A novel method to detect and quantify RNA modifications

Abstract

The present disclosure provides, for instance, a method of detecting and quantifying RNA modifications. The RNA modification may be, for example, m6A, m6Am, m1A, hm5C, m5C, Ψ, or inosine. The method can comprise contacting the RNA with an antibody that binds the modification, and using a bar code approach to quantify the amount of RNA.

Description

[0001]Attorney Docket No.: Tech ID 3380J 0312021.00255 A NOVEL METHOD TO DETECT AND QUANTIFY RNA MODIFICATIONS CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of Greek Application No.20240100579, filed August 19, 2024. The contents of the aforementioned application are hereby incorporated by reference in their entirety. BACKGROUND RNA modifications are chemical modifications to nucleotides which can affect many biological functions of RNA molecules, including RNA processing, translation of mRNA, localization, and stability. Detection of RNA modifications in an RNA sample may be useful for drug discovery and diagnostics. There is a need in the art for new methods of quantifying RNA modifications. SUMMARY OF THE INVENTION This disclosure provides, for example, methods of detecting RNA modifications in an RNA sample. Detection of RNA modifications in an RNA sample may be useful for RNA vaccine / drug discovery and development, disease diagnostics, and RNA based gene therapy. The methods described herein may have advantages including a low (e.g., less than 5-hour) time-to-answer, minimal required training, use of standard lab equipment, low cost per sample, and high sensitivity. ENUMERATED EMBODIMENTS 1. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds a chemically modified nucleotide in the RNA, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the substrate from the RNA-antibody- substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA-antibody- substrate-DNA mixture; and 1 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 f) performing nucleic acid amplification technique on the DNA molecules in the RNA- antibody-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample. 2. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) providing an antibody-substrate mixture comprising a solid substrate bound to an antibody that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the antibody-substrate mixture, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the substrate from the RNA-antibody- substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA-antibody- substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- antibody-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample. 3. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds the chemically modified nucleotide, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the solid substrate from the RNA- antibody-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; 2 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 e) removing DNA molecules not associated with the solid substrate from the RNA- antibody-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-antibody-substrate mixture associated with the antibody, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 4. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) providing an antibody-substrate mixture comprising a solid substrate bound to an antibody that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the antibody-substrate mixture, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the solid substrate from the RNA- antibody-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- antibody-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-antibody-substrate mixture associated with the antibody, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 5. The method of embodiment 3 or 4, wherein step g) comprises co-relating the quantity of the DNA molecule detected in step f) to the quantity of the RNA comprising the chemically modified nucleotide. 6. The method of any of embodiments 1-5, wherein each DNA molecule in the plurality comprises a barcode sequence. 3 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 7. The method of any of embodiments 1-6, wherein the nucleic acid amplification technique is polymerase chain reaction (PCR). 8. The method of any of the preceding embodiments, which further comprises removing RNA not associated with the solid substrate from the RNA-antibody mixture. 9. The method of any of the preceding embodiments, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA not associated with the solid substrate is removed. 10. The method of any of the preceding embodiments, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the DNA molecules not associated with the solid substrate are removed. 11. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: (i) providing an RNA-antibody-substrate-DNA mixture wherein the RNA-antibody-substrate- DNA mixture comprises: the RNA, an antibody that binds the chemically modified nucleotide, a solid substrate that binds the antibody, and a plurality of DNA molecules , wherein each DNA molecule in the plurality comprises a barcode sequence; (ii) removing DNA not associated with the solid substrate from the RNA-antibody-substrate- DNA mixture, thereby producing a washed mixture, and (iii) determining the amount of the DNA molecule via a nucleic acid amplification technique; and wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 12. The method of embodiment 11, wherein step (i) comprises: providing an RNA-antibody-substrate mixture wherein the RNA-antibody-substrate mixture comprises: the RNA, an antibody that binds the chemically modified nucleotide, and a solid substrate that binds the antibody; and contacting the RNA-antibody-substrate mixture with a plurality of DNA molecules thereby producing the RNA-antibody-substrate-DNA mixture. 13. The method of embodiment 12, wherein providing the RNA-antibody-substrate mixture comprises: contacting a sample comprising the RNA with an antibody that binds the chemically modified nucleotide, thereby producing an RNA-antibody mixture; and 4 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing the RNA-antibody-substrate mixture. 14. The method of any of embodiments 1-13, which further comprises removing DNA molecules not associated with the solid substrate from the RNA-antibody-substrate-DNA mixture. 15. The method of embodiment 14, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the DNA molecules not associated with the solid substrate are removed. 16. The method of any of embodiments 7-15, which further comprises eluting the RNA and bound DNA molecules from the antibody prior to performing PCR on the mixture. 17. The method of embodiment 16, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA and bound DNA molecules associated with the antibody is eluted from the antibody. 18. The method of any of embodiments 7-17, wherein the PCR is quantitative PCR. 19. The method of embodiment 18, wherein the quantitative PCR comprises detecting a fluorescent emission from a double-strand specific dye (e.g., N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3- benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine). 20. The method of embodiment 19, wherein the quantitative qPCR comprises detecting a fluorescent emission from a fluorescently labeled probe. 21. The method of any of embodiments 18-20, wherein the quantitative PCR primer is complementary to the DNA molecule barcode sequence. 22. The method of any of embodiments 1-21, wherein each DNA molecule in the plurality is a single-stranded DNA (ssDNA) molecule. 23. The method of any of embodiments 1-21, wherein each DNA molecule in the plurality comprises a double-stranded region and a single-stranded overhang region. 24. The method of embodiment 23, wherein the single-stranded overhang region binds to RNA. 5 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 25. The method of any of embodiments 1-24, wherein the method quantifies the amount of RNA associated with the antibody. 26. The method of embodiment 25, wherein the amount of RNA associated with the antibody is quantified relative to the level of a reference RNA. 27. The method of embodiment 25, wherein the amount of RNA associated with the antibody is quantified absolutely. 28. The method of embodiment 25, further comprising measuring fluorescence quantitatively. 29. The method of any of embodiments 25-28, wherein a standard curve is produced using RNA samples with known amounts of the RNA modification. 30. The method of embodiment 29, wherein a logarithmic function fit to the standard curve has an R2value greater than or equal to 0.9. 31. The method of any of embodiments 3-24, wherein the method provides a qualitative readout of RNA associated with the antibody. 32. The method of embodiment 31, wherein the qualitative readout is colorimetric. 33. The method of embodiment 31, wherein the qualitative readout is fluorescent. 34. The method of any of the preceding embodiments, wherein the RNA is split into more than one pool prior to the first step of the method. 35. The method of embodiment 34, wherein the RNA is split into 2, 3, 4, 5, 6, 7, 8, 9, or 10 pools. 36. The method of embodiment 34 or 35, wherein a different chemically modified nucleotide is detected in each pool. 6 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 37. An RNA-antibody-substrate-DNA mixture comprising: RNA; an antibody that binds a chemically modified nucleotide; a solid substrate that binds the antibody; and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence. 38. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is from a mammalian cell. 39. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is from a human cell. 40. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is from a human subject. 41. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is from a bacterial cell. 42. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is from a yeast cell. 43. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA was produced in a cell-free system, e.g., in vitro. 44. The method or RNA-antibody-substrate-DNA mixture of any of the preceding embodiments, wherein the RNA is a therapeutic RNA. 45. A kit comprising: an antibody that binds a chemically modified nucleotide; a solid substrate that binds the antibody (e.g., a bead, e.g., directly or indirectly, e.g., wherein the substrate binds a ligand and the ligand binds the antibody); a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; 7 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 optionally, a nucleic acid probe for detecting PCR amplification; and optionally, primers for amplification of the barcode sequence. 46. The kit of embodiment 45, wherein the solid substrate that binds the antibody is provided as: a first container comprising the solid substrate; and a second container comprising a ligand that binds the solid substrate, wherein the ligand binds the antibody. 47. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds the chemically modified nucleotide, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; and c) detecting if RNA in the RNA-antibody-substrate mixture was associated with the antibody, wherein association of RNA with the antibody is indicative of the RNA comprising the chemically modified nucleotide. 48. The method of embodiment 47, which further comprises contacting the RNA-antibody- substrate mixture with a plurality of DNA molecules, thereby producing an RNA-antibody-bead-primer mixture. 49. The method of embodiment 48, wherein each DNA molecule in the plurality comprises a barcode sequence. 50. The method of embodiment 48 or 49, which further comprises removing DNA not associated with the solid substrate from the RNA-antibody-substrate-DNA mixture, thereby producing a washed mixture. 51. The method of embodiment 50, which further comprises performing PCR on the washed mixture to detect if RNA was associated with the antibody. 52. The method of any of embodiments 37-51, which further comprises removing RNA not associated with the solid substrate from the RNA-antibody mixture. 8 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 53. The method of embodiment 52, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA not associated with the solid substrate is removed. 54. The kit of embodiment 45 or 46, wherein the kit further comprises RNA modification standards for one or more chemical modifications, wherein the RNA modification standard comprises RNA having a known level of a known chemical modification. 55. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the chemically modified nucleotide comprises a chemically modified adenine. 56. The method, RNA-antibody-substrate-DNA mixture, or kit of embodiment 55, wherein the chemically modified nucleotide comprises a m6A or m1A modification. 57. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 1-54, wherein the chemically modified nucleotide comprises chemically modified cytosine. 58. The method, RNA-antibody-substrate-DNA mixture, or kit of embodiment 57, wherein the chemically modified nucleotide comprises a hm5C or m5C modification. 59. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 1-54, wherein the chemically modified nucleotide comprises chemically modified uracil. 60. The method or RNA-antibody-bead-DNA mixture of embodiment 59, wherein the chemically modified nucleotide comprises a Ψ modification. 61. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the antibody binds a m6A, m6Am, m1A, hm5C, m5C, Ψ, or inosine chemically modified nucleotide. 62. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the antibody is polyclonal. 