Pharmaceutical composition for treating or alleviating degenerative brain disease containing houttuynia cordata thunb. extract

Abstract

The present invention relates to a pharmaceutical composition containing a Houttuynia cordata Thunb. extract as an active ingredient, and thus having excellent efficacy in treating or alleviating degenerative brain diseases, and a method for preparing same. A fraction derived from Houttuynia cordata Thunb., according to the present invention, not only does not exhibit cytotoxicity to macrophages, but also exhibits excellent anti-inflammatory efficacy due to having excellent inhibitory activity against NO production and TNF-α, and iNOS gene expression, increases the expression of mucin-related genes (MUC2), and increases the proliferation of intestinal epithelial cells and the expression of tight junction proteins. In addition, the fraction derived from Houttuynia cordata Thunb. inhibits the conversion of astrocytes into activated type A1, and significantly reduces Aβ plaques in the brain. Accordingly, the fraction derived from Houttuynia cordata Thunb. according to the present invention is remarkably effective in treating or alleviating degenerative brain diseases.

Description

Pharmaceutical composition containing extract of Eoseongcho for treating or improving degenerative brain diseases

[0001] This application claims priority to Republic of Korea Application No. 10-2024-0034580, filed March 12, 2024, the entire disclosure of which is incorporated herein by reference.

[0002] The present disclosure relates to a pharmaceutical composition having excellent therapeutic or improving efficacy for degenerative brain diseases by containing an extract of Eoseongcho as an active ingredient, and a method for producing the same.

[0003] Alzheimer's disease (AD) is characterized by neuronal loss and the appearance of extracellular senile plaques composed primarily of amyloid-beta (Aβ), a 39-43 amino acid peptide derived from the amyloid precursor protein. AD is known to be characterized by the accumulation of abnormal protein deposits, such as Aβ plaques and tau tangles, in the brain, leading to cognitive impairment, functional impairment, memory loss, and / or ultimately, loss of independence.

[0004] Microglia and astrocytes are two types of glial cells present in the brain, and they play a crucial role in maintaining homeostasis in the central nervous system (CNS) and protecting it from toxic substances. Recent studies have revealed that microglia and astrocytes play a crucial role in regulating neuroinflammation and neurodegeneration within the CNS. Microglia function as macrophages of the CNS, migrating to and surrounding damaged or dead cells in pathological conditions such as neurodegenerative diseases, stroke, traumatic injury, or brain tumor invasion, and removing cellular debris. Microglia activate a homeostatic system in astrocytes to defend against imbalances triggered by various forms of stress in the CNS. The activation of astrocytes and microglia in response to brain damage is called reactive gliosis.

[0005] In Alzheimer's disease, microglia and astrocytes are activated in response to the accumulation of abnormal proteins and neuroinflammation. Acutely activated microglia clear Aβ plaques through phagocytosis. However, chronic exposure of microglia to Aβ impairs oxidative phosphorylation and glycolysis, leading to a metabolic deficit that prevents energy production and contributes to immune dysfunction. Furthermore, activated microglia induce inactive astrocytes to become neurotoxic, reactive astrocytes. This induces neuroinflammation, reduces the clearance of toxic proteins, and disrupts the balance of neurotransmitters, further accelerating neuronal dysfunction and degeneration. Aβ 1-42 Inhibiting microglial activation induced by (AD-associated proteins) could potentially inhibit the formation of reactive astrocytes, thereby leading to the treatment or alleviation of Alzheimer's disease.

[0006] Neurodegenerative diseases such as Alzheimer's disease produce large amounts of Aβ or its peptide fragments, which have been reported to have toxic effects, suggesting that Aβ plays a key role in the pathogenesis of AD (Butterfield et al., Free Radical Biology and Medicine, 2002, 32:1050-1060; Butterfield et al., Free Radical Biology and Medicine, 2007, 43:658-677). Aβ directly induces neuronal cell death and makes neurons vulnerable to excitotoxicity and oxidative damage. Furthermore, the formation of reactive oxygen species is known to be involved in the pathogenesis of neurodegenerative diseases.

[0007] Mild cognitive impairment (MCI) is considered a precursor to Alzheimer's disease and is characterized by short-term memory loss, spatial memory loss, and emotional imbalance. MCI associated with memory loss is called amnestic MCI. While the probability of a 65-year-old normal person developing Alzheimer's disease within a certain period is 1-3%, the group with amnestic MCI showed that 8 out of 10 people developed Alzheimer's disease. In other words, people with amnestic MCI are considered to have a higher risk of developing Alzheimer's dementia.

[0008] The 5X FAD transgenic mouse is a specific type of genetically modified mouse that expresses five human genes (APPswe, APPI716V, APPV717I, Psen1M146L, and Psen1L286V) associated with familial Alzheimer's disease (FAD). These genetically modified animals exhibit several key features of the disease, including the formation of amyloid plaques and neurofibrillary tangles. The use of 5X FAD transgenic mice in drug development and testing is important for evaluating potential therapeutic interventions for Alzheimer's disease. The 5X FAD transgenic mouse can be useful in providing a platform for testing compounds and therapeutic strategies aimed at slowing the progression of subsequent AD behaviors by reducing the formation of amyloid plaques and neurofibrillary tangles and blocking the activation of microglia and astrocytes.

[0009] Plant-derived high molecular weight polysaccharides are known to exhibit pharmacological effects on cell differentiation, information transmission, infection, or cancer metastasis by binding to various receptors expressed on the surface of cell membranes (Ruoslahti E. (1989). Proteoglycans in cell regulation. J. Biol. Chem., 264: 13369-13372.). In addition, polysaccharides are known to be promising for the prevention and treatment of degenerative brain diseases such as AD, and have been reported to improve AD through various mechanisms with almost no toxic side effects (Zhiyuan Zhang et al., Advances in polysaccharides of natural source of the anti-Alzheimer's disease effect and mechanism, Carbohydrate Polymers, 2022, Nov 15, Volume 296; Qun Liu et al., Characterization of a pectin from Lonicera japonica Thunb. and its inhibition effect on Aβ 42 aggregation and promotion of neuritogenesis. Int J Biol Macromol, 2018, Feb;107(Pt A):112-120.)

[0010] Houttuynia cordata (Thunb.) is the root of the plant Houttuynia cordata, a member of the Saururaceae family. It is native to southeastern Asia, particularly Japan and Korea. Houttuynia cordata is used for both medicinal and edible purposes, and is classified as a plant that can only be used in minimal amounts as a secondary ingredient in the Food Code's food ingredient classification. Its medicinal properties include cardiotonic, diuretic, antibacterial, detoxifying, and anticancer effects. In the traditional Korean market, it is used in cosmetics and health functional foods to aid detoxification and beauty. Houttuynia cordata contains a variety of compounds, including decanoyl acetaldehyde, which has antibacterial, antiviral, and antifungal effects; and flavonoids, which have diuretic, cardiotonic, and laxative effects. Recent studies have shown that Houttuynia cordata extracts contain rhamnogalacturonan, a pectin-derived polysaccharide, which is known to be effective in treating neurodegenerative diseases such as Alzheimer's disease. In addition, in Korean Patent Publication No. 10-1302163, it was reported that the extract of Eoseongcho has a preventive or therapeutic effect on degenerative brain diseases such as dementia, Alzheimer's disease, Parkinson's disease, or stroke.

[0011] However, since the aforementioned Korean Patent Publication No. 10-1302163 discloses that the Houttuynia cordata extract was extracted using a conventional extraction method, it is expected to contain similar components to traditional Houttuynia cordata extracts. In other words, the prior art does not disclose Houttuynia cordata extracts with improved efficacy compared to standardized Houttuynia cordata extracts, or extraction methods for enhancing the efficacy of Houttuynia cordata extracts. Therefore, there is a need to develop a new extraction method that can further enhance the pharmacological effects of Houttuynia cordata extracts.

[0012] The problem to be solved by the present disclosure is to provide a method for producing a fraction derived from Houttuynia cordata that can improve the pharmacological efficacy of the Houttuynia cordata extract for treating or improving degenerative brain diseases.

[0013] In addition, the problem to be solved by the present disclosure is to provide a fraction derived from the herbaceous plant produced through the above production method and a pharmaceutical composition for treating or improving a degenerative brain disease comprising the same.

