METHOD FOR DETECTING FtxA GENE ENCODING RTX FILIFACTOR ALOCIS PROTEIN ISOLATED FROM PATIENTS WITH INFLAMMATORY PERIODONTAL DISEASES

A PCR-based method using specific primers identifies the FtxA gene in Filifactor alocis, addressing the lack of detection methods for this gene, enhancing the diagnosis of periodontal diseases by distinguishing bacterial strains.

RU2864809C1Active Publication Date: 2026-06-29FEDERALNOE GOSUDARSTVENNOE BYUDZHETNOE OBRAZOVATELNOE UCHREZHDENIE VYSSHEGO OBRAZOVANIYA BASHKIRSKIJ GOSUDARSTVENNYJ MEDITSINSKIJ UNIV MINISTSTVA ZDRAVOOKHRANENIYA ROSSIJSKOJ FEDERATSII
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
RU2025110387
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2026-06-29
Estimated Expiration
2045-04-23

Smart Images

  • Figure 00000001
    Figure 00000001
Patent Text Reader

Abstract

FIELD: molecular biology.SUBSTANCE: method for detecting the FtxA gene encoding the RTX Filifactor alocis protein isolated from patients with inflammatory periodontal diseases using the polymerase chain reaction method with primers of the sequence SEQ ID NO: 1–2 is described.EFFECT: developing a means for identifying the FtxA gene encoding the RTX Filifactor alocis protein using the qualitative polymerase chain reaction method.1 cl, 1 dwg, 4 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The invention relates to the field of medicine and biotechnology and can be used to identify the FtxA gene encoding the RTX Filifactor alocis protein using the classical PCR method.

[0002] Filifactor alocis is a gram-positive bacterium that predominates and grows in the periodontal pocket in various infectious diseases of the oral cavity, including periodontitis [Razooqi Z., Khzam Nl, L'Hostis M., Belibasakis GN, Johansson A., Oscarsson J. Association of Filifactor alocis and its RTX toxin gene ftxA with periodontal attachment loss, and in synergy with Aggregatibacter actinomycetemcomitans / / Front. Cell. Infect. Microbiol. - 2025. V. 14:1501028.]. With high frequency, it accompanies the aggressive course of periodontitis and is also recorded in endodontitis. Due to its ability to participate in arginine metabolism, pronounced protease activity, and a broad spectrum of virulence factors, F.alocis colonizes periodontal tissues. It significantly influences the formation of the periodontal microbial community, facilitating their invasion of epithelial tissues.alocis is resistant to oxidative stress conditions at the site of the lesion, induction of epithelial cell apoptosis, degradation of the extracellular matrix of periodontal tissues, activation and production of proinflammatory cytokines in places of its presence, as well as to the suppression of protective reactions of neutrophilic granulocytes and inhibition of the complement activation process [Balmasova I.P., Tsarev V.N., Arutyunov S.D., Babaev E.A. Filifactor alocis and its role in the etiology of chronic periodontitis / / Dentistry. - 2020. No. 99 (3): 78-82.].

[0003] There is evidence in the literature that approximately 50% of F. alocis strains carry the FtxA gene, which encodes the RTX protein [Oscarsson J., Claesson R., Bao K., Brundin M., Belibasakis GN Phylogenetic analysis of filifactor alocis strains isolated from several oral infections identified a novel RTX toxin, ftxA / / Toxins (Basel) - 2020. V. 12: 687; Ozuna H., Snider I., Belibasakis GN, Oscarsson J., Johansson A., Uriarte SM Aggregatibacter actinomycetemcomitans and Filifactor alocis: Two exotoxin-producing oral pathogens / / Front. Oral. Health - 2022. V. 3: 981343.]. Studies show that the presence of FtxA in F. alocis usually demonstrates a higher bacterial load and also indicates a progressive form of periodontitis and periodontal ligament rupture [Razooqi Z., Tjellström I., Höglund Åberg C., Kwamin F., Claesson R., Haubek D., Johansson A., Oscarsson J.Association of Filifactor alocis and its RTX toxin gene ftxA with periodontal attachment loss, and in synergy with Aggregatibacter actinomycetemcomitans / / Front Cell Infect Microbiol. 2024. V. 14].

