Use of SDX in preparation of diagnostic product and therapeutic drug for testis premature senility or oligoasthenospermia

By detecting the SDX gene sequence or protein expression level and using AAV vector therapy, the diagnostic and treatment challenges of premature testicular failure or oligoasthenospermia have been solved, restoring seminiferous tubule function and improving fertility.

WO2026060769A1PCT designated stage Publication Date: 2026-03-26WUHAN UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/125972
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-11
Filing Date
2024-10-21
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Male fertility declines with age, and premature testicular failure or oligospermia or asthenospermia can lead to infertility, which is difficult to diagnose accurately and treat effectively with current technology.

Method used

By detecting the SDX gene sequence or SDX protein expression level, gene therapy can be performed using adeno-associated virus vector (AAV), or SDX protein can be directly supplemented or mRNA can be used to increase SDX protein expression, thus preparing test kits and therapeutic drugs for premature testicular failure or oligoasthenospermia.

Benefits of technology

It enables accurate diagnosis and effective treatment of premature testicular failure or oligospermia and asthenospermia, restores seminiferous tubule function, improves fertility, and provides a new treatment method for preserving fertility in middle-aged and elderly men.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024125972_26032026_PF_FP_ABST
    Figure CN2024125972_26032026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a use of SDX in the preparation of a diagnostic product and therapeutic drug for testis premature senility or oligoasthenospermia. It has been found that the occurrence of testis premature senility or oligoasthenospermia is associated with an SDX gene abnormality or an abnormality in the expression level of a protein encoded by an SDX gene. Therefore, testis premature senility or oligoasthenospermia can be clearly diagnosed by detecting an SDX gene sequence or the expression level of the SDX protein. In addition, it has been found that a mutant pathogenic gene associated with testis premature senility or oligoasthenospermia contains seven mutation sites, and on the basis of the seven mutation sites above, a corresponding AAV vector is constructed for therapy, and the effectiveness of a gene therapy drug targeting a specific genetic mutation has been confirmed.
Need to check novelty before this filing date? Find Prior Art

Description

Application of SDX in preparation of diagnostic products and therapeutic drugs for testicular premature aging or oligoasthenospermia TECHNICAL FIELD

[0001] The present application relates to the field of biomedical detection technology, in particular to the application of SDX in preparation of diagnostic products and therapeutic drugs for testicular premature aging or oligoasthenospermia. BACKGROUND

[0002] In modern society, the trend of late marriage and late childbirth is obvious, and the problem of male reproductive ability decreasing with age is increasingly valued. The core of male fertility is the healthy sperm production process. Premature aging of the testis seriously affects sperm production and function, especially in middle-aged and elderly men, which is manifested as sperm production disorders, sperm abnormalities and Sertoli cell dysfunction, and ultimately may lead to infertility. Studies have shown that with age, the level of testosterone in men and the quality of semen generally decrease, increasing the concern for the reproductive health of middle-aged and elderly men.

[0003] Therefore, it is necessary to develop a detection reagent and therapeutic drug related to testicular premature aging or oligoasthenospermia.

[0004] SUMMARY

[0005] The purpose of the present application is to provide the application of SDX in preparation of diagnostic kits for testicular premature aging or oligoasthenospermia. The present application found that the occurrence of testicular premature aging or oligoasthenospermia is related to abnormal SDX gene or abnormal expression level of SDX gene encoded protein. By detecting the sequence of SDX gene or the expression level of SDX protein, testicular premature aging or oligoasthenospermia can be diagnosed, which has important significance in improving male infertility. At the same time, the treatment of male infertility caused by abnormal SDX gene or / and protein SDX by using adeno-associated virus vector (AAV), and the application of AAV virus vector, or directly supplementing SDX protein, or using mRNA and other drugs to improve the expression of SDX protein in the treatment of testicular premature aging and oligoasthenospermia have important significance in improving testicular premature aging and oligoasthenospermia.

[0006] The present application adopts the following technical solutions:

[0007] In the first aspect of the present application, the application of SDX in preparation of diagnostic kits for testicular premature aging or oligoasthenospermia is provided, which includes detecting abnormal SDX gene and / or abnormal expression level of SDX protein.

[0008] Further, the abnormal SDX gene includes at least one of the following abnormalities: mutation of the promoter or enhancer sequence of the gene, single or multiple base sequence deletion, insertion or substitution in the coding sequence of the gene.

[0009] Further, the abnormal SDX protein expression level includes at least one of the following abnormalities: reduced SDX protein expression, premature termination of SDX protein expression, or deletion of SDX protein expression, deletion, insertion or substitution of amino acids in the important functional domain of SDX protein.

[0010] Further, the test kit for testicular premature aging or oligoasthenospermia includes an SDX gene test kit and / or an SDX protein expression level test kit.

[0011] Further, the SDX gene test kit includes a whole genome sequencing test kit.

[0012] Further, the SDX protein expression level test kit includes an antibody that specifically binds to the SDX protein.

[0013] In the second aspect of the present application, an antibody that specifically binds to the SDX protein is provided for use in the preparation of a test kit for testicular premature aging or oligoasthenospermia.

[0014] In the third aspect of the present application, a mutant pathogenic gene related to testicular premature aging or oligoasthenospermia is provided, wherein the mutant pathogenic gene has the following 7 mutation sites: S219P(T655C), E257K(G769A), R549W(C1645T), R549Q(G1646A), P594H(C1781A), C647F(G1940T), Q622E(C1864G) compared with the nucleotide sequence of the SDX gene as shown in SEQ ID NO: 1.

[0015] In the fourth aspect of the present application, a reagent for detecting the mutant pathogenic gene related to testicular premature aging or oligoasthenospermia is provided for use in the preparation of a diagnostic product for testicular premature aging or oligoasthenospermia.

[0016] In the fifth aspect of the present application, an SDX overexpression vector is provided for use in the preparation of a medicament for treating testicular premature aging or oligoasthenospermia.

[0017] Further, the SDX overexpression vector includes an adeno-associated virus vector.

[0018] A substance that promotes the expression of SDX is provided for use in the preparation of a medicament for treating testicular premature aging or oligoasthenospermia. Specifically, but not limited to: according to the sequence of the SDX gene, design and synthesize mRNA containing the correct coding sequence, and inject the packaged mRNA into the testis of a mouse to promote the expression of SDX.