[0014] The inventors of the present disclosure have diligently researched and developed a novel extraction method capable of enhancing the pharmacological effects of the extract of Eoseongcho (Fruit of the Korean ginseng family) against degenerative brain diseases. As a result, the inventors discovered that the Eoseongcho-derived fraction obtained through a specific manufacturing method according to the present disclosure exhibits significantly enhanced therapeutic or ameliorating effects against degenerative brain diseases, compared to conventional extraction methods (e.g., hot water extraction or solvent extraction).

[0015] The present disclosure provides a method for preparing a fraction derived from Houttuynia cordata, comprising the steps of (S1) adding an ethanol aqueous solution to Houttuynia cordata leaves and then heat-extracting them to obtain an extract; (S2) hot-extracting Houttuynia cordata stems, then adding an ethanol aqueous solution and stirring to obtain an extract; and (S3) mixing the respective extracts obtained in steps S1 and S2. The method includes a specific step of extracting Houttuynia cordata leaves with an ethanol aqueous solution to obtain an extract, hot-extracting Houttuynia cordata stems, then adding an ethanol aqueous solution and stirring to obtain an extract, and then mixing the extracts of each part. Surprisingly, the present invention has been completed by discovering that the Houttuynia cordata-derived fraction prepared through this specific method has remarkably excellent efficacy in treating or improving brain degenerative diseases.

[0016] In one aspect of the present disclosure, the order of the (S1) extracting the leaves of the perilla plant and the (S2) extracting the stems of the perilla plant may be changed. This change in order does not affect the fractions obtained after the (S3) mixing step of the respective extracts.

[0017] In one aspect of the present disclosure, the (S1) step of extracting the leaves of the perilla frutescens may include the steps of (S1-1) adding an aqueous ethanol solution to the leaves of the perilla frutescens, heating and stirring, and then steeping; and (S1-2) filtering the steeped substance obtained in step S1-1 and concentrating the filtrate under reduced pressure to obtain a concentrate. The volume of the aqueous ethanol solution added in step (S1-1) may be 0.5 to 5 times (v / w), preferably 1 to 3 times (v / w), relative to the weight of the leaves of the perilla frutescens. The concentration of the aqueous ethanol solution in step (S1-1) may be 10 to 90% (v / v), and preferably a 50% (v / v) aqueous ethanol solution may be used. The heating and stirring in step (S1-1) may be performed at 30 to 70°C, preferably 40 to 60°C, for 3 to 9 hours, preferably 5 to 7 hours. In the above step (S1-2), filtration can be performed using Whatman filter paper #2. In the above step (S1-2), concentration under reduced pressure can be performed at 30 to 70°C, preferably 40 to 60°C. The concentrate obtained from the above step (S1-2) can be in the form of a soft extract.

[0018] In one aspect of the present disclosure, the (S2) step of extracting the stems of the perilla leaves may include a step of extracting the stems of the perilla leaves with hot water, filtering the extracted stems, concentrating the filtrate under reduced pressure, adding an aqueous ethanol solution to the obtained concentrate, and stirring the extracted stems. Preferably, the (S2) step of extracting the stems of the perilla leaves may include a step of (S2-1) adding water to the stems of the perilla leaves, heating, and stirring to extract the extracted stems; a step of (S2-2) filtering the extract obtained in step S2-1, and concentrating the filtrate under reduced pressure to obtain a concentrate; and a step of (S2-3) adding an aqueous ethanol solution to the concentrate obtained in step S2-2, and stirring the filtrate to obtain a precipitate. The volume of the water added in step (S2-1) may be 5 to 15 times (v / w), preferably 8 to 12 times (v / w), relative to the weight of the stems of the perilla leaves. In the step (S2-1), heating and stirring can be performed at 80 to 120°C, preferably 90 to 110°C, for 0.5 to 4 hours, preferably 1 to 3 hours. In the step (S2-2), filtration can be performed using Whatman filter paper #2. The concentrate obtained from the step (S2-2) can be in the form of a soft extract. The concentration of the ethanol aqueous solution used in the step (S2-3) can be 10 to 90% (v / v), and preferably 50% (v / v) ethanol aqueous solution can be used. The volume of the ethanol aqueous solution of the step (S2-3) can be 2 to 6 times, preferably 3 to 5 times, the volume of the soft extract of the step (S2-2). The precipitate of the step (S2-3) can be separated through filtration and used in the subsequent step (S3).

[0019] In one aspect of the present disclosure, the step of mixing each of the extracts (S3) may include a step of mixing the precipitate obtained in step (S2-3) with the concentrate obtained in step (S1-2) and then concentrating and drying the mixture.

[0020] In one aspect of the present disclosure, preferably, the manufacturing method may include the steps of (S1-1) adding an ethanol aqueous solution to the leaves of the perilla plant, followed by heating and stirring to extract the leaves; (S1-2) filtering the extract obtained in step S1-1 and concentrating under reduced pressure to obtain a concentrate; (S2-1) adding water to the stems of the perilla plant, followed by heating and stirring to extract the extract; (S2-2) filtering the extract obtained in step S2-1 and concentrating the filtrate under reduced pressure to obtain a concentrate; (S2-3) adding an ethanol aqueous solution to the concentrate obtained in step S2-2 and then stirring to obtain a precipitate; and (S3) mixing the precipitate obtained in step S2-3 with the concentrate obtained in step S1-2 and then concentrating and drying the mixture.

[0021] In one aspect of the present disclosure, the term "extraction" may refer to an operation of separating soluble components contained in a solid or liquid raw material by dissolving them with a solvent. Furthermore, the term "leaching" may refer to an operation of separating a solid raw material by dissolving it with a solvent.

[0022] In addition, the present disclosure provides a fraction derived from Houttuynia cordata obtained through the method for producing the above-described fraction derived from Houttuynia cordata. Compared to conventional extraction methods, the fraction derived from Houttuynia cordata obtained through the above-described method has a significantly higher content of quercitrin and rhamnogalacturonan.

[0023] In one aspect of the present disclosure, the quercitrin is a glycoside formed from the flavonoid quercetin and the deoxysugar rhamnose. Quercitrin, a type of flavonoid, is a natural antioxidant present in the plant kingdom and is known to exhibit effects of preventing aging, cancer, and heart disease by inhibiting lipid oxidation and oxidative stress and removing active oxygen. In addition, quercitrin is known to be useful in the treatment of Alzheimer's disease by improving cognitive impairment through alleviating inflammation (Lixin Wang et al., Quercitrin improved cognitive impairment through inhibiting inflammation induced by microglia in Alzheimer's disease mice, Neuroreport. 2022 May 18; 33(8): 327-335).

[0024] In one aspect of the present disclosure, the rhamnogalacturonan is a complex polysaccharide component of pectin found in the cell walls of plants. Rhamnogalacturonan is known to have various physiological activities such as stimulating cytokine production, activating macrophages, and stimulating natural killer (NK) cell activity. In addition, this pectin polysaccharide is known to have therapeutic potential for Alzheimer's disease by inhibiting the aggregation of Aβ and promoting neurogenesis (Qin Lui et al., Characterization of a pectin from Lonicera japonica Thunb. and its inhibition effect on Aβ 42 aggregation and promotion of neuritogenesis, International Journal of Biological Macromolecules, Volume 107, Part A, February 2018, Pages 112-120).

[0025] The present disclosure provides a fraction derived from Houttuynia cordata comprising 1 to 8 wt% quercitrin and 20 to 60 wt% rhamnogalacturonan relative to the total weight of the fraction. The Houttuynia cordata fraction can be obtained through the above-described production method. The Houttuynia cordata fraction contains a higher content of total polyphenols and low-molecular-weight active ingredients than a Houttuynia cordata extract extracted through a conventional extraction method. In particular, the Houttuynia cordata fraction has a significantly higher content of quercitrin and rhamnogalacturonan than a Houttuynia cordata extract extracted through a conventional extraction method (e.g., hot water extraction or aqueous ethanol solution extraction), thereby showing significantly superior efficacy in treating or improving degenerative brain diseases.

[0026] In one aspect of the present disclosure, the quercitrin may be present in an amount of 1 to 8 wt%, preferably 2 to 6 wt%, and more preferably 3 to 5 wt%, relative to the total weight of the fraction. If the quercitrin is present in an amount of less than 1 wt% relative to the total weight of the fraction, the effect of treating or improving degenerative brain diseases may be weak, and it is practically difficult to extract quercitrin from the extract of Houttuynia cordata in a high amount exceeding 8 wt%.

