Composition for preventing or improving cancer comprising jeonho as an active ingredient
The Jeonho root extract addresses the limitations of EGFR TKIs in NSCLC by inducing apoptosis and inhibiting cancer cell proliferation, providing a effective and safer treatment for NSCLC.
Patent Information
- Application Number
- KR1020220064699
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-05-26
- Publication Date
- 2026-07-15
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current therapies for non-small cell lung cancer (NSCLC) with EGFR mutations, such as EGFR tyrosine kinase inhibitors (TKIs), face challenges with low response rates, primary drug resistance, and acquired resistance due to endogenous heterogeneity and activation of accessory pathways, leading to poor clinical outcomes and toxicity.
A composition comprising a root extract of Jeonho (Peucedanum praeruptorum) is developed, which induces apoptosis and inhibits cancer cell proliferation, targeting STAT3 and tumor-associated macrophages to overcome EGFR TKI resistance and inhibit tumor formation without side effects.
The Jeonho extract effectively prevents and treats NSCLC by inducing apoptosis and inhibiting cancer cell growth and colony formation, offering a promising alternative to existing therapies with reduced toxicity.
Smart Images

Figure 112022055802615-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a composition for preventing or improving cancer comprising *Jeonho* as an active ingredient. More specifically, by including a root extract of *Jeonho*, the invention provides a composition having excellent anticancer effects without the problem of side effects, and a pharmaceutical composition for preventing or treating cancer or a functional food composition for preventing or improving cancer comprising the same. Background Technology
[0002] Lung cancer is the second most common cancer in the world and a leading cause of cancer-related deaths. In 2020, 1,796,144 people died from lung cancer, accounting for approximately 18% of all cancer-related deaths. Although the prognosis for lung cancer patients has steadily improved over the past few decades, the five-year survival rate remains below 20%. According to U.S. statistics, 57% of all lung cancer patients are diagnosed at an advanced stage with metastatic disease, which contributes to the extremely low five-year survival rate (6%) for patients with distant metastatic lung cancer. Therefore, the development of new strategies for early diagnosis and treatment is urgent.
[0003] Epidermal growth factor receptor (EGFR) mutations are identified in about 32% of patients with non-small cell lung cancer, and the prevalence of EGFR mutations is higher, particularly among Asians, women, and non-smokers. Most EGFR mutations are intraframe deletions in exon 19 (45%) or L858R mutations in exon 20 (40%). These EGFR-activating mutations, also known as EGFR-sensitive mutations, make cancer cells dependent on the EGFR signaling pathway and stimulate proliferation, angiogenesis, and evasion of apoptosis by activating downstream effectors.
[0004] Advancements in the understanding of the relevance of EGFR mutations to lung cancer progression have led to the development of EGFR targeted therapies; in particular, EGFR tyrosine kinase inhibitors (TKIs), such as eroteinib or gefitinib, have significantly improved clinical outcomes for NSCLC patients with EGFR mutations. However, a significant proportion of cases exhibited low response rates to EGFR TKIs due to oral EGFR heterogeneity in lung cancer. Only cancer cells with EGFR mutations respond to EGFR TKIs, while the remaining non-mutated cancer cells, which are insensitive to treatment, develop primary drug resistance. Furthermore, acquired resistance occurs within one year of treatment in patients benefiting from EGFR TKIs. The EGFR T790M secondary mutation is the most common mechanism (60%) associated with acquired resistance to EGFR TKIs.
[0005] Although next-generation EGFR TKIs such as osimertinib were developed targeting the EGFR T790M mutation, additional resistance has been identified. Activation of accessory pathways, including MET, HER2, KRAS, PIK3CA, and BRAF, accounts for approximately 20% of EGFR TKI resistance cases, suggesting that combining EGFR TKIs with other targeted therapies could be a promising strategy to overcome TKI resistance. However, combination therapies have so far demonstrated disappointing clinical results and higher toxicity. Therefore, there is a need to develop new therapies that can conquer NSCLC due to endogenous EGFR heterogeneity and overcome EGFR TKI resistance with minimal toxicity.
[0006] Furthermore, signal transducers and transcription activators 3 (STAT3) are transcription factors activated by signaling via receptor tyrosine kinases, including EGFR and interleukin-6 receptors (IL-6R), and non-receptor tyrosine kinases, including Src. STAT3 regulates the expression of various genes associated with cancer progression by stimulating tumor growth, angiogenesis, and metastasis; in particular, STAT3 activation is recognized as a non-genetic mechanism underlying EGFR TKI resistance. Recent studies have reported that inhibition of the STAT3 signaling pathway reverses EGFR TKI resistance in NSCLC cells. Therefore, targeting STAT3 represents a therapeutic strategy for NSCLC associated with EGFR TKI resistance.
[0007] Meanwhile, tumor-associated macrophages (TAMs) are formed when bone marrow-derived monocytes circulating in the bloodstream are attracted to tumors by various chemokines or cytokines secreted by cancer cells and differentiate into macrophages. Recent studies indicate that not only bone marrow-derived monocytes but also embryonic macrophages residing in tissues infiltrate tumor tissues to form tumor-associated macrophages. As a core component of the tumor microenvironment, tumor-associated macrophages account for the highest proportion of tumor-infiltrating immune cells. The presence of tumor-associated macrophages has been reported in various types of cancer, and they have been reported to be closely associated with tumor growth, metastasis, and anticancer drug resistance.
[0008] Tumor-associated macrophages can be broadly classified into M1 and M2 types. M1 macrophages possess typical immune functions, such as activating the adaptive immune system in response to signals like bacterial products or interferon (IFN)-γ and phagocytizing target cells. M1 macrophages are known to exert anticancer effects by directly attacking cancer cells through the secretion of toxic substances like reactive oxygen species (ROS) and nitric oxide (NO). M2 macrophages are polarized in response to interleukin (IL)-4, IL-13, and transforming growth factor (TGF)-β, and are classified into M2a, M2b, M2c, and M2d types depending on the specific factor causing the polarization. M2 macrophages are known to exacerbate cancer by secreting anti-inflammatory factors such as IL-10, thereby inhibiting the immune system from attacking cancer cells, and by secreting vascular endothelial growth factor (VEGF), thereby promoting angiogenesis and cancer cell metastasis. Since various factors secreted by cancer cells and the tumor microenvironment induce polarization into M2 macrophages, the invasion of tumor-associated macrophages into the tumor is closely associated with a poor prognosis of cancer. Therefore, regulating tumor-associated macrophages is emerging as a new anticancer strategy, and representative strategies proposed include inhibiting the attraction of macrophages into the tumor or regulating the M2 polarization of tumor-associated macrophages.
[0009] Meanwhile, the roots of *Peucedanum praeruptorum Dunn* (PP) have traditionally been used in East Asia to treat coughs, asthma, and thick phlegm. According to traditional herbal medicine, *Peucedanum praeruptorum* roots can reduce qi stagnation, relieve phlegm heat, and disperse wind-heat; angular pyranocoumarins, including praeruptorin A, praeruptorin B, and praeruptorin E, are known as the major active compounds in *Peucedanum praeruptorum*. Previous studies have indicated that *Peucedanum praeruptorum* root extracts reduce airway inflammation, treat cardiovascular diseases, and exhibit antibacterial effects.
[0010] Accordingly, the present invention was completed to provide a composition for cancer prevention or improvement that includes the above-mentioned *Jeonho* extract as an active ingredient, thereby having excellent anticancer effects without the problem of side effects by including a natural extract as an active ingredient. Prior art literature
[0011] (Patent Document 0001) KR 10-2043454 B1(Patent Document 0002) KR 10-1574581 B1 The problem to be solved
[0012] The objective of the present invention is to provide a composition for preventing or improving cancer that has excellent anticancer effects without the problem of side effects by including a natural extract containing *Jeonho* as an active ingredient.
[0013] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising *Jeonho* as an active ingredient.
[0014] Another objective of the present invention is to provide a functional food composition for cancer prevention or improvement comprising *Jeonho* as an active ingredient. means of solving the problem
[0015] To achieve the above objective, a composition for preventing or improving cancer according to one embodiment of the present invention comprises *Jeonho* as an active ingredient.
[0016] The above composition exhibits anticancer activity by inducing apoptosis in cancer cells.
[0017] The above composition exhibits anticancer activity by inhibiting cell proliferation or colony formation of cancer cells.
[0018] The above cancer is selected from the group consisting of liver cancer, stomach cancer, breast cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, esophageal cancer, small intestine cancer, colorectal cancer, prostatic cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, prostate cancer, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, lung cancer, and central nervous system tumors.
[0019] The above extract is extracted using an extraction solvent selected from the group consisting of water, C1 to C6 lower alcohols, and mixtures thereof.
[0020] A pharmaceutical composition for cancer prevention or treatment according to another embodiment of the present invention is prepared using the above composition.
[0021] A functional food composition for cancer prevention or improvement according to another embodiment of the present invention is prepared using the above composition.
[0023] The present invention will be described in more detail below.
[0025] As used in this specification, the term "extract" has the meaning commonly used in the art as a crude extract, as described above, but in a broader sense, it also includes fractions obtained by further fractionating the extract. That is, the extract includes not only those obtained using the extraction solvent described above, but also those obtained by additionally applying a purification process thereto. For example, fractions obtained through various additional purification methods, such as a fraction obtained by passing the extract through an ultrafiltration membrane having a certain molecular weight cut-off value, or separation by various chromatographs (designed for separation based on size, charge, hydrophobicity, or affinity), are also included in the extract of the present invention.
[0026] The extract used in the present invention can be prepared in a powder state by additional processes such as vacuum distillation, freeze-drying, or spray-drying.
[0027] In this specification, the term "containing as an active ingredient" means containing an amount sufficient to achieve the efficacy or activity of the following natural extracts.
[0028] In the terms used in this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.
[0029] The present invention aims to provide a composition as follows to exhibit existing cancer prevention, improvement, or treatment effects.
[0031] Accordingly, the present invention aims to provide a composition for preventing or improving cancer by including *Jeonho* as an active ingredient.
[0032] A composition for preventing or improving cancer according to one embodiment of the present invention comprises *Jeonho* as an active ingredient.
[0033] The aforementioned *Peucedanum praeruptorum* is a perennial herb belonging to the Apiaceae family (Umbelliferae) of the order Apiaceae (Dicotyledonous plants). It thrives primarily in slightly moist areas, such as forest edges. It grows to a height of approximately 1 meter, with stems emerging from thick roots that branch out. Leaves emerging from the roots and the lower part of the stem have long petioles and are divided into three lobes two to three times, which are then pinnately divided. The lobes have serrated edges, and there are a few spreading hairs on the veins of the underside. Leaves emerging from the stem are alternate and similar to those from the roots, but they gradually become smaller, eventually consisting only of a leaf sheath. Flowers bloom in May and June in umbels; they are white and have 5 to 12 spikelets. The involucre consists of 5 to 12 bracts, which are hairless, reflexed, and have hairs along the margins. There are five petals, with the outer one being particularly large; there are five stamens and two pistils. The fruit is a schizocarp, lanceolate in shape, greenish-black, and is smooth or has slight protrusions. The roots are used medicinally, and it is mainly distributed in Korea, Japan, the Kamchatka Peninsula, Siberia, and Europe.
[0034] Jeonho is used for asthma with accumulated phlegm in the lungs, symptoms of chest tightness and difficulty expelling phlegm, fever, cough, and headache; pharmacologically, it exhibits activities such as promoting bronchial mucus secretion, increasing coronary blood flow, and anti-influenza virus, anti-ulcer, anticonvulsant, anti-allergic, and antibacterial effects.
[0035] By including the above-mentioned herb as an active ingredient, anticancer activity can be exhibited through cancer prevention, improvement, or treatment activity by the active ingredient contained within the herb.
[0036] In particular, it may be desirable to include a root extract of Angelica gigas, which includes the root of Angelica gigas among the parts including the root, stem, leaves, and flowers of Angelica gigas, as an active ingredient.
[0037] The above composition exhibits anticancer activity by inducing apoptosis in cancer cells.
[0038] Cells die through necrosis and apoptosis.
[0039] The aforementioned cell necrosis refers to the death of a cell due to the destruction of its structure by physical force or chemical substances.
[0040] Meanwhile, apoptosis, also known as cell suicide, is a phenomenon in which cells die by self-destructing under the control of genes; it refers to a natural process that occurs to eliminate unnecessary or abnormal cells from the body.