9 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 63. The method, RNA-antibody-substrate-DNA mixture, or kit of embodiments 1-61, wherein the antibody is monoclonal. 64. The method, RNA-antibody substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the solid substrate is a bead. 65. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the solid substrate is a magnetic bead. 66. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the surface of the solid substrate binds a ligand that binds the antibody. 67. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein recombinant protein G binds, e.g., covalently binds, the surface of the solid substrate. 68. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein recombinant protein A binds, e.g., covalently binds the surface of the solid substrate. 69. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein recombinant protein A / G binds, e.g., covalently binds the surface of the solid substrate. 70. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding embodiments, wherein the solid substrate comprises free carboxyl groups. 71. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 1-70, wherein the antibody is covalently bound to the solid substrate. 72. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 1-71, wherein each DNA molecule in the plurality of DNA molecules comprises a random hexamer sequence. 10 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 73. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 1-71, wherein each DNA molecule in the plurality of DNA molecules comprises an oligo(dT) sequence. 74. The method, RNA-antibody-substrate-DNA mixture, or kit of embodiment 73, wherein the oligo(dT) sequence comprises 10-25 deoxythymidines. 75. The method, RNA-antibody-substrate-DNA mixture, or kit of any of embodiments 6-74, wherein the barcode sequence is 70-90 nucleotides in length. 76. A method of amplifying a nucleic acid, the method comprising: providing a nucleic acid template; contacting the nucleic acid template with a DNA molecule, wherein the DNA molecule comprises a double stranded region and a single stranded overhang that is complementary to the nucleic acid template; and contacting the nucleic acid template and the DNA molecule with a primer, wherein the primer is complementary to the double stranded region of the DNA molecule, and a polymerase, under conditions that allow the polymerase to extend the primer along the double stranded region. 77. The method of claim 76, wherein the nucleic acid template is RNA. 78. The method of claim 76 or 77, wherein the double stranded region of the DNA molecule is about 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 base pairs (bp) in length. 79. The method of any of claims 76-78, wherein the single stranded 3’ overhang of the DNA molecule is about 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, or 25 bp in length. 80. The method of any of claims 76-79, wherein the double stranded region of the DNA molecule comprises a barcode sequence. 81. The method of claim 80, wherein the primer is complementary to the barcode sequence. 11 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 82. The method of any of claims 76-81, further comprising detecting a fluorescent emission from a double-strand specific dye (e.g., N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2- ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine). 83. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) contacting a sample comprising the RNA with a polypeptide that binds a chemically modified nucleotide in the RNA, thereby producing an RNA-polypeptide mixture; b) contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA- polypeptide-substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- polypeptide-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample. 84. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) providing a polypeptide-substrate mixture comprising a solid substrate bound to a polypeptide that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the polypeptide-substrate mixture, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; 12 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 e) removing DNA molecules not associated with the substrate from the RNA- polypeptide-substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- polypeptide-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample. 85. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with a polypeptide that binds the chemically modified nucleotide, thereby producing an RNA-polypeptide mixture; b) contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the solid substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- polypeptide-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-polypeptide-substrate mixture associated with the polypeptide, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 86. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) providing a polypeptide-substrate mixture comprising a solid substrate bound to a polypeptide that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the polypeptide-substrate mixture, thereby producing an RNA-polypeptide-substrate mixture; 13 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 c) optionally, removing RNA not associated with the solid substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- polypeptide-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-polypeptide-substrate mixture associated with the polypeptide, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 87. The method of embodiment 3 or 4, wherein step g) comprises co-relating the quantity of the DNA molecule detected in step f) to the quantity of the RNA comprising the chemically modified nucleotide. 88. The method of any of embodiments 83-87, wherein each DNA molecule in the plurality comprises a barcode sequence. 89. The method of any of embodiments 83-88, wherein the nucleic acid amplification technique is polymerase chain reaction (PCR). 90. The method of any of embodiments 83-89, which further comprises removing RNA not associated with the solid substrate from the RNA-polypeptide mixture. 91. The method of any of embodiments 83-90, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA not associated with the solid substrate is removed. 92. The method of any of embodiments 83-91, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the DNA molecules not associated with the solid substrate are removed. 93. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: 14 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 (i) providing an RNA-polypeptide-substrate-DNA mixture wherein the RNA-polypeptide- substrate-DNA mixture comprises: the RNA, a polypeptide that binds the chemically modified nucleotide, a solid substrate that binds the polypeptide, and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; (ii) removing DNA not associated with the solid substrate from the RNA-polypeptide-substrate- DNA mixture, thereby producing a washed mixture, and (iii) determining the amount of the DNA molecule via a nucleic acid amplification technique; and wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide. 94. The method of embodiment 93, wherein step (i) comprises: providing an RNA-polypeptide-substrate mixture wherein the RNA-polypeptide-substrate mixture comprises: the RNA, a polypeptide that binds the chemically modified nucleotide, and a solid substrate that binds the polypeptide; and contacting the RNA-polypeptide-substrate mixture with a plurality of DNA molecules thereby producing the RNA-polypeptide-substrate-DNA mixture. 95. The method of embodiment 94, wherein providing the RNA-polypeptide-substrate mixture comprises: contacting a sample comprising the RNA with a polypeptide that binds the chemically modified nucleotide, thereby producing an RNA-polypeptide mixture; and contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing the RNA-polypeptide-substrate mixture. 96. The method of any of embodiments 83-95, which further comprises removing DNA molecules not associated with the solid substrate from the RNA-polypeptide-substrate-DNA mixture. 97. The method of embodiment 96, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the DNA molecules not associated with the solid substrate are removed. 98. The method of any of embodiments 89-97, which further comprises eluting the RNA and bound DNA molecules from the polypeptide prior to performing PCR on the mixture. 15 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 99. The method of embodiment 98, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA and bound DNA molecules associated with the polypeptide is eluted from the polypeptide. 100. The method of any of embodiments 89-99, wherein the PCR is quantitative PCR. 101. The method of embodiment 100, wherein the quantitative PCR comprises detecting a fluorescent emission from a double-strand specific dye (e.g., N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3- benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine). 102. The method of embodiment 101, wherein the quantitative qPCR comprises detecting a fluorescent emission from a fluorescently labeled probe. 103. The method of any of embodiments 100-102, wherein the quantitative PCR primer is complementary to the DNA molecule barcode sequence. 104. The method of any of embodiments 83-103, wherein each DNA molecule in the plurality is a single-stranded DNA (ssDNA) molecule. 105. The method of any of embodiments 83-103, wherein each DNA molecule in the plurality comprises a double-stranded region and a single-stranded overhang region. 106. The method of embodiment 105, wherein the single-stranded overhang region binds to RNA. 107. The method of any of embodiments 83-106, wherein the method quantifies the amount of RNA associated with the polypeptide. 108. The method of embodiment 107, wherein the amount of RNA associated with the polypeptide is quantified relative to the level of a reference RNA. 109. The method of embodiment 107, wherein the amount of RNA associated with the polypeptide is quantified absolutely. 110. The method of embodiment 107, further comprising measuring fluorescence quantitatively. 16 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 111. The method of any of embodiments 107-110, wherein a standard curve is produced using RNA samples with known amounts of the RNA modification. 112. The method of embodiment 111, wherein a logarithmic function fit to the standard curve has an R2value greater than or equal to 0.9. 113. The method of any of embodiments 85-106, wherein the method provides a qualitative readout of RNA associated with the polypeptide. 114. The method of embodiment 113, wherein the qualitative readout is colorimetric. 115. The method of embodiment 113, wherein the qualitative readout is fluorescent. 116. The method of any of embodiments 83-115, wherein the RNA is split into more than one pool prior to the first step of the method. 117. The method of embodiment 116, wherein the RNA is split into 2, 3, 4, 5, 6, 7, 8, 9, or 10 pools. 118. The method of embodiment 116 or 117, wherein a different chemically modified nucleotide is detected in each pool. 119. An RNA-polypeptide-substrate-DNA mixture comprising: RNA; a polypeptide that binds a chemically modified nucleotide; a solid substrate that binds the polypeptide; and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence. 120. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-119, wherein the RNA is from a mammalian cell. 121. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-120, wherein the RNA is from a human cell. 17 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 122. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-121, wherein the RNA is from a human subject. 123. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-122, wherein the RNA is from a bacterial cell. 124. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-123, wherein the RNA is from a yeast cell. 125. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-124, wherein the RNA was produced in a cell-free system. 126. The method or RNA-polypeptide-substrate-DNA mixture of any of embodiments 83-125, wherein the RNA is a therapeutic RNA. 127. A kit comprising: a polypeptide that binds a chemically modified nucleotide; a solid substrate that binds the polypeptide (e.g., a bead, e.g., directly or indirectly, e.g., wherein the substrate binds a ligand and the ligand binds the polypeptide); a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; optionally, a nucleic acid probe for detecting PCR amplification; and optionally, primers for amplification of the barcode sequence. 128. The kit of embodiment 127, wherein the solid substrate that binds the polypeptide is provided as: a first container comprising the solid substrate; and a second container comprising a ligand that binds the solid substrate, wherein the ligand binds the polypeptide. 129. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with a polypeptide that binds the chemically modified nucleotide, thereby producing an RNA-polypeptide mixture; 18 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 b) contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing an RNA-polypeptide-substrate mixture; and c) detecting if RNA in the RNA-polypeptide-substrate mixture was associated with the polypeptide, wherein association of RNA with the polypeptide is indicative of the RNA comprising the chemically modified nucleotide. 130. The method of embodiment 129, which further comprises contacting the RNA-polypeptide- substrate mixture with a plurality of DNA molecules, thereby producing an RNA-polypeptide-bead- primer mixture. 131. The method of embodiment 130, wherein each DNA molecule in the plurality comprises a barcode sequence. 