[0027] In one aspect of the present disclosure, the rhamnogalacturonan may be 20 to 60 wt%, preferably 25 to 55 wt%, and more preferably 30 to 50 wt%, based on the total weight of the fraction. If the rhamnogalacturonan is less than 20 wt% based on the total weight of the fraction, the effect of treating or improving degenerative brain diseases may be weak, and it is realistically difficult to extract rhamnogalacturonan from Houttuynia cordata in a high amount exceeding 60 wt%.

[0028] The fraction derived from the above-described herb according to the present disclosure was not only non-cytotoxic, but also showed excellent NO production inhibition activity and TNF-α and iNOS gene expression inhibition activity, and was confirmed to have remarkably excellent anti-inflammatory efficacy (Experimental Example 2).

[0029] In addition, it was confirmed that the fraction derived from the above-mentioned Eoseongcho increases the expression level of a mucin production-related gene (MUC2) in intestinal mucus-secreting cells (Experimental Example 3), proliferates intestinal epithelial cells (Caco2 cells), and increases the expression of occludin, a tight junction protein (Experimental Example 4).

[0030] In addition, it was confirmed that the fraction derived from the above-mentioned perilla frutescens suppresses the gene that converts astrocytes into reactive astrocytes, thereby inhibiting the conversion of astrocytes into activated A1 (Experimental Example 5). In addition, when astrocytes whose conversion into activated A1 was inhibited by the above-mentioned perilla frutescens fraction were treated to mouse neurons or human embryonic neurons, it was confirmed that apoptosis of the neurons was reduced (Experimental Example 6). In addition, through an experiment with 5XFAD mice, an Alzheimer's disease animal model, it was confirmed that the fraction derived from the above-mentioned perilla frutescens significantly reduced Aβ aggregates in the brain (Experimental Example 7), and through a fear conditioning test, it was confirmed that the effect of treating Alzheimer's disease was remarkably excellent (Experimental Example 8).

[0031] The present disclosure provides a pharmaceutical composition or health functional food composition comprising a fraction derived from the above-described herb according to the present disclosure as an active ingredient. Preferably, the composition exhibits a remarkably excellent effect in treating or improving degenerative brain diseases.

[0032] In one aspect of the present disclosure, a food composition according to the present disclosure includes all forms such as functional foods, nutritional supplements, health foods, and food additives. The above types of food compositions can be prepared in various forms according to conventional methods known in the art. For example, as a health functional food, the fraction derived from the Houttuynia cordata of the present disclosure can be prepared in the form of tea, juice, or a drink and consumed, or can be granulated, encapsulated, or powdered and consumed. In addition, the fraction derived from the Houttuynia cordata of the present disclosure can be prepared in the form of a composition by mixing it with a known substance or active ingredient known to have a treatment or improvement effect on degenerative brain diseases.

[0033] In one aspect of the present disclosure, the preferred content of the fraction derived from the perilla leaf in the food composition is, but is not limited to, 0.01 to 100 wt% of the final food product. In addition, the fraction derived from the perilla leaf of the present disclosure may be prepared in the form of a powder or concentrate for use as a food additive.

[0034] In addition, the present disclosure provides a pharmaceutical composition for treating or improving a degenerative brain disease, comprising a fraction derived from the plant as an active ingredient. The degenerative brain disease refers to a disease that occurs in the brain with age, and may include, but is not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, or amyotrophic lateral sclerosis.

[0035] In one aspect of the present disclosure, the pharmaceutical composition may contain the extract of the plant derived from the plant alone or may further contain one or more pharmaceutically acceptable carriers, excipients, or diluents. Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, or stearic acid. In addition, carriers for parenteral administration may include water, suitable oils, saline solution, aqueous glucose, or glycols, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, or chlorobutanol.

[0036] In one aspect of the present disclosure, the pharmaceutical composition may be administered to a mammal, including a human, by any method, for example, orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.

[0037] In one aspect of the present disclosure, the pharmaceutical composition may be formulated as a preparation for oral administration or parenteral administration, depending on the route of administration as described above. In the case of a preparation for oral administration, the pharmaceutical composition may be formulated as a powder, granule, tablet, pill, sugar-coated tablet, capsule, liquid, gel, syrup, slurry, or suspension, etc., using a method known in the art. For example, an oral preparation may be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture to obtain a tablet or sugar-coated tablet.

[0038] For example, in order to formulate the composition into dosage forms such as tablets and capsules, it may contain excipients such as lactose, saccharose, sorbitol, mannitol, starch, milk sugar, or microcrystalline cellulose; binders such as polyvinylpyrrolidone or hydroxypropylmethylcellulose; disintegrants such as dicalcium phosphate or crospovidone; and lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax. In the case of capsule dosage forms, in addition to the substances mentioned above, it may contain a liquid carrier such as fatty oil.

[0039] In the case of preparations for parenteral administration, they can be formulated in the form of injections, creams, lotions, ointments for external use, oils, moisturizers, gels, aerosols, or nasal inhalers using methods known in the art.

[0040] In one aspect of the present disclosure, the content of the fraction derived from Houttuynia cordata in the pharmaceutical composition may be 100 to 1,200 mg, preferably 150 to 300 mg, in a unit dosage form. The total effective amount of the fraction derived from Houttuynia cordata may be administered to a patient as a single dose or multiple doses, and may also be administered by a fractionated treatment protocol for long-term administration. Preferably, when administered orally to an adult, the pharmaceutical composition may be administered 1 to 4 times a day. The pharmaceutical composition may vary the content of the active ingredient depending on the severity of the degenerative brain disease. Preferably, the preferred total dose of the fraction derived from Houttuynia cordata of the present disclosure may be about 0.01 μg to 1,000 mg, more preferably 0.1 μg to 100 mg, and most preferably 1 μg to 10 mg per 1 kg of patient body weight per day. However, the dosage of the fraction derived from the perilla leaf of the present disclosure is determined as an effective dosage for a patient by considering various factors such as the route of administration and number of treatments of the pharmaceutical composition, as well as the patient's age, weight, health status, sex, severity of the disease, diet, or excretion rate. Considering these points, those skilled in the art can determine an appropriate effective dosage of the fraction derived from the perilla leaf of the present disclosure depending on the purpose of treating or improving a degenerative brain disease. The pharmaceutical composition according to the present disclosure is not particularly limited in its formulation, route of administration, or method of administration, as long as it exhibits the effects of the present disclosure.

[0041] In addition, the present disclosure provides a method for treating or improving a degenerative brain disease, comprising administering the fraction derived from the above-mentioned Houttuynia cordata or a pharmaceutical composition comprising the same to a patient with the degenerative brain disease. In addition, the present disclosure provides a use of the fraction derived from the above-mentioned Houttuynia cordata for treating or improving a degenerative brain disease. The descriptions regarding the administration method and effective dosage of the pharmaceutical composition can be applied to the above-mentioned method for treating or improving a degenerative brain disease.

[0042] The present disclosure provides a method for producing a fraction derived from Houttuynia cordata having an excellent effect in treating or improving neurodegenerative diseases, a Houttuynia cordata fraction extracted thereby, and a pharmaceutical use thereof. The Houttuynia cordata fraction according to the present disclosure not only has no cytotoxicity toward macrophages, but also has excellent anti-inflammatory effects due to excellent NO production inhibition activity and TNF-α and iNOS gene expression inhibition activity, and increases the expression level of a mucin production-related gene (MUC2), and increases the proliferation of intestinal epithelial cells and the expression of tight junction proteins. In addition, the Houttuynia cordata fraction inhibits the conversion of astrocytes to activated A1 and significantly reduces Aβ plaques in the brain. Accordingly, the Houttuynia cordata fraction according to the present disclosure has a remarkably excellent effect in treating or improving neurodegenerative diseases.

[0043] The following drawings attached to this specification illustrate preferred embodiments of the present invention and, together with the contents of the invention described above, serve to further understand the technical idea of ​​the present invention, and therefore, the present invention should not be interpreted as being limited to matters described in such drawings.

