of 3 ng / mL) for stimulation, and after 72 hours... Samples were collected.

[0508] m7 group: Number 8 (PE): Number 12 (PC): Number 4 (Cer) (v:v:v=1:2 A mixture of the lipid combination in 1) and double-stranded HJT-sRNA-m7 was added to MRC-5 cells. The solution was added and mixed. The final concentration of nucleic acid was 400 nM. After 24 hours, the TGF-β1 protein A chlorine-based solution (final concentration of 3 ng / mL) was added for irritation, and samples were collected after 72 hours.

[0509] 2) Number 8 (PE): Number 12 (PC): Number 4 (Cer) (v:v:v=1:2:1 The lipid mixture allows NF-κB siRNA to enter A549 cells and inhibit gene expression. This was done through a process called boiling.

[0510] As shown in Figure 58, number 4 (Cer), number 8 (PE): number 12 (PC) By adding a lipid mixture of (v:v=1:2) in a ratio of v:v:v=1:2:1, the nucleus We were able to effectively deliver acid into the cells and enable them to function.

[0511] Naive group: Untreated cells.

[0512] si-NC group: Number 8 (PE): Number 12 (PC): Number 4 (Cer) (v:v:v= A 1:2:1 lipid mixture and a mixture of si-NC and siNC are added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0513] si-NF-κB group: No. 8 (PE): No. 12 (PC): No. 4 (Cer) (v:v A mixture of lipids (v=1:2:1) and si-NF-κB siRNA was introduced into the cells. The solution was added and mixed. The final concentration of nucleic acid was 400 nM.

[0514] 4. Number 8 (PE): Number 12 (PC): Number PC (11) (v:v:v=1:2:1 The lipid mixture mediated the entry and function of nucleic acids into cells.

[0515] 1) Number 8 (PE): Number 12 (PC): Number PC (11) (v:v:v=2:4:3 The lipid mixture allows XRN2 siRNA to enter A549 cells and inhibit gene expression. It facilitated the process. As shown in Figure 59, number 11 (PC) is number 8 (PE): number 12 (PC) By adding a mixture of (v:v=1:2) in a ratio of v:v:v=1:2:1, nucleic acids can be obtained. We were able to effectively deliver and activate the substance within the cell.

[0516] Naive group: Untreated cells.

[0517] si-NC siNC group: Number 8 (PE): Number 12 (PC): Number PC (11) (v A lipid mixture (v:v=1:2:1) and a mixture of si-NC were added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0518] si-XRN2 group: number 8 (PE): number 12 (PC): number PC (11) (v:v: A mixture of lipids (v=1:2:1) and XRN2 siRNA was added to the cells, and The results were combined. The final nucleic acid concentration was 400 nM.

[0519] 5. Number 8 (PE): Number 12 (PC): Number LPC (37) (v:v:v=1:2: 1) The lipid mixture mediated the entry and function of nucleic acids into cells.

[0520] 1) Number 8 (PE): Number 12 (PC): Number LPC (37) (v:v:v=1:2: 1) The lipid mixture allows XRN2 siRNA to enter A549 cells and inhibit gene expression. It facilitated the process.

[0521] As shown in Figure 60, number 37 (LPC) is replaced by number 8 (PE), and number 12 (P C) Based on adding to a lipid mixture of (v:v=1:2) in a ratio of v:v:v=1:2:1 This allowed us to effectively deliver nucleic acids into cells and enable them to function.

[0522] Naive group: Untreated cells.

[0523] si-NC group: No. 8 (PE): No. 12 (PC): No. LPC (37) (v:v:v A lipid mixture (1:2:1) and a mixture of si-NC were added to cells and mixed. The final concentration was 400 nM.

[0524] si-XRN2 group: number 8 (PE): number 12 (PC): number LPC (37) (v:v A lipid mixture (v=1:2:1) and a mixture of XRN2 siRNA were added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0525] 6. Number 8 (PE): Number 12 (PC): Number MG (34) (v:v:v=2:3:1 The lipid mixture mediated the entry and function of nucleic acids into cells.

[0526] 1) Number 8 (PE): Number 12 (PC): Number MG (34) (v:v:v=2:3:1 The lipid mixture allows CPSF4 siRNA to enter A549 cells and inhibit gene expression. It facilitated the process.

[0527] Naive group: Untreated cells.

[0528] si-NC siNC group: No. 8 (PE): No. 12 (PC): No. MG (34) (v A lipid mixture of :v:v=2:3:1 and a mixture of si-NCsiNC were added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0529] si-CPSF4 group: Number 8 (PE): Number 12 (PC): Number MG (34) (v:v A mixture of lipids (v=2:3:1) and CPSF4 siRNA was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0530] As shown in Figure 61, numbers 8 (PE): 12 (PC): MG (34) (v:v:v=2:3:1) Lipid mixtures effectively deliver nucleic acids into cells and enable them to function. I was able to do it.

[0531] 7. Number 38 (PE): Number 37 (LPC): Number 32 (TG) (v:v:v=32: 8:5) The lipid mixture mediated the entry and function of nucleic acids into cells.

[0532] 1) Number 38 (PE): Number 37 (LPC): Number 32 (TG) (v:v:v=32: 8:5) Lipid mixtures facilitate the entry of anti-fibrotic HJT-sRNA-m7 into MRC-5 cells. It was transmitted (by boiling).

[0533] As shown in Figure 62, the m7 band was lighter in color compared to the control. The effect was not sufficient to restore the cells to an unstimulated level.

[0534] Naive group: Untreated cells, i.e., blank control group.

[0535] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0536] NC group: Lipid combinations of numbers 38 (PE): 37 (LPC): 32 (TG) (v NC mimetic was delivered using :v:v=32:8:5). After 24 hours, cells were TG The cells were stimulated with F-β1 protein (final concentration of 3 ng / mL), and samples were collected after 72 hours.

[0537] M7 group: No. 38 (PE): No. 37 (LPC): No. 32 (TG) (v:v:v=3 A mixture of the lipid combination 2:8:5 and double-stranded HJT-sRNA-m7 was used in MRC-5. The solution was added to the cells and mixed. The final concentration of nucleic acid was 400 nM. After 24 hours, the cells were treated with TGF. The cells were stimulated with -β1 protein (final concentration of 3 ng / mL), and samples were collected after 72 hours.

[0538] 2) Number 38 (PE): Number 37 (LPC): Number 32 (TG) (v:v:v=32: 8:5) The lipid mixture allows XRN2 siRNA to enter A549 cells and induce gene expression. It mediated the inhibition.

[0539] As shown in Figure 63, numbers 38 (PE): 37 (LPC): 32 (T G) (v:v:v=32:8:5) Lipid mixtures effectively deliver nucleic acids and enter cells. We were able to make it work.

[0540] si-NC group: No. 38 (PE): No. 37 (LPC): No. 32 (TG) (v:v: A lipid mixture (v=32:8:5) and a mixture of si-NC were added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0541] si-XRN2 group: Number 38 (PE): Number 37 (LPC): Number 32 (TG) (v: A mixture of lipids (v:v=32:8:5) and XRN2 siRNA was added to the cells. The samples were then mixed. The final concentration of nucleic acid was 400 nM.

[0542] 8. Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer): Number 3 1(So): Number 29(FA): Number 16(TG)(v:v:v:v:v:v:v=2: 1:2:2:3:1:3) Lipid mixtures mediate the entry and function of nucleic acids into cells. Ta.

[0543] 1) As shown in Figure 64, numbers 1 (DG): 8 (PE): 12 (PC) ): Number 4 (Cer): Number 31 (So): Number 29 (FA): Number 16 (TG) (v: v:v:v:v:v:v=2:1:2:2:3:1:3) Lipid mixture is MRC-5 cells This method mediated the entry of anti-fibrotic HJT-sRNA-m7 into the tissue (boiling method).

[0544] Naive group: Untreated cells, i.e., blank control group.

[0545] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0546] NC group: Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer): No. No. 31 (So): No. 29 (FA): No. 16 (TG) (v:v:v:v:v:v:v= NC mimetic was delivered using the lipid combination 2:1:2:2:3:1:3. 24 hours After a certain period, TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, and at 72 hours... Samples were collected a short time later.

[0547] M7 group: Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer): Number No. 31 (So): No. 29 (FA): No. 16 (TG) (v:v:v:v:v:v:v= A mixture of lipid combination 2:1:2:2:3:1:3 and double-stranded HJT-sRNA-m7. This was added to MRC-5 cells and mixed. The final nucleic acid concentration was 400 nM. 24 hours Next, TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, and the cells were treated for 72 hours. Samples were collected later.

[0548] 2) As shown in Figure 65, numbers 1 (DG): 8 (PE): 12 (PC) ): Number 4 (Cer): Number 31 (So): Number 29 (FA): Number 16 (TG) (v: v:v:v:v:v:v=2:1:2:2:3:1:3) The lipid mixture is XRN2 si RNA entered A549 cells and mediated the inhibition of gene expression (boiling method).