[0041] The aforementioned apoptosis is accomplished through a series of processes in which chromosome condensation and DNA cleavage occur within the nucleus, organelles are destroyed leading to a decrease in cell mass, and intracellular substances form vesicles called apoptotic bodies, which are then removed by the phagocytosis of macrophages without causing inflammatory reactions.
[0042] In normal cells, the aforementioned apoptosis occurs naturally, but in the case of cancer cells, problems arise in the apoptosis function due to an imbalance in the body tissue's control capabilities.
[0043] If the aforementioned apoptosis function is compromised, abnormal cells fail to die and proliferate excessively; in severe cases, this can metastasize to other cells, potentially worsening the cancer.
[0044] Accordingly, when using the composition for cancer prevention, improvement, or treatment of the present invention, it may be possible to prevent cancer or improve or treat cancer by inducing apoptosis.
[0045] In addition, the above composition exhibits anticancer activity by inhibiting cell proliferation or colony formation of cancer cells.
[0046] According to the composition of the present invention, cancer cell growth can be inhibited by reducing the proliferation of cancer cells. Furthermore, while cancer may worsen because cancer cells form colonies during tumor formation, the composition of the present invention inhibits cell colony formation, thereby reducing the colony-forming ability and consequently inhibiting tumor formation.
[0047] Accordingly, according to the composition of the present invention, it may be possible to prevent, improve, or treat cancer by inhibiting tumor formation through inducing apoptosis of cancer cells or inhibiting the proliferation or colony formation of cancer cells.
[0048] The above cancer is selected from the group consisting of liver cancer, stomach cancer, breast cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, esophageal cancer, small intestine cancer, colorectal cancer, prostatic cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, prostate cancer, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, lung cancer, and central nervous system tumors.
[0049] The aforementioned cancer is a disease caused by abnormal cell growth and is classified into benign and malignant tumors. Benign tumors grow relatively slowly and do not metastasize, whereas malignant tumors grow faster than benign tumors and have a high likelihood of metastasizing to organs other than the one where the cancer originated; commonly referred to as cancer corresponds to malignant tumors.
[0050] The cancer cells that caused the above cancer have characteristics different from normal cells.
[0051] First, cancer cells acquire the ability to be self-sufficient, capable of supplying growth factors or growing on their own even without a supply of growth factors.
[0052] Secondly, while normal cells are inhibited by growth-inhibiting signals, cancer cells possess resistance to such signals, allowing them to maintain continuous growth and division capabilities rather than growth inhibition.
[0053] Thirdly, while normal cells undergo a process of self-destruction through apoptosis when they are damaged or unable to perform their functions, cancer cells acquire the ability to resist and evade apoptosis, preventing their elimination.
[0054] Fourth, in the case of normal cells, telomeres (pieces of DNA with repetitive base sequences located at the ends of eukaryotic chromosomes) shorten with cell division, and cell division is inhibited after a certain period, whereas in the case of cancer cells, they have the ability to divide without restriction.
[0055] Fifth, in the case of solid cancer cells that have grown large due to excessive division and growth, which differ from the aforementioned normal cells, they are relatively lacking in nutrients. Consequently, they acquire the ability to promote angiogenesis, thereby inducing blood vessels to surround the cancer cells and facilitating blood vessel formation in a way that is advantageous for survival.
[0056] Sixth, when cancer cells grow beyond a certain point, they face a situation where further growth becomes difficult due to spatial and nutritional issues, leading them to invade other tissue cells or acquire the ability to metastasize to other organs through blood vessels via the EMT process. The aforementioned EMT process refers to a series of processes in which cancer-associated microphages and cancer-associated fibroblasts secrete large amounts of cytokines (signaling molecules) and proteases (protein-dissolving enzymes) to dissolve surrounding tissues, thereby enabling cancer cells to move toward blood vessels.
[0057] Cancer cells that have characteristics different from normal cells as described above metastasize to various tissues within the human body or cause cancer, leading to various types of cancer.
[0058] In the present invention, the composition for preventing, improving, or treating cancer may be selected from the group consisting of liver cancer, gastric cancer, breast cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, esophageal cancer, small intestine cancer, colorectal cancer, prostatic cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, prostate cancer, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, lung cancer, and central nervous system tumors, and more preferably may be lung cancer.
[0059] The above extract is extracted using an extraction solvent selected from the group consisting of water, C1 to C6 lower alcohols, and mixtures thereof.
[0060] Specifically, to prepare an extract, a natural extract can be obtained by including the steps of: grinding a natural product; leaching the ground product using an organic solvent; drying the sample after leaching; re-leaching the dried sample using an organic solvent; drying the sample after leaching; leaching using water; and leaching.
[0061] The natural extract obtained using the above organic solvent may further include a step of fractionating using an organic solvent.
[0062] The above extraction solvent may be used in an amount of 2 to 50 times the weight of the sample, more specifically 2 to 20 times. For extraction, the sample may be left in the extraction solvent for leaching for 1 to 72 hours, more specifically 24 to 48 hours.
[0063] The above extract may be prepared in a powder state by additional processes such as vacuum distillation and freeze-drying or spray-drying, and includes obtaining it by an extraction method selected from the group consisting of solvent extraction, ultrasonic extraction, reflux extraction, leaching, fermentation, and preparation.
[0064] The ultrasonic extraction method is carried out at 30 to 50°C for 0.5 to 2.5 hours, and the extraction solvent is water or 50 to 100% alcohol having 1 to 6 carbon atoms. Specifically, the extraction is carried out at 40 to 50°C for 1 to 2.5 hours, and the extraction solvent is water or 70 to 80% alcohol having 1 to 6 carbon atoms.
[0065] The reflux extraction method is based on 100 mL of water, 10 to 30 g of crushed natural product, a reflux time of 1 to 3 hours, and 50 to 100% of alcohol or water having 1 to 6 carbon atoms. More specifically, based on 100 mL of alcohol or water having 1 to 6 carbon atoms, 10 to 20 g of crushed natural product, a reflux time of 1 to 2 hours, and 70 to 90% of alcohol or water having 1 to 4 carbon atoms.
[0066] The leaching method is carried out at 15 to 30°C for 24 to 72 hours, using water or 50 to 100% of an alcohol having 1 to 6 carbon atoms as the extraction solvent. More specifically, it is carried out at 20 to 25°C for 30 to 54 hours, using water or 70 to 80% of an alcohol having 1 to 6 carbon atoms as the extraction solvent.
[0067] After extraction, the extract can be fractionated by sequentially applying a new fractionation solvent. The fractionation solvent used for fractionation is one or more selected from the group consisting of water, hexane, butanol, ethyl acetic acid, ethyl acetate, methylene chloride, and mixtures thereof, and preferably ethyl acetate or methylene chloride.
[0068] Preferably, the above-mentioned cancer prevention or improvement composition may further include any one selected from the group consisting of Trichosanthes kirilowii root, Pinellia ternata, and mixtures thereof, in addition to Angelica dahurica.
[0069] The aforementioned *Trichosanthes kirilowii* is a climbing perennial herb belonging to the Cucurbitaceae family of the Cucurbitales order of dicotyledonous plants, also known as *Haneultari*. It is also referred to as *Haneultari*, *Gwarudeung*, *Haneulsubak*, and *Cheonseonjiru*. It grows at the foot of mountains and below, and is distributed in Korea, Japan, Taiwan, China, and Mongolia. The roots thicken like sweet potatoes, and the stems climb by wrapping tendrils around other objects. The leaves are alternate and divided into 5 to 7 lobes like maple leaves; the lobes have serrated edges, and the base is heart-shaped. Flowers bloom from July to August, are dioecious, and are white. Male flowers are borne in spike inflorescences, while female flowers are borne singly. The calyx and corolla are each divided into five parts, and the corolla lobes are further divided like threads. There are three stamens and one pistil. The fruit is round, about 7 cm in diameter, ripens to an orange color, and the seeds are dark brown. In traditional Korean medicine, the root is called Wanggwageun, the fruit Togwasil, and the seeds Togwain, and they are used medicinally. The root is used for menstruation regulation, diuresis, and pus drainage; the fruit pulp is used in folk medicine for burns and frostbite; and the seeds are used for expectorant, antitussive, and analgesic purposes, or as an anti-inflammatory agent. The starch extracted from the root is used for food or medicinal purposes.
[0070] In particular, it may be desirable to include a root extract of the *Gwaru* plant, which includes the root of the *Gwaru* plant, as an active ingredient among the parts including the root, stem, leaves, and flowers of the *Gwaru* plant.
[0071] Pinellia ternata, mentioned above, is a perennial herb belonging to the Araceae family of the Araceae order of monocotyledonous plants. Also known as Kimureut, Socheonnamseong, or Beopbanha, it grows in fields and is distributed in Korea, Japan, and China. It reaches a height of about 30 cm, with one to two leaves growing from a bulb about 1 cm in diameter. The leaf stalks are 10 to 20 cm long, and the plant reproduces by producing a single bulbil at the base or top, which then falls off. The leaves are compound leaves consisting of three leaflets. The leaflets are hairless and vary greatly in shape, ranging from egg-shaped to lanceolate. The flower stalk is 20 to 40 cm tall, and the bracts are green, 6 to 7 cm long, hairless on the outside but hairy on the inside. Flowers bloom in June and are borne in spadixes. Female flowers are located at the bottom, while male flowers are located at the top, with their tips growing long. The flowers are yellowish-white, and the fruit is a green berry. Although the bulb is toxic, in traditional Korean medicine it is used for vomiting, diarrhea, and vomiting during pregnancy due to its expectorant and antitussive effects.
[0072] The cancer prevention or improvement composition of the present invention may be selected from the group consisting of the Angelica root extract, Pinellia root extract, and mixtures thereof, and may include all of the Angelica root extract, Angelica root extract, and Pinellia root extract.
[0073] Preferably, for every 100 parts by weight of the Angelica gigas extract, it may contain 80 to 120 parts by weight of Trichosanthes kirilowii extract and 80 to 120 parts by weight of Pinellia ternata extract.
[0074] By including it in the above weight range, it can exhibit a superior inhibitory effect on cancer cell growth, proliferation, and colony formation compared to the case where only a single extract of Angelica gigas is included, and it can exhibit a superior anticancer activity by inducing apoptosis, thereby showing an effect of preventing, improving, or treating cancer.
[0075] More preferably, the above-mentioned Angelica extract, Trichosanthes root extract, and Pinellia extract may additionally include any one selected from the group consisting of *Glechoma longifolia* extract, *Pteridium aquilinum* extract, and mixtures thereof.
[0076] Echinops setifer Iljin is a perennial herb belonging to the Asteraceae family, order Campanulales, and class Dicotyledon. It is also known as *Gae-seurichwi* or *Jeolgudae*. It grows in sunny grasslands and is distributed in Korea and Japan. Reaching a height of about 1 meter, its branches are slightly forked and covered in cottony hairs, giving the entire plant a whitish appearance. Leaves emerging from the roots have long petioles; the upper surface is green while the underside is white. Additionally, the margins are lobed like those of a thistle and contain thorns. Leaves emerging from the stem are sessile, long elliptical, and divided into 5 to 6 pairs. Flowers bloom from July to August; they are purplish in color, about 5 cm in diameter, and are tubular. The corolla splits into five lobes at the tip that curl backward, and the involucre has thorn-like tips. The fruit is an achene densely covered with hairs, and the pappus resembles scales. Young leaves are edible, and the roots are used to treat boils.
[0077] *Cacalia koraiensis* is a perennial herb belonging to the Asteraceae family, order Campanulales, and class Dicotyledon. It grows in deep mountains and is an endemic Korean species distributed in areas such as Unseonryeong, Potaesan, and Choegaryeong in South Hamgyong Province. The stem stands upright, reaching a height of 1–2 m, with a diameter of 1.5 cm at the base and branches out from the upper part. The leaves are alternate, triangular, pointed at the tip, slightly heart-shaped at the base, and serrated at the margins. Leaves located in the middle of the stem are 15 cm long and 25 cm wide; the petioles are winged, with the wings at the base broadening to clasp the stem. Yellow flowers bloom in August, with capitulum flowers forming a panicle at the tip of the stem. There are 5–6 linear bracts, 13–15 cm long, arranged in a single row. There are 1 to 2 bracts at the base of the involucre, and the flower head consists of about 10 tubular flowers. The fruit is an achene, linear in shape, striated, and hairless; the pappus is white and 8 mm long. The young leaves are edible.
[0078] The above extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata may further include extracts of Artemisia princeps and Artemisia princeps.
[0079] More preferably, with respect to 100 parts by weight of the Angelica gigas extract, it may comprise 80 to 120 parts by weight of Trichosanthes kirilowii extract, 80 to 120 parts by weight of Pinellia ternata extract, 40 to 60 parts by weight of Elaeocarpus erythrorhizon extract, and 40 to 60 parts by weight of Elaeocarpus pyrifolia extract.