[0044] Figure 1 shows the results of quantitative PCR performed to confirm whether genes related to reactive astrocytes and genes related to astrocyte transformation were induced when HCW or DDN-A-0101 was treated in Experimental Example 5.

[0045] Figure 2 shows the results of Experimental Example 6, which confirmed that when DDN-A-0101 was administered to microglial cell culture medium in which activation was induced by Aβ, the conversion of astrocytes to the activated form (A1) was significantly inhibited, and when astrocytes whose conversion to the activated form (A1) was inhibited in this way were treated to mouse neurons, apoptosis of the neurons was reduced.

[0046] Figure 3 shows the results of Experimental Example 6, which confirmed that when the astrocytes, which were inhibited from converting to the active form (A1) by DDN-A-0101, were treated with human embryonic cell neurons, apoptosis of the human embryonic cell neurons was reduced, as in the mouse neuron cells.

[0047] Figures 4 and 5 are the experimental results confirming that the DDN-A-0101 treatment group reduced the amount of Aβ aggregates using Thioflavin-S staining in Experimental Example 7. Figure 4 shows the representative Thioflavin-S staining results (left) among the groups of 8-month-old rats, and Figure 5 shows the quantification of the number of Aβ plaques in the cerebral cortex and hippocampus (WT and WT+DDN-A-0101 (n=6), 5XFAD and 5XFAD+DDN-A-0101 (n=8). Statistical significance was determined using one-way ANOVA test and Tukey's test for multiple comparisons (*** p<0.001, **** p<0.0001).

[0048] Figure 6 shows the results of a fear conditioning test to compare the behavioral test effects of HCW and DDN-A-0101 in Experimental Example 8.

[0049] Hereinafter, the present invention will be described in detail, using examples and the like, to aid understanding. However, the examples according to the present invention may be modified in various different forms, and the scope of the present invention should not be construed as being limited to the following examples. The examples of the present invention are provided to more fully explain the present invention to those of average skill in the art.

[0050]

[0051] By varying the extraction method of the fraction derived from the perilla seed, various fractions derived from the perilla seed were prepared as follows. The perilla seed used in the examples and comparative examples below was purchased domestically from the Hapcheon Medicinal Herb Processing Agricultural Cooperative.

[0052]

[0053] Example: Preparation of fractions derived from Houttuynia cordata by separately extracting Houttuynia cordata leaves and stems (DDN-A-0101)

[0054] 650 g of dried leaves of Houttuynia cordata were steeped with 1000 mL of 50% ethanol solution at 50℃ for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50℃ to obtain a soft extract. In addition, 350 g of dried stems of Houttuynia cordata were steeped with 10 times the volume of DIW, extracted at 100℃ for 2 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate thus obtained was concentrated to obtain a soft extract, and then 50% ethanol solution in an amount 4 times the volume of the soft extract was added thereto and stirred. The precipitate formed after stirring was separated through filtration, and then mixed with the sample (soft extract) obtained from the Houttuynia cordata leaf extraction, concentrated, and dried. This was named DDN-A-0101.

[0055]

[0056] Comparative Example 1: Preparation of Houttuynia cordata extract through hot water extraction (HCW)

[0057] After finely crushing 1000 g of dried perilla leaves, distilled water was added in an amount 10 times (v / w) of the perilla leaves, and reflux extraction was performed at 100°C for 2 hours. Afterwards, the extract was filtered under reduced pressure using Whatman filter paper #2. The filtrate was dried and powdered and stored at -20°C, and used as a ready-to-use solution during the experiment, with a yield of 33.7%.

[0058]

[0059] Comparative Example 2: Preparation of Houttuynia cordata extract through 30% ethanol aqueous solution extraction

[0060] 1000 g of dried Eoseongcho was steeped in 1000 mL of 30% ethanol solution at 25°C for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50°C, and the resulting sample was freeze-dried and stored at -20°C. It was used as a ready-to-use solution during the experiment, and the yield was 23.37%.

[0061]

[0062] Comparative Example 3: Preparation of Houttuynia cordata extract through 50% ethanol aqueous solution extraction

[0063] 1000 g of dried perilla leaves was steeped in 1000 mL of 50% ethanol solution at 25°C for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50°C, and the resulting sample was freeze-dried and stored at -20°C. The solution was used as a pre-mix solution during the experiment, and the yield was 20.52%.

[0064]

[0065] Comparative Example 4: Preparation of Houttuynia cordata extract through 70% ethanol aqueous solution extraction

[0066] 1000 g of dried perilla leaves was steeped in 1000 mL of 70% ethanol solution at 25°C for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50°C, and the resulting sample was freeze-dried and stored at -20°C. The solution was used as a pre-mix solution during the experiment, and the yield was 17.83%.

[0067]

[0068] Comparative Example 5: Preparation of Houttuynia cordata extract through 90% ethanol aqueous solution extraction

[0069] 1000 g of dried perilla leaves was steeped in 1000 mL of 90% ethanol solution at 25°C for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50°C, and the resulting sample was freeze-dried and stored at -20°C. The solution was used as a pre-mix solution during the experiment, and the yield was 14.20%.

[0070]

[0071] Comparative Example 6: Preparation of Houttuynia cordata extract through 50% ethanol aqueous solution extraction and subsequent hot water extraction of the residue (HCM1)

[0072] 1000 g of dried Eoseongcho was steeped in 1000 mL of 50% ethanol solution at 50℃ for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50℃ to obtain a soft extract. After filtration, DIW 10 times the volume of the residue was added to the residue, and the extraction was performed under stirring at 100℃ for 2 hours, and then filtered using Whatman filter paper #2. The extract thus obtained was concentrated to form a soft extract, which was then mixed with the sample obtained from the above ethanol aqueous extraction, concentrated, and dried. This was designated as HCM1.

[0073]

[0074] Comparative Example 7: Preparation of Houttuynia cordata extract through hot water extraction and subsequent extraction of the residue with 50% ethanol aqueous solution (HCM2)

[0075] 10 times DIW was added to 1000 g of dried perilla leaves, extracted at 100℃ under stirring for 2 hours, and filtered using Whatman filter paper #2. The extract was concentrated under reduced pressure at 100℃ to obtain a soft extract. After filtration, 1000 mL of 50% aqueous ethanol solution was added to the residue remaining, extracted at 50℃ under stirring for 6 hours, and filtered using Whatman filter paper #2. The extract thus obtained was concentrated to make a soft extract, mixed with the sample obtained from the hot water extraction, and concentrated and dried. This was designated as HCM2.

[0076]

[0077] Comparative Example 8: Preparation of Houttuynia cordata extract filtered through a nonpolar resin column after extraction with a 50% ethanol aqueous solution (HCO)

[0078] 1000 g of dried perilla leaves was steeped in 1000 mL of 50% ethanol solution at 50°C for 6 hours under stirring, and then filtered using Whatman filter paper #2. The filtrate was concentrated under reduced pressure at 50°C to obtain a soft extract. This solution was passed through a column filled with nonpolar resin, and polyphenolic substances that passed through without being adsorbed by the resin were collected and designated as HCO.

[0079]

[0080] Comparative Example 9: Production of Houttuynia cordata extract through ethanol aqueous solution extraction after hot water extraction (HCP)

[0081] 1000 g of dried Eoseongcho was extracted with 10 times the volume of DIW at 100℃ for 2 hours under stirring, and then filtered using Whatman filter paper #2. The extract was concentrated under reduced pressure at 100℃ to obtain a soft extract. To this, 50% ethanol aqueous solution in an amount 4 times the volume of the soft extract was added and stirred. The precipitate formed after stirring was filtered, the filtrate was removed, and the remaining precipitate was collected. This was named HCP.

[0082]

[0083] Experimental Example 1: Analysis of effective ingredients of examples and comparative examples

[0084] Analysis of the active components of the extracts or fractions derived from Houttuynia cordata prepared in the above examples and comparative examples was performed using a Waters2695.HPLC system with reference to the quantitative analysis method of Houttuynia cordata (Simultaneous quantification of eight bioactive components of Houttuynia cordata and related Saururaceae medicinal plants by on-line high performance liquid chromatography-diode array detector-electrospray mass spectrometry, Fitoterapia (2009) Volume 80, Issue 8) of Jiang Meng, et al., under the analysis conditions shown in Table 1 below.