[0549] Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer): Number 31 ( So): Number 29 (FA): Number 16 (TG) (v:v:v:v:v:v:v=2:1: 2:2:3:1:3) Lipid mixtures effectively deliver nucleic acids, allowing them to enter cells and function. I was able to do it.

[0550] si-NC group: Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (Cer ): Number 31 (So): Number 29 (FA): Number 16 (TG) (v:v:v:v:v:v :v=2:1:2:2:3:1:3) A mixture of lipids and si-NC is attached to the cells. The mixture was added and mixed. The final concentration of nucleic acid was 400 nM.

[0551] si-XRN2 group: Number 1 (DG): Number 8 (PE): Number 12 (PC): Number 4 (C) er): Number 31 (So): Number 29 (FA): Number 16 (TG) (v:v:v:v:v :v:v=2:1:2:2:3:1:3) Lipid mixture and si-XRN2 siRNA The mixture was added to the cells and mixed. The final nucleic acid concentration was 400 nM.

[0552] 9. Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Number 4(Cer)(v:v:v:v:v=2:4:2:2:5) Lipid mixture is a nucleic acid that is intracellular It mediated the entry and functioning of the system.

[0553] 1) As shown in Figure 66, numbers 8 (PE): 12 (PC): 31 (S o): Number 29 (FA): Number 4 (Cer) (v:v:v:v:v=2:4:2:2:5 ) The lipid mixture contains anti-fibrotic HJT-sRNA and HJT-sRNA- into MRC-5 cells. 3, entry of HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRNA-m7 This was done by mediated by (boiling method).

[0554] Naive group: Untreated cells, i.e., blank control group.

[0555] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0556] NC group: Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Using lipid combination number 4 (Cer) (v:v:v:v:v=2:4:2:2:5) NC mimetic was delivered. After 24 hours, cells were treated with TGF-β1 protein (3 ng / mL). The cells were stimulated at the final concentration, and samples were collected after 72 hours.

[0557] M7 group: Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Lipid combination number 4 (Cer) (v:v:v:v:v=2:4:2:2:5) and HJT- A mixture with sRNA-m7 single strands was added to MRC-5 cells and mixed. Final nucleic acid concentration The concentration was 400 nM. After 24 hours, cells were treated with TGF-β1 protein (3 ng / mL). The cells were stimulated with a specific concentration, and samples were collected after 72 hours.

[0558] 2) As shown in Figure 67, numbers 8 (PE): 12 (PC): 31 (S o): Number 29 (FA): Number 4 (Cer) (v:v:v:v:v=2:4:2:2:5 The lipid mixture allows XRN2 siRNA to enter A549 cells and inhibit gene expression. This was done through a process called boiling.

[0559] Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Number 4 ( Cer)(v:v:v:v:v=2:4:2:2:5) Lipid mixtures effectively deliver nucleic acids into cells. We were ultimately able to deliver and make it function.

[0560] si-NC group: Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (F A): Lipid mixture of number 4 (Cer) (v:v:v:v:v=2:4:2:2:5) A mixture of bi-Si-NC was added to the cells and mixed. The final nucleic acid concentration was 400 nM. .

[0561] si-XRN2 group: Number 8 (PE): Number 12 (PC): Number 31 (So): Number 29 (FA): Lipid mixture of number 4 (Cer) (v:v:v:v:v=2:4:2:2:5) A mixture of XRN2 siRNA and XRN2 siRNA was added to the cells and mixed. The final nucleic acid concentration was 40 It was 0 nM.

[0562] 10. Lipid mixture No. 38 (PE): No. 37 (LPC) (v:v=4:1) is nucleic acid It mediated the entry of the substance into the cell and its subsequent function.

[0563] 1) As shown in Figure 68, number 38 (PE): number 37 (LPC) (v:v= 4:1) The lipid mixture contains anti-fibrotic HJT-sRNA and HJT-sR into MRC-5 cells. NA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 The entry of the virus was facilitated by the boiling method.

[0564] Naive group: Untreated cells, i.e., blank control group.

[0565] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0566] NC group: Use lipid combination number 38 (PE): number 37 (LPC) (v:v=4:1) The NC mimetic was delivered using [a specific method]. After 24 hours, cells were tested for TGF-β1 protein (3 ng / The cells were stimulated with a final concentration of mL, and samples were collected after 72 hours.

[0567] M7 group: Lipid combination of No. 38 (PE): No. 37 (LPC) (v:v=4:1) and H JT-sRNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sR A mixture with NA-m7 was added to MRC-5 cells and mixed. The final nucleic acid concentration was 400 nucleotides. The result was M. After 24 hours, the cells were injected with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0568] 2) As shown in Figure 69, number 38 (PE): number 37 (LPC) (v:v= 4:1) The lipid mixture allows XRN2 siRNA to enter A549 cells and induce gene expression. The inhibitory process was mediated (boiling method). Lipid mixture No. 38 (PE): No. 37 (LPC) (v:v=4:1) is effective against nucleic acids. We were able to deliver it to the target, allow it to enter the cell, and enable it to function.

[0569] si-NC group: Lipid mixture of No. 38 (PE): No. 37 (LPC) (v:v=4:1) A mixture of the substance and si-NC was added to the cells and mixed. The final concentration of nucleic acid was 400 nM. there were.

[0570] si-XRN2 group: Lipids of number 38 (PE): number 37 (LPC) (v:v=4:1) The mixture and the XRN2 siRNA mixture were added to the cells and mixed. Final concentration of nucleic acid It was 400 nM.

[0571] 11. Number 38 (PE): Number 12 (PC): Number 2 (DG) (v:v:v=4:1: 3) The lipid mixture mediated the entry and function of nucleic acids into cells.

[0572] As shown in Figure 70, numbers 38 (PE): 12 (PC): 2 (DG) (v:v:v=4:1:3) Lipid mixture allows XRN2 siRNA to enter A549 cells. It mediated the inhibition of gene expression by introducing the substance into the body.

[0573] Number 38 (PE) replaces number 8 (PE), and numbers 12 (PC) and 2 (DG) are also used. The lipid mixture (v:v:v=4:1:3) effectively delivers nucleic acids to enter cells. I was able to get it working.

[0574] si-NC group: No. 38 (PE): No. 12 (PC): No. 2 (DG) (v:v:v= A lipid mixture in a 4:1:3 ratio and a mixture of si-NC were added to the cells and mixed. The final concentration was 400 nM.

[0575] si-XRN2 group: number 38 (PE): number 12 (PC): number 2 (DG) (v:v: A mixture of lipids (v=4:1:3) and XRN2 siRNA was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0576] 12. Number 38 (PE): Number 37 (LPC): Number 12 (PC) (v:v:v=4: The 1:1 lipid mixture mediated the entry and function of nucleic acids into cells.

[0577] As shown in Figure 71, numbers 38 (PE): 37 (LPC): 12 (P C) (v:v:v=4:1:1) Lipid mixture: XRN2 siRNA is found in A549 cells The method involved entering the cell and inhibiting gene expression (reverse-phase transpiration).

[0578] Number 12 (PC) (v:v:v=4:1:1) to Number 38 (PE): Number 37 (LP) By adding C) (v:v=4:1) to the lipid mixture, nucleic acids can be effectively introduced into cells. We were able to deliver the substance and inhibit gene expression.

[0579] si-NC group: No. 38 (PE): No. 37 (LPC): No. 12 (PC) (v:v: A lipid mixture (v=4:1:1) and a mixture of si-NC were added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0580] siRNA group: Number 38 (PE): Number 37 (LPC): Number 12 (PC) (v:v Lipid mixture of :v=4:1:1) and XRN2 siRNA, β-actin siRNA A mixture of Ssu72 siRNA or CPSF4 siRNA is added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0581] 13. Number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 37 (LPC) (v:v:v:v=5:2:8:3) Lipid mixtures allow nucleic acids to enter cells and function. They mediated between them.

[0582] 1) As shown in Figure 72, number 4 (Cer), number 38 (PE), number 37 (LPC), by adding to the lipid mixture of number 12 (PC), number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 37 (LPC) (v:v:v:v=5:2: A lipid mixture of 8:3 is obtained, which contains anti-fibrotic HJT-sRNA, HJT-sR NA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m7 Double-stranded RNA enters MRC-5 cells and reduces fibronectin expression levels. This was done by mediated by (boiling method).

[0583] Naive group: Untreated cells, i.e., blank control group.

[0584] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0585] NC group: Number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 37 (LPC) The NC mimetic was delivered using the lipid combination (v:v:v:v=5:2:8:3). After 24 hours, TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation. The sample was collected 72 hours later.

[0586] HJT-3&a2&h3 group: No. 4 (Cer): No. 12 (PC): No. 38 (PE) : Lipid mixture of number 37 (LPC) (v:v:v:v=5:2:8:3) and HJT-s RNA-3, HJT-sRNA-a2, HJT-sRNA-h3, and HJT-sRN A mixture with A-m7 double strands was added to the cells and mixed. The final nucleic acid concentration was 400 nM. .

