Modified pegRNA favorable for 5' flap cleavage and method for increasing efficiency of prime editing using the same

By adding nucleotides to the 5' end of the pegRNA to bind to Cas9-generated overhangs, the modified pegRNA enhances prime editing efficiency and accuracy by favoring the cleavage of unedited flaps, addressing inefficiencies in existing technologies.

KR102992872B1Active Publication Date: 2026-07-21INDUSTRYACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020230151239
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-11-03
Publication Date
2026-07-21
Estimated Expiration
2043-11-03

Smart Images

  • Figure 112023121904208-PAT00006_ABST
    Figure 112023121904208-PAT00006_ABST
Patent Text Reader

Abstract

The present invention relates to a modified pegRNA (prime editing guide RNA) advantageous for 5' flap cleavage and a method for enhancing prime editing efficiency using said modified pegRNA. More specifically, the invention relates to a modified pegRNA having seven or more nucleotides added to the 5' upstream of an RTT (reverse transcription template) sequence that bind to an endogenous 5' overhang single-stranded DNA generated by Cas9 nickase, and a gene editing composition containing said modified pegRNA. The modified pegRNA of the present invention has the effect of enhancing prime editing efficiency by increasing the cleavage of an endogenous 5' DNA flap that does not contain the desired editing sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a modified pegRNA (prime editing guide RNA) that is favorable for 5' flap cutting and a method for enhancing prime editing efficiency using the modified pegRNA. Background Technology

[0002] Prime editing is a CRISPR-Cas9 tool first described by Anzalone et al. (Nature 2019, 576, 149-157) in 2019. Prime editing does not induce double strand breaks (DSBs) and can accurately correct all types of point mutations, insertions, and deletions, and has been reported to have the potential to repair about 89% of human pathogenic genetic variants. Prime editing technology requires two main components: the first is a prime editor (PE) protein consisting of a reverse transcriptase fused to nickase Cas9 (nCas9), and the second is a prime editing guide RNA (pegRNA) that guides the PE to a target location and functions as a template for the desired correction. pegRNA consists of a PBS (primer-binding site) that serves as a docking site for reverse transcriptase and an RTT (reverse transcription template) containing desired correction information.

[0003] The process of prime editing can be briefly described as follows. A PE / pegRNA complex binds to the target DNA, and nCas9 nicks the strand containing the PAM sequence. Subsequently, the PBS of the pegRNA hybridizes to the 3' flap generated by nicking, and reverse transcriptase initiates the expansion of the strand containing the PAM sequence and creates the desired edit using RTT as a template. This process generates two competing intermediate flaps: a 3' flap containing the intended edit and a 5' flap containing the original sequence without the intended edit. Thermodynamically, the unedited, perfectly complementary 5' flap is likely to be preferred for integration; however, enzymes such as FEN1 (Flap structure-specific endonuclease 1), which occur during lagging-strand DNA synthesis, prefer the 5' flap as a substrate, thereby inducing the degradation of the 5' flap and the integration of the 3' flap. Finally, the resulting heteroduplex DNA strand is degraded, and the desired edit is incorporated into both strands of the target DNA by an endogenous DNA repair mechanism. Prime editing was found to be more effective than HDR (homology-directed repair) and was superior to base editing for targets with a larger target area and at risk of bystander editing.

[0004] Several studies have revealed that the binding stability of the 3' end of pegRNA is a major factor in prime editing efficiency. Kim et al. (Nat. Biotechnol. 2021, 39, 198-206) reported that the high GC content and number of GCs in PBS, which lead to the stable binding of pegRNA to target DNA, are one of the most important characteristics for prime editing efficiency and influence the design of pegRNA for different target sites. Additionally, Nelson et al. (Nat. Biotechnol. 2022, 40, 402-410) hypothesized that the loss of PBS due to the degradation of the 3' end of pegRNA could impede prime editing efficiency. Therefore, the researchers attached a structured RNA motif (evopreQ1 or mpknot) to the 3' end of pegRNA to prevent degradation of the 3' end and increase stability. Engineered pegRNA (epegRNA) increased the efficiency of prime editing by 3–4 times compared to commercial PE3 in various cell types without increasing the InDel ratio. Similarly, Zhang et al. (Nat. Commun. 2022, 13, 1856) conjugated a virus-derived exoribonuclease-resistant RNA (xrRNA) motif to pegRNA to prevent 3' end degradation, and using a similar strategy, Li et al. (J. Mol. Cell Biol. 2022, 14, mjac022) added a human telomerase RNA (hTR) G-quadruplex modification to the 3' end of pegRNA.

