Preparation method for site-specific controllably-modified RNA molecule and use thereof
By linking RNA with trans-self-splicing fragments in a polynucleotide combination, the problems of low efficiency and functional impact of circular RNA preparation caused by random modification are solved, enabling site-specific and controllable chemical modification and improving the stability and therapeutic effect of circular RNA.
Patent Information
- Application Number
- PCT/CN2025/125988
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-30
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
In the preparation of circular RNA, existing technologies use random modification methods that result in low circularization efficiency and affect function. They cannot effectively control the impact of chemical modifications on RNA structure and function, thus reducing the therapeutic effect of mRNA therapy.
By employing a combination of multiple nucleotides, an active autosplicing complex is formed using trans-autosplicing fragments. By cleaving these fragments, the first and second RNAs are linked to form circular or chimeric RNAs, which, combined with homologous arm sequences and ribozyme elements, achieve site-specific and controllable chemical modification.
It improved the preparation efficiency and functional stability of circular RNA, reduced immunogenicity, and enhanced protein translation efficiency and the efficacy of mRNA therapy.
Smart Images

Figure PCTCN2025125988-FTAPPB-I100001 
Figure PCTCN2025125988-FTAPPB-I100002 
Figure PCTCN2025125988-FTAPPB-I100003
Abstract
Description
Method for preparing site-specifically modified RNA molecules and uses thereof TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, in particular to a method for preparing site-specifically modified RNA molecules and uses thereof. BACKGROUND
[0002] In recent years, linear mRNA molecules have shown wide use and prospects in the fields of vaccines, therapeutic drugs, etc., and circular RNA is a type of RNA molecule covalently linked at the head and tail, known as the "2.0 version" of linear mRNA. Compared with linear RNA molecules, circular RNA molecules do not contain exposed 5' and 3' ends, and this structural feature makes them naturally resistant to the wide range of exonucleases existing in vitro and in vivo, so that circular RNA molecules have better stability in vitro and in vivo. Therefore, circular RNA has wide use in both short-chain RNA molecules (such as aptamer, gene editing guide RNA (gRNA)) and long-chain RNA molecules (such as messenger RNA (mRNA)), and both can exert better and more optimal biomedical functions by converting linear RNA molecules into circular RNA molecules than corresponding linear RNA molecules.
[0003] Chemical modification is one of the key factors for mRNA technology to make breakthroughs in the fields of vaccine and drug development. Human endogenous RNA molecules have various types of post-transcriptional modifications, and these chemical modifications are important ways for the innate immune system to recognize "self" and "non-self" nucleic acid molecules. Studies have shown that unmodified in vitro synthesized mRNA molecules have high immunogenicity, which can significantly activate the innate immune system such as pattern recognition receptors in vivo, thereby accelerating the clearance of mRNA molecules by the body, inhibiting the protein translation efficiency of mRNA, causing adverse reactions in the host body, etc. Chemical modification of nucleotides is one of the most important factors for improving the safety and efficacy of RNA vaccines and drugs.
[0004] For example, in the marketed mRNA vaccine, modified bases are used to replace natural bases, thereby avoiding the activation of the innate immune system in host cells, reducing immunogenicity, and improving the translation level of mRNA. Endogenous RNA molecules in cells usually contain various chemical modifications, which help to regulate the innate immunogenicity of endogenous RNA molecules and control the RNA metabolism process.
[0005] A large number of studies have shown that the introduction of various chemical modifications (such as pseudouridine, m6A, etc.) in in vitro synthesized mRNA helps to improve the immunogenicity and stability of exogenous mRNA molecules, thereby promoting the better performance of mRNA vaccines and drugs. The existing method for preparing chemically modified mRNA is a random modification method, which replaces natural nucleotides with chemically modified nucleotides in a certain proportion in the raw material for in vitro transcription (IVT) to prepare mRNA, thereby preparing mRNA products containing a certain proportion of chemically modified nucleotides.
[0006] The random modification method is widely used in the preparation process of linear mRNA. However, in circular mRNA, random modification has many adverse effects, the most important of which include two aspects: (1) Random modification significantly reduces the efficiency of circular RNA preparation: the most commonly used and efficient method for large-scale preparation of circular RNA molecules at present is based on the self-catalytic circularization strategy of ribozyme. Random modification can affect the normal structure and function of ribozyme, thereby reducing the circularization efficiency; (2) Random modification significantly affects the function of circular RNA: chemical modification can change the spatial structure of RNA, so for RNA elements that rely on spatial structure to function, they will all be affected by chemical modification. Random modification will have uncontrollable effects on structural and functional elements in RNA molecules, such as miRNA binding sites, protein binding sites and translation regulatory elements contained in the mRNA sequence. Studies have found that random modification can reduce the translation initiation activity of cap-independent translation initiation elements (such as IRES), thereby reducing the efficiency of mRNA expressing proteins and affecting the therapeutic effect of mRNA therapy. When the proportion of chemical modification is high, the circular mRNA prepared by the random modification method may lose the translation activity.
[0007] Therefore, there is an urgent need in the art to develop a site-specific, controllable and efficient method for preparing chemically modified circular RNA, in order to improve the performance of circular RNA in medical applications (such as reducing immunogenicity, improving RNA stability, improving protein translation efficiency, etc.). SUMMARY
[0008] The purpose of the present application is to provide a site-specific, controllable and efficient method for preparing chemically modified circular RNA or chimeric RNA molecules.
[0009] In a first aspect of the invention, a polynucleotide combination is provided, the polynucleotide combination comprising a first RNA and a second RNA, wherein one end of the first RNA is provided with a trans-splicing fragment, and one end of the second RNA is provided with a trans-splicing fragment, the two said trans-splicing fragments combining to form an active self-splicing body, thereby cleaving the trans-splicing fragment from the first RNA and / or cleaving the trans-splicing fragment from the second RNA, such that the first RNA and the second RNA are joined together by the cleaved ends.
[0010] In another preferred embodiment, the polynucleotide combination is used to prepare circular RNA or chimeric linear RNA;
[0011] The trans-self-splicing fragment contains ribozyme elements and trans-interacting elements.
[0012] In another preferred embodiment, the polynucleotide combination is used to prepare circular RNA, the polynucleotide combination comprising a first RNA and a second RNA, wherein one end of the first RNA is provided with a trans-splicing fragment B1, and one end of the second RNA is provided with a trans-splicing fragment B2, the trans-splicing fragment B1 and the trans-splicing fragment B2 combine to form an active self-splicing variant B, thereby cleaving the trans-splicing fragment B1 from the first RNA and / or cleaving the trans-splicing fragment B2 from the second RNA, such that the first RNA and the second RNA are joined together by the cleaved ends.