[0587] m7 group: Number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 37 (LPC) The lipid combination (v:v:v:v=5:2:8:3) and the mixture with HJT-sRNA-m7 The mixture was added to the cells and mixed. The final nucleic acid concentration was 400 nM.

[0588] 2) As shown in Figure 73, number 4 (Cer): number 12 (PC): number 38 ( PE): Number 37 (LPC) (v:v:v:v=5:2:8:3) Lipid mixture, XRN 2. siRNA mediated the entry of cells and the inhibition of gene expression.

[0589] si-NC group: Number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 37 ( A lipid mixture of LPC (v:v:v:v=5:2:8:3) and a mixture of si-NC. The solution was added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0590] si-XRN2 group: Number 4 (Cer): Number 12 (PC): Number 38 (PE): Number 3 Lipid mixture of 7(LPC)(v:v:v:v=5:2:8:3) and XRN2 siR A mixture of NA was added to the cells and mixed. The final nucleic acid concentration was 400 nM.

[0591] 14. Number 38 (PE): Number 2 (DG): Number 31 (So) (v:v:v=4:2: 3) The lipid mixture mediated the entry and function of nucleic acids into cells.

[0592] 1) As shown in Figure 74, numbers 38 (PE): 2 (DG): 31 (S o) (v:v:v=4:2:3) lipid mixture contains anti-fibrotic HJT-sRNA, HJT-s RNA-3, HJT-sRNA-a2, HJT-sRNA-h3, HJT-sRNA-m 7. Double-stranded RNA enters MRC-5 cells and reduces fibronectin expression levels. This was mediated by (boiling method).

[0593] Naive group: Untreated cells, i.e., blank control group.

[0594] TGF-β1 group: Cells are stimulated with TGF-β1 protein (final concentration of 3 ng / mL). The sample was collected 72 hours later.

[0595] NC group: Number 38 (PE): Number 2 (DG): Number 31 (So) (v:v:v=4:2 3) The NC mimetic was delivered using the lipid combination. After 24 hours, TG was stimulated. F-β1 protein (final concentration of 3 ng / mL) was added, and the sample was collected after 72 hours.

[0596] HJT-3&a2&h3 group: No. 38 (PE): No. 2 (DG): No. 31 (So) ( A lipid mixture of v:v:v=4:2:3, and HJT-sRNA-3, HJT-sRNA- A mixture of a2 and HJT-sRNA-h3 was added to the cells and mixed. The concentration was 400 nM.

[0597] M7 group: Lipid combination of No. 38 (PE): No. 37 (LPC) (v:v=4:1) and H A mixture with JT-sRNA-m7 was added to the cells and mixed. The final nucleic acid concentration was 400 nucleotides. It was M.

[0598] 2) As shown in Figure 75, numbers 38 (PE): 2 (DG): 31 (S o)(v:v:v=4:2:3) Lipid mixture is used by XRN2 siRNA in A549 cells. It mediated the inhibition of gene expression by entering the environment (boiling method).

[0599] Number 38 (PE): Number 2 (DG): Number 31 (So) (v:v:v=4:2:3) Fat The mixture effectively delivered and activated XRN2 siRNA into A549 cells.

[0600] si-NC group: Number 38 (PE): Number 2 (DG): Number 31 (So) (v:v:v= A lipid mixture in a 4:2:3 ratio and a mixture of si-NC were added to the cells and mixed. The final concentration was 400 nM.

[0601] si-XRN2 group: number 38 (PE): number 2 (DG): number 31 (So) (v:v: A mixture of lipids (v=4:2:3) and XRN2 siRNA was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0602] [Example 5] Verification of the effects of lipid number 41 and its composition I. Single lipids can be prepared using different methods (reverse-phase evaporation and boiling) to obtain nucleic acids (double-stranded R). NA and single-stranded RNA were delivered into the cell. Lipid number 41. Sphinganin (d22:0)

[0603] [ka]

[0604] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. As shown in Figure 76, they were prepared by different methods (boiling or reverse-phase evaporation). Lipid number 41 delivered HJT-sRNA-m7 double-stranded RNA into A549 cells. In A549 cells, the delivery effect of lipid number 41 in the boiling method is the delivery of RNAiMAX. The efficiency was approximately twice as high. Even with reverse-phase evaporation, the delivery effect of lipid number 41 was also observed in RNAiMA. The delivery effect was significantly higher than that of X.

[0605] As shown in Figure 77, they were prepared by different methods (boiling or reverse-phase evaporation). Lipid number 41 delivers HJT-sRNA-m7 double-stranded RNA into MRC-5 cells. In MRC-5 cells, when boiled, lipid number 41 is used to transport double-stranded RNA into MRC-5 cells. It was delivered into the cell. In the case of reverse-phase vaporization, the delivery effect of lipid number 41 is the delivery of RNAiMAX. It was significantly higher than the effect of the tactic.

[0606] As shown in Figure 78, lipid number 41 was obtained by boiling, HJT-sRNA-m Single-stranded RNA was delivered into A549 and MRC-5 cells.

[0607] 2. Digital PCR (ddPCR) detection of the efficiency of nucleic acid delivery by lipids 2.1 Experimental materials: A549 cells were collected at the Cell Center of the Ins titute of Basic Medical Sciences, Chines I purchased it from the Academy of Medical Sciences, TRIzo The lysis buffer was purchased from Sigma, and the high-volume cRNA reverse transcription kit was ABI, US We purchased from company A, and the digital PCR-related reagents were purchased from Bio-Rad USA.

[0608] 2.2 Experimental method: Collect all cellular RNA and lyse buffer TRIzol according to the method described above. Extracted using a liquid, reverse transcribed into cDNA using a high-volume cRNA reverse transcription kit, and different... cDNA derived from the group was subjected to a digital PCR reaction. The protocol used was QX200. Droplet Reader and QuantaSoft Software Manual The results were analyzed using QuantaSoft software. The groups were as follows: The results were as follows: (1) Naive group: Untreated A549 cells. (2) Free uptake group: Cells The cells were incubated directly with HJTsRNA-m7 dsRNA for 6 hours. 3) RNAiMAX group: A549 cells were treated with RNAiMAX to remove HJT-sRNA-m7 The samples were transfected with dsRNA and collected for detection after 6 hours. (4) Lipid No. 41 group: Lipid No. 41 prepared by different methods (boiling method or reverse-phase evaporation method) is divided into two parts. Strand RNA was delivered into A549 cells. Samples were collected for detection after 6 hours.

[0609] Experimental results and analysis: As shown in Figure 79, lipid number 41 was obtained by boiling and reverse sterilization. Both phase evaporation methods effectively deliver HJT-sRNA-m7 dsRNA into A549 cells. The substance was successfully delivered to its target. The boiling method showed better results than the reverse-phase evaporation method.

[0610] 3. Flow cytometry detection of the efficiency of nucleic acid delivery by lipids Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), FAM-sRN A (purchased from Ribobio Biotechnology Co., Ltd.), lipids Number 41, Accuri(registered trademark) C6 equipment (BD, purchased from the USA).

[0611] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid It was mixed and prepared by boiling. Then, the mixture was dropped onto A549 cells and co-inked. Six hours after incubation, the samples were collected for detection as follows: First, 3 PBS Wash once, then digest with trypsin for 3 minutes to remove the trypsin, and wash again with PBS. The cells were then blown down. Detection was performed using the Accuri(registered trademark) C6 instrument. Ta.

[0612] Experimental results shown in Figure 80: Lipid number 41 is PGY-sRNA-6 single-stranded RNA. It showed a 94.1% efficiency in delivery. This is higher than the 69.4% efficiency of the positive control RNAiMAX. It was also high. Furthermore, lipid number 41 is involved in the delivery of PGY-sRNA-6 double-stranded RNA (96%). It showed an efficiency of 7%, which was also higher than the 94.9% of the positive control RNAiMAX. Quality 41 was able to effectively deliver single-stranded and double-stranded nucleic acids into A549 cells. .

[0613] 4. Observation of the localization of nucleic acids delivered to cells by lipids using confocal fluorescence microscopy. Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), PGY-s RNA-6-Cy3(Ribobio Biotechnology Co.,Ltd. Purchased from), lipid number 41, Zeiss LSM780 (Zeiss, purchased from Germany) (Introduced), Alexa Fluor (registered trademark) 488 phalloidin (Invitrog (Purchased from the USA), DAPI (Invitrogen, purchased from the USA) Paraformaldehyde (Sigma, purchased from the USA).

[0614] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid It was mixed and prepared by boiling. Then the mixture was dropped onto A549 cells and co-incubated. Six hours after vaping, the sample was washed three times with PBS and fixed with 4% paraformaldehyde. Wash three times with PBS, then rinse with Alexa Fluor® 488 phalloidin for 30 minutes. Stain for 1 minute, wash 3 times with PBS, stain with DAPI for 5 minutes, wash with PBS, then It was sealed.