[0085] HPLC conditionsHPLC systemWaters 2695 Separations ModuleWaters 996 Photodiode Array DetectorColumnCAPCELL PAK C18 UG120 (4.6 mm ID %(v / v) formic acid(B) Acetonitrile09552085153082.517.54082.517.56050506501008001008595590955Flow rate0.8 mL / minInjection volume10 μLDetection345 nmTemperature30

[0086] Hyperoside, Quercitrin, Afzelin, Rutin, Chlorogenic acid, and Rhamnogalacturonan were set as the effective ingredients of the extract or fraction, and the optimal conditions for analyzing the indicator components simultaneously were set and analyzed by considering various variables such as the stationary phase, mobile phase, detection wavelength, type and concentration of acid in the mobile phase, and injection volume.

[0087] Extraction method HCW (water extract) 30 Ethanol extract 50 Ethanol extract 70 Ethanol extract 90 Ethanol extract HCM2 (hot water first) HCM1 (ethanol first) HCP (high molecular weight) HCO (low molecular weight) DDN-A-0101 Extraction yield (%) 33.7 23.4 20.5 17.8 14.2 37.8 36.0 15.0 18.8 11.4 % Total polyphenols (%) 3.7 6.26.26.6 7.5 10.9 13.3 1.27 9.28 16.17 Total low molecular weight active ingredients (%) 1.14 2.0 22.0 22.3 3.0 31.4 14.13 -- 6.94 Type and content of active ingredients (%) Chlorogenic Acid0.340.530.530.650.710.420.82Trace trace1.35Rutin0.130.160.160.220.290.130.18Trace trace0.76Hyperoside0.150.270.270.330.440.110.4Trace trace0.55Quercitrin0.511.061.061.131.590.672.63Trace trace3.94Afzelin0.010.000.000.000.000.080.1Trace trace0.34Rhamnogalacturonan14.3000015.15.171.9036.4

[0088] Looking at the above analysis results, the polyphenol components, including flavonoids, increased in proportion to the amount of solvent in the ethanol aqueous extract compared to the water extract. The low-molecular-weight active ingredient content of the DDN-A-0101 fraction of the example was the highest, and it was confirmed to be approximately 6 times higher than that of the water extract (HCW) of the comparative example. In addition, the DDN-A-0101 fraction had the highest content of the active ingredient rhamnogalacturonan compared to the comparative example.

[0089]

[0090] Experimental Example 2: Analysis of the anti-inflammatory effect of fractions derived from Eoseongcho

[0091] The anti-inflammatory effects of the above examples and comparative examples were evaluated. Nitric oxide (NO) production inhibition activity was measured using RAW 264.7 murine macrophage cells, a mouse macrophage cell line. In addition, the MTT (Dimethylthiazaolyl diphenyltetrazolium salt) assay was performed to evaluate the cytotoxicity of each example and comparative example.

[0092]

[0093] 2-1. Cell culture

[0094] RAW 264.7 murine macrophages, a mouse macrophage cell line, were cultured in DMEM medium (dulbecco's modified eagle's medium, GIBCO, Grand Island, YY, USA) containing 1% penicillin-streptomycin and 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator.

[0095]

[0096] 2-2. Measurement of NO production inhibition activity

[0097] The above cultured RAW 264.7 cells were seeded in a 96-well plate (1*10 5The cells were seeded so that the number of cells was 100 μl per well) and cultured for 24 hours in a 37°C, 5% CO2 incubator. After culture, the medium was removed, washed with phosphate buffered saline (PBS), and then replaced with a medium containing 1 μg / mL of LPS (lipopolysaccharides). After replacing the medium with LPS, the Houttuynia cordata extract samples were treated at a concentration of 100 μg / mL or 200 μg / mL, respectively, and cultured for 24 hours. After 24 hours of culture, the amount of NO produced was measured in the form of NO2 present in the cell culture medium using Greiss's reagent (1% sulfanilamide, 0.1% naphthylethylenediamine in 2.5% phosphoric acid). 100 μl of the cell culture medium cultured for 24 hours and 100 μl of Griess reagent were mixed in a 96-well plate, reacted for 10 minutes, and the absorbance was measured at 570 nm using a microplate reader. The amount of NO produced was compared after creating a calibration curve using sodium nitrite (NaNO2).

[0098]

[0099] 2-3. Cytotoxicity evaluation

[0100] For MTT assay, the polysaccharide fractions remaining in the cell culture medium used in the above NO production inhibition activity experiment were diluted to 2-fold concentrations of 100 μg / mL and 200 μg / mL in the medium, respectively, and treated with 100 μl each (final concentration 1X) and cultured for 24 hours. After 24 hours, 100 μl of the supernatant was removed, and 10 μl of MTT solution was treated and cultured for 3 hours. Afterwards, 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate) was treated and cultured to lyse the cells. Thereafter, formazan was dissolved in DMSO, and the absorbance was measured at 570 nm using a microplate reader to evaluate cytotoxicity. Cytotoxicity was calculated by the following mathematical formula.

[0101] Cell viability (%) = (A sample / A control )X100

[0102] A sample : Absorbance of formazan formed after solvent treatment (without sample addition)

[0103] A control : Absorbance of formazan formed after sample treatment

[0104] The results of cytotoxicity evaluation and NO production inhibition activity measurement of the extracts or fractions of the examples and comparative examples are shown in Table 3 below.

[0105] Cell viability (%)Cell viability (%)NO production (%)NO production (%)Sample nameSample (100ug / ml)LPS(1ug / ml)Sample (200ug / ml)LPS(1ug / ml)Sample (100ug / ml)LPS(1ug / ml)Sample (200ug / ml)LPS(1ug / ml)MeanSDMeanSDMeanSDHCW (Comparative Example 1)85.24.886.79.695.31.999.92.4HCP crude polysaccharide (Comparative Example 9)95.73.487.11.4100.10.695.60.9HCM1 low molecule 1 (Comparative Example 6)85.711.779.65.381.76.362.38.8HCM2 low molecule 2 (Comparative Example 7)100.13.5104.94.797.90.790.31.3DDN-A-0101 (Example)120.95.5111.99.883.42.868.80.5HCO (Comparative Example 8)104.88.588.15.0109.49.4114.18.7

[0106] As a result of measuring the inhibitory activity of NO production, an inflammatory factor, DDN-A-0101 showed an excellent NO production inhibition effect compared to other comparative examples, even when administered simultaneously with LPS, a potent inflammatory factor. Not only was DDN-A-0101 non-cytotoxic, but its NO production inhibition rate was also remarkably excellent at up to 31.2% in a concentration-dependent manner, confirming its strong NO production inhibition effect.

[0107] 2-4. Measurement of TNF-α and iNOS production inhibition activity

[0108] In the above experiment, RAW 264.7 cells cultured were seeded in 12-well plates at 1*10 6Cells were seeded at a density of 1 ml per well. The cells were cultured for 18 hours in a 37°C, 5% CO2 incubator. After culture, the medium was removed, washed with phosphate-buffered saline (PBS), and replaced with medium containing 1 μg / mL of lipopolysaccharides (LPS). After replacing the medium with LPS, the extract or fraction sample of Houttuynia cordata was treated at a concentration of 200 μg / mL and cultured for 24 hours. RNA was isolated by lysing the cells with TRIzol and separating the RNA into the supernatant with BCP. cDNA was then synthesized at a concentration of 1,000 ng / μl. RT-PCR premix, DEPC, primers (forward, reverse), and cDNA were mixed, and PCR was performed using a thermocycler. The primer sequences used are shown in Table 4 below.

[0109] Primer sequence GAPDH F5' TCTCTGCTCCTCCCTGTTCC 3'GAPDH R5' TACGGCCAAATCCGTTCACA 3'iNOS F5' CGAAACGCTTCACTTCCAA 3'iNOS R5' TGAGCCTATATTGCTGTGGGCT 3'TNF-α F5' TGCCTATGTCTCAGCCTCTT 3'TNF-α R5' GAGGCCATTTTGGGAACTTCT 3'

[0110] The results of measuring the TNF-α and iNOS production inhibitory activity of the extracts of the examples and comparative examples are shown in Table 5 below.