[0013] In another preferred embodiment, the polynucleotide combination is used to prepare a chimeric linear RNA, wherein the first RNA in the polynucleotide combination is RNA. x The second RNA is RNA x+1 , wherein the RNA x One end of the RNA contains a trans-self-splicing fragment TS. x+1 One end of the RNA is provided with a trans-splicing variant fragment TS'. The trans-splicing variant fragment TS and the trans-splicing variant fragment TS' combine to form an active self-splicing variant, thereby transferring the trans-splicing variant fragment TS from the RNA. x Excision and / or removal of the trans-splicing fragment TS' from RNA x+1 The RNA was cut off. x and RNA x+1 The ends formed after the excision are connected together.
[0014] In another preferred embodiment, the trans-interacting element comprises: a homologous arm element, tRNA halves or derivatives thereof, or a combination of RNA fragments that have high stability after cofolding.
[0015] In another preferred embodiment, the pair of the paired trans-acting elements can recognize and interact with each other.
[0016] In another preferred embodiment, the trans-acting elements are homologous arm elements.
[0017] In another preferred embodiment, the first RNA and the second RNA are linear.
[0018] In another preferred embodiment, the two paired trans-self-splicing body fragments each comprise a pair of ribozyme fragments.
[0019] In another preferred embodiment, the pair of the paired ribozyme fragments are two fragments split from one ribozyme.
[0020] In another preferred embodiment, the ribozyme is a trans-splicing active ribozyme, including: a SL (Spliced Leader) RNA, a mod(mdg4) gene, a lola gene, or a combination thereof.
[0021] In another preferred embodiment, the SL (Spliced Leader) RNA is from a lower eukaryote, such as a trypanosome, a nematode; the mod(mdg4) and lola genes are from an insect.
[0022] In another preferred embodiment, the ribozyme is a cis-splicing active ribozyme, including: a self-splicing intron, a group I intron, a group II intron, or a combination thereof.
[0023] In another preferred embodiment, the group I intron includes: an Anabaena pre-tRNA-Leu gene intron, a T4 phage Td gene intron, a Tetrahymena intron, an Azoarcus, etc.
[0024] In another preferred embodiment, the group I intron is selected from the Intron_gpI (RF00028) family of the Rfam database.
[0025] In another preferred embodiment, the group II intron is selected from the Intron_gpII (RF00029) family of the Rfam database.
[0026] In another preferred embodiment, the ribozyme is a natural ribozyme or a modified ribozyme, and the modified ribozyme has similar or better reaction activity than the natural ribozyme.
[0027] In the second aspect of the present application, a polynucleotide combination for preparing a circular RNA is provided, which comprises a first RNA and a second RNA, wherein one end of the first RNA is provided with a trans-self-splicing body fragment B1, one end of the second RNA is provided with a trans-self-splicing body fragment B2, the trans-self-splicing body fragment B1 and the trans-self-splicing body fragment B2 combine to form an active self-splicing body B, so as to cut off the trans-splicing body fragment B1 from the first RNA and / or cut off the trans-splicing body fragment B2 from the second RNA, and the first RNA and the second RNA are connected together through the ends formed after the cutting.
[0028] In another preferred embodiment, the homologous arm sequence z1 and the homologous arm sequence z2 are a pair of paired trans-acting elements.
[0029] In another preferred embodiment, the homologous arm sequence z1 and the homologous arm sequence z2 are reverse complementary.
[0030] In another preferred embodiment, the reverse complementation includes complete reverse complementation, basic reverse complementation.
[0031] In another preferred embodiment, the reverse complementation has a nucleotide length of n, 0
[0032] In another preferred embodiment, after the homologous arm sequence is paired by reverse complementation, the spatial distance between the self-splicing reaction regions of the first RNA and the second RNA is reduced.
[0033] In another preferred embodiment, the first RNA and the second RNA have the following structure:
[0034] The first RNA comprises the structure G1-TSB1 or TSB1-G1 from 5' end to 3' end, wherein G1 is a first target sequence, and TSB1 is a trans-self-splicing body fragment B1.
[0035] The second RNA comprises the structure G2-TSB2 or TSB2-G2 from 5' end to 3' end, wherein G2 is a second target sequence, and TSB2 is a trans-self-splicing body fragment B2.
[0036] In another preferred embodiment, the other end of the first RNA is further provided with a self-splicing body fragment A1, and the other end of the second RNA is further provided with a self-splicing body fragment A2, the self-splicing body fragment A1 and the self-splicing body fragment A2 combine to form an active self-splicing body A, so as to cut off the trans-splicing body fragment A1 from the first RNA and / or cut off the trans-splicing body fragment A2 from the second RNA, and the first RNA and the second RNA are connected together through the ends formed after the cutting, forming a circular RNA molecule.
[0037] In another preferred embodiment, the first RNA and the second RNA have the following structure:
[0038] The first RNA comprises the structure of TSA1-G1-TSB1 from 5' end to 3' end, wherein G1 is the first target sequence, TSA1 is a self-splicing body fragment A1, and TSB1 is a trans self-splicing body fragment B1.
[0039] The second RNA comprises the structure of TSB2-G2-TSA2 from 5' end to 3' end, wherein G2 is the second target sequence, TSB2 is a trans self-splicing body fragment B2, and TSA2 is a self-splicing body fragment A2.
[0040] In another preferred embodiment, the first splicing reaction occurs between TSB1 and TSB2 to connect the 3' end of G1 with the 5' end of G2; and the second splicing reaction occurs between TSA1 and TSA2 to connect the 5' end of G1 with the 3' end of G2; thereby obtaining a circular RNA molecule comprising G1-G2.
[0041] In another preferred embodiment, the first splicing reaction and the second splicing reaction are not limited in the order of occurrence, or can be performed simultaneously.
[0042] In another preferred embodiment, the self-splicing body fragment TSA1 specifically recognizes and acts with the self-splicing body fragment TSA2; the self-splicing body fragment TSB1 specifically recognizes and acts with the self-splicing body fragment TSB2; the self-splicing body fragment TSA1 does not recognize and act with the self-splicing body fragment TSB1, the self-splicing body fragment TSA1 does not recognize and act with the self-splicing body fragment TSB2, the self-splicing body fragment TSA2 does not recognize and act with the self-splicing body fragment TSB1, and the self-splicing body fragment TSA2 does not recognize and act with the self-splicing body fragment TSB2.