[0615] Experimental results shown in Figure 81: The entry of red PGY-sRNA-6-Cy3 is confocalized. It was clearly observable with a point microscope. Lipid number 41 is double-stranded nucleic acid in A549 cells. It was able to be delivered effectively.

[0616] 5. Western blot detection of the efficiency of nucleic acid delivery by lipids As shown in Figure 82, single lipid number 41 is sRNAi MRC-5A549 It mediated the knockdown of protein expression by entering the cell (by reversed-phase evaporation). At the protein level, protein knockdown mediated by single lipid number 41. The effect was more significant than the inhibitory effect on HJT-sRNA-m7 mediated by RNAiMAX. It was expensive.

[0617] Naive group: Untreated MRC-5A549 cells.

[0618] siNC group: A mixture of single lipid number 41 and siNC was added to cells and mixed. The final concentration of nucleic acid was 400 nM.

[0619] siNC group: Single lipid number 41 and LAMP2, XPN2, Ssu72, CPSF4 A mixture of β-actin siRNA, or β-actin siRNA, was added to the cells and mixed. Final concentration of nucleic acid It was 400 nM.

[0620] Free uptake group: The test substance was added directly.

[0621] RNAiMAX group: 2 µl RNAiMAX transfection reagents and nucleic acid solutions Dilute each in 100 µl of Opti-MEM medium, mix the two, and maintain for 15 minutes. The solution was added to the cells and then mixed. The final concentration of nucleic acid was 400 nM.

[0622] So(41) group (reverse-phase evaporation): A mixture of lipid number 41 and nucleic acids is added to cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0623] As shown in Figure 83, single lipid number 41 is an anti-fibrotic H2O2 in MRC-5 cells. The entry of JT-sRNA-m7 double strands was mediated (reverse-phase evaporation). At the protein level, HJT-sRNA-m7 inhibition mediated by single lipid number 41 was mediated by RNAiMAX. The effect was higher than that of HJT-sRNA-m7 inhibition.

[0624] TGFβ1 group: TGFβ1 protein (final concentration of 3 ng / mL) was added for stimulation. Then, samples were collected 72 hours later.

[0625] NC group: Single lipid number 41 was delivered with an NC mimetic. After 24 hours, cells were treated with TGF-β 1. Stimulate with TGFb1 protein (final concentration of 3 ng / mL) and collect samples after 72 hours. did.

[0626] HJT-3&a2&H3 group: Single lipid number 41 and HJT-sRNA-3, HJT -sRNA-α2 and a mixture of HJT-sRNA-H3 were added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0627] m7 group: A mixture of single lipid number 41 and HJT-sRNA-m7 was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0628] 6. Summary of in vivo results for lipid number 41 [Experimental Method] 6-8 week old mice, 22-24g, were fed to the Institute of Basic Med. ical Sciences of Chinese Academy of Medi They were raised in the SPF room at the Cal Sciences Animal Center. Before intragastric administration, Mau The mice were fasted for 12 hours. The mice were randomly divided into three groups: (1) control group, 400 (2) μl of DEPC-treated water administered intragastricly; (2) Free uptake group, small RNA (PGY-sRN) A-26, PGY-sRNA-32, and PGY-sRNA-23), each small RNA 1 nmol / animal, dissolved in 400 μl of DEPC-treated water, administered intragastricly; (3) Lipid number 4 Group 1: Small RNA molecules (PGY-sRNA-26 and PGY-sR) prepared by heating method A mixture of NA-32 and lipid number 41 was administered intragastricly. Each small RNA molecule was 1 nmol. / Animal, lipid number 41, 10 μl / animal, dissolved in 400 μl of DEPC-treated water. Tissue and All organ samples were collected 6 hours after intragastric administration. All small RNA molecules were 3p-termined. It was a single-stranded RNA modified by 2-O methylation.

[0629] [Experimental Results] As shown in Figure 108, lipid number 41 promotes the entry of small RNA molecules into the bloodstream. This allowed for further development and protection from degradation in the bloodstream.

[0630] As shown in Figure 109, lipid number 41 facilitates the entry of small RNA molecules into gastric cells. This promoted its breakdown and protected it from further degradation in the stomach.

[0631] As shown in Figure 110, lipid number 41 is involved in the entry of small RNA molecules into small intestinal cells. This could promote its breakdown and protect it from further degradation in the small intestine.

[0632] As shown in Figure 111, lipid number 41 promotes the entry of small RNA molecules into the liver. This allowed it to progress and protect it from breakdown in the liver.

[0633] 7. Effects of lipid combinations containing lipid number 41 on nucleic acid delivery 1) Lipid combination 1 (number 8 + number 41 = 6:1) and lipid combination for nucleic acid delivery The effect of 2 (number 38 + number 41 = 6:1).

[0634] As shown in Figure 84, lipid combination 1 (number 8 + number 41 = 6:1) and lipids Combination 2 (number 38 + number 41 = 6:1) involves the introduction of anti-fibrotic HJT-3 into MRC-5 cells. &a2&H3 mediates the entry of HJT-sRNA-m7 (heating method), HJT-sRNA- The significant inhibitory effect of m7 was mediated at the protein level.

[0635] TGF: TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, 7 The sample was collected two hours later.

[0636] NC group: NC mimetic was delivered using single lipid number 41. After 24 hours, TGF- β1 TGFb1 protein (final concentration of 3 ng / mL) was added for stimulation, and the treatment was continued for 72 hours. Samples were collected later.

[0637] HJT-3&a2&H3 group: lipid mixture, HJT-sRNA-3, HJT-sRNA -a2 and a mixture with HJT-sRNA-h3 were added to the cells and mixed. The final concentration was 400 nM.

[0638] HJT-m7 group: A mixture of lipids and HJT-sRNA-m7 was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0639] 2) Lipid combination 3 (number 39 + number 41 = 6:1) and lipid combination for nucleic acid delivery The effect of se4 (number 40 + number 41 = 6:1).

[0640] As shown in Figure 85, lipid combination 3 (number 39 + number 41 = 6:1) and lipid Quality combination 4 (number 40 + number 41 = 6:1) is anti-fibrotic HJT- into MRC-5 cells. 3&a2&H3 mediates the entry of HJT-sRNA-m7 (heating method), HJT-sRNA -m7's significant inhibitory effect was mediated at the protein level.

[0641] TGF: TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, 7 The sample was collected two hours later.

[0642] NC group: NC mimetic was delivered using single lipid number 41. After 24 hours, TGF- β1 protein (final concentration of 3 ng / mL) was added for stimulation, and the sample was collected after 72 hours. They gathered.

[0643] HJT-3&a2&H3 group: lipid mixture, HJT-sRNA-3, HJT-sRNA -a2 and a mixture with HJT-sRNA-H3 were added to the cells and mixed. The final concentration was 400 nM.

[0644] A mixture of HJT-m7 lipids and HJT-sRNA-m7 was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0645] 3) Lipid combination 5 for nucleic acid delivery (numbers 38+12+41+29=1:2:1:1 The effect of ).

[0646] As shown in Figure 86, lipid combination 5 (numbers 38+12+41+29=1:2: 1:1) Anti-fibrotic HJT-3, α2, and HJT-sR into MRC-5 cells It mediates the entry of NA-m7 (heating method) and has a significant inhibitory effect on HJT-sRNA-m7. It was transmitted at the protein level.

[0647] TGF: TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, 7 The sample was collected two hours later.

[0648] NC group: NC mimetic was delivered using single lipid number 41. After 24 hours, TGF- β1 protein (final concentration of 3 ng / mL) was added for stimulation, and the sample was collected after 72 hours. They gathered.

[0649] HJT-3&a2&H3 group: lipid mixture, HJT-sRNA-3, HJT-sRNA -a2 and a mixture with the HJT-sRNA-H3 mixture were added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0650] A mixture of HJT-m7 lipids and HJT-sRNA-m7 was added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0651] 4) Lipid combination 6 for nucleic acid delivery (number 40 (PE) + number 12 (PC) + number 4 The effect of 1(So) = 2:4:3).

[0652] As shown in Figure 87, lipid combination 6 (number 40 (PE) + number 12 (PC) + Number 41 (So) = 2:4:3) is anti-fibrotic HJT-3&a2& into MRC-5 cells. H3 mediates the entry of HJT-sRNA-m7 (boiling method and reverse-phase evaporation method), HJT-s The significant inhibitory effect of RNA-m7 was mediated at the protein level.

[0653] TGF: TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, 7 The sample was collected two hours later.

[0654] 3'-NC group: Using lipid number 41, NC mimetic was delivered, and after 24 hours, TGF- β1 TGFb1 protein (final concentration of 3 ng / mL) was added for stimulation, and the treatment was continued for 72 hours. Samples were collected later.