[0019] In the sixth aspect of the present application, a method for constructing an SDX gene-related point mutation mouse model is provided, the method comprising:

[0020] Transcribe gRNA with nucleotide sequence as shown in SEQ ID NO. 6-SEQ ID NO. 7, SEQ ID NO. 11-SEQ ID NO. 12, SEQ ID NO. 13-SEQ ID NO. 14, SEQ ID NO. 15-SEQ ID NO. 16, SEQ ID NO. 17-SEQ ID NO. 18, SEQ ID NO. 19-SEQ ID NO. 20, SEQ ID NO. 21-SEQ ID NO. 22 into mRNA respectively in vitro to obtain transcribed sgRNA;

[0021] Obtain active Cas9 mRNA;

[0022] Obtain targeting donor with nucleotide sequence as shown in SEQ ID NO. 2-SEQ ID NO. 5 respectively;

[0023] Mix the transcribed sgRNA, Cas9 mRNA and targeting donor, then microinject into mouse zygote to obtain F0 generation mice;

[0024] Select F0 generation positive mice in F0 generation genotype identification results, mate them with wild type mice to obtain F1 generation mice with stable genotype, then screen, that is, obtain point mutation mouse model.

[0025] Further, in the technical solution, the transcribed sgRNA and the targeting donor are one-to-one corresponding. Specifically, it includes:

[0026] Scheme 1:

[0027] Transcribe gRNA with nucleotide sequence as shown in SEQ ID NO. 6-SEQ ID NO. 7 into mRNA respectively in vitro to obtain transcribed sgRNA;

[0028] Obtain active Cas9 mRNA;

[0029] Obtain targeting donor with nucleotide sequence as shown in SEQ ID NO. 2 respectively;

[0030] Mix the transcribed sgRNA, Cas9 mRNA and targeting donor, then microinject into mouse zygote to obtain F0 generation mice;

[0031] Select F0 generation positive mice in F0 generation genotype identification results, mate them with wild type mice to obtain F1 generation mice with stable genotype, then screen, that is, obtain S219P(T655C) point mutation mouse model.

[0032] Scheme 2:

[0033] The gRNAs with nucleotide sequences as shown in SEQ ID NO. 11-SEQ ID NO. 12 were respectively transcribed into mRNA in vitro to obtain the transcribed sgRNAs;

[0034] Active Cas9 mRNA was obtained;

[0035] The targeting donors with nucleotide sequences as shown in SEQ ID NO. 3 were respectively obtained;

[0036] The transcribed sgRNAs, Cas9 mRNA and targeting donors were mixed and then microinjected into mouse zygotes to obtain F0 generation mice;

[0037] The F0 generation positive mice in the genotype identification results of the F0 generation mice were selected and mated with wild type mice to obtain F1 generation mice with stable genotypes, and then screened, i.e. the E257K(G769A) point mutation mouse model was obtained.

[0038] Scheme 3:

[0039] The gRNAs with nucleotide sequences as shown in SEQ ID NO. 13-SEQ ID NO. 14 were respectively transcribed into mRNA in vitro to obtain the transcribed sgRNAs;

[0040] Active Cas9 mRNA was obtained;

[0041] The targeting donors with nucleotide sequences as shown in SEQ ID NO. 4 were respectively obtained;

[0042] The transcribed sgRNAs, Cas9 mRNA and targeting donors were mixed and then microinjected into mouse zygotes to obtain F0 generation mice;

[0043] The F0 generation positive mice in the genotype identification results of the F0 generation mice were selected and mated with wild type mice to obtain F1 generation mice with stable genotypes, and then screened, i.e. the R549W(C1645T) point mutation mouse model was obtained.

[0044] Scheme 4:

[0045] The gRNAs with nucleotide sequences as shown in SEQ ID NO. 15-SEQ ID NO. 16 were respectively transcribed into mRNA in vitro to obtain the transcribed sgRNAs;

[0046] Active Cas9 mRNA was obtained;

[0047] a targeting donor having a nucleotide sequence as shown in SEQ ID NO. 5 is obtained respectively;

[0048] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse zygotes to obtain F0 generation mice;

[0049] The F0 generation positive mice in the genotype identification results of the F0 generation mice are selected and mated with wild type mice to obtain F1 generation mice with stable genotypes, and after screening, a P594H (C1781A) point mutation mouse model is obtained.

[0050] Scheme 5:

[0051] The gRNAs having nucleotide sequences as shown in SEQ ID NO. 17-SEQ ID NO. 18 are respectively transcribed into mRNA in vitro to obtain transcribed sgRNA;

[0052] Active Cas9 mRNA is obtained;

[0053] a targeting donor having a nucleotide sequence as shown in SEQ ID NO. 6 is obtained respectively;

[0054] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse zygotes to obtain F0 generation mice;

[0055] The F0 generation positive mice in the genotype identification results of the F0 generation mice are selected and mated with wild type mice to obtain F1 generation mice with stable genotypes, and after screening, a P594H (C1781A) point mutation mouse model is obtained.

[0056] Scheme 6:

[0057] The gRNAs having nucleotide sequences as shown in SEQ ID NO. 19-SEQ ID NO. 20 are respectively transcribed into mRNA in vitro to obtain transcribed sgRNA;

[0058] Active Cas9 mRNA is obtained;

[0059] a targeting donor having a nucleotide sequence as shown in SEQ ID NO. 7 is obtained respectively;

[0060] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse zygotes to obtain F0 generation mice;

[0061] The F0 generation positive mouse in the genotype identification result of the F0 generation mouse is selected to mate with a wild type mouse, so that the F1 generation mouse with a stable genotype is obtained, and then screening is performed, that is, the Q622E (C1864G) point mutation mouse model is obtained.

[0062] Scheme 7:

[0063] The gRNA with the nucleotide sequence as shown in SEQ ID NO. 21-SEQ ID NO. 22 is respectively transcribed into mRNA in vitro to obtain the transcribed sgRNA;

[0064] Active Cas9 mRNA is obtained;

[0065] The targeting donor with the nucleotide sequence as shown in SEQ ID NO. 5 is obtained;

[0066] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into a mouse zygote to obtain an F0 generation mouse;

[0067] The F0 generation positive mouse in the genotype identification result of the F0 generation mouse is selected to mate with a wild type mouse, so that the F1 generation mouse with a stable genotype is obtained, and then screening is performed, that is, the Q622E (C1864G) point mutation mouse model is obtained.