[0004] A method for differentiating between the main and minor subspecies of plague and the pseudo-tuberculosis pathogen is known using classical polymerase chain reaction (PCR). This method involves isolating DNA from the strain under study and performing PCR analysis using nucleotide primers targeting the terC, ilvN, and inv genes, which have the following sequences:

[0005] 89-S - AATCAAATCTCGCCCAGC,

[0006] 89-As - GCTGCGTATCATTTCACC;

[0007] 45-S - AGTGGTCTGCTTCTCTGG,

[0008] 45-As - CGGCATACACAGAATACC;

[0009] inv839 - TACCTGCACTCCCACAAC,

[0010] inv1007 - CCCATACGCTGATCTACC.

[0011] Differentiation of the studied strains is carried out by comparing the sizes of the obtained fragments of the terC, ilvN and inv genes with similar fragments in typical strains of plague pathogens of the main and minor subspecies [Patent RU 2425891 C1, 2011].

[0012] In the available scientific, medical and patent literature, no information was found about the known method for detecting the FtxA Filifactor alocis gene isolated from patients with inflammatory periodontal diseases.

[0013] The objective of the invention is to develop a reliable method for identifying the FtxA gene encoding the RTX protein in Filifactor alocis.

[0014] The technical result consists in developing a means for identifying the FtxA gene encoding the RTX Filifactor alocis protein using the qualitative polymerase chain reaction method.

[0015] The proposed method for detecting the FtxA gene encoding the RTX protein Filifactor alocis in patients with inflammatory periodontal diseases is carried out as follows. Biological material is collected: the contents of the gingival sulcus and periodontal pockets in patients with gingivitis and chronic generalized periodontitis. For PCR analysis, total DNA is isolated from the clinical material: the contents of the gingival sulcus or periodontal pockets using any suitable method, for example, the commercial DNA-sorb-AM kit (AmpliSens, Russia). Subsequently, the obtained DNA is used as a template for the polymerase chain reaction (PCR) and amplification of the FtxA gene encoding the RTX protein detected using selected primers with the following sequence structure (SEQ ID NO: 1-2):

[0016] Forward - 5′ TGGCAACGGTAACAAGAGCATA 3′

[0017] Reverse - 5′ TTCCCAAATCCAACCACAATAAT 3′

[0018] Amplification is carried out in 25 μl of a total volume of a mixture containing standard buffer for Taq polymerase (10x, 750 mM Tris-HCl (pH 8.6); 200 mM (NH4)2SO4; 0.1% (v / v) Tween 20, pH 8.6), 4 deoxyribonucleotide triphosphates (dNTP, 10 mM), Taq polymerase (5 units / μl), two oligonucleotide primers (each 2 μM).

[0019] Next, standard PCR is performed using the following reaction parameters: 94°C - 30 sec; 30 cycles: denaturation at 94°C - 30 sec, primer annealing at 53°C - 30 sec, elongation at 72°C - 3 min 30 sec; final elongation at 72°C - 10 min. The amplification products are separated electrophoretically in a 1.6% agarose gel and, after staining the gel with ethidium bromide, identified under ultraviolet light. Upon detection of an amplification product (amplicon) 405 bp long, the presence of the FtxA gene, encoding the RTX Filifactor alocis protein, is identified.

[0020] Thus, the claimed method makes it possible to distinguish Filifactor alocis strains by various fragments obtained as a result of PCR analysis.

[0021] The invention is illustrated by a figure showing the results of electrophoretic analysis of biological material (contents of the gingival sulcus and periodontal pockets) for the presence of the FtxA gene encoding the RTX Filifactor alocis protein, where: 1 - DNA length marker (100 bp, Eurogen), 2 - negative control (water), 3 - 18 - test samples.

[0022] Samples (gingival sulcus and periodontal pocket contents) were analyzed for the microbiome composition of Filifactor alocis, which was detected using 16S rRNA gene sequencing. The FtxA gene, encoding the RTX protein, was detected in six of the 18 samples analyzed using a 405-bp amplicon (Figure).

[0023] The essence of the invention is explained by the following examples.

