Recombinase polymerase amplification primer set for discrimination of Korean cattle
The RPA primer set for Hanwoo identification addresses the limitations of PCR by providing rapid, equipment-free, and accurate on-site differentiation using isothermal amplification, enhancing the efficiency of origin labeling.
Patent Information
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- NATIONAL INSTITUTE OF ENVIRONMENTAL RESEARCH
- Filing Date
- 2023-06-12
- Publication Date
- 2026-07-21
AI Technical Summary
The existing PCR-based method for distinguishing Hanwoo cattle from imported cattle is labor-intensive, requires specialized equipment, and is not suitable for rapid on-site identification due to its time-consuming nature and need for temperature cycling.
A recombinase polymerase amplification (RPA) primer set comprising a forward primer (SEQ ID NO. 1) and a reverse primer (SEQ ID NO. 2) that specifically targets the MC1R gene, allowing for rapid gene amplification under isothermal conditions without the need for temperature-cycling equipment, enabling on-site identification using a small sample.
The RPA primer set enables rapid and accurate differentiation between Hanwoo and imported cattle by detecting the presence or absence of gene amplification products, facilitating efficient origin labeling management with minimal equipment and sample requirements.
Smart Images

Figure 112023064305018-PAT00002_ABST
Abstract
Description
Technology Field
[0001] The present specification discloses an RPA primer set for identifying Hanwoo, a composition comprising said primer set, a kit comprising said composition, and a method for identifying Hanwoo using said primer set. Background Technology
[0002] Among its various duties, the National Agricultural Products Quality Management Service carries out the management of origin labeling by enforcing the "Act on the Labeling of Origin of Agricultural and Fishery Products."
[0003] Previously, the differentiation between Hanwoo and imported (non-Hanwoo) cattle used the Polymerase Chain Reaction (PCR) technique in the laboratory. This involved the beef coat color gene ( MC1R Since determining whether a animal is Hanwoo or non-Hanwoo based on the amplification of single nucleotide polymorphism (SNP) markers of a gene requires specialized personnel and expensive experimental equipment. In addition, there is a problem in that immediate application in the field is difficult because it takes at least 6 hours from the gene extraction process to amplification and confirmation of amplification.
[0004] Meanwhile, Recombinase Polymerase Amplification (RPA) is similar to the conventional PCR method, but it has the advantages of shortening reaction time because it allows for the amplification of specific genes at a constant temperature without temperature fluctuations, lower testing costs as it does not require specialized equipment, and enabling on-site testing due to its excellent transportability. RPA is a method that uses bacteriophage T4 recombinase to induce the dissociation of DNA double strands and simultaneously amplifies specific DNA using DNA polymerase and specific primers. Like PCR, it can amplify DNA of a specific nucleotide sequence using a target template and a pair of primers (oligonucleotides); however, unlike PCR, it requires a constant temperature (37 It has the advantage of being able to induce amplification reactions under isothermal conditions within the range of 42℃. Currently, RPA has been developed to produce amplification products very quickly, and this is widely recognized along with the advantage of isothermal conditions, so RPA is being applied in various ways to detect targets through specific gene amplification.
[0005] Accordingly, the inventors of the present invention completed the present invention as a result of researching a method for identifying Hanwoo using RPA. Prior art literature
[0007] (Patent Document 0001) KR 10-2007-0104085 A(Patent Document 0002) KR 10-2000-0034292 A The problem to be solved
[0008] In one aspect, the object of the present invention is to provide a composition, a kit, and a method for rapidly identifying Hanwoo. means of solving the problem
[0009] In one aspect, the present invention provides a set of recombinase polymerase amplification (RPA) primers comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2.
[0010] In another aspect, the present invention provides a composition for identifying Hanwoo cattle comprising the above primer set.
[0011] In another aspect, the present invention provides a kit for identifying Hanwoo cattle comprising the above composition.
