Recombinant vector for inducing neuronal differentiation and pharmaceutical composition for preventing or treating neurodegenerative diseases comprising same

Abstract

The present invention relates to a recombinant vector for inducing neuronal differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2, wherein when the vector is treated with neural stem cells or neural precursor cells, differentiation into neurons is induced, and when the vector is injected into a neurodegenerative disease mouse model, neural behavioral function is improved, and neurogenesis and GABAergic neuron formation are promoted.

Description

Recombinant vector for inducing neural cell differentiation and pharmaceutical composition for preventing or treating degenerative brain nerve diseases comprising the same

[0001] The present invention relates to a recombinant vector for inducing neural cell differentiation and a pharmaceutical composition comprising the same for preventing or treating degenerative brain nerve diseases.

[0002] Huntington's disease (HD) is a genetic brain disorder that affects the nervous system. It usually causes severe physical and mental disability within 15 to 25 years of onset, and eventually leads to death. Symptoms of HD that develop in adulthood include involuntary movements, abnormal gait, slurred speech, difficulty swallowing, cognitive impairment, and personality disorders. When HD develops, widespread brain damage occurs, damaging the caudate nucleus, putamen, globus pallidus, cerebral cortex, and neurotransmitters, leading to death. By the time of death, the brain weight has decreased by 15 to 20% of normal.

[0003] Diagnostic methods for Huntington's disease include clinical symptoms, family history, and genetic testing. Genetic testing involves examining whether the CAG trinucleotide sequence, which is repeated 28 times in normal individuals, is amplified to 40 or more times in patients. Treatment for Huntington's disease can partially improve chorea, movement disorders, depression, and behavioral symptoms through medication, but there is currently no treatment that can halt or reverse neuronal loss.

[0004] Oct4, Sox2, Klf4, and c-Myc are transcription factors that can reprogram adult differentiated cells into induced pluripotent stem cells (iPSCs), and it is known that partial reprogramming can be induced in the body by forcibly inducing partial reprogramming through the expression of these genes, thereby inducing tissue regeneration. According to prior patent document 1, a cell therapeutic agent for preventing or treating bone-related diseases is disclosed, which utilizes a method for direct cross-differentiation from somatic cells into bone-related cells, including a step of treating somatic cells with an OCT4 expression promoting factor and a musculoskeletal growth factor, and according to prior patent document 2, a pharmaceutical composition for preventing or treating kidney cell damage diseases is disclosed, which utilizes a method for inducing direct redifferentiation from urine cells into renal progenitor cells by introducing a nucleic acid encoding Oct4, Sox2, Klf4, and c-Myc. However, research related to the prevention or treatment of neurodegenerative diseases such as Huntington's disease using the above factors is insufficient.

[0005] Accordingly, the present inventors have completed the present invention by confirming that when neural stem cells (NSCs) or neural progenitor cells (NPCs) are treated with a vector expressing Oct4 or Sox2, differentiation into neural cells is induced and promoted, and when a vector containing the above gene is administered to a mouse model of a degenerative brain nerve disease, brain weight increases, nerve regeneration is promoted, and behavioral function is improved.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] (Patent Document 0001) Republic of Korea Patent Publication No. 10-2020-0004744 (January 14, 2020)

[0009] (Patent Document 0002) Republic of Korea Patent Document No. 10-2150489 (August 26, 2020)

[0010] The purpose of the present invention is to provide a recombinant vector for inducing neuron differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0011] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain nerve diseases, comprising the recombinant vector.

[0012] Another object of the present invention is to provide a composition for inducing neuron differentiation, comprising the recombinant vector.

[0013] Another object of the present invention is to provide a method for producing a recombinant vector comprising: (a) preparing a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2; and

[0014] (b) a step of treating the vector to neural stem cells (NSCs) or neural progenitor cells (NPCs);

[0015] It provides a method for inducing differentiation of neurons, including:

[0016] Another object of the present invention is to provide a use for preventing or treating degenerative brain nerve diseases, comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0017] Another object of the present invention is to provide a method for preventing or treating a degenerative brain nerve disease, comprising the step of administering to a subject in need thereof a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0018] Another object of the present invention is to provide a use of a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for producing a preparation for preventing or treating a degenerative brain nerve disease.

[0019] Another object of the present invention is to provide a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

[0020] Another object of the present invention is to provide a use of a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

[0021] To achieve the above purpose, the present invention provides a recombinant vector for inducing neuron differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0022] The present invention also provides a pharmaceutical composition for preventing or treating a degenerative brain nerve disease, comprising the recombinant vector.

[0023] The present invention also provides a composition for inducing neuron differentiation, comprising the recombinant vector.