[0005] Meanwhile, Korean Patent Publication No. 2022-0112698 discloses a 'composition for prime editing with improved editing efficiency' and U.S. Patent Publication No. 2022-0356469 discloses 'methods and compositions for prime editing nucleotide sequences', but there is no description of the 'modified pegRNA advantageous for cleaving a '5' flap' and the 'method for enhancing prime editing efficiency using said modified pegRNA' of the present invention. The problem to be solved

[0006] The present invention was derived from the above-mentioned requirements. The inventors produced a modified pegRNA by adding a nucleotide that binds to an endogenous 5' overhang single-stranded DNA generated by Cas9 nickase to the 5' upstream of the 3' end RTT (reverse transcription template) sequence of the pegRNA (prime editing guide RNA). Subsequently, the invention was completed by confirming that the desired editing efficiency increased compared to prime editing using the modified pegRNA when prime editing was performed using the modified pegRNA. means of solving the problem

[0007] To solve the above problem, the present invention provides a modified pegRNA (prime editing guide RNA) in which at least 7 nucleotides are added to the 5' upstream of the RTT (reverse transcription template) sequence to bind to the endogenous 5' overhang single-stranded DNA generated by Cas9 nickase.

[0008] In addition, the present invention provides a recombinant vector comprising a nucleic acid sequence encoding the modified pegRNA and a Prime Editor.

[0009] In addition, the present invention provides a method for editing the genes of a target individual, comprising the step of introducing the recombinant vector into an isolated eukaryotic cell or a eukaryotic organism other than a human.

[0010] In addition, the present invention provides a gene editing composition comprising, as active ingredients, the modified pegRNA or a nucleic acid sequence encoding the same; and a prime editor or a nucleic acid sequence encoding the same. Effects of the invention

[0011] By using a prime editing composition containing modified pegRNA according to the present invention, prime editing efficiency can be enhanced by increasing the cleavage of 5' DNA flaps that do not contain the desired editing sequence, so the technology of the present invention can be usefully utilized to improve prime editing systems with low editing efficiency. Brief explanation of the drawing

[0012] Figure 1 is a schematic representation of the mechanism of prime editing using modified pegRNA (prime editing guide RNA) according to the present invention. Figure 2 shows a tomato for herbicide resistance conferment. ALS1 It shows the RTT (reverse transcription template), PBS (primer binding site), and location and arrangement information of the added polynucleotide of the modified pegRNA for prime editing of the (acetolactate synthase 1) gene. FIG. 3 is a schematic diagram of a recombinant vector used in an embodiment of the present invention, showing a system for expressing the modified pegRNA of FIG. 2 as paired pegRNA. FIG. 4 is a schematic diagram of a recombinant vector used in an embodiment of the present invention, showing a system for expressing the modified pegRNA of FIG. 2 as a single forward pegRNA. FIG. 5 is a schematic diagram of a recombinant vector used in an embodiment of the present invention, showing a system for expressing the modified pegRNA of FIG. 2 as a single reverse pegRNA. Figure 6 analyzes the efficiency of prime editing using the recombination vectors of Figures 3 to 5, and is the result of analyzing whether the desired location was edited using NGS (Next Generation Sequencing). Figure 7 is the result of a statistical analysis of editing efficiency according to the number of added nucleotides in the modified pegRNA according to the present invention. Specific details for implementing the invention

[0013] To achieve the objective of the present invention, the present invention provides a modified pegRNA (prime editing guide RNA) in which at least 7 nucleotides are added to the 5' upstream of the RTT (reverse transcription template) sequence to bind to the endogenous 5' overhang single-stranded DNA generated by Cas9 nickase.

[0014] A prime editor is a type of gene editing system based on CRISPR / Cas9 that can introduce genetic changes by cutting only a single strand of DNA without cutting the DNA double strand. The prime editor may comprise a Cas nickase-reverse transcriptase (RT) fusion protein and a prime editing guide RNA (pegRNA), and additional domains or proteins may be additionally included in the fusion protein to enhance the efficiency of prime editing. As with other gene editing tools, the gene editing efficiency of a prime editor is heavily influenced by pegRNA; therefore, it is important to select the optimal pegRNA for a specific gene editing.