[0111] Raw 264.7 cell (Evaluation of Anti-inflammatory effect)Cell viability (%)Cell viability (%)iNOSTNF-αSample nameSample (100ug / ml)LPS(1ug / ml)Sample (200ug / ml)LPS(1ug / ml)Sample (200ug / ml)LPS(1ug / ml)Sample (200ug / ml)LPS(1ug / ml)MeanSDMeanSDExpressionSEMExpressionSEMHCW (Comparative Example 1)85.24.886.79.60.900.101.190.02HCP (Comparative Example 9)95.73.487.11.41.920.141.880.50HCM1 (Comparative Example 6)85.711.779.65.30.260.010.980.22HCM2 (Comparative Example 7)100.13.5104.94.70.870.010.710.01DDN-A-0101 (Example)120.95.5111.99.80.420.020.840.07HCO (Comparative Example 8)104.88.588.15.00.950.050.900.09

[0112] The degree of gene expression inhibition activity of inflammatory factors TNF-α and iNOS was analyzed compared with the LPS treatment group, which was the control group. As a result of measuring the TNF-α and iNOS gene expression inhibition activity according to the concentration of the Houttuynia cordata extract, it was confirmed that the expression of TNF-α and iNOS genes was significantly reduced as the concentration increased within the concentration range without cytotoxicity. In the case of DDN-A-0101, not only was the effect of inhibiting TNF-α gene expression excellent, but it was also confirmed to significantly inhibit the expression of the iNOS gene, an NO generating enzyme, by approximately 58%. In other words, DDN-A-0101 was confirmed to exert a multifunctional effect of inhibiting various inflammatory factors, and this effect is significantly superior to other comparative examples including HCW.

[0113]

[0114] Experimental Example 3: Evaluation of the effect of the extract of Eoseongcho on intestinal mucus-secreting cells (LS 174T, a human intestinal goblet cell line)

[0115] 3-1. Culture of mucus-secreting cells (goblet cells)

[0116] LS174T cells, a human colon epithelial cell line, were used to determine the level of mucin expression. LS 174T cells were cultured in RPMI-1640 containing 10% FBS, 100 units / mL penicillin, and 100 μg / mL streptomycin in a 5% CO2-95% air incubator.

[0117]

[0118] 3-2. Cytotoxicity evaluation (MTT analysis)

[0119] The above cultured LS174T cells were placed in a 96-well plate (3*10 5 The cells were seeded so that the number of cells was 100 cells / well (100 μl per well) and cultured for 24 hours under 37°C, 5% CO2 incubator conditions. After culture, the medium was removed, washed with phosphate buffered saline (PBS), and the medium was replaced. After that, each sample of the extract of Houttuynia cordata was treated at a concentration of 100 μg / mL and cultured for 24 hours. After culture for 24 hours, 100 μl of the cell culture supernatant was transferred and discarded, and 10 μl of MTT solution was treated and cultured for 3 hours. After that, 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate) was treated and cultured to lyse the cells. Cytotoxicity was evaluated by dissolving formazan in DMSO and measuring the absorbance at 570 nm using a microplate reader. Cytotoxicity was calculated by the following mathematical formula.

[0120] Cell viability (%) = (A sample / A control )X100

[0121] A sample : Absorbance of formazan formed after solvent treatment (without sample addition)

[0122] A control : Absorbance of formazan formed after sample treatment

[0123]

[0124] 3-3. Evaluation of MUC expression level in intestinal mucus-secreting cells (LS174T cell line)

[0125] LS174T cells, a human colon epithelial cell line, were used to determine the level of mucin expression. Propionate, an SCFA, was used as a positive control for comparison. LS174T cells (3 x 10) were plated on coverslips in 12-well plates containing 100 μg / mL of polysaccharide fraction. 4 cells / cm 2 , 1 mL per well) were cultured at 37°C for 24 hours. RNA was isolated by lysing cells using TRIzol and adding BCP to separate RNA into the supernatant. Afterwards, cDNA was synthesized at a concentration of 1000 ng / μl. After mixing RT-PCR premix, DEPC, primers (forward, reverse), and cDNA, PCR was performed using a thermocycler. The primer sequences used are shown in Table 6 below.

[0126] Primer sequence GAPDH F5' GACAGTCAGCCGCATCTTCT 3'GAPDH R5' GCGCCCAATACGACCAAATC 3'MUC2 F5' ACCCGCACTATGTCACCTTC 3'MUC2 R5' GGACAGGACACCTTGTCGTT 3'

[0127] The results of measuring the expression level of MUC2 in intestinal mucus secretory cells (LS174T cell line) of the extracts of the examples and comparative examples are shown in Table 7 below.

[0128] LS-174T cell (Mucin production)Cell viability (%)Cell viability (%)mucin2 mRNASample nameSample (100ug / ml)propionate (1ug / ml)Sample (200ug / ml)propionate (1ug / ml)Sample (100ug / ml)propionate (1ug / ml)MeanSDMeanSDMeanSDHCW (Comparative Example 1)105.34.0111.23.51.30.0HCP (Comparative Example 9)103.91.5106.03.71.30.0HCM1 (Comparative Example 6)105.41.3106.30.90.90.1HCM2 (Comparative Example 7)110.82.0109.51.30.90.0DDN-A-0101 (Example) 112.94.0114.32.31.60.0HCO (Comparative Example 8) 109.34.4110.44.91.20.0

[0129] Looking at the above experimental results, it was confirmed that the expression of genes related to mucin production in the Houttuynia cordata-derived fraction of DDN-A-0101 increased by 60% compared to the positive control, propionate. In addition, it was confirmed that the expression of genes related to mucin production in HCP and HCW, which have a high rhamnogalacturonan content, also increased by 30% compared to the positive control. Looking at these results, it can be seen that rhamnogalacturonan is an active ingredient that affects mucin production, and as the content of rhamnogalacturonan in the Houttuynia cordata-derived fraction increases, such as in DDN-A-0101, the mucin production effect increases.

[0130]

[0131] Experimental Example 4: Evaluation of the Effect of Eoseongcho Extract on Tight Junctions of Intestinal Epithelial Cells (Caco2)

[0132] 4-1. Intestinal epithelial cell culture

[0133] To determine the level of tight junction proteins, Caco2 cells, a human small intestine enterocyte cell line, were used. Caco2 cells were cultured in DMEM (Dulbecco's Modified Eagle Medium, Cytiva, UT, USA) containing 1% penicillin-streptomycin and 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator.

[0134]

[0135] 4-2. Cytotoxicity evaluation

[0136] In the above experiment, 3*10 of cultured Caco2 cells were placed in a 96-well plate. 4 cells / cm 2 , 100 μl of cells were dispensed per well, and cultured for 24 hours under 37°C, 5% CO2 incubator conditions. After culture, the medium was removed, washed with phosphate-buffered saline (PBS), and the medium was replaced. After that, the samples of the extract of the Houttuynia cordata, adjusted to the target concentration, were treated at a concentration of 100 μg / mL each and cultured for 24 hours. After culture for 24 hours, 100 μl of the cell culture supernatant was transferred and discarded, and 10 μl of MTT solution was treated and cultured for 3 hours. After that, the cells were lysed by treating 100 μl of MTT stopping solution containing SDS (sodium dodecyl sulfate) and cultured. Cytotoxicity was evaluated by dissolving formazan in DMSO and measuring the absorbance at 570 nm using a microplate reader. Cytotoxicity was calculated by the following mathematical formula

[0137] Cell viability (%) = (A sample / A control )X100

[0138] A sample : Absorbance of formazan formed after solvent treatment (without sample addition)

[0139] A control : Absorbance of formazan formed after sample treatment

[0140]

[0141] 4-3. Evaluation of Caco2 cell proliferation and tight junction protein (occludin) expression levels

[0142] To investigate the proliferation of enterocyte cells and the expression level of tight junction proteins, Caco2 cells, a human small intestine enterocyte cell line, were used. Propionate, a SCFA, was used as a positive control for comparison. Caco2 cells cultured according to the above method were seeded in 12-well plates at a density of 3*10 4 cells / cm 2 , and plated at 100 μl per well. Then, culture was performed overnight (37°C, 5% CO2). After culture, 500 μl of the supernatant was removed, and 500 μl of the polysaccharide fraction dilution was treated and cultured for 24 hours. Cells were lysed using TRIzol, and RNA was isolated by adding BCP to the supernatant. Then, cDNA was synthesized at a concentration of 1000 ng / μl. After mixing RT-PCR premix, DEPC, primers (forward, reverse), and cDNA, PCR was performed using a thermocycler. The primer sequences used are shown in Table 8 below.