[0024] The present invention also comprises the steps of (a) preparing a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2; and

[0025] (b) a step of treating the vector to neural stem cells (NSCs) or neural progenitor cells (NPCs);

[0026] A method for inducing differentiation of neurons, including:

[0027] The present invention also provides a use for preventing or treating a degenerative brain disease, comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0028] The present invention also provides a method for preventing or treating a degenerative brain disease, comprising administering to a subject in need thereof a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0029] The present invention also provides the use of a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for producing a preparation for preventing or treating a degenerative brain nerve disease.

[0030] The present invention also provides a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

[0031] The present invention also provides the use of a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

[0032] A recombinant vector for inducing neuronal differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2 of the present invention, induces differentiation of neural stem cells or neural progenitor cells into neurons, and in particular, can increase the number of GABAergic neurons in the striatum. In addition, when injected into the brain of a mouse model of a degenerative brain disease, the vector increases the number of neurons without tumor formation, does not cause loss of brain tissue due to brain degeneration or damage, and improves behavioral functions, thereby having the effect of treating degenerative brain disease.

[0033] Figure 1 shows the results of confirming the gene transfer efficiency by treating Neuro2a cells with mCherry, Oct4, or Sox2 expression plasmids, and measuring the expression of fluorescent proteins and specific genes to confirm whether the plasmids were efficiently expressed within the cells.

[0034] Figure 2A shows the schedule of behavioral experiments after injection of OCT4 or SOX2 expression vectors into a Huntington's disease mouse model, and Figure 2B shows the results of confirming the efficiency of virus and gene expression through evaluation of mCherry expression after injection of the vectors into the ventricles region.

[0035] Figure 3(A) shows the results of evaluating Oct4 expression in the frontal cortex (FC) and subventricular zone (SVZ) using qRT-PCR, and Figure 3(B) shows the results of evaluating Oct4 expression in the heart, liver, kidney, and spleen along with the subventricular zone. Oct4 expression was not observed in organs other than the subventricular zone.

[0036] Figure 4(A) of Figure 4a shows cell proliferation (BrdU) due to Oct4 expression in the subventricular zone by immunohistochemistry (IHC) staining. + cells), neural stem cells (Nestin+ cells), GABAergic neurons (GABA + and Darpp32 + The results of confirming the increase in the number of GABAergic neurons (GABA cells) in the striatum (STR) by IHC staining are shown in Figure 4(B). + and Darpp32 + This shows the results of confirming an increase in the number of cells.

[0037] Figure 4(C) of Figure 4b shows cell proliferation (BrdU+ cells) and neural stem cells (Nestin) due to Sox2 expression by IHC staining. + cells), GABAergic neurons (GABA + and Darpp32 + We confirmed an increase in the number of cells (GFAP) and astrocytes (GFAP + Figure 4(D) shows the results of confirming the decrease in the number of newly generated neural stem cells (Nestin + BrdU + cells) and newly generated GABAergic neurons (Darpp32 + BrdU + This shows the results of confirming the increase in cells.

[0038] Figure 5(A) shows brain images of AAV4-OCT4, AAV4-SOX2, and control groups, and Figure 5(B) shows brain weight and body weight increase results of AAV4-OCT4 or AAV4-SOX2 treatment groups compared to untreated control group, PBS control group, and AAV4-mCherry control group.

[0039] Figures 6(A) and 6(B) show the results of evaluating improvement in motor function through the rotarod test and muscle strength test, respectively.

[0040] Figures 7(A) and 7(B) show the results of comparing the increased expression levels of OCT4, TUJ1, GAD67, and GABAAα1, and the increased expression levels of SOX2, TUJ1, GAD67, and GABAAα1, respectively, compared to the control group (mCherry), measured by RT-PCR.

[0041] Figure 8 shows the results of H&E staining confirming that no teratoma or tumor was formed in the subventricular zone (SVZ) and striatum.

[0042] Hereinafter, the present invention will be described in detail.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0044] In the present invention, the term "reprogramming factor" originates from the concept of reprogramming (Cellular Reprogramming), introduced by Professor Yamanaka's team in 2006. All tissues in an adult body undergo normal development, gradually differentiating from an undifferentiated state into specialized cells with specific functions. Among these, the cells of the fertilized egg are totipotent, and as development progresses and the blastocyst forms, they can differentiate into the inner cell mass and outer cells. The cells of the inner cell mass can develop into embryonic somatic cells and germ cells, and this is called pluripotent.

[0045] In the present invention, the term "vector" refers to a genetic construct that is an expression vector capable of expressing a target protein in a suitable host cell and includes essential regulatory elements operably linked to enable expression of a genetic insert.

[0046] The above "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein so that the nucleic acid expression control sequence can perform a general function. The operative linkage with a recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art.

[0047] The above expression vector can be introduced into cells using methods known in the art. For example, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun, and other known methods for introducing nucleic acids into cells.

[0048] The amino acid sequences and nucleic acid sequences described in the present invention can be interpreted to extend to sequences having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology with the provided sequences.