[0043] In another preferred embodiment, TSA1 comprises the structure of y1-a1 from 5' end to 3' end; and TSA2 comprises the structure of a2-y2 from 5' end to 3' end; wherein y1 and y2 are reverse complementary homologous arm fragments; a1 and a2 are fragments of a ribozyme a, preferably a1 and a2 are two fragments formed by dividing the ribozyme a, and a1 and a2 combine to form a ribozyme a with self-splicing activity.
[0044] In another preferred embodiment, TSB1 comprises the structure of b1-z1 from 5' end to 3' end; and TSB2 comprises the structure of z2-b2 from 5' end to 3' end; wherein z1 and z2 are reverse complementary homologous arm fragments; b1 and b2 are fragments of a ribozyme b, preferably b1 and b2 are two fragments formed by dividing the ribozyme b, and b1 and b2 combine to form a ribozyme b with self-splicing activity.
[0045] In another preferred embodiment, the first RNA and the second RNA have the following structure:
[0046] The first RNA comprises the structure from 5' end to 3' end: y1-a1-G1-b1-z1;
[0047] The second RNA comprises the structure from 5' end to 3' end: z2-b2-G2-a2-y2.
[0048] In another preferred embodiment, z1 and z2 have a length of 5-50 nt.
[0049] In another preferred embodiment, y1 and y2 have a length of 5-50 nt.
[0050] In another preferred embodiment, TSA1 comprises the structure from 5' end to 3' end: y1-a; TSA2 comprises the structure from 5' end to 3' end: y2; wherein y1 and y2 are reverse complementary homology arm fragments, and a is a complete ribozyme a.
[0051] In another preferred embodiment, TSA1 comprises the structure from 5' end to 3' end: y1; TSA2 comprises the structure from 5' end to 3' end: a-y2; wherein y1 and y2 are reverse complementary homology arm fragments, and a is a complete ribozyme a.
[0052] In another preferred embodiment, TSB1 comprises the structure from 5' end to 3' end: b-z1; TSB2 comprises the structure from 5' end to 3' end: z2; wherein z1 and z2 are reverse complementary homology arm fragments, and b is a complete ribozyme b.
[0053] In another preferred embodiment, TSB1 comprises the structure from 5' end to 3' end: z1; TSB2 comprises the structure from 5' end to 3' end: z2-b; wherein z1 and z2 are reverse complementary homology arm fragments, and b is a complete ribozyme b.
[0054] In another preferred embodiment, z1 and z2 have a length of 10-200 nt.
[0055] In another preferred embodiment, y1 and y2 have a length of 10-200 nt.
[0056] In another preferred embodiment, the first RNA and the second RNA have the following structure:
[0057] The first RNA comprises the structure from 5' end to 3' end: y1-a-G1-b1-z1;
[0058] The second RNA comprises the structure from 5' end to 3' end: z2-b2-G2-y2.
[0059] In another preferred embodiment, the first RNA and the second RNA have the following structure:
[0060] The first RNA comprises, from 5' end to 3' end, the structure: y1-G1-b1-z1;
[0061] The second RNA comprises, from 5' end to 3' end, the structure: z2-b2-G2-a-y2.
[0062] In another preferred example, the first and second RNAs have the following structure:
[0063] The first RNA comprises, from 5' end to 3' end, the structure: y1-a1-G1-b-z1;
[0064] The second RNA comprises, from 5' end to 3' end, the structure: z2-G2-a2-y2.
[0065] In another preferred example, the first and second RNAs have the following structure:
[0066] The first RNA comprises, from 5' end to 3' end, the structure: y1-a1-G1-z1;
[0067] The second RNA comprises, from 5' end to 3' end, the structure: z2-b-G2-a2-y2.
[0068] In another preferred example, the first and second RNAs have the following structure:
[0069] The first RNA comprises, from 5' end to 3' end, the structure: y1-a-G1-b-z1;
[0070] The second RNA comprises, from 5' end to 3' end, the structure: z2-G2-y2.
[0071] In another preferred example, the first and second RNAs have the following structure:
[0072] The first RNA comprises, from 5' end to 3' end, the structure: G1-TSB1;
[0073] The second RNA comprises, from 5' end to 3' end, the structure: TSB2-G2;
[0074] TSB1 and TSB2 undergo a splicing reaction to connect the 3' end of G1 to the 5' end of G2, forming a chimeric RNA molecule comprising the sequence G1-G2;
[0075] The 5' end of the G1-G2 chimeric RNA molecule is connected to its own 3' end using a ligase of the protein class, resulting in a circular RNA molecule comprising the sequence G1-G2.
[0076] In another preferred embodiment, the proteinaceous ligase includes, but is not limited to, T4 RNA ligase 1, T4 RNA ligase 2, T4 DNA ligase, RtcB RNA ligase.
[0077] In another preferred embodiment, the first RNA and the second RNA are linear.
[0078] In another preferred embodiment, the ribozyme is a trans-splicing active ribozyme, which is defined as in the first aspect of the present application.
[0079] In another preferred embodiment, G1 and G2 are close to the 5' end and / or the 3' end of the trans-splicing ribozyme, and the trans-splicing ribozyme comprises a splice acceptor region, which comprises a splice site and a recognition region adjacent to the splice site.
[0080] In another preferred embodiment, when the trans-splicing ribozyme binds to the recognition region, the trans-splicing ribozyme undergoes transesterification at the splice site to form a covalent bond.
[0081] In another preferred embodiment, the splice site (ss) comprises a 5'ss and a 3'ss, wherein the 5'ss is located in the recognition region of the trans-splicing ribozyme, the 5'ss forms a U-G mismatch with an internal guide sequence (IGS) of the trans-splicing ribozyme, and the upstream and downstream sequences adjacent to the U-G mismatch comprise at least one base pair.
[0082] In another preferred embodiment, the recognition region comprises a 5'ss, and the upstream sequence adjacent to the 5'ss forms n base pairs (n≥1, such as 1-10) with an IGS of the trans-splicing ribozyme, and the downstream sequence adjacent to the 5'ss forms n base pairs (n≥1, such as 1-10) with the IGS, and the continuous sequence of the 5'ss and the upstream and downstream nucleotides adjacent to the 5'ss that form base pairs with the IGS constitutes the recognition region.
[0083] In another preferred embodiment, the recognition region comprises a 3'ss, and the upstream sequence adjacent to the 3'ss forms n base pairs (n≥1, such as 1-10) with an IGS of the trans-splicing ribozyme, and the downstream sequence adjacent to the 3'ss forms n base pairs (n≥1, such as 1-10) with the IGS, and the continuous sequence of the 3'ss and the upstream and downstream nucleotides adjacent to the 3'ss that form base pairs with the IGS constitutes the recognition region.