[0080] When used as a complex extract within the above range, it exhibits excellent cancer prevention, improvement, or treatment effects, and at the same time, by including *Jeolgutdae* and *Chamnarae* extracts, the palatability (taste and aroma) that may be reduced due to the characteristic aroma of *Jeonho*, *Gwarugeun*, or *Banha* extracts can be improved, thereby providing a composition with excellent functionality and palatability.
[0081] A pharmaceutical composition for cancer prevention or treatment according to another embodiment of the present invention comprises the above composition.
[0082] The pharmaceutical composition according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, capsules, suspensions, emulsions, syrups, and aerosols, as well as external preparations, suppositories, and sterile injectable solutions, each according to conventional methods. When formulating, the composition is prepared using diluents or excipients such as commonly used fillers, extenders, binders, humectants, disintegrants, and surfactants. Solid formulations for oral administration include tablets, pills, powders, granules, and capsules, and such solid formulations may be prepared by mixing the above-mentioned compound with at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc.
[0083] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included.
[0084] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used.
[0085] Furthermore, the dosage of the pharmaceutical composition according to the present invention may be increased or decreased depending on the route of administration, the severity of the disease, gender, body weight, age, etc. Accordingly, the above dosage does not limit the scope of the present invention in any way.
[0086] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" in this invention refers to an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention. The effective dose level may be determined based on factors including the severity of the disease, drug activity, the patient's age, weight, health, gender, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition of the present invention, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with known immunotherapies. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration.
[0087] The formulation of the above pharmaceutical composition is selected from creams, gels, patches, sprays, emulsions, ointments, warning agents, lotions, solvents, and suspensions.
[0088] In the manufacture of the above-mentioned pharmaceutical, the content of the composition for the prevention and treatment of metabolic diseases according to the present invention varies depending on the form of the drug, and the dosage can also be easily adjusted by a person skilled in the art according to the type of subject being treated, the route of administration, body weight, gender, age, and the severity of the disease. Furthermore, the formulation is not limited thereto and can be easily modified by a person skilled in the art.
[0089] A functional food composition for cancer prevention or improvement according to another embodiment of the present invention is prepared using the above composition.
[0090] The functional food composition according to the present invention includes health supplement foods manufactured and processed by methods such as extraction, concentration, purification, and mixing of specific components contained in food ingredients, or using specific components as raw materials for the purpose of health supplementation; and also includes all foods designed and processed to fully exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, and prevention and recovery of disease, which are food components, and which also have functions related to disease prevention and recovery.
[0091] The above functional food composition may be provided in the form of powder, granules, tablets, capsules, syrup, or beverage, and may be used in combination with other foods or food additives, or appropriately used according to conventional methods. The amount of the active ingredient may be appropriately determined according to its intended use, for example, for prevention, health, or therapeutic treatment. Effects of the invention
[0092] According to the cancer prevention or improvement composition of the present invention, by including *Jeonho* as an active ingredient, tumor formation can be prevented by inhibiting the growth and colony formation of cancer cells without the problem of side effects, and anticancer activity can be exhibited by inducing apoptosis in cancer cells.
[0093] It may be possible to provide a pharmaceutical composition for cancer prevention or treatment comprising the composition of the present invention, and it may be possible to provide a functional food composition for cancer prevention or improvement that has excellent palatability as well as functionality by including the composition of the present invention. Brief explanation of the drawing
[0094] Figure 1 relates to the effect of *Jeonho* root extract (EPP) on the growth of human non-small cell lung cancer (NSCLC) cell lines having different EGFR mutation states. Figure 2 relates to the effect of *Jeonho* root extract (EPP) on colony formation in human non-small cell lung cancer (NSCLC) cell lines having different EGFR mutation states. Figure 3 relates to the induction of apoptosis by *Jeonho* root extract (EPP) in human non-small cell lung cancer (NSCLC) cell lines with different EGFR mutation states. Figure 4 shows the inactivation of STAT3 and AKT by *Jeonho* root extract (EPP) in human non-small cell lung cancer (NSCLC) cell lines with different EGFR mutation statuses. Figure 5 shows the blockade of MET by *Jeonho* root extract (EPP) in human non-small cell lung cancer (NSCLC) cell lines with different EGFR mutation statuses. Figure 6 relates to the identification of specific compounds that contribute to the anticancer effect of EPP. Figure 7 shows the effect of EPP on the activity of the MET signaling pathway in EGFR wild-type H1299 cells. Figure 8 relates to the identification of praeruptorin A from EPP by HPLC-MS analysis. Figure 9 relates to the inhibition of cell growth by Trichosanthes root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells. Figure 10 relates to the inhibition of colony formation by Trichosanthes root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells. Figure 11 relates to the induction of apoptosis by Trichosanthes root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells. Figure 12 shows the inactivation of STAT3 and Src by Gualu root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells. Figure 13 shows the inactivation of STAT3-mediated Gualu root extract (TK)-induced apoptosis in EGFR TKI-resistant NSCLC cells. Figure 14 relates to the identification of cucurbitacin B from Trichosanthes root extract (TK) through HPLC-MS analysis. Figure 15 relates to the inactivation of AKT and mTOR by Trichosanthes root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells. Figure 16 shows the effect of Pinellia extract (ETPT) on the cell viability of macrophages. Figure 17 shows the effect of Pinellia extract (ETPT) on the migration of macrophages toward cancer cells. Figure 18 shows the effect of Pinellia extract (ETPT) on the expression of M2 macrophage marker genes in RAW 264.7 cells. Figure 19 shows the effect of Pinellia extract (ETPT) on the phosphorylation of STAT3 and STAT6 in RAW 264.7 cells. Figure 20 shows the effect of Pinellia extract (ETPT) on cancer cell migration stimulated by M2 macrophages. Specific details for implementing the invention
[0095] Hereinafter, embodiments of the present invention are described in detail so that those skilled in the art can easily implement the invention. However, the present invention may be embodied in various different forms and is not limited to the embodiments described herein.
[0097] [Experimental Example 1: Anticancer Effect of Angelica Extract]
[0098] 1. Experimental Method
[0099] 1.1. Preparation of Angelica gigas extract (EPP)
[0100] On April 23, 2021, Angelica root (PP) from Guizhou, China was purchased from Bonchomaru (Seoul, Korea). Sample certification was performed by Deokin Pharmaceutical Co., Ltd. (Seoul, Korea). The voucher sample (#21152-01) was deposited in the Herbarium of the Pathology Laboratory, College of Korean Medicine, Dong-eui University, Busan. 50g of Angelica root (PP) was extracted with 800mL of 80% ethyl alcohol in a shaking incubator at 40℃ for 48 hours. Once the first extract was collected, 300mL of 80% ethyl alcohol was added to the Angelica root again, and the mixture was incubated for an additional 24 hours for the second extraction. Subsequently, the mixture of the first and second extracts underwent a concentration step using a vacuum rotary evaporator under reduced pressure. After freeze-drying the concentrated extract for 3 days, 12.53g of EPP powder was obtained (yield = 25.06%). Then, the EPP powder was diluted to a working concentration with 200 mg / mL of dimethyl sulfoxide (DMSO; Amresco, Solon, OH, USA) immediately before use.
[0102] 1.2. HPLC-MS Analysis
[0103] HPLC analysis was performed using a Dionex UltiMate 3000 UHPLC system (Thermo Fisher Scientific, San Jose, CA, USA) and Thermo Chromeleon 7 software (Thermo Fisher Scientific, San Jose, CA, USA). Praeruptorin A (ChemFaces, Wuhan, China) and EPP powder were dissolved in 50% methanol at final concentrations of 20 mg / mL and 50 g / mL, respectively. Separation was performed on a YMC Triart C18 column (150 x 2.0 mm, 3 m) using distilled water (DW) as solvent A and acetonitrile as solvent B. The migration conditions were as follows: initially 80% solvent A and 20% solvent B, 10% solvent A and 90% solvent B for 30 minutes, 10% solvent A and 90% solvent B for 5 minutes, 80% solvent A and 20% solvent B for 0.5 minutes, and as a final condition, 80% solvent A and 20% solvent B for 9.5 minutes. The flow rate was 0.2 mL / min and the column temperature was 25°C. The detection wavelength was 330 nm. MS analysis was performed using a Compact Mass Spectrometer LC-MS system (Advion, Ithaca, NY, USA). Mass spectra were recorded over m / z 100–1200 in positive electron spray ionization (ESI) mode.
[0105] 1.3 Cell Culture
[0106] PC9, H1299, and H1975 human NSCLC cell lines were provided by Professor Ho-Young Lee (Seoul National University, Seoul, Korea). Cells were cultured in RPMI-1640 medium (WelGENE, Daegu, Korea) supplemented with 10% fetal bovine serum (FBS; WelGENE) and 1% antibiotic (WelGENE) and maintained at 37°C under 5% CO2 conditions. Erlotinib-resistant PC9 (PC9 / ER) cell lines were established as described in previous studies. PC9 / ER cells were cultured in RPMI-1640 medium containing 25M erlotinib, and other culture conditions were the same as above.
[0108] 1.4 MTT Assay
[0109] 3 x 10 cells in 96-well plates 3 Cells were seeded at a density of cells / well. After stabilization overnight, cells were treated for 72 hours with EPP (0.5–5 μg / mL) or components including PA, PB (ChemFaces), and PX (ChemFaces). Subsequently, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Duchefa, Haarlem, The Netherlands) solution (4 mg / mL) was added to the culture medium at a final concentration of 0.4 mg / mL, and the cells were incubated for an additional 2 hours. The culture medium was then carefully discarded, and the insoluble MTT formazan was solubilized by adding 100 L of DMSO. Cell viability was evaluated by measuring the absorbance of each well at 540 nm using a microplate reader (SpectraMax M3; Molecular Devices, San Jose, CA, USA).
[0111] 1.5. Trypan Blue Exclusion Assay
[0112] 2×10 cells in 12-well plates 4Cells were plated at a density of cells / well. After stabilization overnight, cells were treated with various concentrations of EPP (0.5–2.5 g / mL). 2 x 10⁶ cells were plated in a 12-well plate. 4 Cells were plated at a density of cells / well. After stabilization overnight, cells were treated with various concentrations of EPP (0.5–2.5 μg / mL). Cells were collected at 24, 48, and 72 hours after EPP treatment and suspended in phosphate-buffered saline (PBS; Donginbio, Seoul, Korea). The cell suspension was then mixed with an equal volume of 0.4% trypan blue solution (WelGENE). Blue-colored cells were considered dead, and the number of colorless living cells was counted using a hemocytometer.
[0114] 1.6. Colony Formation Assay
[0115] For the analysis of fixation-dependent colony formation, 2 x 10 cells were placed in 12-well plates. 2 Single-cell suspensions were plated at a density of cells / well. After stabilization overnight, cells were inoculated with varying concentrations of EPP (0.25–1 g / mL) and cultured for 14 days until colonies were fully grown. The culture medium containing EPP was replaced every 3 days. Colonies were fixed with methanol for 5 minutes, stained with hematoxylin (Sigma-Aldrich, St. Louis, MO, USA) for 30 minutes, and washed several times with distilled water (DW). All procedures were performed at room temperature. The fixation-independent colonization ability of cancer cells was evaluated using a soft agar assay.
[0116] First, 1% bottom agar prepared by diluting 4% SeaPlaque agarose (Lonza, Rockland, ME, USA) with warm culture medium was spread onto a 24-well plate and solidified at room temperature for 1 hour. Then, 1 x 10⁻⁶ 30.4% upper agar containing cells was added to the lower agar. After the upper agar had completely solidified at room temperature, 0.5 mL of warm culture medium containing various concentrations of EPP (0.5-2.5 μg / mL) was added to the upper agar at room temperature. On day 14 after treatment, colonies were stained by adding MTT solution to 0.5 mg / mL of culture medium and incubated at 37°C for 1.5 hours. Then, the culture medium was replaced with PBS, and colony images were taken using a digital camera (Canon, Tokyo, Japan).