[0143] Primer sequence GAPDH F5' GACAGTCAGCCGCATCTTCT 3'GAPDH R5' GCGCCCAATACGACCAAATC 3'Occludin F5' TCCTATAAATCCACGCCGGTTC 3'Occludin R5' CTCAAAGTTACCACCGCTGCTG 3'

[0144] Afterwards, electrophoresis was performed on a 1% agarose gel containing EtBR (ethidium bromide) at 100 V for 1 hour, and band intensity was compared under UV. The results of evaluating the expression level of the tight junction protein (occludin) are shown in Table 9 below.

[0145] Caco2 cell (tight junction protein level)Cell viability (%)Cell viability (%)OccludinSample nameSample (100ug / ml)propionate (1ug / ml)Sample (200ug / ml)propionate (1ug / ml)Sample (100ug / ml)propionate (1ug / ml)MeanSDMeanSDMeanSDHCW (Comparative Example 1)122.54.6126.48.81.00.1HCP (Comparative Example 9)106.111.594.72.10.90.0HCM1 (Comparative Example 6)160.12.7167.96.81.00.1HCM2 (Comparative Example 7)141.63.1156.79.00.90.0DDN-A-0101 (Example) 131.46.6130.310.20.80.0HCO (Comparative Example 8) 113.814.2121.321.00.60.1

[0146] Looking at the above experimental results, the examples and comparative examples did not significantly increase the expression of the occludin gene, a protein involved in tight junctions, compared to the positive control, propionate. However, DDN-A-0101 significantly improved the proliferation of intestinal cells compared to the positive control, and showed superior efficacy than HCW manufactured by conventional hot water extraction. Through this study, it was found that the fraction derived from Houttuynia cordata manufactured by the manufacturing method according to DDN-A-0101 contains a large amount of flavonoids that exhibit anti-inflammatory effects as well as polysaccharides such as rhamnogalacturonan, and thus has an excellent effect in treating or improving degenerative brain diseases such as Alzheimer's disease.

[0147]

[0148] Experimental Example 5: Comparison of the efficacy of DDN-A-0101 and HCW on Alzheimer's disease biomarkers (reactive astrocytes and astrocyte transformation-related genes).

[0149] Activation of microglia and astrocytes is a crucial factor in neurodegenerative diseases, particularly Alzheimer's disease (AD), with astrocyte activation playing a particularly significant role. Genes associated with reactive astrocytes and astrocyte transformation are biomarkers for AD. The effects of DDN-A-0101 or HCW on primary microglia and astrocytes prepared in cell culture were evaluated.

[0150]

[0151] 5-1. Oligomeric Aβ 1-42 preparation

[0152] Synthesis of Aβ from rPeptide (Bogart, GA, USA) 1-42The peptide was treated with hexafluoroisopropanol (HFIP). It was first dissolved in DMSO and then diluted in phosphate-buffered saline (PBS) to make a 250 μM stock solution. The stock solution was incubated at 4°C for at least 24 h and then stored at -80°C until needed. Before use, the solution was centrifuged at 12,000 g for 10 min, and the supernatant containing oligomeric Aβ (ADDL) was used. 1 μM oligomeric Aβ was used. 1-42 was used.

[0153]

[0154] 5-2. Preparation of primary microglia and astrocytes through DDN-A-0101 treatment

[0155] Primary microglia and astrocytes were obtained from postnatal mouse pups (P1). Brains were removed, and meninges were removed, and the cells were treated with 10% heat-inactivated FBS, 50 U / mL penicillin, 50 μg / mL streptomycin, 2 mM L-glutamine, 100 μM nonessential amino acids, and 2 mM sodium pyruvate. The brains were triturated with 0.25% trypsin-EDTA to obtain a single-cell suspension, and cell debris and aggregates were removed through a 100-μm nylon mesh. The final single-cell suspension was cultured in T-175 flasks for 13 days, and the medium was replaced on day 6. The mixed glial cultures were separated into magnetic microglia-enriched and astrocyte-enriched fractions using the EasySep Mouse CD11b positive selection kit (StemCell, Cambridge, MA, USA).

[0156]

[0157] Microglia were collected from primary microglia treated with PBS or DDN-A-0101 (10 μg / mL) and 1 μM oligomeric Aβ (Aβ MCM), and microglia-conditioned medium (MCM) was applied to primary astrocytes for 24 h.

[0158] Specifically, Aβ1-42 To investigate whether mouse primary microglia induced by oligomeric Aβ promote the formation of reactive astrocytes, primary astrocytes were treated with oligomeric Aβ 1-42 Microglial activation was induced by exposure to microglial conditioned medium (MCM) containing DDN-A-0101 for 24 hours. After inducing microglial activation, DDN-A-0101 or HCW was administered, respectively, and cultured for 24 hours. Afterwards, only the culture medium was separated and added to the medium containing primary astrocytes, and whether the astrocytes changed into an activated form (A1) was quantitatively measured.

[0159] Quantitative polymerase chain reaction (qPCR) was then used to assess mRNA levels of genes associated with astrocyte function.

[0160]

[0161] 5-3. Quantitative PCR

[0162] RNA was extracted from primary cells using the RNeasy Mini Kit (Qiagen Sciences, Inc., Germantown, MD, USA), and the amount was measured using a UV-Vis spectrophotometer (NanoDrop 2000, ThermoFisher Scientific Inc., Wilmington, DE, USA). A high-capacity cDNA reverse transcription kit (Applied Biosystems, Carlsbad, CA, USA) was used for reverse transcription of RNA. The generated cDNA was amplified using PowerUp™ SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus™ system (Applied Biosystems). The cDNA amount of each sample was normalized to 18sRNA, and 2 -ΔΔct The relative mRNA levels were assessed using the method. The primer sequences used are shown in Table 10 below.

[0163] Primer sequenceTimp1 F5' AGTGATTTCCCCGCCAACTC 3'Timp1 R5' GGGGCCATCATGGTATCTGC 3'Steao4 F5' CCCGAATCGTGTCTTTCCTA 3'Steao4 R5' GGCCTGAGTAATGGTTGCAT 3'Lcn2 F5' CCAGTTCGCCATGGTATTTT 3'Lcn2 R5' CACACTCACCACCCATTCAG 3'Ggta1 F5' GTGAACAGCATGAGGGGTTT 3'Ggta1 R5' GTTTTGTTGCCTCTGGGTGT 3'Ligp1 F5' GGGGCAATAGCTCATTGGTA 3'Ligp1 R5' ACCTCGAAGACATCCCCTTT 3'Srgn F5' GCAAGTTATCCTGCTCGGA 3'Srgn R5' TGGGAGGGCCGATGTTATTG 3'18sRNA F5' GTAACCCGTTGAACCCCATT 3'18sRNA R5' CCATCCAATCGGTAGTAGCG 3'

[0164] As seen in the above experimental results, primary microglial cells administered with Aβ showed hyperactivation compared to the control group. Aβ 1-42 MCM was found to increase the expression of Timp1, Steap4, and Lcn2 genes, which are known to be associated with reactive astrocytes; and Ggta1, Ligp1, and Srgn genes, which are known to be associated with astrocytes. In contrast, Aβ 1-42 When MCM was treated with DDN-A-0101, the induction of reactive astrocytes and astrocyte transformation-related genes was significantly inhibited (Fig. 1).

[0165]

[0166] Experimental Example 6: Neuroprotective effect when treating astrocytes whose conversion to an active form is inhibited by DDN-A-0101.

[0167] The culture medium isolated from hyperactivated microglia effectively induced astrocytes into the activated form, A1. However, when DDN-A-0101 was administered to the microglia medium in which Aβ activation had been induced, the conversion of astrocytes to the activated form (A1) was significantly inhibited (P<0.001 or 0.0001). When the astrocytes with the inhibition of conversion to the activated form (A1) as described above were administered to mouse neurons, apoptosis of the neurons was reduced, confirming that DDN-A-0101 exhibited a neuroprotective effect (Fig. 2). On the other hand, when HCW was administered, the effect of converting astrocytes to the activated form was low or absent in statistical significance (p<0.05). Therefore, it was confirmed that DDN-A-0101 significantly inhibits astrocyte activation, which plays an important role in the progression of Alzheimer's disease, compared to the comparative example, HCW.