[0084] In another preferred embodiment, the first RNA contains one or more chemically modified nucleotides, and the proportion of modified nucleotides contained is 0-100%, such as 25% or 50%.
[0085] In another preferred embodiment, the second RNA contains one or more chemically modified nucleotides, and the proportion of modified nucleotides contained is 0-100%, such as 25% or 50%.
[0086] In another preferred embodiment, the first and second RNAs contain types and / or proportions of modified nucleotides that are independent of each other.
[0087] In another preferred embodiment, the modifications include, but are not limited to, pseudouridine (Ψ), N1-methylpseudouridine (m1Ψ), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hm5C), N6-methyladenosine (m6A), 5-methoxyuridine (5moU), 5-methyluridine (m5U), 2-thiouridine (s2U), 2'-O-methylation modification (Nm), or a combination thereof.
[0088] In another preferred embodiment, the first RNA contains a high proportion of modified nucleotides, and the second RNA contains no modified nucleotides or a low proportion of modified nucleotides.
[0089] In another preferred embodiment, the first RNA contains no modified nucleotides or a low proportion of modified nucleotides, and the second RNA contains a high proportion of modified nucleotides.
[0090] In another preferred embodiment, the high proportion of modified nucleotides refers to ≥ 25%, such as ≥ 50% or ≥ 75%.
[0091] In another preferred embodiment, the low proportion of modified nucleotides refers to ≤ 25%, such as ≤ 20% or ≤ 15%.
[0092] In another preferred embodiment, the first RNA is TSA1-G1-TSB2, wherein TSA1, G1 and TSB2 each independently contains any proportion of any type of nucleotide modification; and the second RNA is TSB1-G1-TSA2, wherein TSB1, G1 and TSA2 each independently contains any proportion of any type of nucleotide modification.
[0093] In another preferred embodiment, the TSA1 and TSA2 do not contain (or do not simultaneously contain) nucleotide modifications.
[0094] In another preferred embodiment, the TSB1 and TSB2 do not contain (or do not simultaneously contain) nucleotide modifications.
[0095] In a third aspect of the present application, a polynucleotide combination for preparing a chimeric linear RNA is provided, which comprises n linear RNA segment precursor molecules, respectively named RNA1 to RNA n ; wherein each of the n RNA segment precursor molecules comprises G1 to G n n target RNA sequences, and the n RNA segment precursor molecules are sequentially connected into a chimeric linear RNA through ribozyme self-splicing reactions.
[0096] When 1≤x x comprises G x and a trans self-splicing segment TSx located at the 3' end of G x , and RNA x+1 comprises G x+1 and a trans self-splicing segment TSx' located at the 5' end of G x+1 ; the TSx and TSx' combine to form an active self-splicing body, thereby cleaving TSx from RNA x , cleaving TSx' from RNA x+1 , and connecting G x and G x+1 together through the ends formed after cleavage.
[0097] In another preferred embodiment, the self-splicing reaction only occurs between TSx and TSx', and does not occur with any other trans self-splicing segment.
[0098] In another preferred embodiment, n=2, the linear RNA segments each correspond to a precursor molecule of RNA1 and RNA2, and the RNA1 and RNA2 have a structure selected from the following group:
[0099] (1) RNA1 comprises the structure G1-TS1 from 5' end to 3' end, and RNA2 comprises the structure TS1'-G2 from 5' end to 3' end, and TS1 and TS1' undergo a splicing reaction to connect the 3' end of G1 with the 5' end of G2;
[0100] (2) RNA1 comprises the structure G1-TS1 from 5' end to 3' end, and RNA2 comprises the structure G2-TS1' from 5' end to 3' end, and TS1 and TS1' undergo a splicing reaction to connect the 3' end of G1 with the 3' end of G2;
[0101] (3) RNA1 comprises the structure TS1-G1 from 5' end to 3' end, and RNA2 comprises the structure TS1'-G2 from 5' end to 3' end, and TS1 and TS1' undergo a splicing reaction to connect the 5' end of G1 with the 5' end of G2;
[0102] Thus a chimeric RNA molecule with the sequence G1-G2 is obtained.
[0103] In another preferred embodiment, the trans-self-splicing fragment TS1 comprises the ribozyme fragment a1 and the homology arm sequence z1, and the trans-self-splicing fragment TS1' comprises the ribozyme fragment a2 and the homology arm sequence z2, wherein the ribozyme fragment a1 and the ribozyme fragment a2 combine to form the ribozyme a having self-splicing activity.
[0104] In another preferred embodiment, a1 and a2 are two fragments formed by splitting the ribozyme a.
[0105] In another preferred embodiment, the trans-self-splicing fragment TS1 comprises the ribozyme a and the homology arm sequence z1, and the trans-self-splicing fragment TS1' comprises the homology arm sequence z2.
[0106] In another preferred embodiment, the trans-self-splicing fragment TS1 comprises the homology arm sequence z1, and the trans-self-splicing fragment TS1' comprises the ribozyme a and the homology arm sequence z2.
[0107] In another preferred embodiment, the homology arm sequence z1 and the homology arm sequence z2 are reverse complementary.
[0108] In another preferred embodiment, the reverse complementation comprises full reverse complementation, substantial reverse complementation.
[0109] In another preferred embodiment, the reverse complementation has a nucleotide length of n, 0 < n < 200 nt; preferably, 0 < n < 100 nt; more preferably, 0 < n < 50 nt.
[0110] In another preferred embodiment, the reverse complementary pairing of the homology arm sequences facilitates the reduction of the spatial distance between the self-splicing reaction regions of RNA1 and RNA2.
[0111] In another preferred embodiment, n = 3, the linear RNA fragments each correspond to a precursor molecule of RNA1, RNA2 and RNA3, and the structures of the RNA1, RNA2 and RNA3 are as follows:
[0112] RNA1 comprises the structure: G1-TS1 from 5' end to 3' end;
[0113] RNA2 comprises the structure: TS1'-G2-TS2 from 5' end to 3' end;
[0114] RNA3 comprises the structure: TS2'-G3 from 5' end to 3' end;
[0115] wherein TS1 and TS1' undergo self-splicing reaction to connect the 3' end of G1 with the 5' end of G2;
[0116] TS2 and TS2' undergo self-splicing reaction to connect the 3' end of G2 with the 5' end of G3.