[0049] In the present invention, the term "prevention" refers to the suppression or delay of the onset of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is suppressed or delayed for a predetermined period of time.

[0050] In the present invention, the term "treatment" means partially or completely alleviating, improving, alleviating, inhibiting or delaying the symptoms of a specific disease, disorder and / or condition or condition, reducing the severity or reducing the occurrence of one or more symptoms or characteristics.

[0051]

[0052] The present invention provides a recombinant vector for inducing neuron differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2.

[0053] The recombinant vector for inducing neural cell differentiation containing the above Oct4 may include the base sequence of sequence number 1.

[0054] The recombinant vector for inducing neural cell differentiation containing the above Sox2 may include the base sequence of sequence number 2.

[0055] The above differentiation may be from, but is not limited to, neural stem cells (NSCs) or neural progenitor cells (NPCs).

[0056] The above-mentioned nerve cells may be at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons, and are preferably GABAergic neurons, but are not limited thereto.

[0057] The above recombinant vector may additionally include, but is not limited to, a nestin promoter.

[0058] A recombinant vector additionally comprising the above nestin promoter may comprise the base sequence of SEQ ID NO: 3.

[0059] The above vector may be an adeno-associated virus (AAV) vector, and the adeno-associated virus vector may be any one selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAV11, and preferably, but not limited to, AAV4.

[0060] The present invention also provides a pharmaceutical composition for preventing or treating a degenerative brain disease, comprising a recombinant vector.

[0061] The above degenerative brain nerve disease refers to a disease that causes various symptoms as degenerative changes appear in nerve cells of the central nervous system, and includes a brain nerve disease that impairs cognitive function, learning or memory, or is accompanied by a neuroinflammatory response. The above degenerative brain nerve disease may be at least one disease selected from the group consisting of Huntington's disease, dementia, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Creutzfeldt-Jakob disease, stroke, multiple sclerosis, learning disability, and memory impairment, and is preferably Huntington's disease, dementia, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, stroke, multiple sclerosis, and most preferably Huntington's disease, but is not limited thereto.

[0062] The above composition may be formulated into a unit dosage form suitable for administration into a patient's body according to a conventional method in the pharmaceutical field, and may be administered by a parenteral route including intravenous, oral, or cutaneous, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, intragastric, topical, sublingual, intravaginal, or rectal route using a conventional administration method in the art, and most preferably, may be administered into the ventricles, but is not limited thereto.

[0063] The above administration may be performed via a stereotaxic procedure.

[0064] The above stereotaxic procedure, also known as stereotactic functional surgery or stereotactic surgery, is a surgical method that uses a stereotactic system to obtain the three-dimensional coordinates of a target in the brain, and then precisely reaches the target according to the coordinates. The surgery can be performed through a small hole in the skull under local anesthesia.

[0065] When the pharmaceutical composition of the present invention is formulated as a preparation for oral administration or parenteral administration depending on the route of administration, it may be prepared using one or more buffers (e.g., saline or PBS), carbohydrates (e.g., glucose, mannose, sucrose, or dextran, etc.), antioxidants, bacteriostats, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

[0066] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

[0067] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents, such as water or liquid paraffin, various excipients may be included, such as wetting agents, sweeteners, flavoring agents, or preservatives.

[0068] Additionally, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrating agent in some cases, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.

[0069] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. In the case of injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the above injection from microbial contamination, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal, may be additionally included. In addition, the above injection may, in most cases, additionally include an isotonic agent, such as sugar or sodium chloride.

[0070] Transdermal administration agents include ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" as used herein refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

[0071] For inhalation dosage forms, the active ingredient used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of all pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0072] The total effective amount of the pharmaceutical composition of the present invention can be administered to a patient as a single dose, or can be administered by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. For example, the dosage of the composition is determined by considering various factors such as the patient's age, weight, health status, sex, severity of the disease, diet, and excretion rate, as well as the route of administration and the number of treatments. Therefore, considering this, a person having ordinary skill in the art will be able to determine an appropriate effective dosage for the composition according to the specific use intended for the present invention. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, or method of administration, as long as it exhibits the effects of the present invention.

[0073] The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0074]

[0075] The present invention also provides a composition for inducing neuron differentiation, comprising the recombinant vector.

[0076] The above differentiation may be from, but is not limited to, neural stem cells (NSCs) or neural progenitor cells (NPCs).

[0077] The above-mentioned nerve cells may be at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons, and are preferably GABAergic neurons, but are not limited thereto.

[0078]

[0079] The present invention also provides a method for inducing differentiation of neurons, comprising the steps of: (a) preparing a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2; and (b) treating the vector to neural stem cells (NSCs) or neural progenitor cells (NPCs).

[0080] The above-mentioned nerve cells may be at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons, and are preferably GABAergic neurons, but are not limited thereto.