[0068] The one or more technical solutions in the embodiments of the present application have at least the following technical effects or advantages:

[0069] The application provides an application of the SDX in preparation of a test kit for testicular premature aging or oligoasthenospermia, and finds that the occurrence of testicular premature aging or oligoasthenospermia is related to abnormal SDX genes or abnormal expression levels of SDX gene coding proteins. Therefore, the SDX gene sequence or the SDX protein expression level can be detected to diagnose testicular premature aging or oligoasthenospermia, which has important significance in improving male infertility. Compared with the prior art, the application can more accurately diagnose and effectively treat testicular premature aging and oligoasthenospermia through a unique molecular marker and gene therapy strategy. In particular, the animal model research of the application shows that the impaired seminiferous tubule function and the fertility rate can be significantly restored through AAV vector-mediated gene therapy. In addition, the application also provides a theoretical and technical scheme for clinical application, and provides a new treatment method for the preservation and recovery of male fertility of middle-aged and elderly men. BRIEF DESCRIPTION OF DRAWINGS

[0070] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the following embodiment description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort.

[0071] Figure 1 is a whole genome sequencing analysis of patient SDX point mutation sites and construction of SDX point mutation mouse models; Figure 1A is screened by patient database, and seven non-synonymous point mutation sites are obtained by whole genome sequencing analysis, and there is no other non-synonymous mutation in the genomes of these patients; Figure 1B shows that it is found that seven point mutations S219P(T655C), E257K(G769A), R549W(C1645T), R549Q(G1646A), P594H(C1781A), C647F(G1940T), and Q622E(C1864G) all cause small testis, abnormal spermatogenic tubules, incomplete spermatogenesis, and oligoasthenospermia in mice.

[0072] Figure 2 is a whole genome sequencing analysis of patient SDX point mutation sites and construction of SDX point mutation mouse models; Figure 1A is screened by patient database, and seven non-synonymous point mutation sites are obtained by whole genome sequencing analysis, and there is no other non-synonymous mutation in the genomes of these patients; Figure 1B shows that it is found that seven point mutations S219P(T655C), E257K(G769A), R549W(C1645T), R549Q(G1646A), P594H(C1781A), C647F(G1940T), and Q622E(C1864G) all cause small testis, abnormal spermatogenic tubules, incomplete spermatogenesis, and oligoasthenospermia in mice.

[0073] Figure 3 is a construction of SDX gene-deficient mouse models; Figure 3A is a small testis of SDX gene-deficient mouse, Figure 3B is a testicular tissue section showing abnormal spermatogenic tubules, and Figure 3C is a proportion of abnormal spermatogenic tubules of 50%.

[0074] Figure 4 is a result of an increase in β-galactosidase-positive cells in SDX gene-deficient mice related to aging, and up-regulation of aging secretion phenotype-related genes (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2); Figure 4A is an increase in β-galactosidase-positive cells in SDX gene knockout mice, Figure 4B is a part of the support cells of the gene-deficient mice showing β-galactosidase-positive (Figure 4B), and Figure 4C is a result of RNA extraction from mouse testis for transcriptome sequencing.

[0075] Figure 5 is the result of treating testicular premature aging mice by adeno-associated virus vector (AAV). Figure 5A is the difference in testicular morphology, Figure 5B is the result of testicular and epididymal tissue sections, Figure 5C is whether SDX is expressed after AAV infection of the testis of mice, and Figure 5D is the number of offspring of mice after AAV virus treatment.

[0076] Figure 6 is the treatment of testicular premature aging by increasing the expression of SDX protein in the testis by mRNA drugs. Figure 6A is the difference in the expression of SDX between the experimental group of mice (SDX-deficient mice injected with lipid nanoparticles containing SDX mRNA) and the control group (SDX-deficient mice injected with lipid nanoparticles not containing SDX mRNA); and Figure 6B is the comparison of the size of the testis of the experimental group of mice and the control group. DETAILED DESCRIPTION

[0077] The advantages and various effects of the present application will be more clearly presented from the specific embodiments and examples below. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, not to limit the present application.

[0078] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present application belongs. If there is a conflict, the present specification takes precedence.

[0079] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present application can be purchased on the market or obtained by existing methods.

[0080] The technical solution of the embodiments of the present application is to solve the above technical problems, and the general idea is as follows:

[0081] The present inventors found that abnormal SDX in mice can cause testicular premature aging or oligoasthenospermia through gender differentiation proteomics research on model animals C57 / 6J male mice in the process of genetic factors (gene mutation) leading to male sex development abnormalities (Disorders of Sex Development, DSD).

[0082] We found that the SDX protein sequence is highly conserved between mice and humans, and the protein localization pattern is completely consistent, so the function of SDX in humans should be consistent with that in mice by comparing the protein sequences of SDX gene in humans and mice.

[0083] Subsequently, we first found that the occurrence of testicular premature aging or oligoasthenospermia is related to abnormal SDX gene or abnormal expression level of SDX gene encoded protein through experiments.

[0084] Therefore, by detecting the sequence of the SDX gene or the expression level of the SDX protein, testicular premature failure or oligoasthenospermia can be determined, which is of great significance in improving male infertility.

[0085] The abnormality of the SDX gene can be detected by whole genome sequencing, and the expression level of the protein encoded by the SDX gene can be detected by an antibody specifically binding to the SDX protein. Therefore, a test kit for testicular premature failure or oligoasthenospermia can be prepared.

[0086] According to the sequencing results, it is found that the SDX point mutation patients include the following point mutation sites for diagnosing testicular premature failure and oligoasthenospermia: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), Q622E (C1864G).

[0087] The patient has at least one of the 7 mutations, such as the above-mentioned 7 mutations or one or several of the 7 mutations, and then an overexpression vector is prepared for treatment according to the mutation.

[0088] It should be noted that the human gene SDX (MUM1L1; PWWP3B) is located on chromosome Xq22.3, NC_000023.11 (106168278..106208961), contains 6 exons, and currently it is confirmed to have two transcripts (NM_001171020.2; NM_152423.5), but they all encode the same protein, showing a high expression profile in the reproductive system. The structure and function of the SDX gene and the SDX encoded protein still need to be further studied. The sequence of the human gene SDX, the effective coding sequence of the human SDX, and the protein sequence encoded by the human SDX gene are shown in the patent CN113604554B;

[0089] The application of the SDX in preparing a test kit for testicular premature failure or oligoasthenospermia will be described in detail below in combination with examples and experimental data.

[0090] Example 1, discovery of a mutation pathogenic gene related to testicular premature failure or oligoasthenospermia

[0091] 1. Obtain a biological sample

[0092] Male patients: no family history of degenerative diseases. Clinical phenotype: abnormal spermatogenesis and more serious with age, low sperm content in semen detection, and finally diagnosed as testicular premature failure or oligoasthenospermia.

[0093] 2. DNA extraction

[0094] Peripheral blood mononuclear cells were extracted, and DNA was extracted using a DNA isolation kit (Blood DNA Kit V2, #CW2553).