[0117] Thus, a chimeric RNA molecule comprising G1-G2-G3 is obtained.
[0118] In another preferred embodiment, the first splicing reaction occurs between TS1 and TS1', and TS1 / TS1' does not react with TS2 / TS2'.
[0119] In another preferred embodiment, the second splicing reaction occurs between TS2 and TS2', and TS2 / TS2' does not react with TS1 / TS1'.
[0120] In another preferred embodiment, the trans-self-splicing fragment TS1 comprises a ribozyme fragment a1 and a homologous arm sequence z1, and the trans-self-splicing fragment TS1' comprises a ribozyme fragment a2 and a homologous arm sequence z2, wherein ribozyme fragment a1 and ribozyme fragment a2 combine to form a self-splicing active ribozyme a;
[0121] The trans-self-splicing fragment TS2 comprises a ribozyme fragment b1 and a homologous arm sequence y1, and the trans-self-splicing fragment TS2' comprises a ribozyme fragment b2 and a homologous arm sequence y2, wherein ribozyme fragment b1 and ribozyme fragment b2 combine to form a self-splicing active ribozyme b.
[0122] In another preferred embodiment, a1 and a2 are two fragments formed by splitting ribozyme a.
[0123] In another preferred embodiment, b1 and b2 are two fragments formed by splitting ribozyme b.
[0124] In another preferred embodiment, a1 / a2 and b1 / b2 do not interact.
[0125] In another preferred embodiment, homologous arm sequence y1 and homologous arm sequence y2 are reverse complementary.
[0126] In another preferred embodiment, y1 / y2 and z1 / z2 do not substantially complementary pair.
[0127] In another preferred embodiment, the reverse complementarity includes complete reverse complementarity, substantial reverse complementarity.
[0128] In another preferred embodiment, the reverse complementarity has a nucleotide length of n, 0
[0129] In another preferred embodiment, after the reverse complementary pairing of homologous arm sequence z1 and z2, the spatial distance between the self-splicing reaction regions of RNA1 and RNA2 is facilitated to be shortened; and after the reverse complementary pairing of homologous arm sequence y1 and y2, the spatial distance between the self-splicing reaction regions of RNA2 and RNA3 is facilitated to be shortened.
[0130] In another preferred embodiment, the first splicing reaction and the second splicing reaction are not limited in the order, or can be performed simultaneously.
[0131] In another preferred embodiment, TS1 comprises a structure of a1-z1 from 5' end to 3' end; and TS1' comprises a structure of z2-a2 from 5' end to 3' end.
[0132] In another preferred embodiment, TS2 comprises a structure of b1-y1 from 5' end to 3' end; and TS2' comprises a structure of y2-b2 from 5' end to 3' end.
[0133] In another preferred embodiment, the RNA1 and the RNA2 have the following structure:
[0134] The RNA1 comprises a structure of G1-a1-z1 from 5' end to 3' end;
[0135] The RNA2 comprises a structure of z2-a2-G2-b1-y1 from 5' end to 3' end;
[0136] The RNA3 comprises a structure of y2-b2-G3 from 5' end to 3' end.
[0137] In another preferred embodiment, z1 and z2 have a length of 5-50 nt.
[0138] In another preferred embodiment, y1 and y2 have a length of 5-50 nt.
[0139] In another preferred embodiment, TS1 comprises a structure of a-z1 from 5' end to 3' end; and TS1' comprises a structure of z2 from 5' end to 3' end; wherein z1 and z2 are reverse complementary homologous arm fragments, and a is a complete ribozyme a.
[0140] In another preferred embodiment, TS1 comprises a structure of z1 from 5' end to 3' end; and TS1' comprises a structure of z2-a from 5' end to 3' end; wherein z1 and z2 are reverse complementary homologous arm fragments, and a is a complete ribozyme a.
[0141] In another preferred embodiment, TS2 comprises a structure of b-y1 from 5' end to 3' end; and TS2' comprises a structure of y2 from 5' end to 3' end; wherein y1 and y2 are reverse complementary homologous arm fragments; and b is a complete ribozyme b.
[0142] In another preferred embodiment, TS2 comprises a structure of y1 from 5' end to 3' end; and TS2' comprises a structure of y2-b from 5' end to 3' end; wherein y1 and y2 are reverse complementary homologous arm fragments; and b is a complete ribozyme b.
[0143] In another preferred embodiment, z1 and z2 are 10-200 nt in length.
[0144] In another preferred embodiment, y1 and y2 are 10-200 nt in length.
[0145] In another preferred embodiment, the G x The trans-splicing body has a recognition region adjacent to the 5' end and / or the 3' end, and the recognition region comprises a splicing site and a recognition region adjacent to the splicing site.
[0146] In another preferred embodiment, when the trans-splicing body binds to the recognition region, the trans-splicing body undergoes transesterification at the splicing site to form a covalent bond.
[0147] In another preferred embodiment, the splicing site (ss) is characterized by comprising a 5'ss and a 3'ss, wherein the 5'ss is located in the recognition region of the trans-splicing body, the 5'ss forms a U-G mismatch with the internal guide sequence (IGS) of the trans-splicing body, and the upstream and downstream sequences adjacent to the U-G mismatch comprise at least one base complementary pairing.
[0148] In another preferred embodiment, the recognition region is characterized in that the recognition region comprises a 5'ss, the upstream sequence adjacent to the 5'ss forms n base complementary pairings (n≥1, for example, 1-10) with the IGS of the trans-splicing body, and the downstream sequence adjacent to the 5'ss forms n base complementary pairings (n≥1, for example, 1-10) with the IGS of the trans-splicing body, and the continuous sequence composed of the 5'ss and the upstream and downstream nucleotides adjacent to the 5'ss and forming base complementary pairings with the IGS constitutes the recognition region.
[0149] In another preferred embodiment, the recognition region is characterized in that the recognition region comprises a 3'ss, the upstream sequence adjacent to the 3'ss forms n base complementary pairings (n≥1, for example, 1-10) with the IGS of the trans-splicing body, and the downstream sequence adjacent to the 3'ss forms n base complementary pairings (n≥1, for example, 1-10) with the IGS of the trans-splicing body, and the continuous sequence composed of the 3'ss and the upstream and downstream nucleotides adjacent to the 3'ss and forming base complementary pairings with the IGS constitutes the recognition region.
[0150] In another preferred embodiment, the RNA x The RNA comprises one or more chemically modified nucleotides, and the proportion of the modified nucleotides is 0-100%, for example, 25% or 50%.