132. The method of embodiment 130 or 131, which further comprises removing DNA not associated with the solid substrate from the RNA-polypeptide-substrate-DNA mixture, thereby producing a washed mixture. 133. The method of embodiment 132, which further comprises performing PCR on the washed mixture to detect if RNA was associated with the polypeptide. 134. The method of any of embodiments 129-133, which further comprises removing RNA not associated with the solid substrate from the RNA-polypeptide mixture. 135. The method of embodiment 134, wherein at least 50%, 60%, 70%, 80%, 90%, or 95% of the RNA not associated with the solid substrate is removed. 136. The kit of embodiment 127 or 128, wherein the kit further comprises RNA modification standards for one or more chemical modifications, wherein the RNA modification standard comprises RNA having a known level of a known chemical modification. 137. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 136, wherein the chemically modified nucleotide comprises a chemically modified adenine. 19 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 138. The method, RNA-polypeptide-substrate-DNA mixture, or kit of embodiment 137, wherein the chemically modified nucleotide comprises a m6A or m1A modification. 139. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 136, wherein the chemically modified nucleotide comprises chemically modified cytosine. 140. The method, RNA-polypeptide-substrate-DNA mixture, or kit of embodiment 139, wherein the chemically modified nucleotide comprises a hm5C or m5C modification. 141. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 136, wherein the chemically modified nucleotide comprises chemically modified uracil. 142. The method or RNA-polypeptide-bead-DNA mixture of embodiment 141, wherein the chemically modified nucleotide comprises a Ψ modification. 143. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 142, wherein the polypeptide binds a m6A, m6Am, m1A, hm5C, m5C, Ψ, or inosine chemically modified nucleotide. 144. The method, RNA-polypeptide substrate-DNA mixture, or kit of any of embodiments 83- 143, wherein the solid substrate is a bead. 145. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 144, wherein the solid substrate is a magnetic bead. 146. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 145, wherein the surface of the solid substrate binds a ligand that binds the polypeptide. 147. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 146, wherein recombinant protein G binds, e.g., covalently binds, the surface of the solid substrate. 148. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 147, wherein recombinant protein A binds, e.g., covalently binds the surface of the solid substrate. 20 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 149. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 148, wherein recombinant protein A / G binds, e.g., covalently binds the surface of the solid substrate. 150. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 149, wherein the solid substrate comprises free carboxyl groups. 151. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 150, wherein the polypeptide is covalently bound to the solid substrate. 152. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 151, wherein each DNA molecule in the plurality of DNA molecules comprises a random hexamer sequence. 153. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 83- 151, wherein each DNA molecule in the plurality of DNA molecules comprises an oligo(dT) sequence. 154. The method, RNA-polypeptide-substrate-DNA mixture, or kit of embodiment 153, wherein the oligo(dT) sequence comprises 10-25 deoxythymidines. 155. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of embodiments 88- 154, wherein the barcode sequence is 70-90 nucleotides in length. 156. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of any of embodiments 83-155, wherein the DNA is a ssDNA. 157. The method, RNA-polypeptide-substrate-DNA mixture, or kit of any of any of embodiments 83-156, wherein the DNA has a double-stranded region and a single-stranded overhang region. The present disclosure contemplates all combinations of the aspects and embodiments disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS 21 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Figure 1 is a schematic showing exemplary steps of the method for quantifying RNA modifications. A modification-specific antibody was bound to RNA. Protein G magnetic beads were added and bound to the antibodies. An ssDNA comprising a barcode and a poly-T region was added and bound to the RNA via the poly-A tail. qPCR was performed with barcode-specific primers to quantify the amount of the ssDNA barcode, which was indicative of the amount of antibody-bound RNA in the sample. Figure 2 is a plot showing the relationship between the Cq value derived from qPCR of the ssDNA barcode and the quantity of m6A (picograms) in three samples (represented by squares). A logarithmic function fit to the data has R2= 0.992. Figures 3A-3C are schematics showing exemplary steps of a method for quantifying RNA modifications. Figure 3A depicts the step of contacting a Protein-G magnetic bead with an antibody, which results in an antibody-bead conjugate. Figure 3B depicts the use of EDC / NHS chemistry to conjugate an antibody to a carboxylated magnetic bead. EDC is added to the carboxylated magnetic bead, resulting in o-Acylisourea. Sulfo-NHS is added, resulting in a sulfo-NHS ester on the surface of the bead and production of isourea. Antibodies are then conjugated to the bead, resulting in release of sulfo-NHS from the bead. Figure 3C depicts exemplary steps of a method for quantifying RNA modifications using beads conjugated to antibodies as shown in Figure 3A or Figure 3B. Beads bound to antibodies are added to an RNA sample and bind to the modified RNA, which in this example has an m6A modification. An ssDNA comprising a barcode and a poly-T region is added and bound to the RNA via the poly-A tail. qPCR is performed with barcode-specific primers to quantify the amount of the ssDNA barcode, which is indicative of the amount of antibody-bound RNA in the sample. Figure 4 is a plot of the Ct value and the % of RNA containing m6A. A function fit to the data has R2= 0.997. The Ct value decreases as the percent of RNA with m6A modifications increases. In this experiment, an Abcam m6A antibody and Dynabeads M270 carboxylic acid beads were used. Figure 5 is a plot of the Ct value and the % of RNA containing m6A in two replicate experiments (replicate 1 and replicate 2). A function fit to the replicate 1 data has R2= 0.989. A function fit to the replicate 2 data has R2= 0.999. The Ct value decreases as the percent of RNA with m6A modifications increases. In this experiment, an ABClonal m6A antibody and Dynabeads M270 carboxylic acid beads were used. Figure 6 is a plot of the Ct value and the % of RNA containing m6A in two replicate experiments (replicate 1 and replicate 2). A function fit to the replicate 1 data has R2= 0.971. A function fit to the replicate 2 data has R2= 0.996. The Ct value decreases as the percent of RNA with m6A modifications increases. In this experiment, an Abcam m6A antibody and Agilent Lodestars Carboxyl beads were used. 22 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 DETAILED DESCRIPTION OF THE INVENTION The present disclosure provides, for example, methods of quantifying chemical modifications to RNA molecules. Exemplary RNA modifications are known to those skilled in the art and are described herein. In the following description, for an explanation, numerous specific details provide a thorough understanding of the compositions and methods disclosed herein. However, it may be evident that the compositions and methods may be practiced without these specific details. Aspects, modes, embodiments, variations, and features of the compositions and methods are described below in various levels of detail to provide a substantial understanding of the present disclosure. Definitions For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are listed below. Unless otherwise defined, all technical and scientific terms have the same meaning as commonly understood by a person having ordinary skill in the biomedical art to which this invention belongs. A term's meaning provided in this specification shall prevail if any apparent discrepancy arises between the meaning of a definition provided in this specification and the term's use in the biomedical art. As used herein, the term “antibody” refers to a naturally occurring antibody, an engineered antibody, or a fragment thereof. In some embodiments, an antibody is an antigen binding portion of a naturally occurring antibody or an engineered antibody. In some embodiments, an antibody includes an antibody or an antigen-binding fragments thereof (e.g., Fab, Fab’, F(ab’)2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), Fd fragments consisting of the VH and CH1 domains, linear antibodies, single domain antibodies such as sdAb (either VL or VH), nanobodies, or camelid VHH domains), an antigen-binding fibronectin type III (Fn3) scaffold such as a fibronectin polypeptide minibody, a ligand, a cytokine, a chemokine, or a T cell receptor (TCR). In some embodiments, an antibody is a humanized antibody. In some embodiments, an antibody is an intact IgA, IgG, IgE or IgM antibody. In some embodiments, an antibody is a bi- or multi- specific antibody (e.g., Zybodies®, etc). In some embodiments, antibodies are antibody fragments such as Fab fragments, Fab’ fragments, F(ab’)β fragments, Fd’ fragments, Fd fragments, isolated CDRs or sets thereof. In some embodiments, an antibody is a single chain Fv (scFv), a polypeptide-Fc fusion, a single domain antibody (e.g., shark single domain antibodies such as IgNAR or fragments thereof), or a cameloid antibody. In some embodiments, antibodies are masked antibodies (e.g., Probodies®), Small Modular ImmunoPharmaceuticals (“SMIPsTM”), single chain or Tandem diabodies (TandAb®), VHHs; Anticalins®, Nanobodies®, 23 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 minibodies, BiTE®s, ankyrin repeat proteins or DARPINs®, Avimers®, DARTs, TCR-like antibodies, Adnectins®, Affilins®, Trans-bodies®, Affibodies®, TrimerX®, MicroProteins, Fynomers®, Centyrins®, or KALBITOR®s. The singular forms a, an, and the like include plural referents unless the context dictates otherwise. For example, a reference to a cell comprises a combination of two or more cells. As used herein, the term “barcode sequence” refers to a known nucleic acid sequence that allows the nucleic acid comprising the barcode sequence to be detected, e.g., by a nucleic acid amplification technique. In some embodiments, one barcode sequence is used. In some embodiments, more than one barcode sequence is used. As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. Using comprising indicates inclusion rather than limitation. As used herein, the term “consisting essentially of” means the listed elements are required for a given embodiment. The term permits additional elements that do not materially affect the basic and functional characteristics of that embodiment of the invention. As used herein, the term “consisting of” means compositions, methods, and respective components thereof, exclusive of any element not recited in that description of the embodiment. As used herein, the term “expression” refers to the transcription or translation of a particular nucleic acid sequence driven by a promoter. In some embodiments, expression refers to the level of accumulation of an RNA. In some embodiments, expression refers to the accumulation of a protein. As used herein, the term “nucleic acid” refers to a polymeric molecule incorporating units of ribonucleic acid, deoxyribonucleic acid, or an analog thereof. In some embodiments, the nucleic acid is in single stranded form. In some embodiments, the nucleic acid is in double stranded form. In some embodiments, the nucleic acid is genomic DNA, cDNA, or RNA (e.g. mRNA). In some embodiments, the nucleic acid contains analogues of natural nucleotides that have similar binding properties as the reference nucleic acid. In some embodiments, the nucleic acid containing analogues of natural nucleotides are metabolized in a manner similar to naturally occurring nucleotides. As used herein, the term “or” refers to and / or. The term and / or as used in a phrase such as A and / or B herein includes both A and B; A or B; A (alone); and B (alone). Likewise, the term and / or as used in a phrase such as A, B, and / or C encompasses each embodiment: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; Band C; A (alone); B (alone); and C (alone). As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a molecule comprised of two or more amino acid residues covalently linked by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. In some embodiments, the polypeptide comprises a modified amino acid. In some embodiments, the polypeptide refers to a natural peptide, a 24 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 recombinant peptide, or a combination thereof. In some embodiments, the polypeptide refers to short chains of amino acids. In some embodiments, the polypeptide refers to long chains of amino acids. In some embodiments, the polypeptide refers to a biologically active fragment, a substantially homologous polypeptide, an oligopeptide, a variant of a polypeptide, a modified polypeptide, a derivative, an analog, or a fusion protein. A person having ordinary skill in the biomedical art recognizes that individual substitutions, deletions, or