[0081]

[0082] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0083]

[0084] Example 1. Experimental materials and methods

[0085]

[0086] 1-1. Experimental animal models

[0087]

[0088] We used an R6 / 2 transgenic mouse model of Huntington's disease (HD) with approximately 160 ± 5 CAG repeats. These mice were provided by Jackson Laboratory (B6CBA-Tg(HDexon1)62Gpb / 1J, Stock No: 002810) and exhibit neurological symptoms similar to those observed in human HD, including chorea, involuntary repetitive behaviors, tremors, seizures, and abnormal vocalizations. Symptoms typically begin to appear between 6 and 8 weeks of age, and the average lifespan is approximately 13 weeks. Wet food pellets were provided daily to prevent dehydration and malnutrition. All experimental animals were housed in an AAALAC-accredited facility, and all procedures were approved by the Institutional Animal Care and Use Committee (IACUC 2016-0298, 2020-0007). Mice were housed in a temperature-controlled environment with a 12-h day / night cycle, with free access to food and water.

[0089]

[0090] 1-2. Huntington's disease mouse genotype analysis

[0091]

[0092] Genotyping of mice was performed based on the Jackson Laboratories protocol. A 2-mm piece was collected from the ear of each mouse, and genomic DNA (gDNA) was extracted using the standard procedure of the KAPA Express Extraction Kit (EXPEXTKB, Roche). The ear tissue was lysed with 10 μL of 10X KAPA, 2 μL of enzyme, and 88 μL of sterile deionized water at 75°C for 10 min, and the enzyme was inactivated at 95°C for 5 min. The primers in Table 1 were used for PCR, and 10 μL of each PCR product was loaded onto a 2% agarose gel and subjected to electrophoresis.

[0093]

[0094] Primer sequence Sequence number Positive control forward primer 5'-GGC CAC AGA ATT GAA AGT TCT -3' Positive control reverse primer 5'-GGT GGA AAT TCT AGC ATC ATC C-3' (length of wild type product, 217 bp) Transgene forward primer 5'-TC AGG TTC TGC TTT TA-3' Transgene reverse primer 5'-AAG GAC TTG AGG GAC TC-3' (length of mutant product, 117 bp)

[0095]

[0096] 1-3. Experiment Schedule

[0097]

[0098] Mice were randomly assigned to one of three groups: AAV4-mcherry (N = 3), Sham (N = 10), AAV4-Sox2 (N = 7), or AAV4-Oct4 (N = 8). Pre-treatment behavioral tests, including the rotarod test and grip strength test, were performed at week 3. Viral vectors were injected at week 4. After injection, mice were monitored for a total of 8 weeks. During this follow-up period, the rotarod test and hindlimb clasping test were performed weekly. Grip strength tests and open field tests were performed at week 12. At the end of the 12-week period, mice were sacrificed and qRT-PCR was performed to analyze gene expression (Sham (N = 10), AAV4-Oct4 (N = 8), AAV9-Sox2 (N = 7)).

[0099]

[0100] 1-4. Immunocytochemistry (ICC)

[0101]

[0102] Immunocytochemistry was performed using a method described previously (Lasic et al., 2016) with slight modifications. Briefly, cell cultures were fixed with 4% paraformaldehyde for 10 min and permeabilized with DPBS containing 0.1% Triton X-100 for 15 min at room temperature. After blocking with 5% albumin bovine for 1 h, cells were incubated overnight with anti-GFAP (Neuronomics, RA-22101) and anti-nestin (Millipore, MAB2736) antibodies. Samples were incubated with antibodies at a concentration of 1:400. After three washes with DPBS, specific secondary antibodies conjugated with Alexa Fluor 488 (green) or 594 (red) were reacted for 1 h at room temperature. Cell nuclei were stained with a 10 mg / mL solution of Hoechst 33342 (trihydrochloride, trihydrate) dissolved in DPBS. Cells were visualized using a confocal microscope (LSM700, Zeiss, Göttingen, Germany).

[0103]

[0104] 1-5. Stereotaxic injection of AAV viral vectors using Oct4 and Sox2

[0105]

[0106] Four-week-old mice were anesthetized by intraperitoneal injection of ketamine (100 mg / kg; Huons) and lumpun (10 mg / kg; Bayer Korea). 1 μL was injected into each of the lateral ventricles (LV) through a stereotaxic procedure, 1 Х 10 9Viruses were injected at a concentration of vg / mL. The injection site was precisely targeted to the ventricles at coordinates AP +0.3, ML +0.7, DV -2.0 for the left side and AP +0.3, ML -0.7, DV -2.0 for the right side. AAV4-NESTIN-OCT4-HA and AAV4-NESTIN-SOX2-FLAG were expressed using the NESTIN promoter.

[0107]

[0108] 1-6. Neurobehavioral tests

[0109]

[0110] To assess the behavior of Huntington's disease in a mouse model, two behavioral tests were performed, including the rotarod test and the muscle strength test. These tests were conducted to assess various motor and behavioral symptoms associated with Huntington's disease.