[0151] In another preferred embodiment, the RNA1-RNA x The type and / or proportion of the modified nucleotides in the RNA1-RNA
[0152] In another preferred embodiment, the modification includes, but is not limited to, pseudouridine (Ψ), N1-methylpseudouridine (m1Ψ), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hm5C), N6-methyladenosine (m6A), 5-methoxyuridine (5moU), 5-methyluridine (m5U), 2-thiouridine (s2U), 2'-O-methylation modification (Nm), or a combination thereof.
[0153] In another preferred embodiment, the RNA1 contains a high proportion of modified nucleotides, and the RNA2 contains no modified nucleotides or a low proportion of modified nucleotides.
[0154] In another preferred embodiment, the RNA1 contains no modified nucleotides or a low proportion of modified nucleotides, and the RNA2 contains a high proportion of modified nucleotides.
[0155] In another preferred embodiment, the high proportion of modified nucleotides means ≥ 25%, such as ≥ 50% or ≥ 75%.
[0156] In another preferred embodiment, the low proportion of modified nucleotides means ≤ 25%, such as ≤ 20% or ≤ 15%.
[0157] In a fourth aspect of the present application, a vector is provided, which comprises the polynucleotide combination as described in the first aspect of the present application, the polynucleotide combination comprising a first RNA and a second RNA.
[0158] In another preferred embodiment, the vector comprises the polynucleotide combination as described in the second aspect of the present application. In another preferred embodiment, the first RNA and the second RNA are located in the same vector.
[0159] In another preferred embodiment, the first RNA and the second RNA are located in different vectors.
[0160] In another preferred embodiment, the vector comprises the polynucleotide combination as described in the third aspect of the present application.
[0161] In another preferred embodiment, the polynucleotide combination comprises RNA1-RNA n n fragments.
[0162] In another preferred embodiment, the RNA1-RNA n are located in the same vector.
[0163] In another preferred embodiment, the RNA1-RNA n are located in different vectors.
[0164] In another preferred embodiment, the vector contains a nucleic acid sequence (e.g., a DNA sequence) for producing the polynucleotide combination as described in the first aspect of the present application, the polynucleotide combination as described in the second aspect of the present application, or the polynucleotide combination as described in the third aspect of the present application.
[0165] In another preferred embodiment, the vector is a plasmid.
[0166] In another preferred embodiment, the vector is a virus-like particle.
[0167] In another preferred embodiment, the vector is a non-virus-like particle.
[0168] In another preferred embodiment, the vector is a viral vector.
[0169] In another preferred embodiment, the vector is a non-viral vector.
[0170] In a fifth aspect of the present application, a method for preparing a circular RNA is provided, comprising steps of:
[0171] A. preparing the polynucleotide combination as described in the second aspect of the present application, comprising a first RNA and a second RNA;
[0172] B. the first RNA and the second RNA undergo a first ligation reaction and a second ligation reaction to generate a target circular RNA; the first ligation reaction is a ribozyme autocatalytic splicing reaction or an enzyme-catalyzed ligation reaction, the second ligation reaction is a ribozyme autocatalytic splicing reaction or an enzyme-catalyzed ligation reaction, and the first ligation reaction and the second ligation reaction are not enzyme-catalyzed ligation reactions at the same time.
[0173] In another preferred embodiment, the first ligation reaction is a ribozyme autocatalytic splicing reaction, and the second ligation reaction is a ribozyme autocatalytic splicing reaction.
[0174] In another preferred embodiment, the first ligation reaction is a ribozyme autocatalytic splicing reaction, and the second ligation reaction is an enzyme-catalyzed ligation reaction.
[0175] In another preferred embodiment, the catalytic enzyme of the enzyme-catalyzed ligation reaction is selected from the following groups: T4 RNA ligase 1, T4 RNA ligase 2, T4 DNA ligase, RtcB RNA ligase, or a combination thereof.
[0176] In another preferred embodiment, the reaction system of the splicing reaction contains magnesium ions.
[0177] In another preferred embodiment, the reaction system of the splicing reaction contains GTP and magnesium ions.
[0178] In another preferred embodiment, when the catalytic enzyme catalyzing the ligation reaction is ligase RtcB, the reaction system of the splicing reaction contains manganese ions.
[0179] In another preferred embodiment, the reaction system contains 0.01 mM-10 mM GTP.
[0180] In another preferred embodiment, the reaction system contains 1 mM-100 mM magnesium ions.
[0181] In another preferred embodiment, the pH value of the reaction system is 5-8.
[0182] In another preferred embodiment, the temperature of the reaction system is 25-65°C.
[0183] In another preferred embodiment, the reaction is carried out in vitro for 5 min-60 min.
[0184] In another preferred embodiment, the first splicing reaction and the second splicing reaction have similar reaction conditions.
[0185] In another preferred embodiment, characterized in that, in the presence of a first ligase, one end of a first RNA is ligated to one end of a second RNA, and in the presence of a second ligase, the other end of the first RNA is ligated to the other end of the second RNA; a circular RNA product containing the sequence of the first RNA and the sequence of the second RNA is generated.
[0186] In another preferred embodiment, the first ligase is a ribozyme, and the ribozyme exists in the form of two trans-self-splicing body fragments TSA1 and TSA2; TSA1 is connected to one end of the first RNA, and TSA2 is connected to one end of the second RNA, and under suitable conditions, a self-splicing reaction occurs to ligate one end of the first RNA to one end of the second RNA.
[0187] In another preferred embodiment, the second ligase is a ribozyme or a protein ligase.
[0188] In another preferred embodiment, the second ligase is a ribozyme, and the ribozyme exists in the form of two trans-self-splicing body fragments TSB1 and TSB2; TSB1 is connected to the other end of the first RNA, and TSB2 is connected to the other end of the second RNA, and under suitable conditions, a self-splicing reaction occurs to ligate the other end of the first RNA to the other end of the second RNA.
[0189] In another preferred embodiment, the second ligase is a protein ligase, which catalyzes the ligation of the other end of the first RNA to the other end of the second RNA under suitable conditions.
[0190] In another preferred embodiment, the protein ligase is selected from the group consisting of T4 DNA ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB RNA ligase, or combinations thereof.
[0191] In another preferred embodiment, the first RNA contains one or more chemical modifications, while the second RNA does not contain any chemical modifications.
[0192] In another preferred embodiment, the first RNA is free of chemical modifications, while the second RNA contains one or more chemical modifications.
[0193] In another preferred embodiment, the first RNA contains one chemical modification and the second RNA contains another chemical modification, the modification ratios of the two chemical modifications being independent of each other.