[0118] 1.7. Flow Cytometry
[0119] 1 x 10⁶ cells in 6-well plates 5Cells were plated at a density of cells / well. After stabilization overnight, cells were treated with 1 μg / mL or 2.5 μg / mL EPP for 72 hours. For cell cycle analysis, cells were fixed in 80% ethyl alcohol at 4°C for 1 hour and stained for 30 minutes with 50 μg / mL propidium iodide (PI) solution supplemented with 30 μg / mL RNase A (Sigma-Aldrich). The cells were then washed and resuspended in PBS. Cell cycle distribution was analyzed by flow cytometry (FACSCaliber, Becton Dickinson and Company, San Jose, CA, USA). The percentage of cells with sub-G1 DNA content, considered to be the apoptotic population, was measured using CellQuest software. Apoptotic cells were also detected using annexin V-PI double staining assay. Cells treated with EPP (1 μg / mL or 2.5 μg / mL) for 72 hours were stained with Annexin V-FITC Apoptosis Detection Kit I (BD Biosciences Pharmingen, San Diego, CA, USA) according to the manufacturer's instructions. Stained cells were analyzed using a flow cytometer (FACSCaliber, Becton Dickinson and Company), and the percentage of Annexin V-positive cells was measured using CellQuest software.
[0121] 1.8. DAPI Staining
[0122] 1 x 10⁶ cells in 6-well plates 5Cells were plated at a density of cells / well. After stabilization overnight, cells were treated with 1 μg / mL or 2.5 μg / mL EPP for 72 hours. Subsequently, cells were fixed with 3.7% paraformaldehyde (Sigma-Aldrich) at 4°C for 30 minutes and resuspended in 200L of PBS. Then, cells were attached to a slide glass using Cytospin (Shandon Inc., Pittsburgh, PA, USA). For nuclear staining, cells were stained with 4,6-diamidino-2-phenylindole-dihydrochloride (DAPI) solution at a final concentration of 2.5 μg / mL for 10 minutes in the dark. After washing twice with PBS, cells were mounted in mounting medium (Biomeda, Foster City, CA, USA), and nuclei were observed at 200x magnification using a fluorescence microscope (Carl Zeiss AG, Oberkochen, Germany).
[0124] 1.9. Western Blot Analysis
[0125] Cells were lysed in cold RIPA buffer (Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific) and phosphatase inhibitors (1 mM Na3VO4 and 100 mM NaF). Protein concentrations for each sample were measured using a bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology, Rockford, IL, USA). Proteins were loaded (20 μg per lane) and separated by 8-12% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). The proteins were then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 3% bovine serum albumin (BSA, GenDEPOT, Barker, TX, USA) for 30 minutes, and immunoblotting was performed overnight at 4°C using primary antibodies labeled at a 1:1000 dilution. After washing several times with Tris-buffered saline (TBS) supplemented with 0.1% Tween-20 (TBST), the membrane was probed with a secondary antibody (1:10,000 dilution) for 1 hour at room temperature. Specific signals were detected using the D-Plus ECL Femto System (Dongin Bio, Seoul, Korea). The intensity of each stain was quantified using ImageJ software (version 1.52a; National Institutes of Health, Bethesda, MD, USA). All primary antibodies, except for the actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), were purchased from Cell Signaling Technology (Beverly, MA, USA), and the corresponding anti-mouse and anti-rabbit secondary antibodies were purchased from Bethyl Laboratories (Montgomery, Texas, USA) and Enzo Life Sciences (Farmingdale, New York, USA), respectively.
[0127] 1.10. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
[0128] Total RNA was extracted using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific) and quantified using a microplate reader (SpectraMax M3; Molecular Devices). Total RNA (1 μg) was used to synthesize first-strand cDNA using the PrimeScript RT reagent kit (Takara, Shiga, Japan). The cDNA template was diluted 50-fold in nuclease-free water, and real-time quantitative PCR analysis was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) with SYBR green (Enzynomics, Daejeon, Korea). The primer sequences and annealing temperatures for each gene are shown in Table 1 below.
[0129] Name Primer Sequence(5'→ 3') AT 1 (℃) MMP-2 Forward: CGC ATC TGG GGC TTT AAA CATReverse: CCA TTA GCG CCT CCA TCG TA 60 Cyclin D1 Forward : CCT GTC CTA CTA CCG CCT CAReverse : TCC TCC TCT TCC TCC TCC TC 55 Twist Forward : TGT CCG CGT CCC ACT AGCReverse : TGT CCA TTT TCT CCT TCT CTG GA 55 C-myc Forward: CTT CTC TCC GTC CTC GGA TTC TReverse: GAA GGT GAT CCA GAC TCT GAC CTT 55 VEGF Forward: AGG AGG AGG GCA GAA TCA TCAReverse: CTC GAT TGG ATG GCA GTA GCT 55 Bcl-Xl Forward : GTT CCC TTT CCT TCC ATC CReverse : TAG CCA GTC CAG AGG TGA G 55 Actin Forward : ACT ACC TCA TGA AGA TCReverse : GAT CCA CAT CTG CTG GAA 55
[0130] 1.11. Statistical Analysis
[0131] Each result is expressed as the mean standard deviation (SD) of three independent experiments. Statistical analysis was performed using the paired Student's t-test. Differences at p < 0.05 were considered statistically significant.
[0133] 2. Experimental Results
[0134] 2.1. Inhibition of Cell Growth by EPP in NSCLC Cells
[0135] The effects of EPP on the cell growth of NSCLC cells with different EGFR mutation states were investigated. As shown in Figures 1A-D below, H1299 (EGFR wild-type), PC9 (EGFR Glu746-Ala750 deletion mutation in exon 19, EGFR TKI sensitive), H1975 (EGFR L858R / T790M double mutation, EGFR TKI resistant), and PC9 / ER (erlotinib resistant) cells were reduced by EPP in a concentration- and time-dependent manner, which was measured by the MTT assay (Figures 1A-D). Results from the trypan blue exclusion assay also showed a concentration- and time-dependent decrease in cell proliferation after EPP treatment. Only 0.5 μg / mL of EPP was sufficient to exert an antiproliferative effect on NSCLC cells (Figures 1E-H). These results collectively demonstrate that EPP inhibits the cell growth of NSCLC cells regardless of the presence of EGFR mutation status and EGFR TKI resistance.
[0137] 2.2. Inhibition of Colony Formation by EPP in NSCLC Cells
[0138] Since cancer cells form colonies during tumorigenesis, the effect of EPP on colony formation in NSCLC cells with different EGFR mutation statuses was investigated. It was found that the number of H1299, PC9, H1975, and PC9 / ER cell colonies gradually decreased in a concentration-dependent manner 14 days after EPP treatment. Because the treatment period was longer than that of the MTT assay or trypan blue exclusion assay, very low concentrations of EPP (0.25 μg / mL) significantly inhibited NSCLC cell colony formation (Fig. 2A, B). A soft agar assay was additionally performed to mimic a 3D tumorigenetic environment.
[0139] As a result, EPP was found to reduce the number of H1299, PC9, and H1975 cell colonies in a dose-dependent manner (Fig. 2C, D). Although there was a tendency for colony formation to decrease after treatment with 0.5 μg / mL EPP, this change was not significant due to the high standard deviation. Treatment with EPP at 1 μg / mL or higher inhibited colony formation in the cell lines (Fig. 2C, D). Taken together, our observations indicate that EPP reduced the colony-forming ability of NSCLC cells at very low concentrations, regardless of EGFR mutation status or the presence of EGFR TKI resistance. These results suggest that EPP can be applied at the early stages of cancer to inhibit tumor formation.
[0141] 2.3. Induction of Apoptosis by EPP in NSCLC Cells
[0142] Flow cytometry was performed to investigate whether the antiproliferative and anticolonial effects of Angelica root extract (EPP) were associated with the induction of apoptosis. We observed that the percentage of cells with sub-G1 DNA content increased in a dose-dependent manner across four NSCLC cell lines (Fig. 3A). We obtained similar results when apoptosis was detected using annexin V-PI double staining assay. The proportion of annexin V-positive cells increased significantly after 72 hours of EPP treatment (Fig. 3B). Next, 40,6-diamidino-2-phenylindole (DAPI) staining assay was performed, as changes in nuclear morphology are another marker of apoptosis. As shown in Fig. 3C, the number of cells with condensed and fragmented nuclei, typical characteristics of apoptotic cells, increased in a concentration-dependent manner upon EPP treatment (Fig. 3C). Consistently, the expression of cleaved PARP and cleaved Caspase-3, marker proteins of apoptosis, was upregulated after EPP treatment (Fig. 3D). These results clearly indicate that EPP induces apoptosis in NSCLC cells regardless of the presence of EGFR mutation status and EGFR TKI resistance.
[0144] 2.4. Inactivation of STAT3 and AKT by EPP in NSCLC Cells
[0145] We explored the molecular mechanism by which EPP exerts anticancer activity in NSCLC cells. We observed that EPP induces apoptosis in both EGFR TKI-sensitive and EGFR TKI-resistant cells. From this, we hypothesized several molecular candidates, including AKT and STAT3, that contribute to cancer cell proliferation as well as the emergence of EGFR TKI resistance. The results showed that both STAT3 and AKT were dephosphorylated in a generally time-dependent manner by EPP treatment in four NSCLC cell lines (Fig. 4A). Consistently, mRNA levels of the STAT3 target gene tended to decrease in EPP-treated cells, suggesting that EPP attenuated the transcriptional activity of STAT3 (Fig. 4B).
[0147] 2.5. Blockade of the MET signaling pathway by EPP in NSCLC cells
[0148] The phosphorylation levels of MET, which is a potential upstream kinase of STAT3 and AKT, were investigated. As shown in Figure 5A below, hepatocyte growth factor (HGF) stimulated the phosphorylation of MET, which was prevented by EPP pretreatment. The phosphorylation levels of AKT also showed the same pattern as MET, indicating that MET was involved in regulating AKT activity (Figure 5A). However, HGF did not phosphorylate STAT3, suggesting that STAT3 activity may be regulated by a mechanism independent of MET (Figure 5A). Furthermore, MET phosphorylation induced by HGF was not inhibited by EPP in EGFR wild-type H1299 cells, indicating that the upstream targets of EPP regulating the activity of STAT3 and AKT may differ depending on the cell type (Figure 7).
[0149] Since MET amplification and protein hyperactivation are important resistance mechanisms for EGFR targeted therapies, it was hypothesized that EGFR TKI resistance could be overcome by applying EPP. In particular, it was found that while MET or AKT were not dephosphorylated in PC9 / ER cells after erlotinib treatment, their activity was completely inhibited by erlotinib in PC9 cells (Fig. 5B). These results suggest that MET activation may be associated with erlotinib resistance in PC9 / ER cells. An MTT assay was performed to determine whether MET activity is important for the induction of EGFR TKI resistance and whether EPP could inhibit erlotinib resistance. As shown in Fig. 5C, HGF treatment induced erlotinib resistance in PC9 cells, which was reversed by the combined treatment of erlotinib and EPP (Fig. 5C). Activation of the MET / AKT pathway was involved in HGF-induced erlotinib resistance, and EPP significantly inhibited the phosphorylation of MET and AKT in PC9 cells (Fig. 5D). Taken together, these results demonstrate that EPP exerts an anticancer effect not only in EGFR TKI-sensitive cells but also in EGFR TKI-resistant cells by inhibiting the MET signaling pathway.
[0151] 2.6. Identification of Specific Compounds Contributing to the Anticancer Effects of Angelica Root Extract (EPP)
[0152] High-performance liquid chromatography-mass spectrometry (HPLC-MS) analysis was performed to identify praeruptorin A (PA), a coumarin commonly found in the roots of Angelica dahurica, within EPP. Total chromatograms of PA and EPP were acquired at 330 nm via UV detection, and it was found that a peak of PA was detected at a retention time of 25.95 minutes (Fig. 8 and Table 2). The chromatogram of EPP also includes a peak with a retention time of 25.94 minutes. Furthermore, the molecular weight of the EPP peak detected by MS analysis was identical to that of PA at m / z 404.1 [M + H]+, indicating the presence of PA in EPP (Fig. 8 and Table 2). Since PA can be used for the standardization of Angelica dahurica roots, this demonstrates that standardized Angelica dahurica samples were used in this study.
[0153] Name RT 1 MS 2 [M+H] + (m / z) PA 3 25.95 404.0 EPP 4 peak 25.94 404.1
[0154] ( 1 RT: retention time, 2 MS: mass spectrometry, 3 PA: praeruptorin A, 4 EPP: the root extract of Peucedanum praeruptorum Dunn.)