[0095] 3. Library construction and sequencing

[0096] Genomic DNA was randomly fragmented and trimmed to 180-280 bp fragments using a Covaris disruptor. Libraries were prepared using a Bioruptor UCD-200 (Diagenode), KAPA library preparation kit (Kapa Biosystems, #KR0453), and SureSelect XT2 Target Enrichment System (Agilent). DNA library sequencing was performed using the Illumina NovaSeq platform, and downstream analysis was performed using Illumina Sequence Control Software (SCS). Variants were retained only if the read depth was greater than or equal to 10. High-quality reads were aligned to the USCS human genome (build 37.1 version hg19) using the Burrows-Wheeler alignment tool.

[0097] Genome Analysis Toolkit (GATK) and ANNOVAR (version: 2016-05-1110:54:48-0700) were used for variant calling and annotation. All subjects were screened for C9ORF72 repeat expansions using standard repeat primer PCR. Variant frequencies were initially determined in gnomeAD and Exome Aggregation Consotium (ExAC) to remove common single nucleotide polymorphisms (SNPs). Only non-synonymous, splice, and frame shift variants with minor allele frequencies (MAF) <0.5% or absent in the population database were selected for further evaluation.

[0098] 4. Patient screening and gene mutation confirmation: In the infertile patient population, we successfully identified 7 point mutations related to the SDX gene (Figure 1A), and we obtained the mutation site of the oligoasthenospermia patient through whole gene sequencing. We found that there were non-synonymous mutations in the SDX coding protein region, and there were no non-synonymous mutations in other positions of the genome; these mutation sites were located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), respectively.

[0099] Example 2, Construction of a point mutation knock-in mouse model

[0100] In the infertile patient population in Example 1, we successfully identified 7 point mutations associated with SDX genes, respectively located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), Q622E (C1864G).

[0101] These mutations were analyzed by conservation analysis, and point mutation knock-in mouse models were constructed to confirm the corresponding positions in the mouse models, providing precise target points for subsequent gene therapy.

[0102] 1. Design gRNA as shown in Table 1.

[0103] Table 1

[0104] 2. Preparation of microinjection RNA of gRNA

[0105] First, the sequence of gRNA is connected to the PT7-4G plasmid vector with a T7 promoter, and then the plasmid is sequenced to verify the correctness, and then the T7 promoter and gRNA nucleotide sequence are amplified using universal amplification primers, and finally the PCR product is used as a template for in vitro transcription to obtain microinjection RNA of gRNA1 and gRNA2;

[0106] And the reaction condition is 65℃ for 5min, and the RNA electrophoresis map indicates that gRNA is successfully transcribed at the required concentration.

[0107] 3. Preparation of microinjection RNA of Donor;

[0108] Synthetic nucleotide sequences of the targeting donor (Donor) are shown in SEQ ID NO. 2-8, wherein SEQ ID NO. 2-8 represent the Donor sequence of S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), Q622E (C1864G), respectively.

[0109] 4. In vitro transcription of samples: Cas9 expression plasmid (Addgene No. 44758) is linearized by Age I enzyme digestion, purified by phenol-chloroform extraction, and dissolved in nuclease-free water as a template for in vitro transcription; according to the T7 Ultra Kit (Ambion, AM1345) kit, Cas 9 mRNA is synthesized in vitro using T7 RNA polymerase.

[0110] 5. Preparation of F0 generation mice;

[0111] Microinjection of Cas9 / sgRNA and donor: Transcribed Cas9 mRNA, sgRNA and purified donor fragment were mixed and the concentrations were adjusted to 20 ng / μl of Cas9 mRNA, 10 ng / μl of sgRNA (gRNA1:gRNA2 = 1:1) and 50 ng / μl of donor fragment. The mixture was microinjected into the pronucleus and cytoplasm of C57BL / 6 mouse zygotes using a TE2000U microinjector. The zygotes were then transferred to the uterus of pseudopregnant C57BL / 6 mice and the F0 generation mice were awaited to be born.

[0112] 6. Genotyping of F0 generation mice:

[0113] This invention uses the Cas9 / gRNA injection method to construct gene knock-in mice. Due to the rapid cleavage rate in the early embryonic stage, the resulting F0 generation mice are chimeras. Therefore, the F0 genotype obtained by identifying the tail of the F0 generation mice is for reference only and does not necessarily represent a heritable gene mutation. The heritable genotype needs to be determined after testing the tail of the F1 generation mice.

[0114] F0 mice were obtained through microinjection of fertilized eggs and embryo transfer. PCR and sequencing confirmed the presence of the following homologous recombination-positive F0 generation mice.

[0115] 7. Preparation of F1 generation mice;

[0116] F1 generation mice with stable genotypes were obtained by mating positive mice from the tail genotype identification results of F0 generation mice with C57BL / 6J wild-type mice.

[0117] DNA was extracted from the tails of F1 generation mice that tested positive by PCR and sequenced. The sequencing results indicated that the model was successfully constructed.

[0118] 8. Phenotypic characteristics of point mutant mouse models

[0119] The results, as shown in Figure 1, indicate that the testes of SDX point mutant mice are smaller, and abnormalities in seminiferous tubules were found in testicular tissue sections. SDX point mutant mice exhibit obvious symptoms of premature testicular aging and oligospermia.

[0120] Example 3: Targeted therapy strategy for specific gene mutations

[0121] 1. Construction and application of viral vectors: The corresponding AAV vector was constructed and its titer was determined. The specific construction method is as follows;

[0122] pAAV-CMV SDX: The gene fragment with sequence as shown in SEQ ID NO. 1 was inserted into the EcoRI / BamHI site of pAAV-CMV vector.

[0123] 2. Co-transfection

[0124] 12-16h before transfection, HEK293T cells were split at a ratio of 1:3 into 15cm plates containing 25mL DMEM complete medium;

[0125] When the cell confluency reached 70-80%, the plasmids were transfected per 15cm dish. 40μg DNA mixture was added; (pAAV-CMV SDX:pAAV2 / 8-RC:pHelper at a molar ratio of 1:1:1) 1.5mL pre-warmed serum-free DMEM was added per dish. Then 120μL PEI (PEI:DNA mass ratio of 3:1) was added, vortexed for 1 minute. Incubate at room temperature for 15 minutes, drop the mixture into each dish; 12h after transfection, wash the cells once with PBS, incubate with 25mL DMEM complete medium;

[0126] 3. Collection of virus

[0127] 72h after transfection, the cells were collected; using a serum pipette, about 20mL of medium was taken from the dish and placed in a 50mL centrifuge tube, 3-5mL of medium should be retained in the dish together with the cells. The transfected HEK293T cells on each 15cm plate were scraped with a cell scraper, the cell suspension was collected and transferred to a 50mL centrifuge tube. Rotate the medium and cell suspension at 3900rpm for 15 minutes at 4°C to form cell pellets.