[0194] In another preferred embodiment, the first RNA contains a chemical modification, and the second RNA contains the same chemical modification, wherein the modification ratios of the chemical modifications in the two RNAs are independent of each other.
[0195] In another preferred embodiment, the circular RNA prepared by the method is a chemically modified RNA.
[0196] In another preferred embodiment, the circular RNA prepared by the method is a chemically modified RNA, wherein the chemical modification is located in a specific sequence region of the circular RNA.
[0197] In a sixth aspect of the invention, a method for preparing a chimeric RNA product is provided, wherein the chimeric RNA product is composed of n linear RNA fragments sequentially linked together, where n ≥ 2; wherein in the chimeric RNA product, the xth linear RNA fragment from the upstream 5' end to the downstream 3' end is named G. x , 1≤x≤n, and x is an integer;
[0198] The method includes the following steps:
[0199] (1) Provide the precursor molecules corresponding to each of the n linear RNA fragments; when 1≤x<n, G x The structure of the precursor molecule includes: G located upstream in the chimeric RNA product. x The 3' end is attached to the trans-self-splicing variant TS, which is located in the G region of the chimeric RNA product. x Downstream G x+1 The 5' end is connected to a reverse self-splicing fragment TS';
[0200] (2) Under suitable conditions, the inverse self-splicing fragments TS and TS' combine and undergo a self-splicing reaction, transferring TS from G... x Upper excision, removing TS' from G x+1 The upper part was excised, and G was removed.x the 3' end of G x+1 is connected to the 5' end of G
[0201] In another preferred embodiment, the n linear RNA fragments each correspond to a precursor molecule named RNA1, RNA2, …, RNA n ; when 1≤x x comprises G x and a trans-splicing fragment TSx located at the 3' end of G x ; RNA x+1 comprises G x+1 and a trans-splicing fragment TSx' located at the 5' end of G x+1 ; the TSx and TSx' combine to form an active self-splicing body, thereby cleaving TSx from RNA x , and cleaving TSx' from RNA x+1 precursor, so that G x and G x+1 are connected together by the ends formed after cleavage.
[0202] The RNA x , RNA x+1 and trans-splicing body are defined as described in the third aspect of the present application.
[0203] In a seventh aspect of the present application, there is provided a circular RNA molecule formed by the combination self-splicing of the polynucleotide as described in the second aspect of the present application, or prepared by the method as described in the fifth aspect of the present application.
[0204] In another preferred embodiment, the circular RNA is selected from the group consisting of a circular mRNA, a circular guide RNA, a circular RNA molecule sponge, a circular interference RNA, a circular RNA aptamer, a circular RNA probe, a circular RNA molecule sensor, a circular RNA molecule diagnostic, a functional non-coding circular RNA, a circular self-replicating RNA, or a combination thereof.
[0205] In another preferred embodiment, the circular RNA has the function of translating a protein, or does not have the function of translating a protein.
[0206] In another preferred embodiment, the circular RNA contains a regulatory region and a functional region.
[0207] In another preferred embodiment, the circular RNA contains a regulatory region and a functional region, the functional region refers to a sequence region that directly exerts the function of the circular RNA (e.g., interacts with other molecules, translates to produce a protein, etc.), and the regulatory region refers to a sequence region that directly or indirectly regulates the function of the circular RNA (e.g., regulates the stability, immunogenicity, protein translation level, etc. of the circular RNA).
[0208] In another preferred embodiment, the regulatory region has one or more sequences selected from the group consisting of: miRNA binding sites, small molecule compound binding sites, protein binding sites, highly structured RNA.
[0209] In another preferred embodiment, the regulatory region is a highly structured RNA, which comprises rich secondary structure and / or three-dimensional structure.
[0210] In another preferred embodiment, the regulatory region is a non-coding region, and the functional region is a coding region.
[0211] In another preferred embodiment, the regulatory region contains a cap-independent translation initiation element.
[0212] In another preferred embodiment, the cap-independent translation initiation element includes, but is not limited to: an internal ribosome entry site (IRES), a Kozak sequence, a cap-independent translation enhancer (CITE), a 5' untranslated region (5'-UTR), a 3' untranslated region (3'-UTR), other elements with cap-independent translation initiation activity, and other future newly discovered elements with cap-independent translation initiation activity. Among them, the mammalian mRNA genes containing CITE include, but are not limited to: human Fibroblast growth factor 9 (FGF-9).
[0213] In another preferred embodiment, the translation initiation element is an internal ribosome entry site (IRES).
[0214] In another preferred embodiment, the IRES sequence includes, but is not limited to, an IRES sequence derived from a species or gene selected from the group consisting of: Coxsackie virus, Echo virus, Polio virus, Rhinovirus, Human rhinovirus, Crickets Paralysis virus, Bovine enterovirus, Enterovirus, Human polio virus, Encephalomyocarditis virus, Hepatitis C virus, Hepatitis A virus, Simian virus, Aphid deadly paralysis virus, Reticulendotheliosis virus, Murine encephalomyelitis virus, Human parainfluenza virus, Bovine viral diarrhea virus, Foot-and-mouth disease virus, Kashmir bee virus, Polio virus, Aphid lethal paralysis virus, Tora syndrome virus, GB virus type C, Bovine rhabdovirus, Kunjin virus, Picornavirus, Swine vesicular disease virus. Human FGF2, Human SFTPA1, Human AMLl / RUNXl, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Human LEF1, Human n-myc, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Human UNR, Human VEGF-A, Human XIAP, Human c-src, Human FGF-1, Drosophila antennapedia, Mouse NDST4L, Mouse HIF1 alpha, Mouse Gtx, Mouse Rbm3, Mouse UtrA, Canine Scamper, Drosophila reaper, Drosophila Ubx, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, or an aptamer of eIF4G.
[0215] In another preferred embodiment, the IRES sequence is a non-natural sequence.
[0216] In another preferred embodiment, the IRES sequence is an IRES sequence of an artificially designed sequence fragment.
[0217] In another preferred embodiment, the functional region contains a CDS sequence.
[0218] In another preferred embodiment, the CDS sequence encodes a prokaryotic protein. In another preferred embodiment, the CDS sequence encodes a eukaryotic protein. In another preferred embodiment, the CDS sequence encodes a native protein. In another preferred embodiment, the CDS sequence encodes a protein engineered based on a native protein. In another preferred embodiment, the CDS sequence encodes a synthetic protein. In another preferred embodiment, the CDS sequence encodes a therapeutic protein. In another preferred embodiment, the CDS sequence encodes one or more antigens. In another preferred embodiment, the CDS sequence encodes a chimeric antigen receptor (CAR). In another preferred embodiment, the CDS sequence encodes a T cell receptor (TCR). In another preferred embodiment, the CDS sequence encodes an antibody. In another preferred embodiment, the CDS sequence encodes a cytokine. In another preferred embodiment, the CDS sequence encodes a fusion protein.