additions to a peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence are a conservatively modified variant where the alteration results in the substitution of amino acid with chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants also do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure. As used herein, the term “subject” refers to a mammal, including but not limited to a dog, cat, horse, cow, pig, sheep, goat, chicken, rodent, or primate. Subjects can be house pets (e.g., dogs, cats), agricultural stock animals (e.g., cows, horses, pigs, chickens, etc.), laboratory animals (e.g., mice, rats, rabbits, etc.), but are not so limited. Subjects include human subjects. The human subject may be a pediatric, adult, or geriatric subject. The human subject may be of either sex. In some embodiments, the subject may have a condition or disease or be at risk of developing a condition or disease. This invention is not limited to the particular methodology, protocols, reagents, etc., described herein and as such can vary. The disclosure described herein does not concern a process for cloning humans, processes for modifying the germ line genetic identity of humans, uses of human embryos for industrial or commercial purposes, or processes for modifying the genetic identity of animals likely to cause them suffering with no substantial medical benefit to man or animal, and animals resulting from such processes. Modified Nucleotides The method described herein detects modifications of RNA. In some embodiments, the RNA is shorter than 200 nt in length or greater than 200 nt in length. In some embodiments, the RNA is messenger RNA (mRNA), transfer RNA (tRNA), long non-coding RNA (lncRNA), ribosomal RNA (rRNA), micro RNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), Piwi- interacting RNA (piRNA), tRNA-derived small RNA (tsRNA), enhancer RNA (eRNA), or small rDNA- derived RNA (srRNA). In some embodiments, the RNA modification comprises a N6-methyladenosine (m6A) modification. In some embodiments, the nucleotide comprising the m6A modification comprises the chemical structure of Formula I: 25 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Formula I An m6A modification can be present in mRNA, tRNA, rRNA, microRNA, and snoRNA. In some embodiments, an antibody is used to detect an m6A modification. In some embodiments, the antibody is antibody 202003, a rabbit polyclonal purified antibody obtained from Synaptic Systems. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody 202003. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody 202003. In some embodiments, the antibody is ab151230, a rabbit polyclonal antibody obtained from Abcam. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody ab151230. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody ab151230. In some embodiments, the antibody is A19841, a rabbit monoclonal antibody obtained from ABClonal. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody A19841. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody A19841. 26 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 In some embodiments, the RNA modification comprises a N6,2‘-O-dimethyladenosine (m6Am) modification. In some embodiments, the nucleotide comprising the m6Am modification comprises the chemical structure of Formula II: In some embodiments, the RNA modification comprises a N1-methyladenosine (m1A) modification. In some embodiments, the nucleotide comprising the m1A modification comprises the chemical structure of Formula III: An m1A modification can be present in mRNA, tRNA, rRNA, and lncRNA. In some embodiments, an antibody is used to detect an m1A modification. In some embodiments, the antibody is antibody E8S7H, a rabbit monoclonal antibody, e.g., obtained from Cell Signaling Technology. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody E8S7H. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody E8S7H. In some embodiments, the antibody is EPR-19836-208, a rabbit recombinant monoclonal antibody obtained from Abcam. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain 27 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody EPR-19836-208. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody EPR-19836-208. In some embodiments, the antibody is D345-3 (e.g., AMA-2), a mouse monoclonal antibody comprising an IgG2b heavy chain constant region and a kappa light chain constant region, e.g., obtained from MBL Life Science. AMA-2 is described in, e.g., Itoh, Mizugaki, and Ishida, Preparation of a monoclonal antibody specific for 1- methyladenosine and its application for the detection of elevated levels of 1-methyladenosine in urines from cancer patients. Jpn J Cancer Res.1988 Oct;79(10):1130-8. doi: 10.1111 / j.1349- 7006.1988.tb01536.x. PMID: 3143701. In some embodiments, the antibody binds a keyhole limpet hemocyanin (KLH)-conjugated 1-methyladenosine (KLH-m1A) antigen. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody AMA-2. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody AMA-2. In some embodiments, the RNA modification comprises a 5-methylcytosine (m5C) modification. In some embodiments, the nucleotide comprising the m5C modification comprises the chemical structure of Formula IV: An m5C modification can be present in mRNA, tRNA, rRNA, and ncRNA. In some embodiments, an antibody is used to detect an m5C modification. In some embodiments, the antibody is antibody FMC-9, a mouse monoclonal antibody comprising an IgG2a heavy chain constant region and a kappa light chain constant region, e.g., obtained from MBL life science. FMC-9 is described in, e.g., Mizugaki M et al. Preparation of a monoclonal antibody specific for 5-methyl-2'-deoxycytidine and its application for the detection of DNA methylation levels in human peripheral blood cells. Biol Pharm Bull.1996 Dec;19(12):1537-40. doi: 10.1248 / bpb.19.1537. PMID: 8996634. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain 28 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody FMC-9. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody FMC-9. In some embodiments, the antibody is antibody 2C9G9, a mouse monoclonal antibody comprising an IgG2b heavy chain constant region, e.g., obtained from Proteintech. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody 2C9G9. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody 2C9G9. In some embodiments, the RNA modification comprises a 5-hydroxymethylcytidine (hm5C) modification. In some embodiments, the nucleotide comprising the hm5C modification comprises the chemical structure of Formula V: In some embodiments, the RNA modification comprises a pseudouridine (Ψ) modification. In some embodiments, the nucleotide comprising the Ψ modification comprises the chemical structure of Formula VI: Formula VI A Ψ modification can be present in mRNA, tRNA, rRNA, and snRNA. In some embodiments, an antibody is used to detect a Ψ modification. In some embodiments, the antibody is antibody C15200247, a 29 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 mouse monoclonal antibody raised against Ψ conjugated to BSA obtained from Cell Signaling Technology. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody C15200247. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody C15200247. In some embodiments, the antibody is antibody APU-6, a mouse monoclonal antibody comprising an IgG1 heavy chain constant region and a kappa light chain constant region, e.g., obtained from MBL Life Science. APU-6 is described in, e.g., Itoh K, Mizugaki M, Ishida N. Detection of elevated amounts of urinary pseudouridine in cancer patients by use of a monoclonal antibody. Clin Chim Acta. 1989 May 31;181(3):305-15. doi: 10.1016 / 0009-8981(89)90236-2. PMID: 2758683. In some embodiments, the antibody binds a KLH-conjugated pseudouridine antigen. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody APU-6. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody APU-6. In some embodiments, the antibody is antibody 1G7C7, a mouse monoclonal antibody comprising an IgG1 heavy chain constant region, e.g., obtained from proteintech. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody 1G7C7. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody 1G7C7. In some embodiments, the RNA modification comprises inosine. In some embodiments, inosine comprises the chemical structure of Formula VII: 30 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Inosine can be present in tRNA, miRNA. In some embodiments, an antibody is used to detect inosine. In some embodiments, the antibody is antibody C15200251, a mouse monoclonal antibody raised against inosine conjugated to BSA, obtained from Diagenode. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody C15200251. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody C15200251. In some embodiments, the antibody is antibody PM098, a rabbit polyclonal antibody raised against carrier protein-conjugated inosine, obtained from MBL Life Science. In some embodiments, the antibody has a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), heavy chain complementarity determining region 3 (HC CDR3), light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of antibody PM098. In some embodiments, the antibody has a heavy chain variable region (VH) and light chain variable region (VL) of antibody PM098. Peptides and RNA binding proteins In some embodiments, a modified nucleotide, e.g., an RNA modification as described herein, is bound by a peptide. In some embodiments, the peptide binds m6A. In some embodiments, the peptide is DGDWDAWTRETS (SEQ ID NO: 10), as described in Rauff R, Abedeera SM, Schmocker S, Xie J, Abeysirigunawardena SC. Peptides Targeting RNA m6 A Methylations Influence the Viability of Cancer Cells. ChemMedChem.2023 Feb 14;18(4):e202200549. doi: 10.1002 / cmdc.202200549. Epub 2023 Jan 23. PMID: 36567478; PMCID: PMC9957953, or an amino acid sequence having no more than 1, 2, or 3 amino acid differences thereto. 31 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 In some embodiments, a peptide that binds a modified nucleotide, e.g., an RNA modification as described herein, is used in a method described herein. In some embodiments, a modified nucleotide, e.g., an RNA modification, as described herein, is bound by a RNA binding protein. RNA binding proteins are known in the art. In some embodiments, the RNA binding protein binds m6A. In some embodiments, the RNA binding protein is YTHDF1, YTHDF2, or YTHDF3, or comprises a YTH domain, as described in Li, F., Zhao, D., Wu, J. et al. Structure of the YTH domain of human YTHDF2 in complex with an m6A mononucleotide reveals an aromatic cage for m6A recognition. Cell Res 24, 1490–1492 (2014). https: / / doi.org / 10.1038 / cr.2014.153. In some embodiments, the RNA binding protein is an IGF2BP protein, as described in Huang H, et al. Recognition of RNA N6-methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat Cell Biol.2018 Mar;20(3):285-295. doi: 10.1038 / s41556-018-0045-z. Epub 2018 Feb 23, or a sequence having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity thereto, or an amino acid sequence having no more than 1, 2, or 3 amino acid differences thereto. In some embodiments, the RNA binding protein binds pseudouridine. In some embodiments, the RNA binding protein is Profilin-1 (PFN-1), as described in Songbo Wei, Xiaoxia Dai, Jun Yuan, Shiyang He, Kriti Shah, Shiyuan Guo, Zheng Duan, Jernej Murn, and Yinsheng Wang. Journal of the American Chemical Society 2025147 (2), 1458-1462 DOI: 10.1021 / jacs.4c17659, or a sequence having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity thereto. In some embodiments, the RNA binding protein binds m1A. In some embodiments, the RNA binding protein is YTHDF1, YTHDF2, YTHDF3, or YTHDC1, or comprises a YTH domain, as described in Xiaoxia Dai, Tianlu Wang, Gwendolyn Gonzalez, and Yinsheng Wang. Identification of YTH Domain-Containing Proteins as the Readers for N1-Methyladenosine in RNA. Analytical Chemistry 201890 (11), 6380-6384 DOI: 10.1021 / acs.analchem.8b01703, or a sequence having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity thereto, or an amino acid sequence having no more than 1, 2, or 3 amino acid differences thereto. In some embodiments, the RNA binding protein binds inosine. In some embodiments, the RNA binding protein is endonuclease V, e.g., endonuclease V from E. coli, as described in Steve D. Knutson, Robert A. Arthur, H. Richard Johnston, and Jennifer M. Heemstra. Selective Enrichment of A-to-I Edited Transcripts from Cellular RNA Using Endonuclease V. Journal of the American Chemical Society 2020 142 (11), 5241-5251 DOI: 10.1021 / jacs.9b13406, or a sequence having at least 80%, 85%, 90%, 95%, or 99% amino acid sequence identity thereto. 