[0128] The supernatant was treated as follows: filtered through a 0.22μm PES membrane; the virus in the supernatant was concentrated using Centricon Plus-70 (100kDa) at 3900rpm at 4°C. The concentrated virus was transferred to a new centrifuge tube.

[0129] The cell pellet was treated as follows: each cell pellet was resuspended in AAV lysis buffer (500 μL AAV lysis buffer was added to each plate) and combined into a 50 mL centrifuge tube. The cells were lysed by 4 freeze-thaw cycles (-80 °C / 37 °C) and then allowed to return to 37 °C. Benzonase (250 U / μL) was added at 1 μL per 5 mL of cell suspension. The mixture was incubated at 37 °C for 1 hour, mixed every 15 minutes, and centrifuged at 3900 rpm for 15 minutes at 4 °C. The virus supernatant was filtered sequentially with 0.45 μm and 0.22 μm filters. The virus in the supernatant was concentrated using a Centricon Plus-70 (100 KDa) at 3900 rpm at 4 °C. The concentrated virus was mixed. The mixture could be stored at 4 °C for a short time overnight or at -80 °C for a long time.

[0130] 4. Take 20 μL of the virus sample for DNA extraction, perform Q-PCR reaction, and measure the virus titer.

[0131] Design Q-PCR primers, and the primer sequences are as follows:

[0132] Q-PCR primer 1: ATGGCATCCCAAGCCAAGAGAGTA;

[0133] Q-PCR primer 2: AAAATGCCCAAGAGGTGGTCCTCT;

[0134] Prepare 1 x 10 10 molecules / μL of plasmid stock solution, generate a standard curve, and dilute the standard curve plasmid 6 times in succession in duplicate;

[0135] Purified AAV samples were treated with Benzonase / deoxyribonuclease I to eliminate any contaminating plasmid DNA carried over from the production process (deoxyribonuclease cannot penetrate the virions);

[0136] Dilute the DNA 10-fold, 100-fold, and 1000-fold, add it to the qPCR plate according to the 2X Universal SYBR Green Fast qPCR Mix (Abclonal, RM21203) system, and calculate the virus titer.

[0137] The following program was run on a Q-PCR instrument (QuantStudio 6 Real-Time Fluorescent Quantitative PCR System) using SYBR detection:

[0138] Table 2

[0139] 5. Subsequently, these full-length SDX viral vectors were injected into the seminiferous tubules of the S219P(T655C), E257K(G769A), R549W(C1645T), R549Q(G1646A), P594H(C1781A), C647F(G1940T), Q622E(C1864G) point mutation mice through minimally invasive surgery for treatment.

[0140] Detailed evaluation of treatment effect: After several months of treatment, detailed histological analysis showed that the testes of these point mutation mice showed restored seminiferous tubules and sperm production (Figure 2).

[0141] 6. Extended application of treatment strategy: After determining the SDX point mutation site by targeted sequencing, AAV viral vectors packaging full-length SDX can be injected into the seminiferous tubules of patients to treat all testicular premature aging and oligoasthenospermia caused by SDX gene point mutations. This strategy demonstrates the great potential of gene therapy in precision medicine and the treatment of genetic diseases.

[0142] This example not only demonstrates the feasibility of a gene therapy strategy for a specific genetic mutation, but also demonstrates the great potential of this strategy in the treatment of genetic infertility. In the future, this technology is expected to be further optimized and may be extended to a wider range of genetic disease treatment areas.

[0143] Example 4 Construction of SDX gene-deficient mouse model

[0144] 1. Method: Using CRISPR / Cas9 technology, the target gene is knocked out by the principle of homologous recombination. The specific process is as follows: design and transcribe guide RNA (gRNA) in vitro.

[0145] gRNA1: ACCCCCACATATGATCCTCA;

[0146] gRNA2: CCATTTGATGACCTATTCAA;

[0147] Cas9 and gRNA are injected into the zygote of the mouse at the same time. Cas9 protein binds to the target site under the guidance of gRNA, causing DNA double-strand break (DSB: Double-strand break), forcing the cell to undergo emergency repair. Under normal conditions, the cell tends to use nonhomologous end joining (NHEJ: nonhomologous DNA end joining) to repair the broken double-strand, thereby causing deletion mutation of the target site gene, thereby achieving knockout of the target gene.

[0148] 2、Isolation and observation of SDX gene-deficient mice, dissection of model animals C57BL / 6J mice, observation of mouse testis

[0149] The results are shown in Figure 3A, which shows that the testis of the SDX gene-deficient mouse is small, and the testis tissue section shows that the seminiferous tubules are abnormal (Figure 3B), and the proportion of abnormal seminiferous tubules is about 50% (Figure 3C); the number of mouse sperm decreases, and the decrease is more obvious as the age increases, and the male mice cannot reproduce after nine months, combined with the conservation of SDX gene in humans and mice, it is speculated that the function of SDX in humans should be consistent with that in mice. SDX knockout mice show obvious testicular premature aging and oligoasthenospermia, and lose the ability to reproduce at 9 months after birth.

[0150] 3、SDX gene-deficient mice have increased β-galactosidase-positive cells, and aging-related secretory phenotype genes are up-regulated

[0151] It was found that the number of β-galactosidase-positive cells increased in SDX gene knockout mice by β-galactosidase kit (Beyotime C0602) detection (Figure 4A), and β-galactosidase antibody (Cell Signaling Technology, 14B7) detection found that part of the supporting cells of the gene-deficient mice showed β-galactosidase positive (Figure 4B), and the mouse testis RNA was extracted for transcriptome sequencing, and it was found that the aging-related secretory phenotype genes (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2) were up-regulated in knockout mice (Figure 4C).

[0152] Example 5 Treatment of testicular premature aging mice by adeno-associated virus vector (AAV)

[0153] 1、After the construction of the overexpression vector, co-transfection was performed, and then the virus was collected. Take 20 μL of the virus sample for DNA extraction, perform Q-PCR reaction, and measure the virus titer.