[0155] Further investigation was conducted to determine which components of EPP contribute to its anticancer activity. NSCLC cells were treated with PA, praeruptorin B (PB), and pterixin (PX), coumarins contained in the roots of *Angelica dahurica*. Their chemical structures are shown in Fig. 6A below. As illustrated in Fig. 6B below, cell viability was significantly reduced by treatment with PA or PX in a concentration-dependent manner, whereas the growth inhibitory effect of PB in these cell lines was relatively negligible. Both PA and PX increased the proportion of annexin V-positive cells in H1975 cells and upregulated the cleavage of PARP, suggesting that PA and PX induced apoptosis (Figs. 6C,D). However, the expression of cleaved caspase-3 was increased only by PX and not by PA, indicating that the mechanisms by which PA and PX induce apoptosis may differ (Fig. 6D).
[0156] Next, we performed Western blot analysis to evaluate the effects of PA and PX on the activity of the MET signaling pathway. We found that PA and PX inhibited HGF-induced phosphorylation of MET in H1975 and PC9 / ER cells (Fig. 6E, F). STAT3 was not activated by HGF but was clearly dephosphorylated by treatment with PA or PX, which was consistent with the results in Fig. 5A (Fig. 6E, F). However, neither PA nor PX inhibited HGF-stimulated phosphorylation of AKT, suggesting that other components of EPP would inhibit AKT activity (Fig. 6E, F). AKT was dephosphorylated by PB, which was accompanied by a slight decrease in phospho-MET (Fig. 6G). Taken together, the results indicate that multiple components of EPP, including PA, PB, and PX, contribute to the anticancer activity of EPP in NSCLC cells.
[0158] [Experimental Example 2: Anticancer Activity of Trichosanthes Root Extract]
[0159] 1. Experimental Method
[0160] 1.1. Preparation of Trichosanthes root extract (TK)
[0161] The Trichosanthes kirilowii root extract was prepared as an alcohol extract by extracting 50 g of dried Trichosanthes kirilowii (Bonchomaru, Seoul, Korea) roots with 800 mL of 80% ethyl alcohol after sporadic ultrasonic treatment and incubation in a shaking incubator at 40°C with shaking (120 rpm). After 48 hours of incubation, the first extract was collected and stored at 4°C. The roots of Trichosanthes kirilowii were re-extracted by incubating them with 300 mL of 80% ethyl alcohol in a shaking incubator under the same conditions as the first extraction for 48 hours. The first and second extracts were combined, filtered, and concentrated using a vacuum rotary evaporator. The concentrated extract was freeze-dried for 72 hours to obtain 3.74 g of Trichosanthes kirilowii (TK) powder. The yield was 7.48%. Trichosanthes root (TK) powder was dissolved in dimethyl sulfoxide (DMSO; Amresco, Solon, OH, USA) at 50 mg / mL and stored at -80℃.
[0163] 1.2. Cell Culture
[0164] Human NSCLC cell lines H1299 (EGFR wild-type, primary EGFR TKI resistance) and H1975 (EGFR L858R / T790M double mutation, acquired EGFR TKI resistance) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). PC9 / ER (erlotinib-resistant PC9) and PC9 / GR (gefitinib-resistant PC9) cell lines were established as previously described. Cells were grown in RPMI-1640 medium (WelGENE, Daegu, Korea) supplemented with 100 mL / L fetal bovine serum (FBS; WelGENE), 100,000 U / L penicillin (WelGENE), and 100 mg / L streptomycin (WelGENE). Cells were cultured in a humidified atmosphere at 37°C and below 5% CO2. PC9 / ER and PC9 / GR cells were maintained in culture media containing erlotinib (10 μM) or gefitinib (10 μM), respectively.
[0166] 1.3. MTT Analysis
[0167] 2 x 10 cells 3Cells were seeded into 96-well plates at a density of cells / well. Cells were stabilized overnight and treated with indicated concentrations of TK (25–100 µg / mL) for 72 hours, after which MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Duchefa, Haarlem, The Netherlands] solution was added to the culture medium at a final concentration of 0.4 mg / mL. After 2 hours of incubation, the supernatant was discarded and MTT formazan was dissolved in 100 µl of DMSO. Then, the plates were shaken for 30 minutes until the formazan was completely dissolved, and the absorbance of each well was measured at a wavelength of 540 nm using a microplate reader (SpectraMax M3; Molecular Devices, San Jose, CA, USA).
[0169] 1.4. Trypan blue exclusion assay
[0170] 2 x 10 cells in 12-well plates 4 Cells were seeded at a density of cells / well. After stabilization overnight, cells were treated with TK at indicated concentrations (25–100 μg / mL). After 24–72 hours of treatment with Trichosanthes root extract (TK), cells were collected, washed, and stained with a final concentration of 0.1% trypan blue solution (WelGENE). Cells stained blue and unstained cells were considered dead and living cells, respectively. To evaluate the effect of Trichosanthes root extract (TK) on cell proliferation, the number of living cells was counted using a microscope (Leica, Wetzlar, Germany).
[0172] 1.5. Anchorage-dependent colony formation assay
[0173] Cells are placed in a 12-well plate at a ratio of 2 × 10⁶ 2Cells were inoculated at a density of cells / well. After stabilization overnight, cells were treated with the indicated concentration of TK (25-100 μg / mL) for 14 days. The medium containing the Trichosanthes root extract (TK) was replaced every 3 days. After 14 days, colonies were washed twice with phosphate-buffered saline (PBS), fixed with methanol for 10 minutes, and stained with hematoxylin (Sigma-Aldrich, St. Louis, MO, USA) for 30 minutes. Images of the colonies were obtained using a digital camera (Canon, Tokyo, Japan), and the number of colonies was counted.
[0175] 1.6. Soft agar assay
[0176] 4% SeaPlaque agarose (Lonza, Rockland, ME, USA) was dissolved and mixed with warm culture medium to prepare 1% bottom agar, which was layered onto 24-well plates and solidified at room temperature. Subsequently, cells (1 x 10⁶ 3 ...) was suspended in 0.5 mL of 0.4% agar (top agar), prepared by mixing complete RPMI-1640 medium and 1% agar in a 3:2 ratio, and added to the bottom agar. After solidifying the top agar, 500 µl of warm culture medium containing TK (25-100 µg / mL) was added to each well. The plates were incubated in a CO2 incubator for 14 days. The medium was replaced every 3 days. After 14 days of culture, MTT solution was added to the culture medium at a final concentration of 0.5 mg / mL, and the plates were incubated at 37°C for 2 hours. Afterward, the culture medium was discarded and replaced with 500 µl of PBS. Colony images were acquired using a digital camera (Canon), and the number of colonies was counted.
[0178] 1.7. Flow cytometry
[0179] 1 x 10 cells 5Cells were seeded into 6-well plates at a density of cells / well. After stabilization overnight, cells were treated with Trichosanthes root extract (TK) for 48 hours and subjected to flow cytometry analysis. For cell cycle analysis, cells were fixed in cold 80% ethanol overnight at -20°C and stained with 50 μL / mL of propidium iodide (PI) solution (Sigma-Aldrich) supplemented with 30 μg / mL of RNase A (Sigma) for 30 minutes. After centrifugation at 8000 rpm, the cell pellet was resuspended in 500 μL of PBS. DNA content at each stage of the cell cycle was determined using a flow cytometer (FACSCaliber, Becton Dickinson and Company, San Jose, CA, USA). For the Annexin V-PI double staining analysis, cells were stained with annexin V-FITC and PI using the Annexin V-FITC Apoptosis Detection Kit I according to the manufacturer's protocol (BD Biosciences Pharmingen, San Diego, CA, USA). The population of Annexin V-positive cells considered to be in apoptosis was measured via flow cytometry (FACSCaliber).
[0181] 1.8. DAPI staining
[0182] 1 x 10 cells 5Cells were seeded into 6-well plates at a density of cells / well. After stabilization overnight, cells were treated with TK (50, 100 µg / mL) for 72 hours. Then, cells were fixed in 3.7% paraformaldehyde (Sigma-Aldrich) at 4°C for 30 minutes and transferred to glass slides using Cytospin (Shandon Inc., Pittsburgh, PA, USA). Cells were stained with DAPI solution (2.5 µg / mL) at room temperature for 20 minutes, washed twice with PBS, and observed under a fluorescence microscope (Leica, Hamburg, Germany). Nucleal images were obtained at x200 magnification.
[0184] 1.9. Western blots
[0185] Cells treated under the indicated conditions were subjected to Western blot analysis as previously described. Specifically, cells were lysed in RIPA buffer (Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific) and phosphatase inhibitors (1 mM Na3VO4 and 100 mM NaF). Protein quantification was performed using a bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology), and 20 μg of each protein sample was separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). Membranes were blocked with 3% bovine serum albumin (BSA, GenDEPOT, Barker, TX, USA) and probed overnight at 4°C with specific primary antibodies (1:1000 dilution), followed by incubation with secondary antibodies (1:10,000 dilution) for 1 hour at room temperature. Specific signals were detected using the D-Plus ECL Femto System (Dongin Bio, Seoul, Korea). Primary antibodies against phospho-STAT3 (Y705), phospho-Src (Y416), phospho-AKT (S473), the phospho-mammalian target of rapamycin (mTOR, S2448), mTOR, and cleaved PARP were purchased from Cell Signaling Technology (Beverly, MA, USA). Primary antibodies against STAT3, Src, AKT, and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-mouse and anti-rabbit secondary antibodies were purchased from Bethyl Laboratories (Montgomery, TX, USA) and Enzo Life Sciences (Farmingdale, NY, USA), respectively.
[0187] 1.10. Transfection
[0188] 3 x 10 cells 5 Cells were seeded into 6-well plates at a density of cells / well. After stabilization overnight, cells were transfected with an empty vector using 1 µg of constitutively activated STAT3 plasmid (pExpress-STAT3Y705D) or Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. pExpress-STAT3Y705D was provided by Professor Ho-Young Lee (Seoul National University). After 48 hours of transfection, cells were subjected to Western blot to analyze STAT3 phosphorylation. Cells were reseeded after 30 hours of transfection for MTT analysis and flow cytometry. After stabilization overnight, cells were treated with the indicated concentration of Trichosanthes kirilowii extract (TK) for 48 hours, followed by MTT and annexin V-PI double staining analyses as described above.
[0190] 1.11. High-performance liquid chromatography-mass spectrometry (HPLC-MS)
[0191] HPLC was performed using an Agilent 1200 series HPLC system (Agilent Technologies, Santa Clara, CA, USA). Cucurbitacin B (ChemFaces, Wuhan, China) and Trichosanthes kirilowii (TK) powder were dissolved in methanol at concentrations of 1 mg / mL and 100 μg / mL, respectively, and diluted with acetonitrile to final concentrations of 100 μg / mL and 100 ng / mL, respectively. The solutions were separated using an InfinityLab Poroshell 120 EC C18 column (100 x 2.1 mm, 2.7 μm) with distilled water (DW) containing 0.1% formic acid and 5 mM ammonium formate as solvent A, and methanol containing 0.1% formic acid and 5 mM ammonium formate as solvent B.
[0192] The HPLC mobile phases were as follows: 90% solvent A and 10% solvent B for the initial 3 minutes, 5% solvent A and 95% solvent B for 4.5 minutes, and 90% solvent A and 10% solvent B for 2.5 minutes. The column temperature was 25°C and the flow rate was 0.3 mL / min. Electrospray ionization (ESI) mass spectra were recorded in cation mode using an Agilent 6410 Triple Quad LC / MS system (Agilent Technologies).
[0194] 1.12. Statistical analyses
[0195] Each result is expressed as the mean ± SD of the data obtained from the triple experiment. Statistical analysis was performed using Student's t-test. Differences with p < 0.05 were considered statistically significant.
[0197] 2. Experimental Results
[0198] 2.1 Inhibition of Cell Growth by Trichosanthes root extract (TK) in EGFR TKI-resistant Non-small Cell Lung Cancer (NSCLC) cells
[0199] Acquired EGFR TKI-resistant cells, including H1299, H1975, PC9 / ER, and PC9 / GR cells, were treated with different concentrations of TK (25-100 μg / mL) for 72 hours. As shown in Figure 1A below, treatment with Trichosanthes root extract (TK) reduced the viability of the four cell lines in a dose-dependent manner (Figure 9A). The IC50 values ranged from 50 to 100 μg / mL for H1299, H1975, and PC9 / GR cells, and from 25 to 50 μg / mL for PC9 / ER cells. The IC50 of Trichosanthes root extract (TK) was 63.86 μg / mL in H1299 cells. Consistently, treatment with Trichosanthes root extract (TK) inhibited cell proliferation in four cell lines in a dose- and time-dependent manner (Fig. 9B). The antiproliferative effect of Trichosanthes root extract (TK) was observed 24 hours after treatment with Trichosanthes root extract (TK) (Fig. 9B). These results suggest that TK treatment attenuates the cell growth of EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells.