[0024] Example 1. Periodontal pocket contents were collected from patient Sh., born in 1981, who was under the care of a dentist with a diagnosis of mild chronic generalized periodontitis. Total DNA was isolated from the biological material using the commercial DNA-sorb-AM kit (AmpliSens, Russia). Based on the results of 16S rRNA gene sequencing, Filifactor alocis was identified in this sample. Next, a polymerase chain reaction was performed with amplification of the FtxA gene, encoding the RTX protein Filifactor alocis, using selected primers of the sequence SEQ ID NO: 1-2. A 405 bp amplification product was detected electrophoretically. The presence of the FtxA gene, encoding the RTX protein Filifactor alocis, was established in the patient.

[0025] Example 2. A periodontal pocket sample was collected from patient G., born in 1964, who was being observed by a dentist with a diagnosis of chronic generalized periodontitis of moderate severity. Total DNA was isolated from the biological material using a commercial DNA-sorb-AM kit (AmpliSens, Russia). Based on the results of 16S rRNA gene sequencing, Filifactor alocis was identified in this sample. Next, a polymerase chain reaction was performed with amplification of the FtxA gene, encoding the RTX protein Filifactor alocis, using selected primers of the sequence SEQ ID NO: 1-2. A 405 bp amplification product was detected electrophoretically. The presence of the FtxA gene, encoding the RTX protein Filifactor alocis, was established in the patient.

[0026] Example 3. A gingival sulcus sample was collected from patient N., born in 2001, who was under the care of a dentist with a diagnosis of gingivitis. Total DNA was isolated from the biological material using a commercial DNA-sorb-AM kit (AmpliSens, Russia). Based on the results of 16S rRNA gene sequencing, Filifactor alocis was identified in this sample. Next, a polymerase chain reaction was performed with amplification of the FtxA gene, encoding the RTX protein Filifactor alocis, using selected primers of the sequence SEQ ID NO: 1-2. An amplification product of 405 bp in length was not detected electrophoretically. The absence of the FtxA gene, encoding the RTX protein Filifactor alocis, was established in the patient.

[0027] Example 4. A gingival sulcus sample was collected from patient O., born in 1994, who was under the care of a dentist with a diagnosis of gingivitis. Total DNA was isolated from the biological material using a commercial DNA-sorb-AM kit (AmpliSens, Russia). Based on the results of 16S rRNA gene sequencing, Filifactor alocis was identified in this sample. Next, a polymerase chain reaction was performed with amplification of the FtxA gene, encoding the RTX Filifactor alocis protein, using selected primers with the sequence SEQ ID NO: 1-2. A 405 bp amplification product was detected electrophoretically. The presence of the FtxA gene, encoding the RTX Filifactor alocis protein, was established in the patient.

[0028] Thus, the proposed method is sensitive and specific for the detection of the FtxA gene encoding the RTX protein Filifactor alocis in the microbiome of the contents of the gingival sulcus or periodontal pockets in patients with inflammatory periodontal diseases, namely gingivitis and chronic generalized periodontitis.

[0029] --->

[0030] <?xml version="1.0" encoding="UTF-8"?>

[0031] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0032] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0033] <st26sequencelisting dtdversion="V1_3" filename="hsa_gene_SEQL.xml"

[0034] softwarename="WIPO Sequence"

[0035] softwareversion="1.0" productiondate=""

[0036] originalfreetextlanguagecode="ru">

[0037] <applicationidentification>

[0038] <ipofficecode>RU< / ipofficecode>

[0039] <applicationnumbertext> 2025110387< / applicationnumbertext>

[0040] <filingdate> 2025-04-23< / filingdate>

[0041] < / applicationidentification>

[0042] <applicantfilereference> 2025110387< / applicantfilereference>

[0043] <applicantname languagecode="ru">Federal State

[0044] budgetary educational institution of higher education

[0045] "BASHKIR STATE MEDICAL UNIVERSITY"