[0111]

[0112] [Rotarod Test]

[0113]

[0114] Huntington's disease is characterized by progressive deterioration of motor function and coordination. To assess these impairments, mice were tested weekly from weeks 3 to 12 using a rotarod (Model 47600, Ugo Basile, Comerio, Italy). The rotarod test was set to an accelerating speed (4–40 rpm) and a constant speed (12 rpm), and the time until the mouse fell was measured, with a maximum test time of 300 seconds. Before the official test, the mice underwent a 2-minute acclimation period at 4 rpm and additional practice. To prevent fatigue, a 20-minute rest period was provided between speed changes.

[0115]

[0116] [Strength Test]

[0117]

[0118] As Huntington's disease progresses, muscle strength gradually declines. Muscle strength testing directly assesses muscle strength by measuring the force mice exert when grasping an object. This test was conducted at weeks 3 and 12 using the SDI Grip Strength System (San Diego Instruments, Inc., San Diego, CA, USA). Mice grasped a 2-mm diameter triangular metal wire, and the device automatically recorded peak muscle strength in kilograms of force (kgf). The average of peak muscle strength measured over three trials was normalized to body weight and used for analysis.

[0119]

[0120] 1-7. Immunochemistry

[0121]

[0122] Mice received intraperitoneal injections of BrdU (5-bromo-2'-deoxyuridine; 50 mg / kg, Sigma-Aldrich, St. Louis, MO, USA) daily for 12 days after stereotaxic surgery. Twelve-week-old R6 / 2 mice were sacrificed and slowly perfused with cold 1X PBS, followed by the same process with 4% paraformaldehyde (PFA). The collected brain tissues were frozen in OCT compound (Leica, Wetzlar, Germany) using isopentane, and then sectioned at 16 μm thickness using a cryomicrotome (Cryostat Leica 1860, Leica biosystem, MI, Italy). Immunohistochemical staining was performed on four sections representing a range of ≥128 μm. The tissue sections were stained with the following antibodies: cell proliferation markers; BrdU (1:400, abcam, ab6326); Nestin (1:400, Millipore MAB2736); GABA (1:400, Sigma, sc-5279); GFAP (glial fibrillary acidic protein, 1:400, Neuronomics, RA-22101); DARPP-32 (dopamine- and cAMP-regulated neuronal phosphoprotein, 1:400, cell signaling technology, 2306). Stained sections were imaged with a confocal microscope (LSM700, Zeiss, Göttingen, Germany) and analyzed using the ZEN Black and Blue Edition (Zeiss, Göttingen, Germany).

[0123]

[0124] 1-8. H&E staining

[0125]

[0126] The nuclei (purple) and cytoplasm (pink) of the biological tissue were distinguished. The staining pattern showed the distribution of cells and helped to determine the overall pathological structure of the tissue. The experiment was performed to determine the presence of histological abnormalities such as dysplasia.

[0127]

[0128] 1-9. qRT-PCR

[0129]

[0130] Twelve-week-old R6 / 2 mice were sacrificed for biochemical studies and perfused cardiacally with cold 1X PBS. RNA was extracted from the prefrontal cortex (FC), subventricular zone, and striatum using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA was synthesized using ReverTra Ace qPCR RT Master Mix and gDNA Remover (TOYOBO) using purified total RNA (1 μg) as a template. The standard protocol for qRT-PCR using SYBR Green was performed according to the Roche Applied Science guidelines. qRT-PCR reactions were performed in triplicate using a LightCycler® 480 SYBR Green I Master (Roche Diagnostics, Mannheim, Germany), containing a total of 20 μL of master mix and 1 μL of cDNA. Relative expression levels are calculated using the magnification method (2^-△△C T ) was quantified using △C T represents the difference in Ct (cycle threshold) values ​​between the target gene Oct4 and the internal control GAPDH. The expression of each gene is 2^△△C TThe results were calculated using the method. All results are expressed as the mean ± standard error of the mean from at least three independent experiments. Reactions were performed on a Light Cycler thermal cycler (Roche Diagnostics, Mannheim, Germany), and the oligonucleotide primers used are listed in Table 2. All results are expressed as the mean ± standard error of the mean from at least three independent experiments.