[0201] 2.2. Inhibition of Colony Formation by Trichosanthes root extract (TK) in EGFR TKI-resistant Non-small Cell Lung Cancer (NSCLC) cells
[0202] Next, the effect of Trichosanthes root extract (TK) on colony formation in EGFR TKI-resistant non-small cell lung cancer (NSCLC) was investigated. Cells were inoculated as single cells and treated with different concentrations of Trichosanthes root extract (TK) for 14 days. Fixation-dependent colony formation analysis showed that the number of colonies was significantly reduced by TK treatment in H1299, H1975, and PC9 / ER cells, using a TK concentration of 25 μg / mL sufficient to block colony formation (Figs. 10A and 10B). Similar results were obtained in a soft agar analysis mimicking the 3D environment of tumorigenesis. As shown in Figs. 10C and 10D, colony formation in H1299 and H1975 cells was completely inhibited by 25 μg / ml of TK (Figs. 10C and 10D). In summary, the above results showed that TK treatment inhibited the colonization ability of EGFR TKI-resistant NSCLC cells, suggesting that TK can block tumor initiation.
[0204] 2.3. Induction of Apoptosis by Trichosanthes root extract (TK) in EGFR TKI-resistant Non-small Cell Lung Cancer (NSCLC) cells
[0205] Dysregulation of apoptosis generally occurs in the pathogenesis of cancer. Therefore, restoring the apoptosis signaling pathway in cancer cells is an important strategy for eliminating cancer. To investigate whether Trichosanthes kirilowii extract (TK) induces apoptosis in EGFR TKI-resistant NSCLC cells, flow cytometry was first performed. Cell cycle analysis revealed that the concentration of sub-G1 DNA, a general marker of apoptosis, gradually increased in a concentration-dependent manner across four cell lines (Fig. 11A). Consistently, annexin V-positive apoptotic cells significantly increased upon treatment with Trichosanthes kirilowii extract (TK) (Fig. 11B).
[0206] Similar results were obtained when determining apoptosis by DAPI staining. Apoptotic nuclei are characterized by chromatin condensation and DNA fragmentation, indicating that treatment with Trichosanthes root extract (TK) increased the proportion of condensed and fragmented nuclei in EGFR TKI-resistant cells in a dose-dependent manner (Fig. 11C).
[0207] Finally, the expression of cleaved PARP, a marker protein for apoptosis, was analyzed after treatment with Trichosanthes root extract (TK). Treatment with TK strongly induced the cleaving of PARP in four cell lines (Fig. 11D). Taken together, the results indicate that TK triggered apoptotic cell death in EGFR TKI-resistant NSCLC cells, which is related to TK's antiproliferative and anticolonial effects.
[0209] 2.4. Inactivation of STAT3 by Trichosanthes root extract (TK) in EGFR TKI-resistant non-small cell lung cancer (NSCLC) cells
[0210] Next, we explored the molecular mechanisms underlying the anticancer effects of TK in EGFR TKI-resistant NSCLC cells. We focused primarily on STAT3 activity, which is associated with cancer cell survival and proliferation. Furthermore, recent studies suggest abnormal STAT3 pathways in EGFR TKI resistance. As shown in Figures 12A and 12B below, TK treatment downregulated STAT3 phosphorylation in EGFR TKI-resistant cells. Src, a non-receptor tyrosine kinase and upstream kinase of STAT3, was consistently dephosphorylated by TK in a time-dependent manner. Since Src was inactivated prior to STAT3, it can be viewed as an upstream target of TK (Figures 12A and 12B). Taken together, the above results demonstrate that treatment with Trichosanthes root extract (TK) inactivates the Src / STAT3 pathway in EGFR TKI-resistant NSCLC cells.
[0212] 2.5. STAT3 Activation Reversal of Apoptosis Induced by Trichosanthes Root Extract (TK) in EGFR TKI-Resistant Non-Small Cell Lung Cancer (NSCLC) Cells
[0213] To investigate whether STAT3 mediates the anticancer effects of TK, H1975 cells were transfected with constitutively active STAT3. It was hypothesized that constitutively activating STAT3 by the Y705D mutation impairs the antiproliferative effects of TK. As shown in Figure 5A below, STAT3 was strongly phosphorylated by transfection with constitutively activated STAT3 (Figure 13A). Furthermore, as expected, H1975 cells activated with STAT3 exhibited high tolerance to TK treatment compared to cells transfected with an empty vector (EV). After treatment with 50 μg / mL or 100 μg / mL TK, the cell viability of EV-transfected cells was 51.24% and 43.77%, respectively, while for STAT3-activated cells, it was 85.27% and 64.81%, respectively (Figure 13B). The proportion of apoptotic cells also decreased from 77.56% to 45.37% after transfection with phospho-mimetic STAT3 Y705D (Fig. 13C). Collectively, the above results indicate that apoptosis induced by the Trichosanthes root extract (TK) was reversed by STAT3 activation, which indicates that TK exerted an anticancer effect on EGFR TKI-resistant NSCLC cells through the inactivation of STAT3.
[0214] However, certain cell populations still underwent apoptosis after TK treatment even after STAT3 activation, suggesting the presence of other molecules mediating TK-induced apoptosis. We observed that AKT and mTOR were dephosphorylated by TK treatment in a time-dependent manner in EGFR TKI-resistant NSCLC cells, suggesting that AKT is another target of TK (Fig. 15).
[0216] 2.6. HPLC-MS Analysis of TK
[0217] HPLC-MS analysis was performed to identify cucurbitacin B, a triterpenoid compound commonly used as a marker component of *T. kirilowii*, in *T. kirilowii* root extract (TK). Cucurbitacin B is also reported to possess potent anticancer effects. The total chromatograms of cucurbitacin B and TK showed similar peaks at a retention time of 7.3 minutes (Fig. 14 and Table 3). According to the MS data, the molecular weight of the TK peak is m / z 581.5 [M+H]+, which is similar to that of cucurbitacin B (Fig. 14 and Table 3). These results clearly indicate the presence of cucurbitacin B in TK.
[0218] Name RT 1 (minutes) MS 2 [M+H] + (m / z) Cucurbitacin B 7.3 581.5 ETK peak 7.3 581.5
[0219] ( 1 RT: retention time, 2 MS: mass spectrometry)
[0220] [Experimental Example 3: Anticancer Effect of Pinellia Extract]
[0221] 1. Experimental Method
[0222] 1.1. Preparation of Pinellia Extract (ETPT)
[0223] Pinellia ternata was purchased from Bonchomaru Co., Ltd. (Seoul, Korea). First, 50 g of Pinellia ternata was finely crushed, and 800 ml of 80% ethanol was added and sonicated in an ultrasonic cleaner for 20 minutes. After repeating sonication three times, extraction was carried out for 48 hours at 40°C with stirring at 120 rpm. The extract was filtered and collected, and 300 ml of 80% ethanol was added to the Pinellia ternata again for a second extraction at 40°C with stirring at 120 rpm for 24 hours. The second extract was also filtered, combined with the first extract, and subjected to vacuum concentration and freeze-drying. The 1.87 g of powder (yield 3.74%) obtained as a result was dissolved in dimethylsulfoxide (DMSO; Amresco, Solon, OH, USA) at 100 mg / mL and used, and was named ETPT (ethanol extract of the tuber of Pinellia ternata (Thunb.) Brei).
[0225] 1.2. Cell Culture
[0226] RAW 264.7 mouse macrophages were obtained from Professor Young-Hyun Choi of Dong-Eui University, and the THP-1 human mononuclear cell line and H1299 human lung cancer cell line were purchased from the American Type Culture Collection (Rockville, MD, USA). The Lewis lung carcinoma (LLC) mouse lung cancer cell line was obtained from Professor Ki-Tae Ha of Pusan National University. THP-1, H1299, and LLC cells were cultured in RPMI-1640 (WelGENE, Seoul, Korea) medium, while RAW 264.7 cells were cultured in DMEM (WelGENE) medium. In all cases, 10% fatal bovine serum (FBS; WelGENE) and 1% penicillin-streptomycin (WelGENE) were added to 90% of the medium, and subcultures were performed every 3 days at 37°C under 5% CO2 conditions. THP-1 cells were differentiated into macrophages by treating them with 100 ng / ml phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St Louis, MO, USA) for 24 hours and used in experiments, and were named THP-1 macrophages.
[0228] 1.3. MTT assay
[0229] RAW 264.7 cells and THP-1 macrophages were placed in a 96-well plate at a ratio of 1 × 10⁶, respectively. 4 Pieces, 3×10 4After dispensing, the cells were stabilized for 24 hours. The following day, ETPT was added at various concentrations (0, 10, 25, 50, 100 µg / ml) and cultured for 24 hours. Subsequently, MTT reagent (Duchefa, Haarlem, The Netherlands) was added to the cell culture medium to a concentration of 0.4 mg / ml, and the mixture was incubated in a CO2 incubator for 2 hours. After removing the cell culture medium from each well, the formazin formed at the bottom was completely dissolved in 100 µl of DMSO. Absorbance was measured at 540 nm using a microplate reader (Molecular Devices, Sunnyvale, CA, USA), and cell viability was calculated based on the OD value.
[0231] 1.4. Transwell migration assay
[0232] We confirmed whether ETPT can regulate the migration of macrophages toward cancer cells using a transwell migration assay. First, the outer membrane of the upper chamber of a 24-well transwell (8.0 µm pore size; Corning, NY, USA) was coated with 0.1% gelatin (Sciencell, Carlsbad, CA, USA) and allowed to solidify at room temperature for 30 minutes. Subsequently, RAW 264.7 cells and THP-1 macrophages were suspended in serum-free medium, and 3×10⁶ cells were placed in the upper chamber, respectively. 5 Pieces, 5×10 5ETPT was treated at various concentrations while dispensing cells individually. 500 µl of conditioned media (CM) collected from H1299 cells was dispensed into the lower chamber. After incubating in a CO2 incubator for 24 hours, the upper chamber was fixed with methanol for 5 minutes and stained with hematoxylin (Sigma-Aldrich) for 30 minutes. Subsequently, the intermembrane was excised, mounted, and observed under a microscope (Carl Zeiss, Oberkochen, Germany) to count the number of migrated cells. The CM of H1299 cells was prepared in the following manner. H1299 cells were dispensed into 100 π dishes, and the next day, the cell culture medium was removed and 4 ml of serum-free medium was added. After incubating for 24 hours, the collected cell culture medium was filtered and used as the CM. Next, to investigate whether ETPT regulates the M2 polarization of macrophages and ultimately affects the motility of cancer cells, 3×10 LLC cells suspended in serum-free medium were placed in the upper chamber of a transwell. 5 The cells were dispensed, and 500 µl of CM collected from RAW 264.7 cells was dispensed into the lower chamber. After 24 hours of culture, the migrated LLC cells were counted in the manner described above. The CM of RAW 264.7 cells was collected in the following manner. RAW 264.7 cells were dispensed into a 100 π dish and stabilized; then, IL-6 (100 ng / mL) was added to polarize them into M2 macrophages, while ETPT (100 µg / mL) was added simultaneously. After 24 hours of culture, the cell culture medium was removed, 4 mL of serum-free medium was added, and the cells were cultured again for 24 hours. The collected cell culture medium was filtered and used as CM.
[0234] 1.5. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
[0235] RAW 264.7 cells were seeded into a 6-well plate and stabilized. They were then treated with 100 ng / mL IL-4 (PeproTech, Rocky Hill, NJ, USA) or 100 ng / mL IL-6 (PeproTech) to polarize them into M2 macrophages, while simultaneously being treated with ETPT at various concentrations (0, 50, 100 μg / mL). After 24 hours of incubation, total RNA was isolated from the cells using TRIzol reagent (Invitrogen Co., Carlsbad, CA, USA). 1 μg of total RNA was synthesized into cDNA using the PrimeScript RT reagent kit (Takara, Japan) and diluted 1:50 in nuclease-free water for use. Diluted cDNA, primers for the target gene, and CYBR green (Enzynomics, Daejeon, Korea) were mixed, and quantitative real-time PCR analysis was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The primer sequences and annealing temperatures used are shown in Table 4 below.