[0012] In another aspect, the present invention provides a method for identifying Hanwoo, comprising: (a) a step of isolating DNA from a sample; (b) a step of performing a recombinase polymerase amplification (RPA) reaction using the primer set with the isolated DNA as a template; and (c) a step of analyzing the amplification product produced by performing the reaction. Effects of the invention
[0013] A primer set according to one aspect of the present invention, a composition comprising the primer set, a kit comprising the composition, and a method for identifying Hanwoo using the primer set can rapidly amplify specific nucleotide sequences using a single-strand DNA binding (SSB) and a recombinase enzyme via the RPA method. Since the reaction is possible under isothermal conditions, it is possible to specifically distinguish between Hanwoo or imported cattle (non-Hanwoo) simply by the presence or absence of a gene amplification product without the need for temperature-cycling equipment such as a PCR machine. Furthermore, it has excellent effects that allow for rapid and accurate on-site identification with only a small amount of sample, for example, about 25 mg, which can be utilized for origin labeling management. Brief explanation of the drawing
[0014] Figure 1 is a figure showing the result of performing RPA using a primer set according to one embodiment of the present invention to distinguish between Hanwoo and imported cattle (non-Hanwoo). FIG. 2 is of a Korean native cattle and an imported cattle (non-Korean native cattle) according to one embodiment of the present invention. MC1R This is a photo comparing gene base sequences. FIG. 3 is a flowchart briefly illustrating the process of distinguishing between Hanwoo and imported cattle (non-Hanwoo) using a primer set according to one embodiment of the present invention. Figure 4 is a figure showing the results of performing RPA using a primer set according to an embodiment of the present invention to distinguish between Hanwoo (Fig. 4a) and imported cattle (non-Hanwoo) (Fig. 4b) and analyzing through a lateral flow strip reaction. Specific details for implementing the invention
[0015] The present invention will be described in detail below.
[0017] In one aspect, the present invention provides a set of recombinase polymerase amplification (RPA) primers comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2.
[0018] Recombinase Polymerase Amplification (RPA) according to one aspect of the present invention is similar to the existing PCR method, but has the advantages of being able to shorten reaction time because it allows for the amplification of a specific gene at a constant temperature without temperature changes, and enables on-site testing due to its excellent transportability and low unit cost as it does not require special equipment. Recombinase Polymerase Amplification (RPA) is a method that uses bacteriophage T4 recombinase to cause the dissociation of DNA double strands and simultaneously uses DNA polymerase and specific primers to amplify specific DNA. It can amplify DNA of a specific nucleotide sequence using a target template and a pair of primers (oligonucleotides) as in the case of PCR, but unlike PCR, it can induce an amplification reaction under isothermal conditions within a constant temperature range (37°C - 42°C).
[0019] In a primer set according to one aspect of the present invention, the primer of SEQ ID NO. 1 is a forward primer, and the primer of SEQ ID NO. 2 is a reverse primer.
[0020] According to one aspect of the present invention, the primer may comprise an oligonucleotide composed of a fragment of 30 or more, 31 or more, or 32 or more consecutive nucleotides within SEQ ID NOs 1 to 6, depending on the sequence length of each primer. Specifically, the primer of SEQ ID NO. 1 (37 oligonucleotides) may comprise an oligonucleotide composed of a fragment of 30 or more, 31 or more, or 32 or more nucleotides within SEQ ID NO. 1.
[0021] A primer according to one aspect of the present invention refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be replicated and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer may allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.
[0022] An oligonucleotide used as a primer according to one aspect of the present invention may also include a nucleotide analogue, specifically, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.
[0023] A forward primer and a reverse primer according to one aspect of the present invention are of cattle MC1R It may specifically bind to the (melanocortin 1 receptor) gene.
[0024] A primer set according to one aspect of the present invention may be used for identifying Hanwoo.
[0025] A primer set according to one aspect of the present invention is of cattle MC1R Amplification does not occur in Hanwoo DNA where guanine is deleted, but may be possible only in imported cattle (non-Hanwoo) DNA where guanine is inserted.
[0026] A primer set according to one aspect of the present invention is applied to bovines, and specifically, can be applied to both Hanwoo and imported cattle. In one aspect of the present invention, "Hanwoo (Korean Cattle, Hanwoo)" refers to a native breed of draft ox that has traditionally been raised on the Korean Peninsula for transportation or agricultural purposes, and refers to Korean cattle ( Bos taurus It can be.