[0046] Ministry of Health of the Russian Federation< / applicantname>

[0047] <applicantnamelatin>Federal State Budgetary Educational Institution

[0048] of Higher Education «BASHKIR STATE MEDICAL UNIVERSITY» of

[0049] the Ministry of Health of the Russian Federation< / applicantnamelatin>

[0050] <inventorname languagecode="ru">Gimranova Irina

[0051] Anatolyevna< / inventorname>

[0052] <inventiontitle languagecode="ru">Method for detecting the FtxA gene,

[0053] encoding protein RTX Filifactor alocis, isolated from patients with

[0054] inflammatory periodontal diseases< / inventiontitle>

[0055] <inventiontitle languagecode="en">Method for detecting the FtxA gene

[0056] encoding the RTX protein Filifactor alocis isolated from patients

[0057] with inflammatory periodontal diseases< / inventiontitle>

[0058] <sequencetotalquantity> 2< / sequencetotalquantity>

[0059] <!-- Sequence 1: Forward primer for FtxA gene detection -->

[0060] <sequencedata sequenceidnumber="1">

[0061] <insdseq>

[0062] <INSDSeq_length> 22< / INSDSeq_length>

[0063] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0064] <INSDSeq_division> PAT< / INSDSeq_division>

[0065] <INSDSeq_feature-table>

[0066] <insdfeature>

[0067] <INSDFeature_key>source< / INSDFeature_key>

[0068] <INSDFeature_location>1..22< / INSDFeature_location>

[0069] <INSDFeature_quals>

[0070] <insdqualifier>

[0071] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0072] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0073] < / insdqualifier>

[0074] <insdqualifier>

[0075] <INSDQualifier_name>organism< / INSDQualifier_name>

[0076] <INSDQualifier_value>synthetic

[0077] construct< / INSDQualifier_value>

[0078] < / insdqualifier>

[0079] < / INSDFeature_quals>

[0080] < / insdfeature>

[0081] <insdfeature>

[0082] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0083] <INSDFeature_location>1..22< / INSDFeature_location>

[0084] <INSDFeature_quals>

[0085] <insdqualifier>

[0086] <INSDQualifier_name>note< / INSDQualifier_name>

[0087] <INSDQualifier_value>forward primer for detection of

[0088] FtxA gene of Filifactor alocis< / INSDQualifier_value>

[0089] < / insdqualifier>

[0090] < / INSDFeature_quals>

[0091] < / insdfeature>

[0092] < / INSDSeq_feature-table>

[0093] <INSDSeq_sequence> tggcaacggtaacaagagcata< / INSDSeq_sequence>

[0094] < / insdseq>

[0095] < / sequencedata>

[0096] <!-- Sequence 2: Reverse primer for FtxA gene detection -->

[0097] <sequencedata sequenceidnumber="2">

[0098] <insdseq>

[0099] <INSDSeq_length> 23< / INSDSeq_length>

[0100] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0101] <INSDSeq_division> PAT< / INSDSeq_division>

[0102] <INSDSeq_feature-table>

[0103] <insdfeature>

[0104] <INSDFeature_key>source< / INSDFeature_key>

[0105] <INSDFeature_location>1..23< / INSDFeature_location>

[0106] <INSDFeature_quals>

[0107] <insdqualifier>

[0108] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0109] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0110] < / insdqualifier>

[0111] <insdqualifier>

[0112] <INSDQualifier_name>organism< / INSDQualifier_name>

[0113] <INSDQualifier_value>synthetic

[0114] construct< / INSDQualifier_value>

[0115] < / insdqualifier>

[0116] < / INSDFeature_quals>

[0117] < / insdfeature>

[0118] <insdfeature>

[0119] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0120] <INSDFeature_location>1..23< / INSDFeature_location>

[0121] <INSDFeature_quals>

[0122] <insdqualifier>

[0123] <INSDQualifier_name>note< / INSDQualifier_name>

[0124] <INSDQualifier_value>reverse primer for detection of FtxA gene of

[0125] Filifactor alocis< / INSDQualifier_value>

[0126] < / insdqualifier>

[0127] < / INSDFeature_quals>

[0128] < / insdfeature>

[0129] < / INSDSeq_feature-table>

[0130] <INSDSeq_sequence> ttccccaaatccaaccaataat< / INSDSeq_sequence>

[0131] < / insdseq>

[0132] < / sequencedata>

[0133]

[0134] <---

Citation Information

Patent Citations

  • Method for estimating periodontal pocket inflammation area

    CA3084010A1

  • Method for assessing the progression of chronic periodontitis and a set of reagents for its implementation

    RU2777783C1

  • Assay and method

    US20160138089A1