[0131] Gene primer sequence sequence number mOct4 forward CAGCAGATCACTCACATCGCCA8 reverse GCCTCATACTCTTCTCGTTGGG9 mOct4 (5') forward CCTGCAGGCAGCTGCGCGCT10 reverse AGGAAACCCTAGTGATGGAGT11 mOct4 (3') forward AGGAAACCCCTAGTGATGGAG12 reverse CCTGCAGCAGCTGCGCGCTC13 mSox2 forward AACGGGCAGCTACAGCATGATGC14 reverse CGAGCCTGGTCATGGAGTTGTAC15 mSox2 (5') forward CCTGCAGGCAGCTGCGCGCT16 reverse TGCAGATGGTGTGTCTGTGGTG17 mSox2 (3') Forward AGGAAGCCCTAGTGATGGAG18Reverse CCTGCAGCTGCGCGCTC19βIII-tubulin Forward TAGACCCCAGCGGCAACTAT20Reverse GTTCCAGGTTCCAAGTCCACC21 GAD67 Forward CAAGTTCTGGCTGATGTGGA22Reverse GCCACCCTGTGTAGCTTTTC23 GABAA α1 Forward CGGCAAACAACCTTATGG24Reverse ATTAGCACGGCAGATATGT25 GAPDH Forward GTGAGCCAAAAGGGTCATCA26Reverse CCCTTCCACAATGCCAAAGTT27

[0132]

[0133] 1-10. Statistical Analysis

[0134]

[0135] Statistical analysis was performed using the Statistical Package for Social Sciences software version 23.0 (IBM Corporation, Armonk, NY, USA). One-way analysis of variance (ANOVA) was used to compare the three experimental groups, and the least significant difference (LSD) method was used for post hoc analysis. All data are expressed as the mean ± standard error. For comparisons between groups, independent t-tests were used, and for comparisons between multiple groups, one-way analysis of variance (ANOVA) followed by post hoc Bonferroni or Tukey comparisons were performed using SPSS software (IBM Corporation, Armonk, NY, USA; version 25.0). A P value of <0.05 was considered statistically significant. In vitro experiments were performed at least three times to ensure reproducibility. Both male and female subjects were used in the study, and they were randomly assigned to the in vivo experimental groups. Mouse samples were analyzed by molecular studies such as qRT-PCR, using data from three independent experiments.

[0136]

[0137] Example 2. Confirmation of gene transfer efficiency through detection of mCherry, Oct4, or Sox2 expression plasmids.

[0138]

[0139] A plasmid expressing mCherry fluorescent protein under the control of the nestin promoter was constructed and packaged into an adeno-associated virus 4 (AAV4) viral vector for gene transfer. The AAV4 vector containing the nestin promoter-driven mCherry plasmid was introduced into Neuro2a cells, a mouse neuroblastoma cell line. After transfection of Neuro2a cells with the AAV4 vector, the expression of mCherry fluorescent protein was observed using a fluorescence microscope to evaluate the gene transfer efficiency (Fig. 1).

[0140] In addition to the plasmid expressing mCherry, we also constructed other plasmids that express Oct4 or Sox2 under the control of the nestin promoter. These plasmids were also packaged into an AAV4 viral vector and transfected into Neuro2a cells. After transfection, the expression levels of Oct4 and Sox2 were measured by qRT-PCR to confirm gene expression driven by the nestin promoter.

[0141]

[0142] Example 3. Induction of mCherry, Oct4, or Sox2 expression in neural progenitor cells.

[0143]

[0144] After genotyping at 2-3 weeks of age to confirm that the R6 / 2 Huntington's disease mouse model was Huntington's disease-positive, DPBS, AAV4-mCherry, AAV4-OCT4, or AAV4-SOX2 was injected into the bilateral cerebral ventricles of the mice at 4 weeks of age (Fig. 2A).

[0145] AAV-mediated nestin promoter labeling of neural progenitor cells (NPCs) is suitable for investigating neuronal differentiation and conversion into GABAergic neurons. 1x10 9After injecting AAV4-Nestin promoter-mCherry control virus at a concentration of 1 μl (vg / ml) into the bilateral ventricles, mCherry expression was observed. Marked mCherry expression was observed in the ventricle region injected with the control virus, demonstrating successful transduction of neural progenitor cells via the AAV4-Nestin promoter-mCherry vector (Fig. 2B).

[0146]

[0147] Example 4. Confirmation of reprogramming transcription factor expression

[0148]

[0149] qRT-PCR analysis of Oct4 expression in R6 / 2 mice revealed that the expression levels of each reprogramming gene were significantly increased in the prefrontal cortex (FC) and subventricular zone (SVZ) of the brain, confirming targeted expression in these regions. In contrast, Oct4 expression was minimal or minimal in peripheral organs such as the heart, liver, kidney, lung, and spleen, suggesting that the reprogramming factors delivered via the AAV4 virus were primarily concentrated in the brain and not effectively expressed in other tissues (Fig. 3A and Fig. 3B).