[0027] According to one aspect of the present invention, "imported cattle" or "non-Hanwoo" refers to cattle of all foreign breeds imported from abroad, excluding Hanwoo, and specific examples of imported cattle (non-Hanwoo) breeds include Hereford, Holstein, Angus, Brahman, Limousin, Jersey, and Indian cattle (bos indicus).
[0028] By using a primer set according to one aspect of the present invention, the amount of fluorescence can be confirmed in real time using a real-time amplification method using fluorescence, or rapid detection is possible using an electrophoresis method.
[0030] In another aspect, the present invention provides a composition for identifying Hanwoo cattle comprising the above primer set. The description of the above primer set may be applied to the composition.
[0031] A sample according to one aspect of the present invention may be blood, cells, or tissue of a Korean native cattle or imported cattle (non-Korean native cattle), and specifically may be DNA extracted from said blood, cells, or tissue.
[0032] A composition according to one aspect of the present invention may further include a detection labeling substance to enhance the convenience of detection. The labeling substance may be a compound, a biomolecule, or a biomolecule analog, etc., which is included in the amplification product during the amplification process or is physically inserted into the amplification product to verify the density, concentration, amount, etc. of the amplification product in a conventional manner. Additionally, the forward primer and the reverse primer may include one or more labeling substances at the terminal or intermediate portions to facilitate detection, and the labeling substance is preferably a fluorescent moiety, and specifically, a fluorescent moiety such as a fluorescent dye or a derivative thereof having a basic backbone of damine, coumarin, cyanine, EvoBlue, oxazine, carbopyronin, naphthalene, biphenyl, anthracene, phenanthrene, pyrene, carbazole, etc. may be selectively connected or conjugated. More specifically, the fluorescent moiety is Cy5.5 (694), Cy7 (773), ATTO 390™ (479), ATTO 425™ (484), ATTO 465™ (508), ATTO 488™ (523), ATTO 495™ (527), ATTO 520™ (538), ATTO 532™ (553), ATTO Rho6G™ (570), ATTO 550™ (576), ATTO 565™ (592), ATTO Rho3B™ (565), ATTO Rho11™ (608), ATTO Rho12™ (532), ATTO Thio12™ (579), ATTO 610™ (634), ATTO 611X™ (681), ATTO 620™ (643), ATTO Rho14™ (625), ATTO 633™ (657), ATTO 647™ (669), ATTO 647 N™ (669), ATTO 655™ (684), ATTO Oxa12™ (663), ATTO 700™ (719), ATTO 725™ (752), ATTO 740™ (764), BODIPY TMR (568),BODIPY558 / 568 (568), BODIPY564 / 570 (570), EvoBlue10™, EvoBlue30™, MR121, Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), 로다민(Rhodamine) 110 (520), 5-FAM (522), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), Cy3™ (570), Alexa™546 (570), TRITC (572), Magnesium Orange™ (575), 피코에리트린 R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), 피로닌 Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), SYBR green, VIC (594), TET (541), HEX (553), RED670, TYE563, NED (575), Texas Red(615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-피코시아닌 (642), C-피코시아닌 (648), TOPRO™-3 (660), TOTO3 (660), DiDDilC(5) (665), Cy5™ (670), 티아디카르보시아닌 (671), Biosearch Blue (447),CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar650 (566), Quasar570 (667), Quasar670 (705), Quasar705 (610) and their derivatives or conjugates may be connected, but are not limited thereto. The numbers in parentheses indicate the maximum wavelength of emission in nanometers. Additionally, the fluorescent moiety derivative may further comprise a free carboxyl group, an ester (e.g., N-hydrosuccinimide (NHS) ester), or a maleimide derivative, provided that such interference with the detection of the primer set or composition according to one aspect of the present invention is not present. Alternatively, a quencher capable of absorbing fluorescent light to quench it may be optionally connected or conjugated. Specifically, the quencher may be connected to, but is not limited to, Dabsyl, BHQ (Black Hole Quencher)-0, BHQ-1, BHQ-2, BHQ3, Iowa Black® FQ, Iowa Black® RQ, QXLTM490, IRDye QC-1, Deep Dark Quencher II, Deep Dark Quencher I, Eclipse® Dark Quencher, ATTO 540Q, ATTO 580Q, ATTO 612Q and derivatives or conjugates thereof. Additionally, the quenching derivative may further comprise a free carboxyl group, an ester (e.g., N-hydrosuccinimide (NHS) ester), or a maleimide derivative, provided that it does not interfere with the detection of the primer set or composition according to one aspect of the present invention. Or the above labeling substance is radioactivity, colorimetric measurement, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity,Any labeling material capable of providing a detectable signal, such as hybridized high frequency, is not limited thereto. Furthermore, in the embodiments described below, fluorescent dyes were used as labeling compounds considering ease of operation and detection sensitivity; however, the labeling compound may be freely selected from the materials listed above depending on the circumstances, and is not limited thereto as long as it corresponds to materials commonly used in the industry.