[0154] 2、SDX knockout mouse testis injection of virus, the specific operation is as follows:

[0155] Preoperative high-pressure related surgical instruments; intraperitoneal injection of 50-100 uL of 2% sodium pentobarbital solution to anesthetize the mouse (the volume of anesthetic can be adjusted according to the size of the mouse); place the anesthetized mouse on the operating table, and disinfect the abdomen with alcohol; cut the fur layer about 1 cm above the genitals, then cut the muscle layer, then use a clean forceps to hold the adipose tissue to expose the testis; about 15 uL of virus is sucked into the injection needle, the injection needle is installed, the injection needle is inserted into the vas deferens at the junction of the testis and the head of the epididymis, the injection button of the syringe pump is pressed to inject the virus, and the total amount of injected virus reaches 1 x 10 11 molecules; one testis is injected with SDX virus, and the other testis is injected with EGFP virus as a control; remove the injection needle, adjust the position of the mouse testis and epididymis, and then place it into the abdominal cavity, and then push it back into the scrotum; use a suture needle to suture the mouse wound, first suture the muscle layer and then suture the skin layer; take the mouse out and place it on a warming blanket to wait for the mouse to wake up, and then put it back in the cage.

[0156] The mice injected with the virus are raised for two months, and after two months, the mice are dissected to observe the testis morphology, epididymal tissue sections, and SDX protein expression by immunofluorescence staining.

[0157] 6. Result analysis

[0158] The mice are sacrificed by cervical dislocation, the weight of the mouse is measured, and the results are recorded; the mouse is dissected, the testis and epididymis of the mouse are taken out, and the testis is weighed; the testis weight of the AAV-SDX treated mouse is 0.0588g (Figure 5A, right side), and the testis weight of the control group AAV-EGFP mouse is 0.167g (Figure 5A, left side); it is found that the size of the testis is significantly recovered through treatment;

[0159] After treatment with AAV-SDX, it is found that the abnormal lumen is only 8.96% in the testis section of the mouse, while the lumen of the control group is completely abnormal; through the epididymal tissue section, it is found that the epididymal lumen of the mouse supplemented with SDX contains sperm, while the control group has no sperm (Figure 5B); by detecting whether SDX is expressed in the testis of AAV infected mice, we also found that SDX is expressed in the supporting cells of the knockout mouse seminiferous tubules by immunofluorescence staining (Figure 5C). The treated male mice are mated with wild type female mice, and after one month of natural mating, the female mice are pregnant and give birth to 8 mice (Figure 5D).

[0160] The above results show that by treating SDX-deficient mice with AAV-SDX, the size of the testis can be restored, sperm production is restored to normal, and the ability to produce sperm is improved, and the next generation can be produced through natural mating or in vitro fertilization, which improves the reproductive ability of the mice.

[0161] Example 6. Treatment of testicular premature aging by increasing SDX protein expression in the testis through mRNA drugs

[0162] 1. mRNA synthesis: Synthetic mRNA with a 5' cap structure (Cap 1) and a 3' poly(A) tail is synthesized using in vitro transcription technology to improve its stability and translation efficiency. Purify the mRNA by high-performance liquid chromatography (HPLC) or fast liquid chromatography (FPLC).

[0163] 2. Encapsulate the synthesized mRNA in lipid nanoparticles (LNP) to promote its stability and effective delivery in vivo.

[0164] 3. Mouse testicular injection: Set up experimental and control groups. The experimental group is injected with SDX-deficient mice containing SDX mRNA LNP, and the control group is injected with SDX-deficient mice without mRNA blank LNP. Administer by testicular local injection or tail vein injection, twice a week for 4 weeks.

[0165] 4. Western Blot to detect the mRNA and protein expression levels of SDX gene in testicular tissue.

[0166] 5. Observe the testicular tissue of experimental and control group mice.

[0167] Through the treatment of SDX-deficient mice with synthetic mRNA drugs, we found that the experimental group mice had WB detection results showing the expression of SDX, while the control group had no expression of SDX (Figure 6A). The testicular size of the experimental group mice was restored to some extent, while the testicular size of the control group did not change (Figure 6B).

[0168] Example 7 Application of detecting SDX gene sequence in the preparation of a premature testicular failure or oligoasthenospermia detection kit

[0169] 1. Materials

[0170] Collect 200 microliters (μl) of peripheral blood from patients with premature testicular failure and oligoasthenospermia.

[0171] 2. Extract blood tissue genome

[0172] Use the blood gene extraction kit (brand: TIANGEN, product number: DP304) and follow the instructions. The main operations are as follows:

[0173] (1) Treat the blood sample (when using a blood sample of 200 uL, no treatment is required).

[0174] (2) Add 20 μL of Proteinase K solution and mix well. Add 200 μL of buffer GB and mix well by inverting. Incubate at 70°C for 10 minutes (min). The solution should be clear, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0175] (3) Add 200 μL of absolute ethanol, shake well for 15 seconds (s). At this time, flocculent precipitate may appear. Remove the water droplets on the inner wall of the tube cap by brief centrifugation.

[0176] (4) Add both the solution and the flocculent precipitate obtained in the previous step into an adsorption column CB3 (put the adsorption column into a collection tube), centrifuge at 12000 revolutions per minute (rpm) for 30 seconds (s), discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0177] (5) Add 500 μL of buffer GD (check whether absolute ethanol has been added before use) into the adsorption column CB3, centrifuge at 12000 revolutions per minute (rpm) for 30 seconds (s), discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0178] (6) Add 600 μL of rinse liquid PW (check whether absolute ethanol has been added before use) into the adsorption column CB3, centrifuge at 12000 revolutions per minute (rpm) for 30 seconds (s), discard the waste liquid, and put the adsorption column CB3 into the collection tube.

[0179] (7) Repeat step (6).

[0180] (8) Put the adsorption column CB3 back into the collection tube, centrifuge at 12000 revolutions per minute (rpm) for 2 minutes (min), discard the waste liquid, and put the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0181] (9) Put the adsorption column CB3 into a clean centrifuge tube, add 50-200 μl of elution buffer TE to the middle of the adsorption membrane, put it at room temperature for 2-5 minutes (min), centrifuge at 12000 revolutions per minute (rpm) for 2 minutes (min), and collect the solution into the centrifuge tube.

[0182] (10) Store the DNA solution at -20°C or -80°C.

[0183] 3. Send the obtained patient peripheral blood genomic DNA solution to a sequencing company for whole genome sequencing detection.

[0184] 4. Analyze the SDX gene sequence in the genome

[0185] (1) If there is no mutation in the SDX gene exon sequence, it can be determined that the testicular premature aging of the patient is not related to the SDX gene. Other gene mutations need to be analyzed or other causes need to be considered.