[0150]

[0151] Example 5. Evaluation of neural marker expression

[0152]

[0153] To investigate the effect of OCT4 or SOX2 expression levels on the efficiency of reprogramming NPCs into neurons or GABAergic neurons, we developed a system to study the conversion of NPCs to GABAergic neurons. This system utilized an AAV-mediated approach combined with nestin promoter-driven labeling of neurons. Specifically, AAV4 serotypes expressing OCT4 or SOX2 under the control of the nestin promoter were stereotactically injected into the bilateral lateral ventricles of mice. Eight weeks after injection, immunohistochemistry was performed to assess the expression of various neuronal markers, including nestin, a marker for neural progenitor cells, GAD67, a marker for GABAergic neurons, Darpp32, a marker for medium-sized spiny neurons, and GFAP, a marker for astrocytes. This assessment aimed to confirm the effectiveness of reprogramming and to identify whether OCT4 or SOX2 expression affected specific neuronal and glial cell types ( Figures 4A and 4B ).

[0154]

[0155] Example 6. Evaluation of neural marker expression and neural cell conversion efficiency

[0156]

[0157] Cells infected with OCT4 or SOX2 viruses showed significantly higher expression levels of nestin, a neural progenitor cell marker, GABA, an inhibitory neurotransmitter, and DARPP32, a marker of medium-sized spiny neurons. In contrast, expression of these markers was minimal in control cells infected with Sham or mCherry viruses. These results suggest that OCT4 or SOX2 viruses effectively activate neural progenitor cells (NPCs) or neural stem cells (NSCs) to reprogram them into neurons or cells with neurogenesis potential.

[0158] To evaluate the efficiency of conversion to newly generated neurons, Nestin + / BrdU + (Neural stem cells) and GABA + / BrdU + (Newly generated GABAergic neurons) The proportion of cells was analyzed. To identify new cells, R6 / 2 mice were injected with BrdU daily for 12 days. Histological evaluation was performed 8 weeks after reprogramming induction. As a result, neural stem cells (Nestin) + cells), GABAergic neurons (GABA + cells), medium-sized spiny neurons (DARPP32 + It was confirmed that differentiation of cells) increased. BrdU in the subventricular zone + Cell density was significantly higher in the OCT4 or SOX2 treated groups compared to the sham control group. In addition, BrdU + Nestin + Cells and GABA + BrdU + Cell density was also significantly higher in the OCT4 and SOX2-treated groups than in the sham control group (Figures 5A and 5B). This suggests that OCT4 and SOX2 generate new neurons and activate neural stem cells in the brain.

[0159]

[0160] Example 7. Brain weight measurement

[0161]

[0162] The increase in brain weight is due to enhanced neurogenesis, particularly in areas such as the subventricular zone, where new neurons are generated. This proliferation of neurons contributes significantly to the overall increase in brain weight (Figure 6).

[0163] In R6 / 2 mouse models genetically modified to express OCT4 or SOX2, a significant and marked increase in brain size and weight was observed at 12 weeks. Notably, brain atrophy was reduced, suggesting improved brain structural integrity. Despite the increase in brain weight, there was no significant change in body weight, indicating that the effects of Oct4 or Sox2 reprogramming are specific to the brain. R6 / 2 mice showed no gross structural abnormalities in coronal cortical sections of adult brains at 12 weeks. Size increases were observed in specific brain regions where OCT4 or SOX2 was expressed, indicating that sustained expression of OCT4 or SOX2 contributes to promoted brain growth and reduced atrophy ( Figures 6A and 6B ).

[0164]

[0165] Example 8. Improvement of neurobehavioral function in R6 / 2 mice

[0166]

[0167] To investigate the effects of in vivo expression of reprogramming factors Oct4 or SOX2 on reprogramming and neurobehavioral function transformation in Huntington's disease mouse models, vectors carrying Oct4 or SOX2 were injected into specific brain regions using AAV4 to induce expression of reprogramming factors. This aimed to reprogram NSCs or NPCs into GABAergic neurons, which are primarily affected in Huntington's disease (Fig. 7).

[0168] Neurobehavioral function of the mice was assessed using a series of behavioral tests. In the rotarod test to assess motor ability, the AAV4-Oct4 or AAV4-SOX2-treated group showed a delayed onset of motor decline compared to the untreated group as well as the sham and mCherry controls. When tested at a fixed speed (12 rpm), the falling time of AAV4-Oct4- or AAV4-SOX2-treated mice significantly increased compared to the control group at 10 and 11 weeks, indicating some improvement in motor function (Fig. 7A).

[0169] In a grip strength test measuring muscle strength, the AAV4-Oct4 or AAV4-SOX2-treated group demonstrated greater muscle strength compared to the control group. However, although a trend toward improved motor function was observed, the overall improvement was minimal, indicating that while the treatment slowed the rate of deterioration, it did not significantly improve motor function ( Figure 7B ).

[0170] These results suggest that in situ expression of Oct4 or SOX2 may contribute to neuroprotection or neuroregeneration. This may be achieved through the reprogramming of astrocytes or NSCs / NPCs into GABAergic neurons, as evidenced by increases in markers such as nestin and GABA.

[0171]

[0172] Example 9. Induction of differentiation of neural stem cells into GABAergic neurons in R6 / 2 mice.