[0033] According to one aspect of the present invention, the forward primer and the reverse primer may each be labeled with different labeling substances. Specifically, the forward primer may have fluoresceinamidite (FAM) attached to the 5' end of the nucleotide sequence of SEQ ID NO. 1, or the reverse primer may have biotin and a biotin-triethylene glycol spacer (Biotin-TEG) attached to the 5' end of the nucleotide sequence of SEQ ID NO. 2.
[0034] A composition according to one aspect of the present invention can determine whether a sample is Hanwoo or imported cattle (non-Hanwoo) based on whether the RPA reaction is amplified. Specifically, it may be determined to be Hanwoo if it is not amplified by the primer set.
[0035] A composition according to one aspect of the present invention may further include a reagent for performing a recombinant polymerase amplification (RPA) reaction. Specifically, the reagent may include a reaction buffer, a polymerase, dNTPs, and a template RNA.
[0037] In another aspect, the present invention provides a Hanwoo identification kit comprising the above-described composition for Hanwoo identification. The description of the above-described composition for Hanwoo identification and the primer set may be applied to the kit.
[0038] A kit according to one aspect of the present invention may further include a reagent for performing a recombinant polymerase amplification (RPA) reaction. Specifically, the reagent may include a reaction buffer, a polymerase, dNTPs, and a template RNA.
[0039] A kit according to one aspect of the present invention may further include a mechanism for detecting a target amplification product. Specifically, the mechanism may include a lateral flow analysis strip.
[0041] A composition or kit according to one aspect of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printed document explaining how to use the kit, for example, a method for preparing a buffer solution, the presented reaction conditions, etc. The guide may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide may include information disclosed or provided through an electronic medium, such as the Internet.
[0043] In another aspect, the present invention provides a method for identifying Hanwoo, comprising: (a) isolating DNA from a sample; (b) performing a recombinase polymerase amplification (RPA) reaction using the primer set with the isolated DNA as a template; and (c) analyzing the amplification product generated by performing the reaction. The description of the primer set may be applied to the identification method.
[0044] A determination method according to one aspect of the present invention may include (a) a step of isolating DNA from a sample. The method of isolating DNA from the sample may utilize methods known in the art, specifically, the CTAB method or the Wizard prep kit (Promega). Using the isolated DNA as a template, an amplification reaction may be performed using a primer set according to one embodiment of the present invention to amplify a target sequence.
[0045] A sample according to one aspect of the present invention may be blood, cells, or tissue of a Korean native cattle or imported cattle (non-Korean native cattle), and specifically may be DNA extracted from said blood, cells, or tissue.
[0046] A method for determining according to one aspect of the present invention may include the step of (b) performing a recombinase polymerase amplification (RPA) reaction using the primer set with the isolated DNA as a template.
[0047] According to one aspect of the present invention, the RPA reaction temperature may be 30 to 60°C, and specifically, the reaction temperature may be 30°C or higher, 32°C or higher, 34°C or higher, 36°C or higher, 38°C or higher, 40°C or higher, 41°C or higher, 42°C or higher, 44°C or higher, 46°C or higher, 48°C or higher, 50°C or higher, or 55°C or higher, and may be 60°C or lower, 58°C or lower, 56°C or lower, 54°C or lower, 52°C or lower, 50°C or lower, 48°C or lower, 46°C or lower, 44°C or lower, 42°C or lower, 40°C or lower, or 35°C or lower, but is not limited thereto.