[0015] In this specification, the term “pegRNA” includes a guide sequence (or spacer sequence) that recognizes a target sequence, a tracrRNA (trans-activating crispr RNA) scaffold sequence, a primer binding site (PBS) required for initiating reverse transcription, and a reverse transcription template (RTT) containing a desired genetic change.

[0016] In the above pegRNA, the guide sequence refers to a sequence within the guide RNA that designates a target site and includes a sequence that is wholly or partially complementary to the target sequence. The guide sequence is any polynucleotide sequence having complementarity with the target polynucleotide sequence that hybridizes with the target DNA sequence and is sufficient to induce sequence-specific binding of the gene editing fusion to the target DNA sequence.

[0017] The modified pegRNA according to the present invention may comprise a sequence in which, in the 3' to 5' direction, PBS (primer binding site); RTT; and seven or more nucleotides that bind to endogenous 5' overhang single-stranded DNA generated by Cas9 nicase; a tracrRNA (trans-activating crispr RNA) scaffold sequence; and a spacer sequence that recognizes a target sequence are sequentially connected.

[0018] The nucleotides that bind to the endogenous 5' overhang single-stranded DNA generated by the above Cas9 nicase are 7 or more, preferably 7-15, more preferably 7-12, even more preferably 7-10, most preferably 9 nucleotides, but are not limited thereto.

[0019] The modified pegRNA according to the present invention can enhance prime editing efficiency by increasing the cleavage of an endogenous 5' DNA flap that does not contain the desired edit sequence.

[0020] The present invention also provides a recombinant vector comprising a nucleic acid sequence encoding the modified pegRNA (prime editing guide RNA); and a Prime Editor (PE).

[0021] In the recombinant vector of the present invention, the modified pegRNA is as described above. In addition, the modified pegRNA may be included in the recombinant vector in a single form or in the form of paired pegRNA, but is not limited thereto.

[0022] In addition, in the recombination vector of the present invention, the prime editor may be any one selected from the group consisting of PE1, PE2, PE3, PE3b, PE4, PE5, and PEmax, and preferably may be PE2max, but is not limited thereto.

[0023] The above PE1 consists of wild-type M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase fused with nickase Cas9 (H840A) and pegRNA; PE2 uses mutant M-MLV reverse transcriptase (D200N, T306K, W313F, T330P, L603W) instead of wild-type M-MLV reverse transcriptase in PE1; PE3 includes additional gRNA in addition to PE2 (acting to induce a nick on the unedited strand to allow the edited strand to be integrated); PE3b is designed so that the additional gRNA used in PE3 matches the edited sequence; and PE4 includes MLH1dn (truncated MLH1 D754-756 lacking endonuclease domain), which can inhibit DNA mismatch repair pathways in addition to the mutated M-MLV reverse transcriptase and nickase Cas9 used in PE2. PE5 contains MLH1dn in all PE3 elements, and PEmax is similar to PE2 but uses mutated nCas9 (R221K, N394K, H840A) instead of nCas9 (H840A), has a c-Myc NLS (nuclear localization signal) attached to the carboxy terminus of said mutated nCas9 (R221K, N394K, H840A), and contains a reverse transcriptase optimized for human codons. The components for each prime editor can be easily selected and configured by a person skilled in the art through literature known in the art (Hassan et al., Biotechnol. J. 2022; 17:2100673; Zhao et al., Trends Biotechnol. 2023;41(8):1000-1012).

[0024] In this specification, the term "recombinant vector" may refer to a medium capable of delivering the polynucleotide into a cell and / or expressing the target protein encoding it. In this specification, the recombinant vector may include a polynucleotide encoding the prime editor or a polynucleotide containing a modified pegRNA encoding sequence. The vector may include an essential regulatory element operably linked to an insert, i.e., a polynucleotide, so that the insert can be expressed when present in the cell of an organism. The term "operably linked" means that a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding the target protein are functionally linked to perform a general function. Operatory linkage with the recombinant vector may be prepared and purified using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage may be easily performed using enzymes or the like generally known in the art. The vector may include a promoter, a start codon, and a stop codon terminator. In addition, it may appropriately include DNA encoding a signal peptide, and / or an enhancer sequence, and / or non-translating regions of the 5' and 3' of the desired gene, and / or a selection marker region, and / or a replicable unit, etc.