[0236] Gene Sequence(5'→3') Annealing temperature(°C) Arginase-1 F:AACCAGCTCTGGGAATCTGCR:TCCATCACCTTGCCAATCCC 55 Mannose receptor C type 1 (MRC-1) F:CTCTGTTCAGCTATTGGACGR:CGGAATTTCTGGGATTCAGCTTC 55 IL-10 F:CTCTTACTGACTGGCATGAGGATR:GAGTCGGTTAGCAGTATGTTGT 55 ACTB(β-actin) F:ACTACCTCATGAAGATCR:GATCCACATCTGCTGGAA 55
[0237] 1.6. Western Blot
[0238] RAW 264.7 cells were seeded into a 6-well plate, and on the next day, ETPT was administered simultaneously with IL-4 (100 ng / mL) or IL-6 (100 ng / mL) to polarize them into M2 macrophages. After 24 hours of incubation, proteins were isolated using lysis buffer containing a protease inhibitor cocktail (Thermo Fisher Scientific) and phosphatase inhibitors (1 mM Na3VO4, 100 mM NaF) in RIPA buffer (Thermo Fisher Scientific, San Jose, CA, USA). Proteins were quantified using a Bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology, Rockford, IL, USA), and 20 µg of protein was separated by SDS-PAGE and transferred to a PVDF membrane (Millipore Corporation, Bedford, MA). After blocking with 3% bovine serum albumin (BSA, GenDEPOT, TX, USA) at room temperature for 30 minutes, the antibody was incubated overnight at 4°C with the primary antibody diluted 1:1000 in blocking buffer. The following day, the antibody was incubated for 1 hour at room temperature with the secondary antibody diluted 1:10000 in 3% skim milk, and protein expression was confirmed using a D-Plus ECL Femto System (Donginbio, Seoul, Korea). Phosphorylated STAT3 and total STAT3 antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA), and phosphorylated STAT6, total STAT6, and actin antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA).The goat anti-rabbit secondary antibody was purchased from Enzo Life Sciences (Farmingdale, NY, USA).
[0240] 1.7. Statistical Analysis
[0241] All experimental results were expressed as mean ± standard deviation (SD), and a P < 0.05 value was determined to be statistically significant using Student's t-test.
[0243] 2. Experimental Results
[0244] 2.1. Setting the Concentration of Pinellia Extract (ETPT) That Does Not Affect Macrophage Proliferation
[0245] First, to establish concentration conditions where ETPT does not affect macrophage proliferation, RAW 264.7 cells and THP-1 macrophages were treated with ETPT at various concentrations (0, 10, 25, 50, 100 μg / ml) for 24 hours, followed by an MTT assay. As a result, as shown in Figure 16 below, even after treatment with the highest concentration of ETPT at 100 μg / ml, the survival rates of RAW 264.7 cells and THP-1 macrophages were 97.01±8.74% and 105.57±7.81%, respectively, and no statistically significant difference was observed compared to the control group (Figures 16A and 16B). Therefore, it was determined that ETPT up to 100 μg / ml does not affect macrophage proliferation, and subsequent experiments were conducted with 100 μg / ml as the highest concentration.
[0247] 2.2. Effects of Pinellia Extract (ETPT) on Macrophage Mobility Toward Cancer Cells
[0248] As an anticancer strategy through the regulation of tumor-associated macrophages, there is a strategy to block the attraction of circulating monocytes in the blood or macrophages residing in tissues to the location of the tumor4,6). Accordingly, a transwell migration assay was performed to investigate whether ETPT can regulate the migration of macrophages to cancer cells.
[0249] First, the degree of macrophage migration was determined by counting the number of RAW 264.7 cells and THP-1 macrophages migrating to the down chamber when CM collected from H1299 human lung cancer cell lines was used as a chemoattractant in the manner shown in Figures 17A and 17D below (Figures 17A and 17D). As a result, it was confirmed that the migration ability of both RAW 264.7 cells and THP-1 macrophages decreased in a concentration-dependent manner upon ETPT treatment (Figures 17B and 17E). In the case of RAW 264.7 cells, no significant decrease in migration ability was observed in the ETPT 25 µg / ml treatment group; however, in the 50 µg / ml and 100 µg / ml treatment groups, only 63.15±4.89% and 12.42±1.74% of cells, respectively, migrated compared to the control group, showing a significant decrease in migration ability (Figure 17C). THP-1 macrophages also showed a similar trend, exhibiting reduced migration ability of 66.41±1.71% and 61.12±1.71% in the 50 µg / ml and 100 µg / ml treatment groups, respectively, compared to the control group (Fig. 17F). These results suggest that ETPT may partially inhibit the active migration of macrophages toward the location of the tumor.
[0251] 2.3. Effects of Pinellia Extract (ETPT) on M2 Macrophage Polarization
[0252] Another anticancer strategy involving the regulation of tumor-associated macrophages is to block M2 polarization of these cells. This is because macrophages polarized to the M2 type are known to be factors that exacerbate cancer through immunosuppressive effects and the promotion of angiogenesis. Accordingly, in this study, to investigate whether ETPT can regulate M2 polarization of macrophages, RAW 264.7 cells were treated with IL-6 or IL-4, representative cytokines that induce M2 polarization, while simultaneously being treated with ETPT for 24 hours. We then confirmed, using real-time qPCR, how the expression of M2 macrophage marker genes changed. First, treatment with IL-6 (100 ng / ml) resulted in a 2.72±0.14-fold, 5.23±0.24-fold, and 35.27±3.02-fold increase in the expression of arginase-1, MRC-1, and IL-10 genes, respectively, confirming that M2 polarization was successfully achieved. The expression of M2 macrophage markers increased by IL-6 was reduced in a concentration-dependent manner by ETPT, with arginase-1 in the 50 µg / ml and 100 µg / ml treatment groups showing expression levels 1.45±0.12-fold and 0.65±0.05-fold, MRC-1 1.47±0.05-fold and 1.11±0.11-fold, and IL-10 16.92±0.81-fold and 11.31±2.01-fold, respectively, compared to the control group (Fig. 18A). Similar results were obtained when M2-type polarization was induced with IL-4 (100 ng / ml). Upon treatment with IL-4, the expression of arginase-1 and MRC-1 genes increased by 4.45±0.3 times and 11.58±0.48 times, respectively, compared to the control group. When ETPT 50 µg / ml and 100 µg / ml were co-treated with IL-4, arginase-1 decreased by 2.81±0.26 times and 2.61±0.22 times, respectively, and MRC-1 decreased by 3.98±0.31 times and 3.27±0.39 times, respectively (Fig. 18B). These results suggest that EPTP can inhibit M2-type polarization in macrophages.
[0254] 2.4. Effects of Pinellia Extract (ETPT) on the Phosphorylation of STAT3 and STAT6
[0255] Next, we explored the molecular mechanisms by which EPTP can inhibit polarization into M2 macrophages. Generally, signal transducer and activator of transcription 3 (STAT3) and STAT6 are known to be involved in M2 polarization of macrophages. In particular, STAT6 mediates M2 polarization induced by IL-4 or IL-13, while STAT3 is reported to mediate M2 polarization induced by IL-4 / IL-13 as well as IL-6. Accordingly, we confirmed by Western blot whether ETPT could regulate the phosphorylation of STAT3 and STAT6. As a result, treatment of RAW 264.7 cells with IL-6 significantly increased the phosphorylation of STAT3, and co-treatment with ETPT confirmed that STAT3 was dephosphorylated in a concentration-dependent manner (Fig. 19A). Phosphorylation of STAT3 and STAT6 was increased by IL-4 treatment, and decreased by ETPT 100 μg / ml treatment (Fig. 19B). These results show that ETPT can inhibit M2-type polarization of macrophages induced by IL-6 and IL-4 by inhibiting the activity of STAT3 and STAT6.
[0257] 2.5. Effects of Pinellia Extract (ETPT) on Cancer Cell Migration Increased by M2 Macrophages
[0258] M2 macrophages are known to exacerbate cancer by secreting factors favorable for the metastasis of cancer cells. Therefore, a transwell assay was performed to investigate whether IL-6-induced M2 macrophages actually promote the migration of cancer cells and whether ETPT can inhibit the migration of promoted cancer cells.
[0259] First, as shown in Fig. 20A below, RAW 264.7 cells were treated with IL-6 alone or in combination with ETPT, and the collected CMs were inoculated into the lower chamber of a transwell plate, while LLC mouse lung cancer cell lines were inoculated into the upper chamber. Cells that migrated to the lower chamber were observed for 24 hours (Fig. 20A). As a result, the CMs collected from RAW 264.7 cells treated with IL-6 alone significantly increased the migration of LLC cells by 129.88±9.31% compared to the control group, whereas the CMs treated with IL-6 and ETPT simultaneously reduced the migration of LLC cells to 74.22±7.3% (Figs. 20B and 20C). These results demonstrate that the migration ability of cancer cells is increased by the M2 polarization of macrophages, and that ETPT can inhibit this.
[0261] [Preparation Example 1: Preparation of Mixed Extract]
[0262] A mixed composition (MX) was prepared by mixing extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata within the weight ranges shown in Table 5 below.
[0263] MX1 MX2 MX3 MX4 MX5 MX6 MX7 MX8 MX9 MX10 Jeonho (EPP) 100 - - 100 100 100 100 100 100 100 Trichosanthes root (TK) - 100 - 100 - 60 80 100 120 140 Banha (ETPT) - - 100 - 100 60 80 100 120 140
[0264] (Unit: parts by weight)
[0265] [Experimental Example 4: Anticancer activity of mixed extract of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata]
[0266] As in Experimental Examples 1 to 3 above, the anticancer activity of the extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata was confirmed, and to investigate the anticancer activity resulting from the mixing of these, the anticancer activity of the mixed composition (MX1 to MX10) prepared in Preparation Example 1 above was confirmed.
[0268] 4-1. Anticancer activity in NSCLC cells
[0269] The experiment was conducted in the same manner as the experimental procedure for the Angelica extract (EPP) of Experimental Example 1 above, and the experiment was carried out by changing only the extract to MX2 to MX10. For comparison of the experiment, the Angelica extract was fixed at index 3 and the results are comprehensively presented in Table 6 below.
[0270] MX1(EPP) MX2 MX3 MX4 MX5 MX6 MX7 MX8 MX9 MX10 Cell growth inhibition 3 2 2 4 4 5 9 9 9 6 Colony formation inhibition 3 2 1 4 5 6 8 9 9 6 Induction of apoptosis 3 1 2 5 4 6 8 9 9 6 Disable STAT3 and AKT 3 1 1 4 5 6 8 8 9 7 Blocking the MET signal transmission path 3 2 2 4 5 6 9 9 9 6
[0271] (Unit: Exponential)
[0272] Referring to Table 6 above, experiments were conducted on the Angelica root extract and Pinellia root extract with the Angelica root extract of the present invention fixed at index 3. As a result, regarding the inhibition of cell growth, inhibition of colony formation, induction of apoptosis, inactivation of STAT3 and ATC, and blockage of the MET signaling pathway by the Angelica root extract in NSCLC cells, the experimental results of the Angelica root extract and Pinellia root extract respectively showed lower levels of activity compared to the Angelica root extract, confirming that the activity of the Angelica root extract is the best among single extracts.
[0273] In the case of MX4 and MX5, which contain Angelica root extract and either Trichosanthes root extract or Pinellia root extract, respectively, an enhanced effect due to mixed use was confirmed, and in MX6 to MX10, which contain Angelica root, Trichosanthes root, and Pinellia root, the effect was further enhanced.
[0274] In particular, it was confirmed that MX7 to MX9, which contain preferred weight parts of Angelica gigas extract, Trichosanthes kirilowii root extract, and Pinellia ternata extract, exhibit superior activity compared to cases where the weight parts are excluded.
[0275] Accordingly, while the single extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata all exhibit anticancer activity, the activity is enhanced in the case of a mixed composition containing Angelica dahurica and Trichosanthes kirilowii or Angelica dahurica and Pinellia ternata, which means that the enhanced effect resulting from the mixing of active ingredients is shown through the fact that it exhibits superior anticancer activity compared to when all three of the above natural products are included.
[0276] In other words, it was confirmed that extracts of *Jeonho*, *Gwarugeun*, and *Banha* exhibited excellent effects in inhibiting cell growth and colony formation and inducing apoptosis in NSCLC cells, while also demonstrating anticancer activity by inhibiting the STAT3 and MET / AKT pathways that stimulate tumor growth and confer EGFR TKI resistance.
[0278] 4-2. Anticancer activity in EGFR TKI-resistant NSCLC cells
[0279] The experiment was conducted in the same manner as the experimental procedure for the Trichosanthes root extract (TK) of Experimental Example 2 above, but with only the extract changed to MX1 to MX10. For comparison of the experiment, the Trichosanthes root extract (TK) was fixed at index 3 and the results are comprehensively presented in Table 7 below.