[0173]

[0174] At 12 weeks of age, we dissected the subventricular zone (SVZ) and striatum from R6 / 2 mouse brains and evaluated gene expression using RT-PCR. First, we confirmed overexpression of the reprogramming factors OCT4 and SOX2. Next, we examined the expression levels of key markers, including GAD67 (a marker of GABAergic neurons), TUJ1 (a marker of immature and mature neurons), and GABAAα1 (a subunit of the GABA-A receptor). Significant increases were observed in all markers, and the changes were statistically significant (Fig. 8).

[0175] The above results demonstrate that overexpression of OCT4 or SOX2 contributes to increasing the number of neurons and the proportion of GABAergic neurons. In particular, increased expression of GAD67 and GABAAα1 enhanced the expression of inhibitory neurons and GABA-A receptors. Furthermore, increased expression of TUJ1 suggests an increase in the number of mature neurons (Figures 8A and 8B). Overall, these results demonstrate that overexpression of OCT4 or SOX2 promotes neurogenesis and supports the development of GABAergic neurons.

[0176]

[0177] Example 10. Evaluation of the presence of teratoma or tumor

[0178]

[0179] The presence of teratomas or tumors was assessed using H&E staining. The analysis revealed no such abnormalities, confirming the absence of tumor formation or dysplasia in the tissue samples. These results support the safety of the AAV used in the study and indicate that it does not cause side effects or tumor formation (Figure 9).

[0180]

[0181] The present invention is an invention carried out through the following tasks.

[0182]

[0183] [National Research and Development Project Supporting This Invention]

[0184] [Project ID]1711177403

[0185] [Assignment Number] 21A0202L1-12

[0186] [Ministry Name] Ministry of Science and ICT

[0187] [Name of Project Management (Specialist) Institution] (Foundation) Inter-Ministry Regenerative Medicine Technology Development Project Group

[0188] [Research Project Name] Inter-Ministry Regenerative Medicine Technology Development Project

[0189] [Research Project Name] In vivo reprogramming and targeting for the treatment of neurodegenerative diseases

[0190] Development of cell transformation induction technology

[0191] [Contribution rate] 1 / 1

[0192] [Name of the project performing organization] Yonsei University Industry-Academic Cooperation Foundation

[0193] [Research Period] February 1, 2022 - December 31, 2022

Claims

1. A recombinant vector for inducing neuron differentiation, comprising at least one gene selected from the group consisting of Oct4 and Sox2.

2. A recombinant vector according to claim 1, characterized in that the differentiation is performed from neural stem cells (NSCs) or neural progenitor cells (NPCs).

3. A recombinant vector according to claim 1, characterized in that the neural cells are at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons.

4. A recombinant vector according to claim 1, characterized in that the recombinant vector additionally comprises a nestin promoter.

5. A recombinant vector according to claim 1, characterized in that the vector is an adeno-associated virus (AAV) vector.

6. A recombinant vector according to claim 5, characterized in that the adeno-associated virus vector is any one selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11.

7. A pharmaceutical composition for preventing or treating a degenerative brain disease, comprising a recombinant vector of any one of claims 1 to 6.

8. A pharmaceutical composition according to claim 7, characterized in that the degenerative brain nerve disease is at least one disease selected from the group consisting of Huntington's disease, dementia, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Creutzfeldt-Jakob disease, stroke, multiple sclerosis, learning disability, and memory impairment.

9. A pharmaceutical composition according to claim 7, characterized in that the composition is administered into the ventricles.

10. A pharmaceutical composition according to claim 9, characterized in that the administration is performed through a stereotaxic procedure.

11. A composition for inducing neuron differentiation, comprising a recombinant vector of any one of claims 1 to 6.

12. A composition for inducing differentiation, characterized in that the differentiation in claim 11 is performed from neural stem cells (NSCs) or neural progenitor cells (NPCs).

13. A composition for inducing differentiation, characterized in that the neuronal cells in claim 11 are at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons. 14.(a) A step of preparing a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2; and (b) a step of treating the vector to neural stem cells (NSCs) or neural progenitor cells (NPCs); A method for inducing differentiation of neurons, comprising:

15. A differentiation induction method according to claim 14, characterized in that the neural cells are at least one selected from the group consisting of GABAergic neurons, dopaminergic neurons, and glutamatergic neurons.

16. A use for preventing or treating a degenerative brain disease, comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2. A method for preventing or treating a degenerative brain disease, comprising administering to a subject in need thereof a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of 17.Oct4 and Sox2.

18. Use of a composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for producing a preparation for preventing or treating a degenerative brain nerve disease.

19. A composition comprising a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

20. Use of a recombinant vector comprising at least one gene selected from the group consisting of Oct4 and Sox2 for inducing differentiation of neural stem cells or neural progenitor cells into neural cells.

Images