[0655] 3'-3&a2&H3 group: lipid mixture, HJT-sRNA-3, HJT-sRNA- A mixture of a2 and HJT-sRNA-H3 was added to the cells and mixed. The final nucleic acid concentration was It was 400 nM.

[0656] 3'-m7: Add the lipid mixture and the HJT-sRNA-m7 mixture to the cells and mix The results were combined. The final nucleic acid concentration was 400 nM.

[0657] Figure on the right: Lipid-RNA mixtures were prepared by reverse-phase evaporation. Lipid combination 6 (number 40) (PE) + number 12 (PC) + number 41 (So) = 2:4:3) is XRN2, Ssu7 2. We were able to effectively deliver CPSF4 siRNA into A549 cells. This significantly reduces the expression level at the protein level.

[0658] siNC: A mixture of lipids and siNC was added to the cells and mixed. End of nucleic acid The concentration was 400 nM.

[0659] siRNA: A mixture of lipids and XRN2, Ssu72, and CPSF4 siRNAs. The substance was added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0660] 5) Lipid combination 7 (number 12 (PC) + number 41 (So) = 6:1) for nucleic acid delivery ) and the effect of lipid combination 8 (number 12 (PC) + number 41 (So) = 6:1).

[0661] As shown in Figure 88, by reverse-phase evaporation, lipid combination 7 (number 12(PC)+ Number 41 (So) = 6:1) and lipid combination 8 (Number 12 (PC) + Number 41 (So)) (6:1) effectively delivers Ssu72, CPSF4 siRNA into A549 cells. This resulted in a significant reduction in protein expression levels.

[0662] siNC: A mixture of lipids and siNC was added to the cells and mixed. End of nucleic acid The concentration was 400 nM.

[0663] siRNA: A mixture of lipids and XRN2, Ssu72, and CPSF4 siRNAs. The substance was added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0664] 6) Lipid combination 9 (number 12 (PC) + number 41 (So) = 6:1) for nucleic acid delivery ) and lipid combination 10 (number 40 (PE) + number 12 (PC) + number 41 (So) = 2 The effect of :2:2).

[0665] As shown in Figure 89, by reverse-phase evaporation, lipid combination 9 (number 12 (PC) + Number 41 (So) = 6:1) and lipid combination 10 (Number 40 (PE) + Number 12 (PC) ) + number 41(So)=2:2:2) is XRN2, Ssu72, CPSF4 siRN A can be effectively delivered into A549 cells, and the expression level at the protein level can be increased. This was significantly reduced.

[0666] siNC: A mixture of lipids and siNC was added to the cells and mixed. End of nucleic acid The concentration was 400 nM.

[0667] siRNA: A mixture of lipids and XRN2, Ssu72, and CPSF4 siRNAs. The substance was added to the cells and mixed. The final concentration of nucleic acid was 400 nM.

[0668] 7) Lipid combination 11 for nucleic acid delivery (number 4 (Cer) + number 12 (PC) + number The effect of 41(So)=1:1:1).

[0669] As shown in Figure 90, lipid combination 11 (number 4(Cer)) was obtained by reverse-phase evaporation. +Number 12 (PC) +Number 41 (So) = 1:1:1) is Ssu72 siRNA A It can be effectively delivered into 549 cells, and the expression level at the protein level is significant. It was reduced to [a certain value].

[0670] siNC: A mixture of lipids and siNC was added to the cells and mixed. End of nucleic acid The concentration was 400 nM.

[0671] siSsu72: A mixture of lipids and Ssu72 siRNA is added to the cells. The mixture was then combined. The final concentration of nucleic acid was 400 nM.

[0672] [Example 6] Verification of the effects of lipid number 38 and its combinations. Lipid number 38PE (16:0 / 16:1)

[0673] [ka]

[0674] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. (1) Lipid number 38 obtained by boiling is converted into double-stranded RNA in A549 and MRC-5 cells. It was delivered to [destination].

[0675] As shown in Figure 91, lipid number 38 obtained by heating converts double-stranded RNA to A549 And it was delivered into MRC-5 cells. In MRC-5 cells, when heated, double-stranded RN The delivery effect of lipid number 38 to A was approximately twice that of RNAiMAX.

[0676] 1) Naive group: Untreated A549 cells.

[0677] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell along with 12 The sample was incubated for 2 hours. The final nucleic acid concentration was 100 nM.

[0678] 3) RNAiMAX group: 2 μl RNAiMAX transfection reagent and two vials The HJT-sRNA-m7 chain solution was diluted in 100 μl of Opti-MEM medium. Then, the two were mixed, allowed to stand for 15 minutes, added to the cells, and then mixed. HJT- The final concentration of sRNA-m7 double-stranded sRNA was 100 nM.

[0679] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 38 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions is prepared by boiling or reverse-phase evaporation, and then A54 It was added to 9 cells. The final concentration of RNA was 100 nM. After 12 hours, the samples were collected. The amount of ingress was detected.

[0680] (2) Lipid number 38 obtained by boiling is HJT-sRNA-m7 single-stranded RNA, A54 It was delivered into cells 9 and MRC-5. As shown in Figure 92, lipid number 38 obtained by the heating method is HJT-sRNA-m7 Single-stranded RNA was delivered into A549 and MRC-5 cells. Delivery efficiency was determined by RNAiM. Its delivery efficiency was far superior to that of AX.

[0681] 1) Naive group: Untreated A549 cells.

[0682] 2) Free uptake group: HJT-sRNA-m7 single-stranded RNA was directly taken up by the cell along with 12 The sample was incubated for 2 hours. The final nucleic acid concentration was 100 nM.

[0683] 3) RNAiMAX group: 2 μl RNAiMAX transfection reagent and one vial The HJT-sRNA-m7 chain solution was diluted in 100 μl of Opti-MEM medium. Then, the two were mixed, maintained for 15 minutes, added to the cells, and then mixed. Single-stranded H The final concentration of JT-sRNA-m7 was 100 nM.

[0684] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 64 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions is prepared by boiling or reverse-phase evaporation, and then A54 It was added to 9 cells. The final concentration of RNA was 100 nM. After 12 hours, the samples were collected. The amount of ingress was detected.

[0685] 2. Digital PCR (ddPCR) detection of the efficiency of nucleic acid delivery by lipids 2.1 Experimental materials: A549 cells were collected at the Cell Center of the Ins titute of Basic Medical Sciences, Chines I purchased it from the Academy of Medical Sciences, TRIzo The lysis buffer was purchased from Sigma, and the high-volume cRNA reverse transcription kit was ABI, US We purchased from company A, and the digital PCR-related reagents were purchased from Bio-Rad USA.

[0686] 2.2 Experimental method: Collect all RNA and add it to TRIzol lysis buffer according to the method described above. Further extraction was performed, and the cRNA was reverse transcribed into cDNA using a high-volume cRNA reverse transcription kit, and different groups were selected. cDNA derived from [source] was subjected to a digital PCR reaction. The protocol used was QX200 D Refer to the roplet Reader and QuantaSoft software manuals. The results were analyzed using QuantaSoft software.

[0687] (1) Naive group: A549 cells that have not received any treatment.

[0688] (2) Free uptake group: Cells were directly taken up with HJT-sRNA-m7 dsRNA. Time incubation was performed.

[0689] (3) RNAiMAX group: HJT-sRNA-m7 dsRNA is converted to RNAiMAX The cells were then transfected into A549 cells, and the samples were collected for detection after 6 hours.

[0690] (4) Group 38: Lipid number 38 is prepared by different methods (boiling method or reverse-phase evaporation method) Double-stranded RNA was then delivered into A549 cells. After 6 hours, the samples were collected for detection. Ta.

[0691] Experimental results and analysis: As shown in Figure 93, the boiling method or reverse-phase evaporation method removed fat. Product number 38 effectively delivers HJTsRNA-m7 dsRNA into A549 cells. I was able to do it.

[0692] 3. Flow cytometry detection of the efficiency of nucleic acid delivery by lipids Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), FAM-sRN A (purchased from Ribobio Biotechnology Co., Ltd.), fat Quality number 38, Accuri(registered trademark) C6 equipment (BD, purchased from the USA).

[0693] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid The mixture was then prepared as a lipid-sRNA mixture by boiling. After dropping the solution onto the cells and co-incubating for 6 hours, collect the sample and wash it three times with PBS. Subsequently, the cells were digested with trypsin, washed, resuspended in PBS, and then Accurated. It was blown down for detection using the i(registered trademark)C6 device.

[0694] Experimental results (shown in Figure 94): Lipid number 38 was converted to PGY-s with an efficiency of 72.5%. RNA-6 single-stranded RNA was delivered. This was close to the efficiency of the positive control RNAiMAX. .