[0186] (2) Mutation of the promoter or enhancer sequence of the SDX gene: if the mutation of the base in the promoter or enhancer sequence of the SDX gene occurs, the expression of the encoded protein is not changed, and it can be determined that the testicular premature aging of the patient is not related to the SDX gene; if the mutation of the base in the promoter or enhancer sequence of the SDX gene occurs, it eventually leads to a significant decrease in the expression level of the SDX protein, and it can be determined that the testicular premature aging of the patient is related to the SDX gene.

[0187] (3) Base deletion or insertion in the coding sequence of the SDX gene:

[0188] If the non-3-integral deletion or insertion of the base in the exon sequence of the SDX gene occurs, the encoded protein must be affected, and the testicular premature aging of the patient is related to the SDX gene.

[0189] If the 3-integral deletion or insertion occurs, it can lead to the deletion or insertion of additional amino acid residues in the encoded protein, and if the change site occurs in the important functional domain, it can lead to the decrease of the SDX activity, and the encoded protein sequence needs to be further determined, which needs to be referred to the protein expression and function verification.

[0190] (4) Base substitution in the coding sequence of the SDX gene:

[0191] If the synonymous mutation (the base substitution does not change the type of the encoded amino acid) of the base in the exon sequence of the SDX gene occurs, the encoded protein is not changed, and the testicular premature aging and oligoasthenospermia are not related to the SDX gene.

[0192] If the non-sense mutation (the base substitution leads to the premature termination of the protein translation) of the base in the exon sequence of the SDX gene occurs, it eventually affects the activity and function of the SDX protein, and the testicular premature aging and oligoasthenospermia are related to the SDX gene. In the process of whole genome sequencing analysis, the genomic sequence related to other reported testicular premature aging patients also needs to be analyzed, and if the patient combines the mutation of other reported related genes, the occurrence of the above diseases caused by multiple gene variations can be considered.

[0193] Example 8, application of detection of the expression level of the SDX encoded protein in the preparation of a test kit for testicular premature aging or oligoasthenospermia

[0194] 1. Obtaining tissue

[0195] The reproductive organ tissue of the testicular premature aging and oligoasthenospermia is obtained by tissue puncture (professional medical personnel are needed).

[0196] 2. Preparation of protein sample

[0197] (1) 100 μL RIPA lysis buffer (brand: Beyotime, item number: P0013K), and add a final concentration of 1x protease inhibitor Cocktail (brand: Roche, item number: 11836145001), lyse the tissue, grind on ice, ultrasonic after grinding, 4°C roller lysis for 60 minutes (min), then centrifuge at 4°C 12000g for 10 minutes (min), take the supernatant.

[0198] (2) Determine the protein concentration by BCA method (brand: Beyotime, item number: P0012).

[0199] (3) Add 5x SDS-PAGE protein loading buffer (brand: Abclonal, item number: RM00001), mix and then boil for 10-15 min, and cool on ice.

[0200] 3. Western blotting reaction

[0201] (1) According to the instruction manual, install the gel maker, and prepare 5% concentrated gel and 10% separation gel, respectively.

[0202] (2) Loading: the protein loading amount is 10-100 ng.

[0203] (3) Electrophoresis: after loading, connect the power supply of the electrophoresis instrument, make sure that the positive and negative electrodes are correctly connected, set appropriate electrophoresis parameters, and the electrophoresis parameters of the concentrated gel are constant voltage 60V, when the sample enters the separation gel, the electrophoresis can be adjusted to 120V. When the bromophenol blue electrophoresis reaches the bottom of the gel, stop electrophoresis and turn off the power supply of the electrophoresis instrument.

[0204] (4) Membrane transfer: take out the gel in the glass plate, and place a porous pad, a filter paper, a gel, a PVDF membrane, and three filter papers in order on the clamp plate (“sandwich” structure), place the transferred membrane in the membrane transfer tank, and transfer at a constant current of 250mA for 90 minutes (min) on ice.

[0205] (5) Blocking: take the membrane out of the “sandwich” structure, place it in a suitable antibody incubation tank, and add 5% skimmed milk / TBST Buffer (mass / volume) for room temperature blocking for 1h.

[0206] (6) Primary antibody incubation: self-made rabbit anti-human SDX polyclonal antibody in the laboratory, and dilute with 3% bovine serum albumin (BSA) / TBST Buffer (mass / volume) at a dilution ratio of 1:100-1:200; GAPDH mouse monoclonal antibody (brand: protein tech, item number: 60004-1-Ig), dilution ratio 1:50000. Incubate the primary antibody at 4°C overnight.

[0207] (7) Washing: After the incubation of the primary antibody, TBST Buffer was added for washing 4 times, 5 min each time.

[0208] (8) Secondary antibody incubation: Secondary antibody HRP Goat Anti-Rabbit IgG (H+L) (brand: Abclonal, product number: AS014) was diluted with TBST Buffer at a ratio of 1:5000. Incubate at room temperature for 1 h.

[0209] (9) Washing: After the incubation of the secondary antibody, TBST Buffer was added for washing 4 times, 5 min each time.

[0210] (10) Development: ECL developing solution (brand: Thermo Fisher Scientific, product number: 1863094), after mixing A and B solutions in the dark, add a drop to the PVDF membrane for digital development.

[0211] 4. Data calculation

[0212] By BCA protein quantification, GAPDH (little change in different cells, not affected by target protein changes) as an internal reference protein can be used for relative quantification of SDX protein (take the ratio of SDX protein to internal reference protein as the measurement value), control group protein (normal testis). The developed images of different samples were subjected to gray scale processing and the gray values or gray areas were calculated.

[0213] 5. Result analysis

[0214] (1) No difference between the test group and the control group (position, content): It indicates that the SDX protein expression level of testicular premature aging and oligoasthenospermia patients is not different from that of normal people. At the same time, if the gene sequence is correct, it can further exclude the possibility of SDX abnormality leading to testicular premature aging and oligoasthenospermia.

[0215] (2) Change of SDX protein band position in the test group: combined with SDX gene sequence information, it indicates that SDX protein terminates early, or due to the loss of stop codon caused by insertion of bases, a new sequence is added; it can be judged that SDX mutation leads to the possibility of testicular premature aging and oligoasthenospermia.

[0216] (3) Increase of SDX protein content in the test group: it suggests that the activity of SDX protein is reduced, combined with SDX gene sequence information (functional domain mutation) and protein interaction experiment (decrease of protein binding), it can improve the possibility of diagnosing SDX leading to testicular premature aging and oligoasthenospermia.

[0217] 6. Tissue fixation and dehydration

[0218] The punctured tissue was fixed with 4% PFA / PBS (mass / volume) at 4°C for 2 hours, and then dehydrated with 30% sucrose / PBS (mass / volume) at 4°C overnight.