[0048] According to one aspect of the present invention, the RPA reaction time may be 1 to 20 minutes, and specifically, the reaction time may be 1 minute or more, 2 minutes or more, 3 minutes or more, 4 minutes or more, 5 minutes or more, 6 minutes or more, 7 minutes or more, 8 minutes or more, 9 minutes or more, 10 minutes or more, 12 minutes or more, 14 minutes or more, 16 minutes or more, or 18 minutes or more, and may be 20 minutes or less, 19 minutes or less, 18 minutes or less, 17 minutes or less, 16 minutes or less, 15 minutes or less, 14 minutes or less, 13 minutes or less, 12 minutes or less, 11 minutes or less, 10 minutes or less, 9 minutes or less, 8 minutes or less, 6 minutes or less, 4 minutes or less, or 2 minutes or less, but is not limited thereto.
[0049] A determination method according to one aspect of the present invention may include (c) a step of analyzing the amplification product generated by performing the reaction. The detection step may be performed using a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, or lateral flow detection, but is not limited thereto. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Specifically, an ABi Sequencer may be used for capillary electrophoresis. Additionally, gel electrophoresis may be performed, and depending on the size of the amplification product, agarose gel electrophoresis or acrylamide gel electrophoresis may be used. Furthermore, for the fluorescence measurement method, when the amplification reaction is performed by labeling the 5'-terminus of a primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling substance, and the fluorescence thus labeled can be measured using a fluorescence detector. Additionally, for the radiometric measurement method, when performing the amplification reaction 32 P or 35 After labeling the amplification product by adding a radioactive isotope such as S to the amplification reaction solution, radioactivity can be measured using a radioactivity measuring instrument, specifically a Geiger counter or a liquid scintillation counter.
[0050] A determination method according to one aspect of the present invention may further include a step of (d) determining that it is Hanwoo if the amplification product is not detected in step (c).
[0052] The structure and effects of the present invention will be explained in more detail below through examples and experimental examples. However, the following examples and experimental examples are provided for illustrative purposes only to aid in understanding the present invention, and the scope and range of the present invention are not limited by them.
[0054] [Example] Design of Primers for RPA for Hanwoo Identification
[0056] Korean beef and imported beef (non-Korean beef) MC1R Confirmed that there are differences in the gene base sequences as shown in Figure 2, and MC1R A primer set for RPA that specifically binds to genes was designed. Specifically, the primer set for RPA does not amplify Hanwoo DNA in which G is deleted, but only amplifies imported cattle (non-Hanwoo) DNA in which G is inserted, and includes the forward primer of SEQ ID NO. 1 and the reverse primer of SEQ ID NO. 2 in Table 1 below to be suitable for recombinant enzyme-polymerase amplification (RPA). In addition, FAM is bound to the 5' end of the forward primer of SEQ ID NO. 1 and biotin-triethylene glycol is bound to the 5' end of the reverse primer of SEQ ID NO. 2, so that it can be applied to a lateral flow assay (LFA) and the DNA amplification product can be verified simply and quickly.
[0057] division Sequence number nucleotide sequence (5'→3') Length (mer) GC content (%) amplification product length (bp) RPA-F1-2_FAM 1 (FAM)- TGCTGGAGACGGCAGTCATGCCGCTGCTGGAGGCCGG 37 70.3 221 RPA-R1-11_Btn 2 (Biotin-TEG)- AATGATCCTCCACGCTCGGGGCAGTGTCACAACA 34 55.9
[0059] [Experimental Example] Confirmation of Hanwoo identification using beef samples
[0061] It was verified whether Hanwoo and imported cattle (non-Hanwoo) could be distinguished using the primer set designed in the above example in the following manner. The following determination method is briefly illustrated in FIG. 3.