[0695] 4. Confocal fluorescence microscopy for observing the location of nucleic acids delivered to cells by lipids. Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), PGY-s RNA-6-Cy3(Ribobio Biotechnology Co.,Ltd. Purchased from), lipid number 38, Zeiss LSM780 (Zeiss, purchased from Germany) (Introduced), Alexa Fluor (registered trademark) 488 phalloidin (Invitrog (Purchased from the USA), DAPI (Invitrogen, purchased from the USA) Paraformaldehyde (Sigma, purchased from the USA).

[0696] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid It was mixed and prepared by boiling. Then the mixture was dropped onto A549 cells and co-incubated. Six hours after vaping, the sample was washed three times with PBS and fixed with 4% paraformaldehyde. Wash three times with PBS, then rinse with Alexa Fluor® 488 phalloidin for 30 minutes. Stain for 1 minute, wash 3 times with PBS, stain with DAPI for 5 minutes, wash with PBS, then densely It was sealed.

[0697] Experimental results (shown in Figure 95): The entry of red PGY-sRNA-6-Cy3, It was clearly observed with a confocal microscope. The lipid number 38-sRNA mixture was double-stranded. We were able to effectively deliver nucleic acids into A549 cells.

[0698] [Example 7] Verification of the effects of lipid number 64 and its composition Lipid number 64PE (15:0 / 24:1 (15Z))

[0699] [ka]

[0700] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. (1) Lipid number 64 prepared by different methods (boiling method or reverse-phase evaporation method) HJ T-sRNA-m7 double-stranded RNA was delivered into A549 cells.

[0701] As shown in Figure 96, lipid 64 can be prepared using different methods (boiling or reverse-phase evaporation). HJT-sRNA-m7 double-stranded RNA was delivered into A549 cells using the following method. A54 In 9 cells, the delivery effect of lipid number 64 by boiling was approximately the same as the delivery effect of RNAiMAX. It was three times.

[0702] 1) Naive group: Untreated A549 cells.

[0703] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell along with 12 The sample was incubated for 2 hours. The final nucleic acid concentration was 100 nM.

[0704] 3) RNAiMAX group: 2 μl RNAiMAX transfection reagent and two vials The HJT-sRNA-m7 chain solution was diluted in 100 μl of Opti-MEM medium. The mixture was mixed, maintained for 15 minutes, added to the cells, and then mixed again. HJT-sRNA-m7 The final concentration of the double-stranded molecule was 100 nM.

[0705] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 64 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions is prepared by boiling or reverse-phase evaporation, and then A54 It was added to 9 cells. The final concentration of RNA was 100 nM. After 12 hours, the samples were collected. The amount of ingress was detected.

[0706] 2. Flow cytometry detection of the efficiency of nucleic acid delivery by lipids Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), FAM-sRN A (purchased from Ribobio Biotechnology Co., Ltd.), lipids Number 64, Accuri(registered trademark) C6 equipment (BD, purchased from the USA).

[0707] Experimental method: Dissolve FAM-sRNA in 100 μl of water, mix with 4 μl of lipid, and boil. It was prepared by boiling. Then, the lipid-sRNA mixture was dropped into A549 cells and co-inked. Six hours after incubation, the sample was collected, washed three times with PBS, and then isolated with trypsin. The cells are digested, resuspended in PBS, and then detected using the Accuri(registered trademark) C6 instrument. It blew down to do so.

[0708] Experimental results (shown in Figure 97): Lipid number 64 is the efficiency of the positive control RNAiMAX. PGY-sRNA-6 single-stranded RNA was delivered with approximately half (1 / 2) the efficiency.

[0709] 3. Confocal fluorescence microscopy for observing the location of nucleic acids delivered to cells by lipids. Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), PGY-s RNA-6-Cy3(Ribobio Biotechnology Co.,Ltd. Purchased from), lipid number 64, Zeiss LSM780 (Zeiss, purchased from Germany) (Introduced), Alexa Fluor (registered trademark) 488 phalloidin (Invitrog (Purchased from the USA), DAPI (Invitrogen, purchased from the USA) Paraformaldehyde (Sigma, purchased from the USA).

[0710] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid It was mixed and prepared by boiling. Then the mixture was dropped onto A549 cells and co-incubated. Six hours after vaping, the sample was washed three times with PBS and fixed with 4% paraformaldehyde. Wash three times with PBS, then rinse with Alexa Fluor® 488 phalloidin for 30 minutes. Stain for 1 minute, wash 3 times with PBS, stain with DAPI for 5 minutes, wash with PBS, then densely It was sealed.

[0711] Experimental results (shown in Figure 98): The entry of red PGY-sRNA-6-Cy3, It was clearly observed with a confocal microscope. Lipid number 64 is single-stranded RNA A549 It was able to be effectively delivered into the cells.

[0712] [Example 8] Verification of the effects of lipid number 40 and its composition Lipid number 40PE (16:0 / 22:1)

[0713] [ka]

[0714] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. (1) Lipid number 40 prepared by different methods (boiling method or reverse-phase evaporation method) The RNA strand was delivered into A549 cells.

[0715] As shown in Figure 99, they were prepared by different methods (boiling or reverse-phase evaporation). Lipid number 40 delivered double-stranded RNA into A549 cells. In A549 cells, the reverse In the case of phase evaporation, the delivery effect of lipid number 40 is about half that of RNAiMAX (1 / 2) was the case.

[0716] 1) Naive group: Untreated A549 cells.

[0717] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell along with 12 The sample was incubated for 2 hours. The final RNA concentration was 100 nM.

[0718] 3) RNAiMAX group: 2 μL RNAiMAX transfection reagent and two bottles The HJT-sRNA-m7 chain solution was diluted in 100 μL of Opti-MEM medium. Then, the two were mixed, maintained for 15 minutes, added to the cells, and then mixed again. HJT- The final concentration of sRNA-m7 double-stranded sRNA was 100 nM.

[0719] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 40 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions was prepared by boiling or reverse-phase evaporation, and A549 cells were prepared. It was added to [the sample]. The final concentration of RNA was 100 nM. After 12 hours, the sample was collected and [extracted]. The amount of [substance] was detected.

[0720] 2. Digital PCR (ddPCR) detection of the efficiency of nucleic acid delivery by lipids 2.1 Experimental materials: A549 cells were collected at the Cell Center of the Ins titute of Basic Medical Sciences, Chines I purchased it from the Academy of Medical Sciences, TRIzo The lysis buffer was purchased from Sigma and TaqMan(trademark) MicroRNA Re Verse Transcription KitHigh is Thermo Fish I purchased the digital PCR-related reagents from er Technology, and they are from Bio-Rad. I bought it.

[0721] 2.2 Experimental method: Collect all RNA and add it to TRIzol lysis buffer according to the method described above. Extracted from TaqMan™ MicroRNA Reverse Transcr Using the iption KitHigh, we reverse-transcribed the data into cDNA and extracted samples from different groups. The cDNA was subjected to a digital PCR reaction. The protocol used was QX200 Drople. Refer to the Reader and QuantaSoft software manuals; see Q for results. The analysis was performed using uantaSoft software.

[0722] (1) Naive group: A549 cells that have not received any treatment.

[0723] (2) Free uptake group: Cells were directly taken up with HJT-sRNA-m7 dsRNA. Time incubation was performed.

[0724] (3) RNAiMAX group: HJT-sRNA-m7 dsRNA is converted to RNAiMAX The cells were then transfected into A549 cells, and the samples were collected for detection after 6 hours.

[0725] (4) Group 40: Lipids with number 4 prepared by different methods (boiling method or reverse-phase evaporation method) Agent 0 delivered double-stranded RNA into A549 cells. Samples were collected for detection 6 hours later. did.

[0726] Experimental results and analysis: As shown in Figure 100, in the boiling method or the reverse-phase evaporation method, Lipid number 40 effectively delivers HJT-sRNA-m7 dsRNA into A549 cells. I was able to reach it.

[0727] 3. Confocal fluorescence microscopy for observing the location of nucleic acids delivered to cells by lipids. Experimental materials: A549 cells (Cell Center of the Chinese (Purchased from the Academy of Medical Sciences), PGY-s RNA-6-Cy3(Ribobio Biotechnology Co.,Ltd. Purchased from), lipid number 40, Zeiss LSM780 (Zeiss, purchased from Germany) (Introduced), Alexa Fluor (registered trademark) 488 phalloidin (Invitrog (Purchased from the USA), DAPI (Invitrogen, purchased from the USA) Paraformaldehyde (Sigma, purchased from the USA).

[0728] Experimental method: Dissolve PGY-sRNA-6-FAM in 100 μl of water and add 4 μl of lipid It was mixed and prepared by boiling. Then the mixture was dropped onto A549 cells and co-incubated. Six hours after vaping, the sample was washed three times with PBS and fixed with 4% paraformaldehyde. Wash three times with PBS, then rinse with Alexa Fluor® 488 phalloidin for 30 minutes. Stain for 1 minute, wash 3 times with PBS, stain with DAPI for 5 minutes, wash with PBS, then densely It was sealed.