[0025] The above promoters may be constitutive or inducible as general promoters, and include, but are not limited to, lac, tac, T3 and T7 promoters in the case of prokaryotic cells, cauliflower mosaic virus (CaMV) promoters, monkey virus 40 (SV40) promoters, mouse mammary tumor virus (MMTV) promoters, human immunodeficiency virus (HIV), e.g., HIV long terminal repeat (LTR) promoters, Moloney virus promoters, cytomegalovirus (CMV) promoters, Epstein-Barr virus (EBV) promoters, Rhoese's sarcoma virus (RSV) promoters, as well as β-actin promoters, human hemoglobin promoters, human muscle creatine promoters, human metallothionein promoters, etc.

[0026] The aforementioned selection marker is intended for selecting cells transformed by the introduction of a vector, and markers conferring selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface proteins, may be used. Since only cells expressing the selection marker survive in an environment treated with a selective agent, the transformed cells can be selected.

[0027] The above vector may be a virus, cosmid, or plasmid vector, but is not limited thereto. The type of vector is not particularly limited as long as it is capable of functioning to express a desired gene and produce a desired protein in various target cells, such as prokaryotic and eukaryotic cells; specifically, a vector capable of producing a large amount of foreign proteins in a form similar to their natural state while possessing a promoter exhibiting potent activity and strong expression power may be used.

[0028] The present invention also provides a method for editing the genes of a target individual, comprising the step of introducing the recombinant vector into an isolated eukaryotic cell or a eukaryotic organism other than a human.

[0029] In the gene editing method for a target individual according to the present invention, the recombinant vector comprises a nucleic acid sequence encoding a modified pegRNA and a prime editor, each as described above.

[0030] The present invention also provides a gene editing composition comprising, as active ingredients: the modified pegRNA (prime editing guide RNA) or a nucleic acid sequence encoding the same; and a Prime Editor (PE) or a nucleic acid sequence encoding the same.

[0031] The gene editing composition according to the present invention is intended for editing target DNA or genes in vivo or ex vivo, and more preferably may be a prime editing composition.

[0032] The composition according to the present invention is characterized by including a modified pegRNA that enhances prime editing efficiency by increasing the cleavage of an endogenous 5' DNA flap that does not contain a desired edit sequence, wherein the modified pegRNA and prime editor are as described above.

[0034] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0036] Experimental method

[0037] 1. Combination of PE protein elements and plasmid construction

[0038] To produce the PE proteins used in the present invention, nCas9 (H840A) for PE2max, PE4max, and ePEmax1, and nCas9 and eRT for ePEmax2 and ePEmax3 were cloned from the plasmid pCMV-PEmax-P2A-hMLH1dn (Addgene #174828). nCas9 for PPE-NC-v1 was cloned from the nCas9-PPE plasmid (Addgene #140445), and NC and RT were cloned from the pH-ePPE plasmid (Addgene #183097). ePPE was cloned from the pH-ePPE plasmid, and the NC sequences used in ePEmax1, ePEmax2, ePEmax3, and PE2max-NC were cloned from the pH-ePPE plasmid.

[0039] For the basic PE expression cassette, transcription was controlled using the CaMV 35S promoter (p35S) (Addgene #50267) and the EU + Rb7 double terminator (EURB7) (Diamos and Mason, 2018, Plant Biotechnol J. 16:1971-1982). For experiments evaluating the effect of promoters, several promoters (p35S, double CaMV 35S promoter (p2x35S) (Addgene #50269) and tomato EF1α (PSLEF1α) (Niu et al., 2023, Plant Biotechnol J. 21:5-7) were used in combination with the EU + 35S + Rb7 triple terminator (t3T). To evaluate the effect of terminators on PE efficiency, p35S was combined with several terminators (t35S, tNOS, EURB7, t3T).

[0040] Modified epegRNAs were designed by introducing fundamental changes to the epegRNA scaffold from a modified SpCas9 scaffold (Nelson et al., 2022, Nat Biotechnol. 40:402-410). A U6-26 core promoter (pU6-26 core) or a U6 composite promoter (Jiang et al., 2020, Genome Biol. 21:257) was used to drive the transcription of the pegRNAs. Edited sites / loci, gRNAs, and RTT information are detailed in Table 1. The pegRNAs were amplified by PCR using the primers listed in Table 2, cloned into an expression cassette, and then combined into a binary vector by Golden Gate Assembly.