[0062] First, 45 beef samples (21 Hanwoo samples and 24 imported beef samples) were collected, and each sample was separated into 25 mg portions. Then, to extract DNA, 500 µl of DNA extraction reagent (Genet Bio, Direct PCR reagent) was added, and approximately 40 ng of DNA was extracted from each of the 45 samples using a tissue grinder pestle (Daehan Science, 1.5 ml microtube). An RPA reaction was performed on the extracted DNA using the TwistAmp® basic kit (TwistDx). A reaction mixture for RPA analysis was prepared by adding 29.5 μl of rehydration buffer, 1 μl of primers (10 μM) of SEQ ID NOs 1 and 2, 12.4 μl of sterile distilled water, and 3 μl of template DNA to a reaction tube containing the freeze-dried pellet provided in the kit, and 2.5 μl of 280 mM magnesium acetic acid (MgOAc) was added before starting the reaction. Subsequently, the reaction was carried out at an isothermal temperature of 42°C for 9 minutes in an isothermal device (2NC Bio), and fluorescence values were measured in real time. The results are shown in Figures 1 and 4. Figure 4 is a diagram showing the results of the lateral flow strip reaction, where Figure 4a shows the analysis results of the Hanwoo sample and Figure 4b shows the analysis results of the imported cattle (non-Hanwoo) sample.
[0063] As shown in Figures 1 and 4, the Hanwoo gene appears as one line because no gene amplification occurred, while the imported cattle (non-Hanwoo) appear as two lines because gene amplification occurred.
[0065] Through this, the primer set according to one aspect of the present invention can rapidly amplify a specific nucleotide sequence using a single-strand DNA binding protein (SSB) and a recombinase by the RPA method, and since the reaction is possible under isothermal conditions, it is possible to specifically distinguish between Hanwoo or imported cattle (non-Hanwoo) simply by the presence or absence of a gene amplification product without the need for temperature-cycling equipment such as a PCR machine, and it has an excellent effect of being able to be utilized for origin labeling management by enabling rapid and accurate identification on-site with only a small amount of sample, for example, about 25 mg. Explanation of the symbols delete
Claims
Claim 1 A set of recombinase polymerase amplification (RPA) primers comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO.
2. Claim 2 In claim 1, the forward primer and reverse primer are of a cow MC1R A set of primers that specifically bind to the (melanocortin 1 receptor) gene. Claim 3 In paragraph 1, the primer set is a primer set for identifying Hanwoo. Claim 4 A composition for identifying Hanwoo cattle comprising a primer set according to claim 1. Claim 5 A composition for identifying Hanwoo, wherein, in paragraph 4, the forward primer and the reverse primer are each labeled with different labeling substances. Claim 6 A composition for identifying Hanwoo, wherein, in claim 5, the forward primer is a fluoresceinamidite (FAM) attached to the 5' end of the nucleotide sequence of SEQ ID NO.
1. Claim 7 A composition for identifying Hanwoo, wherein, in claim 5, the reverse primer is a biotin-triethylene glycol (Biotin-TEG) attached to the 5' end of the nucleotide sequence of SEQ ID NO.
2. Claim 8 In paragraph 4, the composition is distinguished by whether the above-mentioned Korean beef and imported beef are amplified by the RPA reaction. Claim 9 A composition according to claim 8, wherein the composition is identified as Hanwoo when not amplified by the above primer set. Claim 10 A kit for identifying Hanwoo cattle, comprising a composition according to any one of paragraphs 4 to 9. Claim 11 In item 10, the above kit further comprises a reagent for performing a recombinant polymerase amplification (RPA) reaction. Claim 12 In claim 11, the above reagent is a kit comprising a reaction buffer, a polymerase, dNTPs, and template RNA. Claim 13 (a) a step of isolating DNA from a sample; (b) a step of performing a recombinase polymerase amplification (RPA) reaction using the isolated DNA as a template and a primer set according to any one of claims 1 to 3; and (c) a step of analyzing the amplification product produced by performing the reaction; comprising a method for identifying Hanwoo. Claim 14 A method for identifying Hanwoo, wherein the analysis of step (c) above includes analyzing the amplified product as a strip. Claim 15 In paragraph 13, the above method further comprises a step of determining that it is Hanwoo if the amplification product is not detected in step (c).
Citation Information
Patent Citations
Method of detecting yellow cattle, non-yellow cattle and their hybrid cattle using sequence specific polymerase chain reaction
KR101278268B1
Method for Distinguishing Korean Beef from Non-KoreanBeef, and Probe and Primer therefor
KR1020050121375A