[0729] Experimental results (shown in Figure 101): The entry of PGY-sRNA-6-Cy3 (indicated in red) This could be clearly observed with a confocal microscope. Lipid number 40 is single-stranded RNA A54 We were able to effectively deliver the drug into 9 cells.

[0730] 4. Western blotting detection of the efficiency of nucleic acid delivery by lipids As shown in Figure 102, phosphatidylethanolamine monolipid number 40 is The anti-fibrotic double-stranded RNA HJTsRNA-m7 enters the MRC-5 cell, It mediated the downregulation of bronnectin protein expression.

[0731] TGF: TGF-β1 protein (final concentration of 3 ng / mL) was added for stimulation, 7 The sample was collected two hours later.

[0732] 3'-NC group: NC mimetic cells were delivered using a lipid mixture, and after 24 hours, cells underwent TGF treatment. - The cells were stimulated with β1 protein (final concentration was 3 ng / mL), and samples were collected after 72 hours. did.

[0733] 3'-m7 group: Lipid mixture and HJT-sRNA-m7 double-stranded nucleic acid solution are attached to the cells. The mixture was added and mixed. The final concentration of nucleic acid was 400 nM.

[0734] [Example 8] Verification of the effects of lipid number 37 Lipid number 37LPC(18:3)

[0735] [ka]

[0736] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. (1) Lipid number 37 was obtained by boiling single-stranded RNA in A549 and MRC-5 cells. It was delivered internally.

[0737] As shown in Figure 103, single-stranded RNA is broken down by boiling, and A549 and MR It was delivered into the C5 cell.

[0738] 1) Naive group: Untreated A549 cells.

[0739] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell at 3 hours. The samples were incubated for an extended period. The final concentration of nucleic acid was 100 nM.

[0740] 3) RNAiMAX group: 2 μL RNAiMAX transfection reagent and one bottle The HJT-sRNA-m7 chain solution was diluted in 100 μL of Opti-MEM medium. The mixture was then maintained for 15 minutes, added to the cells, and mixed. HJT-sRNA-m7 single strand The final concentration was 100 nM.

[0741] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 39 and HJT-sRNA - A mixture of m7 single-stranded nucleic acid solutions was prepared by boiling or reverse-phase evaporation, and A549 cells were prepared. It was added to the sample. The final RNA concentration was 100 nM. After 3 hours, the sample was collected and the entry of... A quantity was detected.

[0742] [Example 9] Verification of the effects of lipid number 39 Lipid number 39PE (16:1-18:1)

[0743] [ka]

[0744] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. As shown in Figure 104, prepared by different methods (boiling method or reverse-phase evaporation method) Lipid number 39 delivered double-stranded RNA into A549 cells.

[0745] 1) Naive group: Untreated A549 cells.

[0746] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell at 6 hours The samples were incubated for an extended period. The final concentration of nucleic acid was 100 nM.

[0747] 3) RNAiMAX group: 2 μL RNAiMAX transfection reagent and two bottles The HJT-sRNA-m7 chain solution was diluted in 100 μL of Opti-MEM medium. The mixture was then maintained for 15 minutes, added to the cells, and mixed. HJT-sRNA-m7 double-stranded The final concentration was 100 nM.

[0748] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 39 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions was prepared by boiling or reverse-phase evaporation, and A549 cells were prepared. It was added to [the sample]. The final concentration of RNA was 100 nM. After 12 hours, the sample was collected and [extracted]. The amount of [substance] was detected.

[0749] 2. Digital PCR (ddPCR) detection of the efficiency of nucleic acid delivery by lipids 2.1 Experimental materials: A549 cells were collected at the Cell Center of the Ins titute of Basic Medical Sciences,Chinese Purchased from the Academy of Medical Sciences, TRIzol The lysis buffer was purchased from Sigma, and the high-volume cRNA reverse transcription kit was purchased from ABI, USA. We purchased the digital PCR-related reagents from Bio-Rad USA.

[0750] 2.2 Experimental method: Collect all RNA and add it to TRIzol lysis buffer according to the method described above. Further extraction was performed, and the cRNA was reverse transcribed into cDNA using a high-volume cRNA reverse transcription kit, and then divided into different groups. The derived cDNA was subjected to a digital PCR reaction. The protocol used was QX200 Dr. Refer to the Oplet Reader and QuantaSoft software manuals; The results were analyzed using QuantaSoft software.

[0751] (1) Naive group: A549 cells that have not received any treatment.

[0752] (2) Free uptake group: Cells were directly taken up with HJT-sRNA-m7 dsRNA. Duration: Incubated for 12 hours.

[0753] (3) RNAiMAX group: HJT-sRNA-m7 dsRNA is converted to RNAiMAX The A549 cells were then transfected, and the sample was detected after 6 hours and 12 hours. They were collected.

[0754] (4) Group No. 39: Lipid No. 39 was obtained by reverse-phase evaporation of double-stranded RNA into A549 cells. The samples were delivered internally. Samples were collected for detection after 6 hours and 12 hours.

[0755] As shown in Figure 105, reverse-phase evaporation revealed that lipid number 39 is HJT-sRN We were able to effectively deliver A-m7 dsRNA into A549 cells.

[0756] [Example 10] Verification of the effects of lipid numbers 60 and 612 Lipid number 60 dMePE(16:1 / 16:1)

[0757] [ka]

[0758] 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. As shown in Figure 106, prepared by different methods (boiling or reverse-phase evaporation). Lipid number 60 delivered double-stranded RNA into A549 cells.

[0759] 7) Naive group: Untreated A549 cells.

[0760] 8) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell at 6 hours The samples were incubated for an extended period. The final concentration of nucleic acid was 100 nM.

[0761] RNAiMAX group: 2 μL RNAiMAX transfection reagent and double-stranded H Dilute each JT-sRNA-m7 solution in 100 μL of opti-MEM medium, and Afterward, the two were mixed, maintained for 15 minutes, added to the cells, and then mixed again. Double-stranded HJT The final concentration of -sRNA-m7 was 100 nM.

[0762] 4) Lipids and nucleic acids: 2.5 μL of single lipid number 60 and HJT-sRNA-m7 A mixture of unchained nucleic acid solutions was prepared by boiling or reverse-phase evaporation and added to cells. RN The final concentration of A was 100 nM. After 12 hours, a sample was collected and the amount of penetration was detected.

[0763] Lipid number 62 dMePE(16:1 / 18:1) 1. Quantitative detection of the efficiency of nucleic acid delivery by lipids using real-time PCR. As shown in Figure 107, it was prepared by different methods (boiling or reverse-phase evaporation). Lipid number 62 delivered double-stranded RNA into A549 cells.

[0764] 1) Naive group: Untreated A549 cells.

[0765] 2) Free uptake group: HJT-sRNA-m7 dsRNA was directly taken up by the cell at 6 hours The samples were incubated for an extended period. The final concentration of nucleic acid was 100 nM.

[0766] 3) RNAiMAX group: 2 μL RNAiMAX transfection reagent and two bottles The HJT-sRNA-m7 chain solution was diluted in 100 μL of Opti-MEM medium. Then, the two were mixed, maintained for 15 minutes, added to the cells, and then mixed again. HJT- The final concentration of sRNA-m7 double-stranded sRNA was 100 nM.

[0767] 4) Lipid and nucleic acid treatment group: 2.5 μL of single lipid number 62 and HJT-sRNA - A mixture of m7 double-stranded nucleic acid solutions is prepared by boiling or reverse-phase evaporation and added to the cells. The final RNA concentration was 100 nM. After 12 hours, the sample was collected and the amount of entry was measured. I took it out.

[0768] In vivo delivery experiments of lipid-nucleic acid mixtures 1. Experimental animal: C57 mouse, male, approximately 6 weeks old.

[0769] 2. Preparation of lipid mixture: Preparation involves 10 μl of lipid-1 nmol sR per mouse. Based on the NA dosage, the following was performed: 1 nmol of each sRNA was added to 500 μl of D Dissolve in EPC water, add 10 μl of the corresponding lipid, pipette and mix thoroughly, then After a 15-minute bath in 90°C water, allow to cool naturally, then administer via gastric tube feeding.

[0770] 3.sRNA:PGY-sRNA-26, PGYsRNA-32

[0771] 4. Experimental group: 1) Naive group: 500 μl of physiological saline administered intragastricly. 2) RNAiMAX-treated group: 10 μl of RNAiMAX-1 nmol sRNA was thoroughly treated. The mixture was thoroughly mixed and administered intragastricly to each mouse. This group served as a positive control group. I purchased RNAiMAX from Invitrogen. 3) Free uptake group: sRNA solution (1 nmol / animal, 500 μL) was added directly. This group served as a control group. 4) Treatment group of lipid nucleic acid mixture: Intragastric administration of the lipid-sRNA mixture prepared in step 2. did.