[0041] For the T-DNA-based PE tool, the expression cassette of the selection marker (NPT II, ​​Addgene #51144), PE protein, and pegRNA was cloned into the pAGM4723 plasmid (Addgene #48015), and for the use of the Geminivirus replication system, the expression cassette was cloned into the previously reported pLSL.R.Ly vector (Vu et al., 2020, Plant Biotechnol J. 18:2133-2143). All bio-components [pNOS::NptⅡ::tOCS (from pICSL11024, Addgene Plasmid #51144), PE2max (SEQ No. 1), 35S promoter (SEQ No. 2), EU + Rb7 double terminator (EURb7; SEQ No. 3), U6 composite promoter (SEQ No. 4)] were domesticated with Moclo (Weber et al., 2011) level 0 plasmid and assembled into a PE protein combination and binary vector.

[0042] pegRNA sequence information used in the present invention No Specification Orientation of pegRNA pegRNA spacer 3' extension(5'-3') PBS(5'-3') RTT(5'-3') LNT(5'-3') 1 No LNT Forward CTATTACAGGTCAAGTGCCA (Sequence No. 5) CAATCATCCTCCTaGaCACTTGACCT (Sequence No. 6) CACTTGACCT (Sequence No. 10) CAATCATCCTCCTaGa (Sequence No. 11) - 2 3-nt LNT ttgCAATCATCCTCCTaGaCACTTGACCT (Sequence No. 7) ttg 3 6-nt LNT tgattgCAATCATCCTCCTaGaCACTTGACCT (Sequence No. 8) tgattg 4 9-nt LNT ggatgattgCAATCATCCTCCTaGaCACTTGACCT (Sequence No. 9) ggatgattg 5 No LNT Reverse TCAGTACCAATCATCCTCCT (Sequence No. 12) TACAGGTCAAGTGtCtAGGAGGATGATTGG (Sequence No. 13) AGGATGATTGG (Sequence No. 17) TACAGGTCAAGTGtCtAGG (Sequence No. 18) - 6 3-nt LNT gtaTACAGGTCAAGTGtCtAGGAGGATGATTGG (Sequence No. 14) gta 7 6-nt LNT cctgtaTACAGGTCAAGTGtCtAGGAGGATGATTGG (Sequence No. 15) cctgta 8 9-nt LNT tgacctgtaTACAGGTCAAGTGtCtAGGAGGATGATTGG (Sequence No. 16) tgacctgta

[0043] ALS1Primer information for pegRNA amplification for editing Name Sequence (5'-3') Sequence number npegR-ALS1-F1 CAGTCGAAGACAATGCACTATTACAGGTCAAGTGCCA 19 npegR-ALS1-R1 CAGTCGAAGACAAAAACTGGCACTTGACCTGTAATAG 20 2gRNA-ALS1-F1 CAGTCGAAGACAATGCACCTAACCCATAGGCGTTTCCGTTTAAGAGCTATGCTGGAAACAGC 21 2gRNA-ALS1-R1 CAGTCGAAGACAACGCGGCACCGACTCGGTGCGACTT 22 PBR1-ALS1-F1 CAGTCGAAGACAAGTGCCAATCATCCTCCTAGACACTTGA 23 PBR1-ALS1-R1 CAGTCGAAGACAACGCGAGGTCAAGTGTCTAGGAGGATGA 24 ALS1-Pr1r-F1 CAGTCGAAGACAATGCATCAGTACCAATCATCCTCCT 25 ALS1-Pr1r-R1 CAGTCGAAGACAAAAACAGGAGGATGATTGGTACTGA 26 rPBR1-ALS1-F1 CAGTCGAAGACAAGTGCTACAGGTCAAGTGtCtAGGAGGATG 27 rPBR1-ALS1-R1 CAGTCGAAGACAACGCGCCAATCATCCTCCTaGaCACTTGACC 28

[0045] 2. Analysis of Agrobacterium-mediated Tomato Transformation and Prime Editing Efficiency