[0280] MX1 MX2(TK) MX3 MX4 MX5 MX6 MX7 MX8 MX9 MX10 Cell growth inhibition 2 3 2 5 5 6 9 9 9 6 Colony formation inhibition 3 3 2 5 5 7 9 9 9 7 Induction of apoptosis 2 3 3 6 5 7 8 9 9 7 Disable Src / STAT3 path 2 3 2 5 6 7 8 9 9 7
[0281] (Unit: Exponential)
[0282] Referring to Table 7 above, the experiment was conducted with the experimental results of the Trichosanthes root extract (TK) fixed at an index of 3. As a result, it was confirmed that the Trichosanthes root extract had the best effect among single extracts in terms of inhibiting cell growth, inhibiting colony formation, inducing apoptosis, and inactivating the Src / STAT3 pathway in EGFR TKI-resistant non-small cell lung cancer cells.
[0283] However, it was confirmed that the activity was further enhanced in the case of MX4 and MX5, which include Angelica dahurica and Trichosanthes kirilowii, and Angelica dahurica and Pinellia ternata, and that the effect was further enhanced in the case of MX6 to MX10, which include all of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata, indicating that the enhancement effect is due to the mixing of the active ingredients of each natural product. Furthermore, in the case of MX7 to MX9, which include the preferred weight parts, superior activity was exhibited, confirming that excellent anticancer effects can be achieved when containing 80 to 120 parts by weight of Trichosanthes kirilowii extract and 80 to 120 parts by weight of Pinellia ternata extract per 100 parts by weight of Angelica dahurica extract.
[0284] In other words, it can be seen that by inactivating STAT3 with the above extract, cell growth and colony formation in EGFR TKI-resistant NSCLC cells are inhibited and apoptosis is induced.
[0286] 4-3. Anticancer activity through inhibition of macrophage or cancer cell migration ability
[0287] The experiment was conducted in the same manner as the experimental procedure for the Pinellia extract (ETPT) of Experimental Example 3 above, and the experiment was carried out by changing only the extract to MX1 to MX10. For comparison of the experiment, the Pinellia extract (ETPT) was fixed at index 3 and the results are comprehensively presented in Table 8 below.
[0288] MX1 MX2 MX3(ETPT) MX4 MX5 MX6 MX7 MX8 MX9 MX10 Inhibition of macrophage migration ability 2 2 3 4 5 6 9 9 9 6 Inhibition of M2 macrophage polarization 3 3 3 5 5 7 9 9 9 7 STAT3 / STAT6 phosphorylation inhibition 2 2 3 5 6 7 8 9 9 7 Inhibition of cancer cell migration 2 2 3 5 6 7 8 9 9 7
[0289] (Unit: Exponential)
[0290] Referring to Table 8 above, when comparing the experimental results with the exponent fixed at 3 for the Pinellia extract (ETPT), it was confirmed that among the extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata, the single extract of Pinellia ternata had the most superior effect in inhibiting the migration of macrophages toward cancer cells, inhibiting M2 polarization of macrophages, inhibiting STAT3 / STAT6 phosphorylation, and inhibiting the migration of cancer cells.
[0291] In the case of MX4 and MX5, which are mixtures of Angelica dahurica and Trichosanthes kirilowii or Angelica dahurica and Pinellia ternata extracts, it was confirmed that an enhanced effect was observed due to the mixed use, and in the case of MX6 to MX10, which contain all of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata extracts, it was confirmed that they exhibited even more enhanced anticancer activity. In particular, MX7 to MX9, which contain the preferred weight parts, showed superior activity, confirming that excellent anticancer effects can be achieved when containing 80 to 120 parts by weight of Trichosanthes kirilowii extract and 80 to 120 parts by weight of Pinellia ternata extract per 100 parts by weight of Angelica dahurica extract.
[0292] In other words, it can be seen that the above extract inhibits the enhanced migration ability of macrophages to cancer cells and inhibits M2 polarization of macrophages through the inactivation of STAT3 and STAT6, and can inhibit cancer metastasis by reducing the increased migration ability of cancer cells caused by M2-polarized macrophages.
[0294] [Preparation Example 2: Preparation of Other Natural Extracts]
[0295] 1. Preparation of a single extract
[0296] After washing, drying, and grinding the mortar and pestle, 100g of the ground powder was placed in 2L of ethanol, which is an extraction solvent, and mixed by shaking at 120rpm for 24 hours at 25℃.
[0297] The resulting extract of *Jellywort* was filtered through Whatman No. 2 filter paper, and the solvent was removed using a vacuum rotary evaporator (N-1000S) to obtain the powder of the *Jellywort* extract (JE). The powder of the *Jellywort* extract (JE) was dissolved in dimethyl sulfoxide (DMSO) to prepare a 100 mg / ml stock solution, which was then stored at 4°C. The stock solution was diluted to the desired concentration using physiological saline to proceed with the experiment.
[0298] A *Chamnareum vulgaris* extract (CE) was prepared using the same method as the *Jewel-leaved-beast
[0300] 2. Preparation of composite composition
[0301] A composite composition (AMX1 to AMX7) was prepared by mixing the extract of *Jewel-leafed Cinnamomum* (JE) and *Pteris multifida* (CE) prepared in Preparation Example 2 with MX8 (a mixed composition of *Angelica dahurica* extract, *Triangularia root* extract, and Pinellia ternata* extract), which showed the best effect in Experimental Example 4 above, within the weight range shown in Table 9 below.
[0302] MX8 AMX1 AMX2 AMX3 AMX4 AMX5 AMX6 AMX7 Jeonho (EPP) 100 100 100 100 100 100 100 100 Trichosanthes root (TK) 100 100 100 100 100 100 100 100 Banha (ETPT) 100 100 100 100 100 100 100 100 Jeolgutdae (JE) - 50 - 30 40 50 60 70 Chamnarae batweed (CE) - - 50 30 40 50 60 70
[0303] (Unit: parts by weight)
[0304] [Experimental Example 5: Anticancer activity of the complex composition]
[0305] To confirm the degree of improvement in anticancer activity by mixing the natural extracts *Jewel-leafed Cinnamomum* (JE) and *Pteris multifida* (CE), the same experiment as in Experimental Example 4 was conducted, and only the composition used was changed to the composite composition of Table 9 above, and the results are comprehensively shown in Table 10 below.
[0306] For comparison of experimental results, the experimental results of the MX8 composition were fixed at an index of 5 to show relative experimental results, and were expressed as an index from 1 to 10, and the result indicates that the higher the number, the better the effect.
[0307] MX8 AMX1 AMX2 AMX3 AMX4 AMX5 AMX6 AMX7 Anticancer activity in NSCLC cells 5 6 6 6 8 9 9 6 Anticancer activity in EGFR TKI-resistant NSCLC cells 5 6 6 7 8 9 9 7 Anticancer activity through inhibition of macrophage or cancer cell migration ability 5 6 6 7 9 9 9 7
[0308] (Unit: Exponential)
[0309] Referring to Table 10 above, it can be seen that the effects of AMX1 to AMX7 are more enhanced compared to the composition MX8 of the present invention, and this is due to the additional inclusion of extracts of *Jeolgukdae* and *Chamnareum* in addition to the extracts of *Jeonho*, *Gwarugeun*, and *Banha*.
[0310] In the case of AMX1 and AMX2, which further include extracts of *Jeolgukdae* or *Chamnareum* in addition to MX8 (including *Jeonho*, *Gwarugeun*, and *Banha*), enhanced activity in anticancer effects on NCLCL cells and anticancer activity on EGFR TKI-resistant NSCLC cells can be confirmed, and through the improved inhibitory activity on the migration ability of macrophages or cancer cells, it can be seen that anticancer activity can be enhanced by including extracts of *Jeolgukdae* and *Chamnareum*.
[0311] In particular, AMX3 to AMX7, which contain both *Jeolgutdae* extract and *Chamnarae* *Batwinamul*, showed a superior index score compared to cases containing each of them separately, and AMX4 to AMX6, which contain a preferred weight portion of the extract, showed an index score of 8 to 9, indicating that there was also a difference in effect depending on the weight portion composition.
[0313] That is, the above complex extract exhibits excellent inhibitory effects on cell growth and colony formation and induces apoptosis in NSCLC cells, and can demonstrate anticancer activity by inhibiting the STAT3 and MET / AKT pathways that stimulate tumor growth and confer EGFR TKI resistance.
[0314] By inactivating STAT3, cell growth and colony formation in EGFR TKI-resistant NSCLC cells can be inhibited, and anticancer activity resulting from the induction of apoptosis can be confirmed.
[0315] In addition, it is possible to inhibit the enhanced migration ability of macrophages to cancer cells and suppress M2 polarization of macrophages through the inactivation of STAT3 and STAT6, and it can be seen that cancer metastasis can be inhibited by reducing the increased migration ability of cancer cells caused by M2-polarized macrophages.
[0317] [Experimental Example 6: Evaluation of the Preference of the Composite Composition]
[0318] Tea beverages containing each of the above compositions were prepared and tasted by 40 adult men and women aged 20 to 60, after which they were asked to evaluate their preference for aroma and taste. The evaluation was performed using an index from 1 to 10, with higher numbers indicating higher preference. The results of the preference evaluation were rounded to the nearest whole number of the average value, and the results are shown in Table 11 below.
[0319] MX8 AMX1 AMX2 AMX3 AMX4 AMX5 AMX6 AMX7 taste 5 6 6 6 9 9 9 7 incense 5 6 6 7 9 9 9 7 Overall preference 5 6 6 7 9 9 9 7
[0320] (Unit: Exponential)
[0321] Referring to Table 11 above, it can be seen that compared to MX8, which contains only the extracts of Angelica dahurica, Trichosanthes kirilowii, and Pinellia ternata of the present invention, AMX1 and AMX2, which respectively contain additional natural extracts of Angelica dahurica (JE) and Akebia quinata (CE), show a slight improvement, and AMX3 to AMX7, which contain both Angelica dahurica and Akebia quinata, show a superior preference for taste and aroma.
[0322] In particular, it can be seen that in the case of AMX4 to AMX6, which contain 80 to 120 parts by weight of Trichosanthes root extract, 80 to 120 parts by weight of Pinellia ternata extract, 40 to 60 parts by weight of Ligusticum chuanxiong extract, and 40 to 60 parts by weight of Ligusticum chuanxiong extract per 100 parts by weight of Angelica gigas extract, the palatability is further improved, thereby providing a composition with high palatability.
[0323] Accordingly, it was confirmed that by using the above mixed composition, the palatability of a composition containing Angelica dahurica, Trichosanthes kirilowii root, and Pinellia ternata can be improved by additionally including natural extracts, and it is possible to provide a food composition or pharmaceutical composition that is excellent in both palatability and functionality, with excellent anticancer activity without problems such as side effects from long-term consumption.
[0325] Although preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present invention as defined in the following claims also fall within the scope of the present invention.
Claims
Claim 1 A pharmaceutical composition for anticancer use comprising, for every 100 parts by weight of Peucedanum praeruptorum Dunn extract, 80 to 120 parts by weight of Trichosanthes kirilowii root extract, 80 to 120 parts by weight of Pinellia ternata extract, 40 to 60 parts by weight of Pteridium aquilinum extract, and 40 to 60 parts by weight of Pteridium aquilinum extract as active ingredients, wherein the cancer is human non-small cell lung cancer (NSCLC). Claim 2 In claim 1, the composition is an anticancer pharmaceutical composition that exhibits anticancer activity by inducing apoptosis in cancer cells. Claim 3 In claim 1, the composition is an anticancer pharmaceutical composition that exhibits anticancer activity by inhibiting cell proliferation or colony formation of cancer cells. Claim 4 delete Claim 5 An anticancer pharmaceutical composition according to claim 1, wherein the extract is extracted using an extraction solvent selected from the group consisting of water, C1 to C6 lower alcohols, and mixtures thereof. Claim 6 delete Claim 7 A functional food composition for anticancer purposes comprising, for every 100 parts by weight of Peucedanum praeruptorum Dunn extract, 80 to 120 parts by weight of Trichosanthes kirilowii root extract, 80 to 120 parts by weight of Pinellia ternata extract, 40 to 60 parts by weight of *Zanthoxylum bungeanum* extract, and 40 to 60 parts by weight of *Zanthoxylum bungeanum* extract as active ingredients, wherein the cancer is human non-small cell lung cancer (NSCLC).
Citation Information
Patent Citations
composition anticancer and inhibition of multidrug resistance comprising extract of Trichosanthes kirilowii Maxim, Dictamnus dasycarpus Turcz. and Morus alba L.
KR1020210117802A