32 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 ssDNA molecules A single-stranded DNA (ssDNA) molecule may be used in the methods as described herein. In some embodiments, a plurality of ssDNA molecules is used. In some embodiments, each ssDNA molecule comprises a region which binds to RNA (e.g., a poly-dT, oligo(dT), or a random sequence that binds to random RNA molecules, e.g., a random hexamer sequence). In some embodiments, the region that binds to RNA preferentially detects a particular RNA sequence relative to other RNA sequences. In some embodiments, the region that binds to RNA recognizes a sequence that is unique in the transcriptome. As examples, the region that binds to RNA may bind to an exon, an exon-exon junction, a 5’ UTR, or a 3’ UTR. In some embodiments, each ssDNA molecule comprises a barcode sequence which can be amplified by a method of nucleic acid amplification (e.g., PCR or qPCR). The barcode sequence may be, for example, a sequence not found in the human genome. In some embodiments, the plurality of ssDNA molecules comprises ssDNA molecules which are not identical. dsDNA molecules with single-stranded overhangs A double-stranded DNA (dsDNA) molecule that has a single-stranded overhang may be used in the methods as described herein. In some embodiments, a plurality of dsDNA molecules with single- stranded overhangs is used. In some embodiments, the DNA molecule has one strand extending beyond the second strand at one end, forming a single-stranded region (e.g., a “sticky end”). In some embodiments, the double-stranded region comprises DNA sequences which are complementary to each other. In some embodiments, the double-stranded region is about 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 base pairs (bp) in length. In some embodiments, the double- stranded region is about 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 bp in length. In some embodiments, the double-stranded region is about 40-200, 50-150, 60-100, or 65-80 bp in length. In some embodiments, the double-stranded region is about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 bp in length. In some embodiments, the single-stranded overhang is about 6-25, 8-23, 10-21, 12-19, or 14-18 bp in length. In some embodiments, the single-stranded overhang is about 6-10, 10-15, 15-20, or 20-25 bp in length. In some embodiments, the single-stranded overhang is about 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, or 25 bp in length. In some embodiments, the single-stranded overhang is about 15, 16, 17, 18, 19, 20, 21, or 22 bp in length. In some embodiments, the single-stranded region has a free 3’ end. In some embodiments, the single stranded region has a free 5’ end. In some embodiments, the single-stranded region has a free end that is a substrate for primer extension. 33 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Without wishing to be bound by theory, using dsDNA with a single-stranded overhang may prevent secondary structures from forming, increasing the binding of the dsDNA to an RNA molecule. In some embodiments, using dsDNA with a single-stranded overhang may increase the efficiency of RNA capture. In some embodiments, this reduces the amount of RNA needed as input to the assay. In some embodiments, each dsDNA molecule comprises a region which binds to RNA (e.g., a poly-dT, oligo(dT), or a random sequence that has an binds to random RNA molecules, e.g., a random hexamer sequence). In some embodiments, the region that binds to RNA preferentially detects a particular RNA sequence relative to other RNA sequences. In some embodiments, the region that binds to RNA recognizes a sequence that is unique in the transcriptome. As examples, the region that binds to RNA may bind to an exon, an exon-exon junction, a 5’ UTR, or a 3’ UTR. In some embodiments, each dsDNA molecule comprises a barcode sequence which can be amplified by a method of nucleic acid amplification (e.g., PCR or qPCR). The barcode sequence may be, for example, a sequence not found in the human genome. In some embodiments, the plurality of dsDNA molecules comprises dsDNA molecules which are not identical. Barcode Sequence In some embodiments, a ssDNA or dsDNA sequence used in the method as described herein comprises a barcode sequence. In some embodiments, the barcode sequence is 70-90 bp in length. In some embodiments, the barcode sequence is about 60, 65, 70, 75, 80, 85, 90, or 95 bp in length. In some embodiments, the barcode sequence is about 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, or 90-95 bp in length. In some embodiments, the barcode sequence is used as an amplicon for PCR, e.g., as described herein. Solid Substrate A solid substrate may be used in the method as described herein. In some embodiments, the solid substrate binds to an antibody or polypeptide. In some embodiments, the solid substrate is a bead. The bead may be, for example, a magnetic bead or an agarose bead. The solid substrate, e.g., bead, may be coupled to an antibody or a polypeptide directly or indirectly. The solid substrate, e.g., bead, may be coupled to an antibody or a polypeptide covalently or noncovalently. In some embodiments, the beads are coated, e.g., with a ligand or a functional group, over at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% of their surface area. In some embodiments, the beads are uniformly coated. In some embodiments, the beads are non-uniformly coated. In some embodiments, the beads are coated with a ligand (such as protein G or protein A) which binds an antibody or a polypeptide, and an antibody or polypeptide is allowed to bind to the ligand-coated 34 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 beads. Magnetic beads coated with one or both of Protein G or Protein A may be obtained from, e.g., Thermo Fisher Scientific, New England Biolabs, Cell Signaling Technology, Promega Corporation, and additional sources known to those skilled in the art. In some embodiments, the solid substrate, e.g., bead, is coated with a functional group, e.g., free carboxyl groups. In some embodiments, antibodies or polypeptides are covalently linked to a bead coated with a functional group, e.g., free carboxyl groups. In some embodiments, antibodies are covalently linked to a bead coated with a carboxyl group by EDC / NHS covalent conjugation. Carboxylated magnetic beads may be obtained from, e.g., Molecular Cloning Laboratories, Thermo Fisher Scientific, Sigma- Aldrich, and additional sources known to those skilled in the art. In some embodiments, an ssDNA or dsDNA molecule may be associated with the solid substrate indirectly, e.g., the ssDNA or dsDNA molecule is associated with RNA, which is associated with an antibody, which is associated with the solid substrate. In some embodiments, RNA may be associated with the solid substrate indirectly, e.g., the RNA is associated with an antibody, which is associated with the solid substrate. Standard Curves The method described herein may involve the production of a standard curve based on samples with a known amount of an RNA modification. In some embodiments, the standard curve is produced using PCR, e.g., real-time quantitative PCR (qPCR). qPCR monitors the amplification of a targeted DNA molecule during the PCR. Methods for the detection of PCR products in qPCR include (1) non-specific fluorescent dyes that intercalate with any double-stranded DNA, e.g., SYBR green, and (2) sequence- specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter, which permits detection after hybridization of the probe with its complementary sequence. In some embodiments, the standard curve includes samples with 0.01, 0.05, 0.1, 0.5, 1, 5, or 10 picograms of the RNA modification. In some embodiments, a logarithmic function is fit to the standard curve. In some embodiments, the logarithmic function has an R2value greater than or equal to 0.9. In some embodiments, the logarithmic function is used to relate the Cq (quantification cycle value) of the ssDNA or dsDNA molecule subjected to qPCR to the amount of the RNA modification in a sample. In some embodiments, the logarithmic function is used to determine absolute quantification of the RNA modification in a sample. Methods of Use In some embodiments, the method described herein may be used to determine the amount of an RNA modification in an RNA sample. In some embodiments, the sample comprises RNA isolated from a 35 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 cell, a tissue, or an organism. In some embodiments, the sample comprises RNA isolated from a subject. In some embodiments, the subject has, or is identified as having, a disease or disorder, e.g., a cancer. In some embodiments, the cancer is a mucosal epithelial cancer, e.g., head and neck squamous cell carcinoma. In some embodiments, the cancer is a colorectal cancer. In some embodiments, the cancer is a gastric cancer. In some embodiments, the cancer is bladder cancer, e.g., urothelial carcinoma of the bladder. In some embodiments, the cancer is liver cancer, e.g., hepatocellular carcinoma. In some embodiments, the cancer is a blood cell cancer, e.g., leukemia. In some embodiments, the sample comprises RNA isolated from cancer cells from a subject. In some embodiments, the disease or disorder is a neurodegenerative disease, e.g., Alzheimer’s disease. In some embodiments, the disease or disorder is diabetes, e.g., Type 2 diabetes mellitus. In some embodiments, the sample comprises RNA isolated from neurons from a subject. Altered nucleic acid modifications, e.g., RNA modifications as described herein, have been linked to several disease states. For example, m6A levels have been shown to be increased in head and neck squamous cell carcinoma, in serum from colorectal and gastric cancer patients, and in urothelial carcinoma of the bladder, as described in: Guo YQ et al. METTL3 modulates m6A modification of CDC25B and promotes head and neck squamous cell carcinoma malignant progression. Exp Hematol Oncol.2022 Mar 14;11(1):14. doi: 10.1186 / s40164-022-00256-3. PMID: 35287752; PMCID: PMC8919647; Hu Y et al. Quantitative Analysis of Methylated Adenosine Modifications Revealed Increased Levels of N6-Methyladenosine (m6A) and N6,2'-O-Dimethyladenosine (m6Am) in Serum From Colorectal Cancer and Gastric Cancer Patients. Front Cell Dev Biol.2021 Jul 26;9:694673. doi: 10.3389 / fcell.2021.694673. PMID: 34381776; PMCID: PMC8350345; Lan Q, Liu PY, Haase J, Bell JL, Hüttelmaier S, Liu T. The Critical Role of RNA m6A Methylation in Cancer. Cancer Res.2019 Apr 1;79(7):1285-1292. doi: 10.1158 / 0008-5472.CAN-18-2965. Epub 2019 Mar 20. PMID: 30894375; and Koch J et al. Reinvestigating the clinical relevance of the m6A writer METTL3 in urothelial carcinoma of the bladder. iScience.2023 Jul 11;26(8):107300. doi: 10.1016 / j.isci.2023.107300. PMID: 37554463; PMCID: PMC10405067. In addition to cancer, m6A has also been implicated in other diseases and disorders. For example, m6A levels have been shown to be decreased in neurons in the brains of patients with Alzheimer’s Disease, as described in Zhao, F., Xu, Y., Gao, S. et al. METTL3-dependent RNA m6A dysregulation contributes to neurodegeneration in Alzheimer’s disease through aberrant cell cycle events. Mol Neurodegeneration 16, 70 (2021). doi.org / 10.1186 / s13024-021-00484-x. m6A levels are also decreased in samples from patients with type 2 diabetes mellitus and diabetic rats, as described in Shen F et al. Decreased N(6)-methyladenosine in peripheral blood RNA from diabetic patients is associated with FTO expression rather than ALKBH5. J Clin Endocrinol Metab.2015 Jan;100(1):E148-54. doi: 36 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 10.1210 / jc.2014-1893. PMID: 25303482; PMCID: PMC5399497. Further, changes in m6A levels have been connected to diabetic cardiac fibrosis as described in Song, Kai et al. WTAP boosts lipid oxidation and induces diabetic cardiac fibrosis by enhancing AR methylation. iScience, Volume 26, Issue 10, 107931. Other RNA modifications have also been linked to cancers. Increased levels of 5mC have been found in hepatocellular carcinoma, as described in Nulali J et al. ALYREF-mediated RNA 5- Methylcytosine modification Promotes Hepatocellular Carcinoma Progression Via Stabilizing EGFR mRNA and pSTAT3 activation. Int J Biol Sci.2024 Jan 1;20(1):331-346. doi: 10.7150 / ijbs.82316. PMID: 38164181; PMCID: PMC10750289. The presence of pseudouridine in a subtype stem cell-enriched transfer RNA derived fragments can inhibit aberrant protein synthesis programs and predict progression to leukemia in myelodysplastic syndrome (Guzzi, N., Muthukumar, S., Cieśla, M. et al. Pseudouridine- modified tRNA fragments repress aberrant protein synthesis and predict leukaemic progression in myelodysplastic syndrome. Nat Cell Biol 24, 299–306 (2022) doi.org / 10.1038 / s41556-022-00852-9). Reduced m1A and m3C levels in tRNA were shown to be with progression in mice, potentially by preventing apoptosis of cancer cells (Chen Z et RNA demethylase ALKBH3 promotes cancer progression via induction of tRNA-derived small RNAs. Nucleic Acids Res.2019 Mar 18;47(5):2533-2545. doi: 10.1093 / nar / gky1250. PMID: 30541109; PMCID: PMC6411830). In some embodiments, the methods described herein are used for performing detection of RNA modifications, e.g., m6A, m1A, inosine, and pseudouridine modifications, in RNA from cancer cells (e.g., from a subject that has, or is identified as having, a cancer). In some embodiments, the cancer is head and neck squamous cell carcinoma. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is gastric cancer. In some embodiments, the cancer is urothelial carcinoma of the bladder. In some embodiments, the cancer is hepatocellular carcinoma. In some embodiments, the cancer is leukemia. In some embodiments, the methods described herein are used for performing detection of RNA modifications, e.g., m6A, m1A, inosine, and pseudouridine modifications, in RNA from cells from a subject that has, or is identified as having, a disease or disorder. In some embodiments, the disease or disorder is Alzheimer’s disease. In some embodiments, the disease or disorder is type 2 diabetes mellitus. In some embodiments, the disease or disorder is diabetic cardiac fibrosis. In some embodiments, RNA is isolated from a cell, a tissue, or an organism, e.g., using conventional methods. In some embodiments, RNA is isolated using trizol. In some embodiments, RNA is isolated using a kit. Kits for isolating RNA can be obtained from commercial sources including Thermo Fisher Scientific, New England Biolabs, and Qiagen. The skilled artisan may use various methods for isolating and purifying RNA. For example, methods for isolating and purifying RNA are described in 37 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Nguyen et al. (Nguyen, L.T., Pollock, C.A. & Saad, S. Extraction of high quality and high yield RNA from frozen EDTA blood. Sci Rep 14, 8628 (2024). doi.org / 10.1038 / s41598-024-58576-9), Lin et al. (Yu Lin et al. Optimization of FFPE preparation and identification of gene attributes associated with RNA degradation, NAR Genomics and Bioinformatics, Volume 6, Issue 1, March 2024, lqae008, doi.org / 10.1093 / nargab / lqae008), Dell’Orso et al. (2021 STAR Protocols, ISSN: 2666-1667, Vol: 2, Issue: 2, Page: 100451). Methods for isolating and purifying mRNA are described, for example, in Wahl et al. (Wahl, A., Huptas, C. & Neuhaus, K. Comparison of rRNA depletion methods for efficient bacterial mRNA sequencing. Sci Rep 12, 5765 (2022). doi.org / 10.1038 / s41598-022-09710-y), Green and Sambrook (Green MR, Sambrook J. Isolation of Poly(A)+ Messenger RNA Using Magnetic Oligo(dT) Beads. Cold Spring Harb Protoc.2019 Oct 1;2019(10). doi: 10.1101 / pdb.prot101733. PMID: 31575797), and Jost et al (Green MR, Sambrook J. Isolation of Poly(A)+ Messenger RNA Using Magnetic Oligo(dT) Beads. Cold Spring Harb Protoc.2019 Oct 1;2019(10). doi: 10.1101 / pdb.prot101733. PMID: 31575797). Methods for isolating and purifying microRNA are described, for example, in Sriram et al (Sriram H, Khanka T, Kedia S, Tyagi P, Ghogale S, Deshpande N, Chatterjee G, Rajpal S, Patkar NV, Subramanian PG, Gujral S, Hasan S, Tembhare PR. Improved protocol for plasma microRNA extraction and comparison of commercial kits. Biochem Med (Zagreb).2021 Oct 15;31(3):030705. doi: 10.11613 / BM.2021.030705. PMID: 34658646; PMCID: PMC8495618). Methods for isolating and purifying tRNA are described, for example, in Avcilar-Kucukgoze et al (Avcilar-Kucukgoze I, Gamper H, Hou YM, Kashina A. Purification and Use of tRNA for Enzymatic Post-translational Addition of Amino Acids to Proteins. STAR Protoc.2020 Dec 9;1(3):100207. doi: 10.1016 / j.xpro.2020.100207. PMID: 33377101; PMCID: PMC7757669). In many of the embodiments described herein, a nucleic acid amplification technique is performed on the DNA molecules in the mixture. Other methods of detecting the DNA may also be used. For example, in some embodiments, the DNA can be detected by hybridizing a nucleic acid probe comprising a detectable label to the DNA. In some embodiments, a method described herein comprises contacting together the RNA, a polypeptide (e.g., an antibody), and a solid substrate. These can be contacted with each other simultaneously or sequentially, in various orders. For example, the RNA can be contacted with the polypeptide (e.g., antibody) and then the solid substrate can be added. As another example, the polypeptide (e.g., antibody) can be contacted with the bead, and then the RNA can be added. Kits In some embodiments, the reagents or components described herein may be included in a kit. In some embodiments, the kit comprises one or more of the reagents or components described herein. In 38 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 some embodiments, the kit comprises a package insert or other labeling including instructions for performing an assay as described herein. In some embodiments, the kit comprises a container. EXAMPLES Example 1: qPCR-based quantification of the m6A RNA modification This Example describes quantitative PCR-based quantification of the m6A RNA modification in an RNA sample. An overview of the protocol is provided in Figure 1 (wash steps after antibody binding and ssDNA binding are not shown). Synthetic Oligonucleotide Design Custom 33nt RNA oligonucleotides containing poly-adenosine tails were obtained from Integrated DNA Technologies. Two RNA oligonucleotides were ordered: one with a single internal N6- methyladenosine modification and one with the same sequence but without any modifications. In addition, two 80nt RNA oligonucleotides (one with an m6A modification and one not) containing poly- adenosine tails were obtained from Genscript. A 100nt ssDNA reporter template and corresponding primers were designed and purchased from Integrated DNA Technologies. The reporter template was designed to have a poly-dT tail, minimal secondary structures, and an amplicon length of 92bp. All sequences are provided below. 33nt RNA with internal m6A modification (5’-3’): AAAAAAAAAAACCCCC / iN6Me-rA / CCCCCAAAAAAAAAAA (SEQ ID NO: 1) 33nt RNA without internal m6A modification (5’-3’): AAAAAAAAAAACCCCCACCCCCAAAAAAAAAAA (SEQ ID NO: 2) 100 nt ssDNA probe sequence (5’-3’): TTTTTTTTTTTTTTTTTTGACCTACAGACCACAAGCAAGGACCTGAATATGACAACCT TAGCCAGACGCGATGTGAGGTGGTGCTCCTTTACTTGGAGTA (SEQ ID NO: 3) 100 nt ssDNA probe used to anneal to poly-A tails of RNA oligos. Amplicon in qPCR is 79 bp in size. qPCR primers for ssDNA template amplification in qPCR (5’-3’): Forward: TCC AAG TAA AGG AGC ACC AC (SEQ ID NO: 4) Reverse: GAC CTA CAG ACC ACA AGC AA (SEQ ID NO: 5) 39 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 DNA and RNA quantification Concentrations of all DNA and RNA were measured in triplicate using a NanoDrop1000 Spectrophotometer (Thermo Fisher Scientific) or a Qubit Flex Fluorometer (Thermo Fisher Scientific) and corresponding quantification kits. For measurement of DNA and RNA from experimental processes, qPCR and RT-qPCR were used respectively with standard curves of known serial dilutions as detailed below. RNA Modification Quantification Assay A 4-point standard curve was generated from a 1:10 serial dilution of 1 ng / μL RNA containing an internal m6A modification. Each standard also contained 2 ng of unmodified RNA. Controls with only unmodified RNA and with no RNA were also made. All samples and standards were incubated at room temperature for 45 minutes and occasionally mixed.Prior to antibody binding, 25 μL protein G magnetic beads (New England Biolabs) per sample were equilibrated to room temperature, washed twice with 1X TBS buffer (pH 8.0)(Thermo Fisher Scientific) with 0.05% Tween-20 (BioRad), then resuspended in 250 μL of Tween-TBS buffer. An anti-n6-methyladenosine antibody (rabbit, polyclonal, Synaptic Systems) was bound to RNA containing m6A modifications. In separate tubes, RNA samples (9.5 μL each) were mixed gently with 0.5 μL of 1 mg / mL anti-N6-methyladenosine antibody (rabbit, polyclonal; Synaptic Systems). An alternative format of the assay was performed where antibodies were first bound to the protein G beads, followed by RNA binding to the antibody-beads. The antibody-RNA mixture was then bound to protein G magnetic beads (New England Biolabs), mixed gently, and incubated at room temperature for 1 hour at 9 rpm on a HulaMixer Sample Mixer (Thermo Fisher Scientific). Unbound RNA was washed away using Tween-TBS buffer and poly-dT ssDNA barcodes (Integrated DNA Technologies) were hybridized to the antibody-RNA mixture: beads were magnetically separated, washed twice with Tween-TBS, and subsequently resuspended with 200 μL of Tween-TBS containing 0.11 ng of ssDNA reporter template, heat-denatured in a standard thermal cycler (Thermo Fisher Scientific) for 2 minutes at 80°C. Following an 8-minute incubation at room temperature, unbound ssDNA barcodes were washed away using Tween-TBS buffer: beads were washed twice and resuspended with 20 μL of 10 mM Tris-HCl (Thermo Fisher Scientific). Remaining RNA was eluted from the protein G beads using a heated elution step performed at 80°C for 2 minutes. Beads were magnetically separated and supernatants were collected and reserved for qPCR testing. Real-Time PCR and Data Analysis 40 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 SYBR Green based qPCR (Applied Biosystems) was used to quantify the amount of m6A modifications in the RNA with primers corresponding to the ssDNA barcode. qPCR master mix for each sample consisted of 5 μL PowerTrack SYBR Green Master Mix (Applied Biosystems), 0.25 μL forward primer (4000 nM), 0.25 μL reverse primer (4000 nM), and 0.25 μL Yellow Sample Buffer (Applied Biosystems) per sample. Master mix (5.75 μL) was plated in a Hard-Shell 384-Well PCR Plate (BioRad). 4.25 μL of each sample eluate and nuclease-free water (Integrated DNA Technologies) for blanks were added to each well and mixed. qPCR was conducted on a BioRad CFX96 Touch Real-Time System (BioRad) following the PowerTrack SYBR Green Master Mix protocol. A standard curve was generated by plotting Ct values against known concentrations of m6A. A logarithmic line of best fit was generated and used to quantify m6A in unknown samples given their Ct value (Figure 2). This experiment was successfully performed at the nanogram to femtogram scale, exhibiting high sensitivity to low quantities of m6A+ RNA. The observed limit of detection was 33 fg of m6A+ RNA, although lower quantities were not tested. A strong relationship between Ct and m6A quantity was observed, with r2= 0.992 for the logarithmic line of best fit. No-m6A and no-RNA controls for this experiment had a ΔCt 1.04 and 2.77 respectively, measured from the lowest tested level of m6A+ RNA. In addition, the 80nt sequences were designed to mimic native mRNA, e.g., RNA isolated from cells. Secondary structures are present in the oligonucleotides, and the length is closer to RNA molecules that may be present in cellular extracts. Additional details are provided below. Materials and Methods Tween-TBS Buffer Tween-TBS buffer was made in a 50 mL centrifuge tube.4 mL of 10x TBS pH 8.0 and 20 uL 100% Tween-20 were added to the tube. The tube was filled to the 40 mL line with nuclease-free water (NFW). The solution was mixed by vortexing until the buffer was homogeneous. Protein G Bead Preparation Protein G magnetic beads were vortexed and equilibrated to room temperature.25 uL of protein G beads was added to a 1.5 mL tube for each sample.200 uL of Tween-TBS was added to each tube containing the beads, then mixed. Tubes were then placed on magnets for 1 minute to pellet the protein G beads. The supernatant was carefully removed and discarded. The tubes were removed from the magnet, and the 41 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 beads were resuspended in 200uL of Tween-TBS buffer. The tubes were placed back on the magnet to pellet the beads, and the supernatant was removed and discarded a second time. The beads were then resuspended in 250 uL Tween-TBS buffer. Antibody Binding 9.5 uL of RNA sample was added to 0.2 mL PCR tubes.0.5 uL of anti-N6-methyladenosine antibody, diluted to 1 mg / mL, was added to the RNA sample. The solution was mixed gently 10 times and incubated at room temperature for 45 minutes, mixed occasionally Binding to Protein G Beads and Subsequent Wash The RNA / antibody mixture was transferred to the 1.5 mL tubes containing washed protein G beads and mixed gently until homogeneous. The mixture was incubated for 1 hour at room temperature as the tubes were rotated. The tubes were placed on a magnet to pellet the protein G beads. The supernatant was removed and discarded. The tubes were then removed from the magnet, and the bead / RNA / antibody mixture was resuspended in 200uL Tween-TBS buffer. The tubes were then placed back on the magnet and the beads were pelleted again. The supernatant was again removed and discarded. The beads were again resuspended in 200uL Tween-TBS buffer and placed back on the magnet. A final resuspension buffer containing 0.11ng total of ssDNA barcode diluted in Tween-TBS was prepared by first aliquoting a small amount of ssDNA stock into a 0.2 mL PCR tube and incubating at 75℃ for 2 minutes to disturb any secondary structures. Second, Tween-TBS buffer was aliquoted so that each sample has 200 uL of 0.11 ng ssDNA diluted in Tween-TBS. The volume of buffer was dependent on the concentration of the ssDNA stock solution. The ssDNA was removed from the thermocycler immediately at two minutes and an appropriate volume was added to the aliquoted Tween-TBS buffer. The supernatant in the 1.5 mL tubes containing the bead / RNA / antibody mixture was removed and discarded.200uL of the buffer, containing 0.11ng total ssDNA barcode in Tween-TBS, was added to each sample and mixed. The samples were incubated for 8 minutes at room temperature and were mixed again at 4 minutes. Tubes were placed on a magnet to pellet the beads, and the supernatant was removed and discarded. Tubes were removed from the magnet and the bead pellets were resuspended with 200uL Tween-TBS. After washing, the tubes were placed on a magnet to pellet the beads again and the supernatant was removed and discarded. Each sample was resuspended in 20 uL of 10 mM Tris-HCL.10 mM Tris-HCL was added quickly so that the beads did not dry excessively. If necessary, Tris-HCL was added to each sample and mixed a few times so that each bead pellet was immersed in liquid, and then 42 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 pellets were fully resuspended. The samples were incubated at 80℃ for 2 minutes and then immediately placed on a magnet to pellet the beads. The supernatant was transferred to a new PCR tube. qPCR Assay A qPCR master mix was made according to Table E1. Volumes are listed for a 1X mixture; amounts were scaled up for n samples + 4 blank controls + extra volume. Table E1. qPCR master mix Reagent Volume . p p q a 384-well PCR plate.4.25 uL of nuclease free water was added to each blank in the plate (2 at beginning of samples and 2 at ends of samples) and mixed thoroughly.4.25 uL of each sample’s eluted volume was added to each well containing master mix (except the blanks) and mixed thoroughly. The plate was sealed and run according