[0772] 5. Detection of the relative amount of entry 1) Tissue sampling and RNA extraction: Six hours after feeding mice via gastric tube, 500 A μl sample of blood is taken from the eyeball, and 1.5 ml of Trizol reagent LS is added and thoroughly mixed. Combine and dissolve, then mix in 3 ml of Trizol reagent (purchased from Invitrogen). Add to the tissue sample and homogenize until completely dissolved. Tissue sampled: Liver / stomach / small intestine.

[0773] 2) Reverse transcription of sRNA into cDNA: Reverse transcription kit (High-volume cDNA reverse transcription kit, A Using pplied Biosystems (catalog number 4368813), all R NA was reverse transcribed into cDNA. The reverse transcription system was as follows: template RNA (150n g / μL) 10 μL, 10 × RT buffer, 2.0 μL, 25 × dNTP mix (100 0.8 μL (m³), 2.0 μL random primers, MultiScribe (trademark) Reverse transcriptase 1.0 μL, RNase inhibitor 1.0 μL, nuclease-free H2O 3. 2 μL. After short-term centrifugation, the reaction was loaded into a PCR reactor. The reaction conditions were as follows: The results were: (1) 25℃, 10 minutes; (2) 37℃, 120 minutes; (3) 85℃, 5 minutes Interval; (4) 4°C, reaction stop. After the reaction, add 20 μL of RNase-free ddH2O. The final volume was set to 40 μL.

[0774] 3) Quantitative PCR amplification reaction: The qPCR reaction system is prepared using 5 μl of 2×SYBR green master. Mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer 10 μl containing imager, 1 μl of cDNA by reverse transcription, and 3 μl of RNase-free dH2O. It had a total volume of l. A LightCycler480 fluorescence quantitative PCR instrument was used. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, followed by PCR amplification. Cycle: (1) 95°C for 10 seconds; (2) 55°C for 10 seconds; (3) 72°C for 20 seconds Total of 40 cycles; finally, cool at 40°C for 10 seconds. Forward primer for amplification reaction. And reverse primers are from Beijing Qing ke New Indust Designed and synthesized by rial Biotechnology Co.,Ltd. (U6 F primer: GCGCGTCGTGAAGCGTTC, U6 R primer) :GTGCAGGGTCCGAGGT).

[0775] 3) Relative expression levels were calculated using the 2-ΔCt method.

[0776] [Example 11-1] In vivo delivery of single-stranded nucleic acids by single lipid number 41 1. Experimental animal: C57 mouse, male, approximately 6 weeks old. 1) Naive group: 500 μl of physiological saline administered intragastricly. 2) RNAiMAX-treated group: Mixed with 10 μl of RNAiMAX-1 nmol sRNA. The drug was administered intragastricly to each mouse. This group served as a positive control group. RNAi I bought MAX from Invitrogen. 3) Free uptake group: Single-stranded sRNA mixture solution (1 nmol each) was added directly (1 nmol each) nmol) 4) Treatment group of single lipid and nucleic acid mixture: 10 μL of single lipid (number 41) and single-stranded s RNA mixture solution (PGY-sRNA-23, PGY-sRNA-26, and PGY- A mixture of sRNA-32 (1 nmol each) was treated by heating, and then administered intragastricly. It was administered to mice.

[0777] 2. Twelve hours after intragastric administration, blood is collected from the eyeball and various tissues (liver / stomach / small intestine) are examined. Samples were taken. They were completely dissolved using TRIzol, and RNA was extracted to determine the amount of entry. Detected.

[0778] Conclusion: As shown in Figure 108, a single PE (number 41) carries a single stranded nucleic acid sRNA through It can be effectively delivered into the mouse bloodstream via oral administration, protecting sRNA from degradation. The delivery effect was better than POPC and Lipofectamine RNAiMAX. It was good.

[0779] As shown in Figure 109, a single PE (number 41) carries a single stranded nucleic acid sRNA through Oral administration effectively delivered the sRNA into the mouse stomach, protecting it from degradation. .

[0780] As shown in Figure 110, a single PE (number 41) carries a single stranded nucleic acid sRNA through It can be effectively delivered into the mouse small intestine via oral administration and protect sRNA from degradation. Ta.

[0781] As shown in Figure 111, a single PE (number 41) carries a single stranded nucleic acid sRNA through It can be effectively delivered into the mouse liver via oral administration and protect sRNA from degradation. Ta.

[0782] [Example 11-2] In vivo delivery of single-stranded nucleic acids by single lipid number 38 1. Experimental animal: C57 mouse, male, approximately 6 weeks old. 1) Naive group: 500 μl of physiological saline administered intragastricly. 2) RNAiMAX-treated group: Mixed with 10 μl of RNAiMAX-1 nmol sRNA. The drug was administered intragastricly to each mouse. This group served as a positive control group. RNAi I bought MAX from Invitrogen. 3) Free uptake group: Single-stranded sRNA mixture solution (1 nmol each) was added directly (1 nmol each) nmol). 4) POPC and nucleic acid treatment group: 10 μL of POPC and nucleic acid treated by heat method A mixture of single-stranded PGY-sRNA-32 sRNA (1 nmol each) solution is placed in a gastric tube. It was administered to mice as a nutritional supplement. 5) Treatment groups of single lipids and nucleic acid mixtures: 10 μL of single lipids treated by heating. (No. 38) and single-stranded sRNA (PGY-sRNA-32) mixture solution (1 nm each) The mixture from (1) was administered to mice via enteral nutrition.

[0783] 2. Twelve hours after gastric tube feeding, blood is collected from the eyeball to detect the amount of blood entering. RNA was extracted after lysis with RIzol.

[0784] Conclusion: As shown in Figure 112, a single PE (number 38) carries a single stranded nucleic acid sRNA through The drug was effectively delivered into the mouse bloodstream via oral administration. The delivery effect was observed in POPC. It performed better than Lipofectamine RNAiMAX.

[0785] [Example 11-3] In vivo delivery of single-stranded nucleic acids by single lipid number 40 1. Experimental animal: C57 mouse, male, approximately 6 weeks old. 1) Naive group: 500 μl of physiological saline administered intragastricly. 2) RNAiMAX-treated group: Mixed with 10 μl of RNAiMAX-1 nmol sRNA. The drug was administered intragastricly to each mouse. This group served as a positive control group. RNAi I bought MAX from Invitrogen. 3) Free uptake group: Single-stranded sRNA mixt...

Claims

1. A single lipid having the following structure. 【Chemistry 1】

2. A lipid composition for use in a method for delivering nucleic acids to a target, The aforementioned method, The lipid composition is mixed with nucleic acids to obtain a lipid-nucleic acid mixture, and The process includes delivering the lipid nucleic acid mixture so that the nucleic acid is delivered to the target, The lipid composition comprises the single lipid described in claim 1.

3. The lipid composition according to claim 2, wherein the lipid composition is mixed with the nucleic acid by boiling to obtain the lipid nucleic acid mixture, and the temperature in the boiling method is in the range of 80°C to 100°C.

4. The lipid composition according to claim 3, wherein the boiling method comprises adding an organic solvent solution of the lipid composition to an aqueous solution of the nucleic acid.

5. The lipid composition according to claim 2, wherein the nucleic acid is a small molecule nucleic acid.

6. The lipid composition according to claim 2, wherein the nucleic acid is single-stranded or double-stranded.

7. The lipid composition according to claim 2, wherein the nucleic acid has a stem-loop structure.

8. The lipid composition according to claim 2, wherein the nucleic acid has a length of 14 to 32 bp, 16 to 28 bp, or 18 to 24 bp.

9. A synthetic pharmaceutical composition comprising a lipid composition and a nucleic acid drug, wherein the lipid composition comprises a lipid having the following structure. 【Chemistry 2】

10. (i) Prepared for administration via the gastrointestinal tract, or (ii) Prepared for administration via the respiratory tract, according to claim 9.

11. The synthesized pharmaceutical composition according to claim 9, which is formulated to be administered by oral administration.

12. The synthesized pharmaceutical composition according to claim 10, wherein at least part or all of the lipid composition and the nucleic acid drug are present in the form of a mixture.

13. The synthesized pharmaceutical composition according to claim 10, wherein the pharmaceutical composition is provided in the form of a kit, and the lipid composition and the nucleic acid drug in the kit are provided separately in a first container and a second container, respectively, wherein the first container and the second container may be the same or different.

14. A composition comprising a lipid having the following structure, wherein the lipid is the only lipid in the composition. 【Transformation 3】

15. A pharmaceutical composition for delivering nucleic acids to a target, The aforementioned pharmaceutical composition comprises a lipid and a nucleic acid having the following structure. 【Chemistry 4】

Citation Information

Patent Citations

  • Methods and systems for systemic delivery of growth-inhibitory lipid-derived bioactive compounds

    JP2006524707A

  • JPP7252132B

  • Liposomal transfection method

    US6074667A

  • Id2 as a target in colorectal carcinoma

    WO2009059201A2

  • Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications

    WO2015187966A1