[0046] Agrobacterium-mediated transformation of tomatoes was performed as described by Vu et al. In this invention, Agrobacterium tumefaciens strains GV3101::pMP90, EHA105, and EHA105-based SuperAgro Version 2 (Nonaka et al., 2019, Front Plant Sci. 10:1204) were used. 7-day-old cotyledons of tomato plants were excised and used for transformation. Agrobacterium containing the PE plasmid was cultured, harvested by centrifugation, and resuspended in an ABM-MS solution supplemented with 100 μM acetosyringon (Vu et al., 2020) to determine the OD level. 600nm This was prepared to be 0.8. Agrobacteria were activated by incubating at 28°C for 1 hour prior to transformation. After mixing Agrobacteria and cotyledons and incubating at room temperature for 20 minutes, the transformed plants were co-cultured for 2 days prior to washing and transferred to screening media. Samples were cultured at 31°C for 5 days, followed by 28°C for 5 days, and then 25°C incubation conditions were applied for the remaining stages. Redifferentiated shoots were selected in a medium containing 80 mg / L kanamycin, and rooting was induced before transferring to soil. Subsequently, the hardened plants were used to evaluate PE efficiency. For the temperature treatment experiment, after co-culture, explants were cultured at different temperatures for 5 days, followed by 28°C for 5 days, and then transferred to 25°C incubation conditions in the later stage.

[0047] To evaluate PE efficiency, samples were collected 16 days (dpt) after transformation and targeted deep sequencing was performed, and leaves of the transformants were collected at all plant growth stages and PE alleles were screened using PCR and Sanger sequencing.

[0049] 3. Targeted deep sequencing

[0050] Genomic DNA (gDNA) was extracted from cotyledons or plant leaves using the CTAB method. The MiniSeq sequencing service (MiniSeq™ System, Illumina, USA) was used for analysis. MiniSeq samples were prepared through three PCRs using the primers listed in Table 3. The third PCR was performed using primers provided by the manufacturer to assign a sample ID. Subsequently, the MiniSeq raw FASTQ data files were analyzed using Cas-Analyzer (Park et al., 2016, Bioinformatics 33:286-288) and CRISPResso2 (Clement et al., 2019, Nat Biotechnol. 37:224-226) tools with the parameters listed in Table 4.

[0051] Primer Information for MiniSeq Sample Amplification Name Sequence (5'-3') Sequence number ALS-F1 CCTCACCATCTCCATGTTTCTC 29 ALS-R1 GTCTCAGCTCCTCACTTGATTG 30 ALS-F2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTACAAATCTTGTTAGTGGTCTTG 31 ALS-R2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GCTTCGTAATAGATCTCGTTACCTC 32

[0052] Parameters used for FASTQ file analysis Name Sequence (5'-3') Sequence number Reference sequence GCTACAAATCTTGTTAGTGGTCTTGCGGATGCTTTGTTAGATAGTATTCCGATTGTTGCTATTACAGGTCAAGTGCCAAGGAGGATGATTGGTACTGATGCGTTCCAGGAAACGCCTATTGTTGAGGTAACGAGATCTATTACGAAGCA 33 Donor (RGEN) AGGTCAAGTGtCtAGGAGGATGATTG 34 CRISPResso2 3' extension CAATCATCCTCCTaGaCACTTGACCT 35

[0054] 4. Identification of transformants containing the PE allele

[0055] PE allele screening was performed on transgenic plants that survived the hardening phase. Three different leaf fragments from each plant were collected and combined, and gDNA was isolated using the CTAB method. PCR reactions were used to amplify DNA sequences adjacent to target sites, and the PCR products were sequenced by the Sanger sequencing method. The resulting sequencing chromatograms were analyzed by the ICE Synthgo tool (Conant et al., 2022, Crispr J. 5:123-130) to screen for potential events carrying PE alleles. Some representative PE events were subsequently verified by targeted deep sequencing.

[0057] 5. Evaluation of the presence of T-DNA and replicons within PE events

[0058] To evaluate the presence of T-DNA and replicons, gDNA from PE plants was used as a template for a PCR reaction using primer pairs specified at the right boundary (RB) of the T-DNA and the circular form of the replicon. The replicon primers were designed to amplify only the circular DNA configured to be released from the vector (Vu et al., 2020). The PCR products were developed on a 1% agarose gel, and the presence of T-DNA and replicons was determined by confirming PCR bands of sizes corresponding to T-DNA and replicons, respectively.

[0060] 6. Off-target Analysis

[0061] The tomato genome database where the pegRNA gRNA sequence has fewer than 4 regions that do not match the gRNA sequence Solanum lycopersicumThe Cas-OFinder tool was used to search for potential off-target sites within (SL2.4). 16-dpt (day post transformation) cotyledon explants converted to pegRNA containing identified potential off-target sites were analyzed by targeted deep sequencing using primers listed in Table 3.