to the manufacturer-issued qPCR protocol. Cq values were obtained from each sample and compared to standard Cq values for a given global amount of m6A modified RNA. Results Figure 2 shows the m6A quantification curve based on 3 samples with a predetermined quantity of m6A standard. Cq decreases as m6A quantity of the sample increases, according to a logarithmic function (R2= 0.992). Example 2: Antibody-Bead Binding using Protein G and Protein A A custom Micro BCA protocol, using the Pierce Micro BCA Protein Assay Kit (Thermo Fisher Scientific), was developed to investigate the binding of protein G and protein A magnetic beads to anti- N6-methyladenosine antibody (rabbit, polyclonal; Active Motif) (Figure 3A). Protein G and A beads from various vendors were tested. Protein G beads were acquired from New England Biolabs and Invitrogen 43 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 (Thermo Fisher Scientific). Protein A beads were acquired from Invitrogen (Thermo Fisher Scientific) and Pierce (Thermo Fisher Scientific). For each test, 25 μL of beads were equilibrated to room temperature and washed twice with 200 μL Tween-TBS buffer, then resuspended in 250 μL Tween-TBS. Anti-N6-methyladenosine antibody (0.5 μL at 1 mg / mL) was added, mixed gently, and incubated at room temperature for 1 hour with rotation at 9 rpm. Post-incubation, beads were separated magnetically, washed once with Tween-TBS, and antibody was eluted using 20 μL of Pierce IgG Elution buffer (pH 2.8) (Thermo Fisher Scientific) for 5 minutes at 4°C. Eluates were neutralized immediately with 2 μL of 1M Tris-HCl (Thermo Fisher Scientific). This elution was performed twice, then the eluates were combined and diluted with 33 μL nuclease-free water for a final volume of 77 μL. An 8-point standard curve was created by diluting a 2 mg / mL Albumin standard to 200 μg / mL, followed by a 1:2 serial dilution using a 40:4:33 buffer mix of IgG Elution Buffer, 1M Tris- HCl, and NFW respectively. BCA working reagent was prepared by mixing reagents MA, MB, and MC in a 25:24:1 ratio as specified by the kit protocol. Each sample or standard (77 μL) was mixed with 77 μL BCA working reagent and incubated at 60°C for 60 minutes. Absorbance was measured using a Nanodrop-1000 on BCA Protein Assay mode with a 2 μL sample volume. A standard curve was generated to relate absorbance to albumin concentration. An absorbance ratio of 1.12 of IgG:Albumin absorbance was used to correct for quantification of antibody instead of BSA. Data analysis was performed to calculate total mass of antibody eluted off beads. Binding efficiency was calculated, defined here as total mass bound then eluted from antibodies to the total mass of antibody added to the original solution. Antibody Binding to Protein G / A Beads A Micro BCA kit was used for protein quantification (Table 1). In addition, one overnight binding condition was conducted. No significant advantage to overnight versus 1 hour of incubation was found. Table 1. Binding of antibodies to various brands of protein G and A beads Sample Total protein Protein G / A IgG eluted (ug) Binding efficiency 44 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Pierce A beads, 1 hr 0.949 0.828 0.108 0.22 0.5 ug Ab in 77uL buffer 0.529 - 0.529 N / A assay and support that the different beads are suitable for use in the methods described herein. Example 3: Covalent Conjugation of Antibodies to Beads In this example, a protocol was developed for the irreversible conjugation of antibodies to magnetic carboxylated beads. Carboxylated magnetic beads (Agilent Technologies) were conjugated to anti-N6-methyladenosine antibody using EDC / sulfo-NHS chemistry to create an ester bond between the bead surface and primary amine residues on the antibodies (Figure 3B). All buffers were prepared ice cold prior to use.5.6 ∗ 108beads (2.7 μm) were washed sequentially with 400 μL PBS containing 0.5% Tween-20, 0.1 M NaOH, and nuclease-free water before activation. Surface activation was carried out in 400 μL 50 mM MES buffer (pH 5) containing 0.12 mg EDC (Thermo Fisher Scientific) and 0.8 mg sulfo- NHS (Thermo Fisher Scientific), incubated for 30 minutes at 4°C with rotation. Beads were immediately washed and incubated with 80 μg antibody diluted in 400 μL of 25 mM MES buffer (pH 6) for 2 hours at 4°C. The supernatant was saved and quantified using Qubit to measure conjugation efficiency. Beads were washed three times with PBS containing 0.5% Tween-20 and then blocked in PBS with 1% BSA for 45 minutes at room temperature. Final conjugated beads were stored in 400 μL TBS containing 0.05% Tween-20 at 4°C. This method achieved 91% efficiency when binding 80 μg antibody to 5.6 ∗ 108beads. For the full assay, the conjugated beads are then incubated with RNA samples, and the remaining steps as described herein, e.g., in Example 2 or as shown in Figure 3C, are performed. Example 4. qPCR-based quantification of the m6A RNA modification using dsDNA This Example describes quantitative PCR-based quantification of the m6A RNA modification in an RNA sample using dsDNA with a single stranded overhang to bind to the RNA. As an overview, the anti-m6a antibody was covalently bound to a bead as described in Example 3. RNA containing m6A modifications was then bound to antibody-beads; unbound RNA was removed; poly-dT dsDNA barcodes were hybridized to RNAs bound to beads; unbound barcode was washed away; dsDNA barcodes were eluted from beads. Lastly, qPCR was performed to quantify m6A. A detailed protocol and sequences are provided below. 45 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 80 nt RNA oligonucleotides with one poly-A tail were used. One version lacks m6A modifications (“Control RNA”), while the other contains a single internal m6A modification (“m6A+ RNA”): 80nt RNA with internal m6A modification (“m6A+ RNA”) (5’-3’): AUG GAC CUG GAG AAC UUC UAC ACU C / iN6-Me-rA / U GAG GCG GGA CCC UGA ACG CUG AAG UGC AGC ACA UGG AAA AAA AAA AAA AAA AA (SEQ ID NO: 6) 80nt RNA without internal m6A modification (“Control RNA”) (5’-3’): AUG GAC CUG GAG AAC UUC UAC ACU CAU GAG GCG GGA CCC UGA ACG CUG AAG UGC AGC ACA UGG AAA AAA AAA AAA AAA AA (SEQ ID NO: 7) A dsDNA duplex with a 3’ poly-dT overhang was used to anneal to the poly-A tail on the 80 nt RNA oligos. The double-stranded component is 72 bp and the ssDNA overhang is 18 nt. The PCR amplicon is 72 bp in size. The individual strand sequences (SEQ ID NOs 8 and 9) were specified in ordering, and the two were annealed as part of the manufacturing process. Sequence 1 (with poly-dT overhang, 5’-3’): TCC AAG TAA AGG AGC ACC AC CAT CGC GTC TGG CTA AGG TTG TCA TAT GGT CCT TGC TTG TGG TCT GTA GGT CTTT TTT TTT TTT TTT TTT (SEQ ID NO: 8) Sequence 2 (shorter, without overhang, 5’-3’): GAC CTA CAG ACC ACA AGC AAG GAC CAT ATG ACA ACC TTA GCC AGA CGC GAT GGT GGT GCT CCT TTA CTT GGA (SEQ ID NO: 9) qPCR primers for ssDNA template amplification in qPCR (5’-3’): Forward: TCC AAG TAA AGG AGC ACC AC (SEQ ID NO: 4) Reverse: GAC CTA CAG ACC ACA AGC AA (SEQ ID NO: 5) Tween-TBS Buffer Preparation In a 50 mL centrifuge tube, 4 mL of 10x TBS pH 8.0 w / 0.5% Tween-20 are added. The tube was filled to 40 mL line with NFW. The tube was inverted or briefly vortexed until buffer was homogenous. 46 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 Antibody-bead conjugation An anti-m6A antibody obtained from Abcam was covalently conjugated to either Agilent Lodestars Carboxyl beads or Dynabeads M270 carboxylic acid beads. In addition, an anti-m6A antibody obtained from ABClonal was covalently conjugated to Dynabeads M270 carboxylic acid beads. Bead Plate Preparation In a twin-tec PCR plate, 126 uL of Tween-TBS was added to each sample well. Antibody-bead stock was briefly inverted to collect condensate on tube top, vortexed briefly, then spun down briefly to collect all liquid. Antibody-beads were pipette mixed with a large volume ~10 times to ensure homogeneity.4 uL of beads was added to each sample well. All wells were mixed with a multichannel pipette, then covered with parafilm and refrigerated at 4℃ while preparing RNA RNA Sample Preparation m6A+ and control RNA were thawed.0%, 20%, 40%, 60%, and 80% m6A samples were prepared as well as a no RNA control sample. Samples were incubated at 70℃ for 2 min, then reduced to 4℃. Once samples reached 4℃, samples were immediately placed on an ice block, then mixed by pipette. 20 uL of sample was transferred to the corresponding buffer-bead mix in the twin-tec PCR plate and mixed. The plate was sealed and incubated for 2 hours at 4℃ with rotation on a Hula Mixer. dsDNA Incubation and Wash Steps The PCR plate was spun down briefly in a plate centrifuge to collect liquid, the plate placed on a strip magnet, and the supernatant was removed and discarded. The dsDNA dilution was prepared in a 5 mL tube with 2960 uL Tween-TBS and 40uL of 1 ng / uL dsDNA stock.150uL of the dsDNA dilution was transferred to the samples and mixed. The samples were incubated for 8 minutes at room temperature, with additional mixing at 4 minutes. The plate was placed on a magnet and the supernatant removed. The samples were then washed with 150 uL Tween-TBS twice. Supernatant was removed from the samples, and 20 uL of 10 mM Tris-HCl to each sample well and mixed thoroughly to resuspend the beads. The plate was incubated at 95℃ for 2 min, then placed on a magnet. The supernatants were transferred to separate wells on the PCR plate. 47 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 qPCR plate preparation qPCR Master Mix was prepared according to PowerTrack SYBR Green Master Mix manufacturer instructions.9 uL of the master mix was added to 1uL of sample and mixed. qPCR was run, and Ct data was collected and plotted. Results Both the Abcam m6A antibody and the ABClonal m6A antibody, when conjugated to Dynabeads M270 carboxylic acid beads, were able to detect RNA containing m6A (Figure 4 and Figure 5). The ABClonal m6A antibody, when conjugated to Agilent Lodestars Carboxyl beads, was also able to detect RNA containing m6A (Figure 6). This experiment indicated that two different m6A antibodies and two different types of magnetic beads performed well in the method, and supports that the different antibodies and beads are suitable for use in the methods described herein. Example 5. RNA isolated from cells RNA, e.g., mRNA, isolated from cells may have properties which would impede RNA-antibody binding, including increased steric hindrance due to the length of the mRNA, the presence of multiple m6A modifications on one transcript, and the range of m6A-containing:non-m6A transcript ratios. As described in Example 2, the 80nt sequences were designed to mimic native mRNA, e.g., by including secondary structures are present in these oligonucleotides, and the length is closer to mRNA which may be present in cellular extracts. In addition, RNA isolated from cells may be fragmented prior to input into the assay, and ssDNA or dsDNA with an ssDNA overhang reporter templates have random hexamer tails in order to anneal to the RNA. The assay is then performed as described herein, e.g., in Example 2 or Example 4. OTHER EMBODIMENTS Specific compositions and methods for the detection of RNA modifications have been described. The scope of the invention should be defined by the claims. The detailed description in this specification is illustrative and not restrictive or exhaustive. This invention is not limited to the particular methodology, protocols, and reagents described in this specification and can vary in practice. When the specification or claims recite ordered steps or functions, alternative embodiments might perform their functions in a different order or substantially concurrently. Other equivalents and modifications besides those already described are possible without departing from the concepts described in this specification, as persons having ordinary skill in the biomedical art recognize. 48 1601330890.1 Attorney Docket No.: Tech ID 3380J 0312021.00255 All patents and publications cited throughout this specification are incorporated by reference to disclose and describe the materials and methods used with the technologies described in this specification. The patents and publications are provided solely for their disclosure before the filing date of this specification. All statements about the patents and publications' disclosures and publication dates are from the Applicant’s information and belief. The Applicant makes no admission about the correctness of the contents or dates of these documents. Should there be a discrepancy between a date provided in this specification and the actual publication date, then the actual publication date shall control. Should there be a discrepancy between the scientific or technical teaching of a previous patent or publication and this specification, then the teaching of this specification and these claims shall control. The foregoing written specification is considered sufficient to enable one skilled in the biomedical art to practice the present aspects and embodiments. The present aspects and embodiments are not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect and other functionally equivalent embodiments are within the scope of the disclosure. Various modifications besides those shown and described herein will become apparent to those skilled in the biomedical art from the foregoing description and fall within the scope of the appended claims. The advantages and objects described herein are not necessarily encompassed by each embodiment. Those skilled in the biomedical art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by these claims. 49 1601330890.1