[0168] In addition, when the astrocytes that were inhibited from converting to an active form by treating them with DDN-A-0101 were treated with human embryonic cell neurons, it was confirmed that the same effect was achieved by reducing apoptosis of the neurons (Fig. 3).

[0169]

[0170] Experimental Example 7: Comparison of the efficacy of DDN-A-0101 and HCW against Alzheimer's disease biomarkers (Aβ aggregates).

[0171] To measure the amount of Aβ aggregates, histochemical analysis was performed on brain tissue from 5xFAD mice using Thioflavin-S (ThS) staining. Thioflavin-S (ThS) staining is a representative method for detecting protein aggregates such as amyloid plaques through fluorescence. Experiments were conducted to detect and quantify Aβ aggregates using this method. To isolate brain tissue from 5xFAD transgenic mice, mice were anesthetized with ketamine injection and perfused with 0.9% NaCl. The mice were sacrificed by cervical dislocation. The brains were removed and fixed in 4% paraformaldehyde. After 24 hours of fixation, the brains were dehydrated in a 30% sucrose solution for 48 hours. A 0.1% Thioflavin-S solution was prepared and filtered through a 0.22 µm filter before use. For immunofluorescence staining, 35-μm-thick brain sections were incubated with 500 μM Thioflavin S (ThS, Sigma-Aldrich, USA) in 50% ethanol solution for 7 minutes. Slices were identified using a fluorescence microscope (ZEISS, Germany). Thioflavin-S (450–490 nm) was readily visible on the microscope, and the cortex and hippocampus areas were counted. Plaque quantification in the cerebral cortex and hippocampus regions detected by Thioflavin S staining was performed using Image J software. For statistical analysis, data were analyzed using GraphPad Prism (GraphPad Software, San Diego, CA, USA). All data are expressed as mean ± SEM, and an unpaired two-tailed Student's test was used for single comparisons.

[0172] Thioflavin-S staining revealed that Aβ aggregates accumulated significantly in most brain regions of the 8-month-old 5XFAD model. In the DDN-A-0101-treated group, Aβ aggregates were significantly reduced compared to the non-treated 5XFAD group or the positive control group HCW in all hippocampal regions directly related to memory (Figs. 4 and 5).

[0173]

[0174] Experimental Example 8: Comparison of the efficacy of DDN-A-0101 and HCW in an animal model of Alzheimer's disease.

[0175] 8-1. Mouse model used

[0176] The 5X FAD transgenic mouse is a specific type of genetically modified mouse that expresses five human genes (APPswe, APPI716V, APPV717I, Psen1M146L, and Psen1L286V) associated with familial Alzheimer's disease (FAD). They exhibit several key features of the disease, including the formation of amyloid plaques and neurofibrillary tangles. The use of the 5X FAD transgenic mouse in drug development and testing is crucial for evaluating potential therapeutic interventions for Alzheimer's disease (AD). These mice provide a platform for testing compounds and therapeutic strategies aimed at slowing the progression of AD behaviors, such as memory impairment.

[0177]

[0178] 8-2. Experiment for Memory Evaluation: Fear Conditioning Test

[0179] Fear conditioning is used to assess associative fear learning and memory in rodents. This test is widely used to understand the neurobiological mechanisms of fear learning and memory in transgenic and knockout mice. Freezing, defined as complete immobility except for breathing, is a common response to fearful situations. In this fear conditioning test, mice are exposed to a combination of an auditory cue and an electric foot shock, and then respond to the fear-producing stimulus by exhibiting freezing behavior, which is measured as an indicator of associative fear learning and memory.

[0180] Fear conditioning testing was conducted over three consecutive days, including habituation, training, and test days. During the habituation day, mice were exposed to a shock box (Coulbourn, Holliston, MA, USA) for 10 min. On the training day, mice were placed in the shock box and allowed to acclimate for 2 min before being presented with white noise (80 dB, 2000 Hz) for 20 s. After a 20-s interval following the tone, a 0.5 mA shock was delivered for 2 s. This tone-shock pairing was repeated three more times. On the test day, mice were placed in the shock box for 3 min to observe context-dependent freezing behavior. Afterwards, mice were transferred to a different context, and freezing behavior in response to a 20-s white noise was recorded. The Cleversys Freezescan system (Cleversys Inc., Reston, VA, USA) was used for automated scoring of freezing behavior.

[0181] For statistical analysis, data were analyzed using GraphPad Prism (GraphPad Software, San Diego, CA, USA). All data are expressed as mean ± SEM, and Student's t-test (two-tailed) was used for single-group comparisons. For multiple-group analyses, one-way ANOVA with Tukey's multiple comparison test was used. A value of p < 0.05 was considered statistically significant.

[0182]

[0183] 8-3. Experimental Results

[0184] As shown in the fear conditioning test results in Figure 6, it was confirmed that the freezing time (%) of the mouse model was improved when treated with DDN-A-0101 and HCW. In particular, it was confirmed that DDN-A-0101 was more effective than HCW, and the statistical significance was also very high (p< 0.0001 or 0.0005). Therefore, it was confirmed that DDN-A-0101 has an excellent therapeutic effect on the Alzheimer's disease animal model.

Claims

1. (S1) A step of obtaining an extract by adding an ethanol solution to the leaves of the perilla plant and then heating and extracting them; (S2) A step of obtaining an extract by adding an ethanol aqueous solution and stirring after extracting the stem of the ginseng plant with hot water; and (S3) A step of mixing the respective extracts obtained in steps S1 and S2. A method for producing a fraction derived from the plant containing the plant.

2. In the first paragraph, the (S1) step of extracting the leaves of the perilla plant (S1-1) Step of adding an ethanol solution to the leaves of the perilla plant, heating and stirring, and then steeping; and (S1-2) A step of filtering the leachate obtained in step S1-1 and concentrating under reduced pressure to obtain a concentrate. A method for producing a fraction derived from the plant containing the plant.

3. A method for producing a fraction derived from Eoseongcho, wherein in the second paragraph, heating and stirring in the step (S1-1) are performed at 30 to 70°C for 3 to 9 hours.

4. In paragraph 1, The above (S2) step of extracting the stem of the sesame oil is (S2-1) A step of adding water to the stem of the perilla plant, then heating and stirring to extract it; (S2-2) A step of filtering the extract obtained in step S2-1 and concentrating the filtrate under reduced pressure to obtain a concentrate; and (S2-3) A step of adding an ethanol solution to the concentrate obtained in step S2-2 and stirring to obtain a precipitate. A method for producing a fraction derived from the plant containing the plant.

5. A method for producing a fraction derived from Eoseongcho, wherein in the fourth paragraph, heating and stirring in the step (S2-1) are performed at 80 to 120°C for 0.5 to 4 hours.

6. (S1-1) Step of adding an ethanol solution to the leaves of the perilla plant, heating and stirring, and then steeping; (S1-2) A step of filtering the leachate obtained in step S1-1 and concentrating the filtrate under reduced pressure to obtain a concentrate; (S2-1) A step of adding water to the stem of the perilla plant, then heating and stirring to extract it; (S2-2) A step of filtering the extract obtained in step S2-1 and concentrating the filtrate under reduced pressure to obtain a concentrate; (S2-3) A step of adding an ethanol aqueous solution to the concentrate obtained in step S2-2 and stirring to obtain a precipitate; and (S3) A step of mixing the precipitate obtained in step S2-3 with the concentrate obtained in step S1-2 and then concentrating and drying. A method for producing a fraction derived from the plant containing the plant.

7. A fraction derived from the sesame oil obtained by the manufacturing method of any one of claims 1 to 6.

8. A fraction derived from Houttuynia cordata containing 1 to 8 wt% of quercitrin and 20 to 60 wt% of rhamnogalacturonan relative to the total weight of the fraction.

9. A pharmaceutical composition for treating or improving a degenerative brain disease, comprising the fraction derived from the perilla leaves of Article 7 or the fraction derived from the perilla leaves of Article 8.

10. A health functional food composition comprising the fraction derived from the perilla leaves of Article 7 or the fraction derived from the perilla leaves of Article 8.

Images