[0063] 7. Data Analysis

[0064] All experiments were performed in multiples of at least three. As a result of editing, the corresponding statistical analysis and scatter plots were processed using MS Excel and GraphPad Prism 9.0 software. Multiple comparisons were performed using the unmodified Fisher's LSD test.

[0066] Example 1. Tomato ALS1 Modification of pegRNA to Enhance Gene Prime Editing Efficiency

[0067] The inventors constructed a modified pegRNA by adding a nucleotide capable of binding to the endogenous 5' overhang single-stranded DNA generated by Cas9 nicase to the 5' upstream of the RTT sequence of the pegRNA, so that cleavage of the 5' flap DNA that was not edited—i.e., where the intended base replacement did not occur—could occur at a higher frequency during the prime editing process (Fig. 2). Using the modified pegRNA, cleavage of the 5' flap DNA can occur more favorably (Fig. 1).

[0068] In the present invention, various pegRNAs were designed for P186S (CCA→TCT) editing of the tomato ALS1 protein to confer herbicide resistance (Table 1). In addition, various recombinant vectors were constructed to enable the said pegRNAs to function within cells in the form of single forward, single reverse, or paired pegRNAs (Figs. 3 to 5), and the samples were transformed using the Agrobacterium tumefaciens EHA105sv2 strain. Tomato explants were cultured at 31°C for 5 days after co-culture with the said Agrobacterium.

[0069] As a result of prime editing using modified pegRNAs containing different numbers of additional nucleotides, when 3 or 6 nucleotides were added upstream of the 5' of the RTT sequence, the overall editing rate was reduced compared to the control group (no LNT) without added nucleotides, but when pegRNA with 9 added nucleotides was used, the intended correction and overall editing rates were increased (Fig. 6). In addition, it was confirmed that all experimental groups using a single reverse pegRNA had significantly lower rates of unintended correction compared to the experimental groups using a single forward and paired pegRNA.

[0070] Through the above results, it was confirmed that the efficiency of prime editing can be increased when 7 or more, more preferably 9, nucleotides that bind to the endogenous 5' overhang single-stranded DNA generated by Cas9 nicase are added upstream of the 5' of the RTT sequence.

Claims

Claim 1 Modified pegRNA (prime editing guide RNA) with 7-12 nucleotides added upstream of the 5′ of the RTT (reverse transcription template) sequence to bind to the endogenous 5′ overhang single-stranded DNA generated by Cas9 nickase. Claim 2 The modified pegRNA according to claim 1, characterized in that the modified pegRNA comprises a sequence in which, in the 3′ to 5′ direction, PBS (primer binding site); RTT; and 7-12 nucleotides binding to endogenous 5′ overhang single-stranded DNA generated by Cas9 nicase; a tracrRNA (trans-activating crispr RNA) scaffold sequence; and a spacer sequence recognizing a target sequence are sequentially connected. Claim 3 The modified pegRNA of claim 1, characterized in that the modified pegRNA enhances prime editing efficiency by increasing the cleavage of an endogenous 5' DNA flap that does not contain the desired edit sequence. Claim 4 A recombinant vector comprising a nucleic acid sequence encoding a modified pegRNA (prime editing guide RNA) according to any one of claims 1 to 3; and a Prime Editor (PE). Claim 5 A recombinant vector according to claim 4, characterized in that the modified pegRNA is in a single or paired form. Claim 6 A recombination vector according to claim 4, characterized in that the prime editor is any one selected from the group consisting of PE1, PE2, PE3, PE3b, PE4, PE5, and PEmax. Claim 7 A method for editing the genes of a target individual, comprising the step of introducing the recombinant vector of claim 4 into an isolated eukaryotic cell or a eukaryotic organism other than a human. Claim 8 A gene editing composition comprising, as active ingredients: a modified pegRNA (prime editing guide RNA) according to any one of claims 1 to 3 or a nucleic acid sequence encoding the same; and a Prime Editor (PE) or a nucleic acid sequence encoding the same. Claim 9 A gene editing composition according to claim 8, characterized in that the prime editor is any one selected from the group consisting of PE1, PE2, PE3, PE3b, PE4, PE5, and PEmax. Claim 10 In claim 8, the composition is a gene editing composition characterized by being for editing target DNA or genes in vivo or ex vivo.

Citation Information

Patent Citations

  • Methods and compositions for editing nucleotide sequences

    KR1020210143230A

  • Improved prime editing methods and compositions

    WO2023205687A1