Claims

Attorney Docket No.: Tech ID 3380J 0312021.00255 CLAIMS What is claimed is:

1. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds a chemically modified nucleotide in the RNA, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the substrate from the RNA-antibody- substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA-antibody- substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- antibody-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample.

2. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) providing an antibody-substrate mixture comprising a solid substrate bound to an antibody that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the antibody-substrate mixture, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the substrate from the RNA-antibody- substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA-antibody- substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- antibody-substrate-DNA mixture; 50 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample.

3. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds the chemically modified nucleotide, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the solid substrate from the RNA- antibody-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- antibody-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-antibody-substrate mixture associated with the antibody, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

4. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) providing an antibody-substrate mixture comprising a solid substrate bound to an antibody that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the antibody-substrate mixture, thereby producing an RNA-antibody-substrate mixture; c) optionally, removing RNA not associated with the solid substrate from the RNA- antibody-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-antibody-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-antibody-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- antibody-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and 51 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 g) determining the quantity of RNA in the RNA-antibody-substrate mixture associated with the antibody, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

5. The method of claim 3 or 4, wherein step g) comprises co-relating the quantity of the DNA molecule detected in step f) to the quantity of the RNA comprising the chemically modified nucleotide.

6. The method of any of claims 1-5, wherein each DNA molecule in the plurality comprises a barcode sequence.

7. The method of any of claims 1-6, wherein the nucleic acid amplification technique is polymerase chain reaction (PCR).

8. The method of any of the preceding claims, which further comprises removing RNA not associated with the solid substrate from the RNA-antibody mixture.

9. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: (i) providing an RNA-antibody-substrate-DNA mixture wherein the RNA-antibody-substrate- DNA mixture comprises: the RNA, an antibody that binds the chemically modified nucleotide, a solid substrate that binds the antibody, and a plurality of DNA molecules , wherein each DNA molecule in the plurality comprises a barcode sequence; (ii) removing DNA not associated with the solid substrate from the RNA-antibody-substrate- DNA mixture, thereby producing a washed mixture, and (iii) determining the amount of the DNA molecule via a nucleic acid amplification technique; and wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

10. The method of any of claims 1-9, which further comprises removing DNA molecules not associated with the solid substrate from the RNA-antibody-substrate-DNA mixture.

11. The method of any of claims 7-10, which further comprises eluting the RNA and bound DNA molecules from the antibody prior to performing PCR on the mixture. 52 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 12. The method of any of claims 7-11, wherein the PCR is quantitative PCR.

13. The method of claim 12, wherein the quantitative PCR comprises detecting a fluorescent emission from a double-strand specific dye (e.g., N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2- ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine).

14. The method of claim 12 or 13, wherein the quantitative PCR primer is complementary to the DNA molecule barcode sequence.

15. The method of any of claims 1-14, wherein each DNA molecule in the plurality is a single- stranded DNA (ssDNA) molecule.

16. The method of any of claims 1-14, wherein each DNA molecule in the plurality comprises a double-stranded region and a single-stranded overhang region.

17. The method of claim 16, wherein the single-stranded overhang region binds to RNA.

18. The method of any of claims 1-17, wherein the method quantifies the amount of RNA associated with the antibody.

19. The method of claim 18, wherein the amount of RNA associated with the antibody is quantified relative to the level of a reference RNA.

20. The method of claim 18, wherein the amount of RNA associated with the antibody is quantified absolutely.

21. The method of claim 18, further comprising measuring fluorescence quantitatively.

22. An RNA-antibody-substrate-DNA mixture comprising: RNA; an antibody that binds a chemically modified nucleotide; a solid substrate that binds the antibody; and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence. 53 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 23. A kit comprising: an antibody that binds a chemically modified nucleotide; a solid substrate that binds the antibody (e.g., a bead, e.g., directly or indirectly, e.g., wherein the substrate binds a ligand and the ligand binds the antibody); a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; optionally, a nucleic acid probe for detecting PCR amplification; and optionally, primers for amplification of the barcode sequence.

24. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with an antibody that binds the chemically modified nucleotide, thereby producing an RNA-antibody mixture; b) contacting the RNA-antibody mixture with a solid substrate that binds the antibody, thereby producing an RNA-antibody-substrate mixture; and c) detecting if RNA in the RNA-antibody-substrate mixture was associated with the antibody, wherein association of RNA with the antibody is indicative of the RNA comprising the chemically modified nucleotide.

25. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding claims, wherein the chemically modified nucleotide comprises a chemically modified adenine.

26. The method, RNA-antibody-substrate-DNA mixture, or kit of claim 25, wherein the chemically modified nucleotide comprises a m6A or m1A modification.

27. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 1-24, wherein the chemically modified nucleotide comprises chemically modified cytosine.

28. The method, RNA-antibody-substrate-DNA mixture, or kit of claim 27, wherein the chemically modified nucleotide comprises a hm5C or m5C modification.

29. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 1-24, wherein the chemically modified nucleotide comprises chemically modified uracil. 54 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 30. The method or RNA-antibody-bead-DNA mixture of claim 29, wherein the chemically modified nucleotide comprises a Ψ modification.

31. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding claims, wherein the antibody binds a m6A, m6Am, m1A, hm5C, m5C, Ψ, or inosine chemically modified nucleotide.

32. The method, RNA-antibody substrate-DNA mixture, or kit of any of the preceding claims, wherein the solid substrate is a bead.

33. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding claims, wherein the solid substrate is a magnetic bead.

34. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding claims, wherein the surface of the solid substrate binds a ligand that binds the antibody.

35. The method, RNA-antibody-substrate-DNA mixture, or kit of any of the preceding claims, wherein the solid substrate comprises free carboxyl groups.

36. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 1-33, wherein the antibody is covalently bound to the solid substrate.

37. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 1-36, wherein each DNA molecule in the plurality of DNA molecules comprises a random hexamer sequence.

38. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 1-36, wherein each DNA molecule in the plurality of DNA molecules comprises an oligo(dT) sequence.

39. The method, RNA-antibody-substrate-DNA mixture, or kit of any of claims 6-38, wherein the barcode sequence is 70-90 nucleotides in length.

40. A method of amplifying a nucleic acid, the method comprising: providing a nucleic acid template; 55 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 contacting the nucleic acid template with a DNA molecule, wherein the DNA molecule comprises a double stranded region and a single stranded overhang that is complementary to the nucleic acid template; and contacting the nucleic acid template and the DNA molecule with a primer, wherein the primer is complementary to the double stranded region of the DNA molecule, and a polymerase, under conditions that allow the polymerase to extend the primer along the double stranded region.

41. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) contacting a sample comprising the RNA with a polypeptide that binds a chemically modified nucleotide in the RNA, thereby producing an RNA-polypeptide mixture; b) contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA- polypeptide-substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- polypeptide-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample.

42. A method of producing an amount of DNA proportional to an amount of chemically modified RNA in a sample, the method comprising: a) providing a polypeptide-substrate mixture comprising a solid substrate bound to a polypeptide that binds a chemically modified nucleotide in RNA; b) contacting a sample comprising the RNA with the polypeptide-substrate mixture, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; 56 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the substrate from the RNA- polypeptide-substrate-DNA mixture; and f) performing nucleic acid amplification technique on the DNA molecules in the RNA- polypeptide-substrate-DNA mixture; thereby producing an amount of DNA proportional to the amount of chemically modified RNA in the sample.

43. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) contacting a sample comprising the RNA with a polypeptide that binds the chemically modified nucleotide, thereby producing an RNA-polypeptide mixture; b) contacting the RNA-polypeptide mixture with a solid substrate that binds the polypeptide, thereby producing an RNA-polypeptide-substrate mixture; c) optionally removing RNA not associated with the solid substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- polypeptide-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-polypeptide-substrate mixture associated with the polypeptide, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

44. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: a) providing a polypeptide-substrate mixture comprising a solid substrate bound to a polypeptide that binds a chemically modified nucleotide in RNA; 57 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 b) contacting a sample comprising the RNA with the polypeptide-substrate mixture, thereby producing an RNA-polypeptide-substrate mixture; c) optionally, removing RNA not associated with the solid substrate from the RNA- polypeptide-substrate mixture, thereby producing a washed mixture; d) contacting the RNA-polypeptide-substrate mixture or the washed mixture with a plurality of DNA molecules that bind the RNA, thereby producing an RNA-polypeptide-substrate-DNA mixture; e) removing DNA molecules not associated with the solid substrate from the RNA- polypeptide-substrate-DNA mixture; f) determining the quantity of the DNA molecule via a nucleic acid amplification technique; and g) determining the quantity of RNA in the RNA-polypeptide-substrate mixture associated with the polypeptide, wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

45. A method of detecting a chemically modified nucleotide in an RNA, the method comprising: (i) providing an RNA-polypeptide-substrate-DNA mixture wherein the RNA-polypeptide- substrate-DNA mixture comprises: the RNA, a polypeptide that binds the chemically modified nucleotide, a solid substrate that binds the polypeptide, and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; (ii) removing DNA not associated with the solid substrate from the RNA-polypeptide-substrate- DNA mixture, thereby producing a washed mixture, and (iii) determining the amount of the DNA molecule via a nucleic acid amplification technique; and wherein the quantity of the DNA molecule is indicative of the quantity of RNA comprising the chemically modified nucleotide.

46. An RNA-polypeptide-substrate-DNA mixture comprising: RNA; a polypeptide that binds a chemically modified nucleotide; a solid substrate that binds the polypeptide; and a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence. 58 1601330890.1Attorney Docket No.: Tech ID 3380J 0312021.00255 47. A kit comprising: a polypeptide that binds a chemically modified nucleotide; a solid substrate that binds the polypeptide (e.g., a bead, e.g., directly or indirectly, e.g., wherein the substrate binds a ligand and the ligand binds the polypeptide); a plurality of DNA molecules, wherein each DNA molecule in the plurality comprises a barcode sequence; optionally, a nucleic acid probe for detecting PCR amplification; and optionally, primers for amplification of the barcode sequence. 59 1601330890.1

Images