[0219] 7. Tissue embedding and sectioning

[0220] The dehydrated tissue was embedded at -80°C with NEG-50 (Thermo Fisher Scientific), and after embedding was completed, frozen sectioning was performed.

[0221] 8. Frozen section immunofluorescence

[0222] Blocking: The tissue was surrounded with a hydrophobic pen on the section, and the sample was completely covered with 10% goat serum / TBS Buffer (volume / volume). The section was placed in a wet box and incubated at room temperature for 1 hour.

[0223] Primary antibody incubation: The blocking solution was removed, and the primary antibody working solution (laboratory-made rabbit anti-human SDX polyclonal antibody, dilution ratio: 1:50) prepared with 10% goat serum / TBS Buffer (volume / volume) was directly added dropwise on the sample. The sample was completely covered, and the section was placed in a wet box and incubated at room temperature overnight. Washed once with buffer TBST for 5 minutes, and washed three times with buffer TBS, each for 5 minutes. Secondary antibody incubation: The fluorescent secondary antibody working solution-Alexa Fluor 488-conjugated Goat anti-Rabbit IgG (H+L) (brand: Abclonal, product number: AS053) prepared with 10% goat serum / TBS Buffer (volume / volume) was added dropwise on the sample. The sample was completely covered, and incubated at room temperature for 1 hour in the dark. Washed once with buffer TBST for 5 minutes, and washed three times with buffer TBS, each for 5 minutes.

[0224] Nucleus staining: DAPI fluorescent fading mounting medium was added dropwise on the sample, followed by covering with a cover glass for mounting, and then observed and images were collected under a fluorescence microscope.

[0225] 9. Result analysis

[0226] Detection group SDX protein fluorescence signal disappearance: combined with SDX gene sequence information and Western blot result analysis, it was shown that SDX protein expression was missing or prematurely terminated, further proving that testicular premature aging and oligoasthenospermia were caused by SDX abnormalities. The SDX protein fluorescence signal of the detection group was consistent with that of the control group: there was no mutation in the exon sequence of the SDX gene, and Western blot results showed that there was no difference in the size and content of the SDX protein between the detection group and the control group, further excluding the possibility of SDX abnormal testicular premature aging and oligoasthenospermia.

[0227] If the SDX gene exon sequence shows a fold deletion or insertion of 3, and Western blot results show a change in the position of the SDX protein band in the test group, the activity of abnormally expressed SDX may be affected. Premature testicular failure and oligoasthenospermia may be associated with SDX abnormalities, requiring further determination of the encoding protein sequence, specifically in conjunction with protein function verification. A weakened fluorescence signal of SDX protein in the test group: Combining SDX genome sequencing sequence variation information with SDX expression level analysis in Western blot experiments can improve the likelihood of SDX causing premature testicular failure and oligoasthenospermia.

[0228] Finally, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims and their equivalents, this invention is also intended to include these modifications and variations.

Claims

1. Use of SDX for the preparation of a diagnostic product for testicular premature aging or oligoasthenospermia, characterized in that, The application comprises detecting SDX gene abnormality and / or SDX protein expression level abnormality.

2. Use according to claim 1, characterized in that, The SDX gene abnormality comprises at least one of the following abnormalities: mutation of the promoter or enhancer sequence of the gene, single or multiple base sequence deletion, insertion or substitution in the coding sequence of the gene.

3. Use according to claim 1, characterized in that, The SDX protein expression level abnormality comprises at least one of the following abnormalities: reduction of SDX protein expression, premature termination or deletion of SDX protein expression, deletion, insertion or substitution of amino acids in the important functional domain of SDX protein.

4. Use according to claim 1, characterized in that, The test kit for diagnosing testicular premature aging or oligoasthenozoospermia comprises an SDX gene detection kit and / or an SDX protein expression level detection kit, the SDX gene detection kit comprises a whole genome sequencing detection reagent, and the SDX protein expression level detection kit comprises an antibody specifically binding to the SDX protein.

5. An antibody specifically binding to the SDX protein in the preparation of a test kit for testicular premature aging or oligoasthenozoospermia.

6. A mutant pathogenic gene associated with testicular premature aging or oligoasthenospermia, characterized in that, The mutation pathogenic gene has at least one of the following 7 mutation sites: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G) compared with the nucleotide sequence of the SDX gene as shown in SEQ ID NO:

1.

7. A reagent for detecting the mutation pathogenic gene related to testicular premature aging or oligoasthenozoospermia according to claim 6 in the preparation of a diagnostic product for testicular premature aging or oligoasthenozoospermia.

8. Application of an SDX overexpression vector in the preparation of a medicine for treating testicular premature aging or oligoasthenozoospermia.

9. Use according to claim 8, characterized in that, The SDX overexpression vector comprises an AAV expression vector, and the construction method comprises the following steps: inserting a gene fragment with the sequence as shown in SEQ ID NO. 4 into an EcoRI / BamHI enzyme cutting site of a pAAV-CMV vector to obtain the same.

10. Application of a substance promoting SDX expression in the preparation of a medicine for treating testicular premature aging or oligoasthenozoospermia.

11. A method for constructing a point mutation mouse model related to SDX gene, characterized in that, The method comprises the following steps: mRNAs of gRNAs with nucleotide sequences as shown in SEQ ID NO. 6-SEQ ID NO. 7, SEQ ID NO. 11-SEQ ID NO. 12, SEQ ID NO. 13-SEQ ID NO. 14, SEQ ID NO. 15-SEQ ID NO. 16, SEQ ID NO. 17-SEQ ID NO. 18, SEQ ID NO. 19-SEQ ID NO. 20, and SEQ ID NO. 21-SEQ ID NO. 22 are respectively transcribed in vitro to obtain sgRNAs; active Cas9 mRNA is obtained; targeting donors with nucleotide sequences as shown in SEQ ID NO. 2-SEQ ID NO. 5 are respectively obtained; Mixing the transcribed sgRNA, Cas9 mRNA and the targeting donor, microinjecting into the mouse zygote to obtain F0 generation mice; Selecting F0 generation mice in the genotype identification results of F0 generation positive mice, mating with wild type mice to obtain F1 generation mice with stable genotype, and screening, that is, obtaining a point mutation mouse model.

Citation Information

Patent Citations

  • Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases

    CN111909994A

  • Application of SDX in preparation of male infertility detection kit

    CN113604554A

  • Gene therapy for treatment of infertility

    US20200171171A1

  • Method for determining male infertility associated with abnormal expression of sex-determining gene on x chromosome (SDX) or SDX protein

    US20230078419A1