[0219] In another preferred embodiment, the regulatory region contains a miRNA binding site that can bind to a miRNA with tissue distribution specificity, thereby degrading the circular RNA in a specific tissue.
[0220] In another preferred embodiment, the regulatory region contains a plurality of miRNA binding sites, which are the same miRNA binding site or different miRNA binding sites.
[0221] In another preferred embodiment, the circular RNA molecule is a modified circular RNA molecule.
[0222] In another preferred embodiment, the circular RNA contains one or more modified nucleotides.
[0223] In another preferred embodiment, a specific sequence region of the circular RNA contains one or more modified nucleotides.
[0224] In another preferred embodiment, a specific sequence region of the circular RNA contains one modified nucleotide, and another specific sequence region of the circular RNA contains another modified nucleotide, and the two specific sequence regions are different in the type of chemical modification.
[0225] In another preferred embodiment, a specific sequence region of the circular RNA contains one modified nucleotide, and another specific sequence region of the circular RNA contains the same modified nucleotide, and the two specific sequence regions are different in the proportion of chemical modification.
[0226] In another preferred embodiment, the specific sequence region of the circular RNA contains n different types of chemically modified nucleotides (n > 2), and the modification ratios of the plurality of chemical modification types within the specific sequence region are independent of each other (i.e., the modification ratios can all be the same, partially the same, or all different).
[0227] In another preferred embodiment, the chemical modification includes, but is not limited to, pseudouridine (Ψ), N1-methylpseudouridine (m1Ψ), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hm5C), N6-methyladenosine (m6A), 5-methoxyuridine (5moU), 5-methyluridine (m5U), 2-thiouridine (s2U), or a combination thereof.
[0228] In another preferred embodiment, the circular RNA comprises a 5-methylcytosine (m5C) modification.
[0229] In another preferred embodiment, the circular RNA comprises a 5-hydroxymethylcytosine (5hm5C) modification.
[0230] In another preferred embodiment, the circular RNA comprises a 5-methyluridine (m5U) modification.
[0231] In another preferred embodiment, the circular RNA comprises a 2'-O-methylation (Nm) modification.
[0232] In another preferred embodiment, the circular RNA comprises a 2'-O-methylated uridine (Um) modification.
[0233] In another preferred embodiment, the circular RNA comprises a N1-methylpseudouridine (m1Ψ) modification.
[0234] In another preferred embodiment, the regulatory region of the circular RNA comprises a 2'-O-methylation (Nm) modification.
[0235] In another preferred embodiment, the regulatory region of the circular RNA comprises a 2'-O-methylated uridine (Um) modification.
[0236] In another preferred embodiment, the IRES region of the circular RNA comprises a 2'-O-methylation (Nm) modification.
[0237] In another preferred embodiment, the IRES region of the circular RNA comprises a 2'-O-methylated uridine (Um) modification.
[0238] In another preferred embodiment, the IRES region of the circular RNA comprises a 2'-O-methylation (Nm) modification, and the CDS region comprises another chemical modification.
[0239] In another preferred embodiment, the regulatory region of the circular RNA comprises 2'-O-methylated (Nm) modifications and the functional region comprises another chemical modification.
[0240] In another preferred embodiment, the IRES region of the circular RNA comprises 2'-O-methylated uridines (Um) modifications and the CDS region comprises another chemical modification.
[0241] In another preferred embodiment, the regulatory region of the circular RNA comprises 2'-O-methylated uridines (Um) modifications and the functional region comprises another chemical modification.
[0242] In another preferred embodiment, the regulatory region comprises one or more chemically modified nucleotides at a ratio of 0-100%, such as 25% or 50%.
[0243] In another preferred embodiment, the functional region comprises one or more chemically modified nucleotides at a ratio of 0-100%, such as 25% or 50%.
[0244] In another preferred embodiment, the ratio of modified nucleotides in the regulatory region and the functional region is independent of each other.
[0245] In another preferred embodiment, the functional region comprises a high ratio of modified nucleotides and the regulatory region comprises no or a low ratio of modified nucleotides.
[0246] In another preferred embodiment, the functional region comprises no or a low ratio of modified nucleotides and the regulatory region comprises a high ratio of modified nucleotides.
[0247] In another preferred embodiment, a high ratio of modified nucleotides means > 25%, such as > 50% or > 75%.
[0248] In another preferred embodiment, a low ratio of modified nucleotides means < 25%, such as < 20% or < 15%.
[0249] In another preferred embodiment, the chemically modified circular RNA has a controllable immunogenicity, such as a lower immunogenicity than a circular RNA with the same sequence but without the chemical modification.
[0250] In another preferred embodiment, the circular RNA has a controllable immunogenicity, such as a lower or higher immunogenicity.
[0251] In another preferred embodiment, the chemically modified circular RNA molecule has a better drugability than a circular RNA molecule with the same sequence but without the chemical modification.
[0252] In another preferred embodiment, the more superior pharmaceutical properties include:
[0253] (S1) lower immunogenicity;
[0254] (S2) higher protein translation level;
[0255] (S3) higher stability;
[0256] (S4) longer protein translation duration.
[0257] In an eighth aspect of the present application, there is provided a chimeric RNA molecule formed from a polynucleotide as described in the third aspect of the present application by self-splicing, or prepared by the method of the sixth aspect of the present application.
[0258] In another preferred embodiment, the chimeric RNA is selected from the group consisting of a chimeric mRNA, a chimeric guide RNA, a chimeric RNA molecule sponge, a chimeric interfering RNA, a chimeric RNA aptamer, a chimeric RNA probe, a chimeric RNA molecule sensor, a chimeric RNA molecule diagnostic, a functional non-coding chimeric RNA, a chimeric self-replicating RNA, or a combination thereof.
[0259] In another preferred embodiment, the chimeric RNA has a function of translating protein, or has no function of translating protein.
[0260] In another preferred embodiment, the chimeric RNA contains a regulatory region and a functional region.
[0261] In another preferred embodiment, the definition of the regulatory region and the functional region is as described in the seventh aspect of the present application.
[0262] In another preferred embodiment, it is characterized in that the chimeric RNA molecule is a chimeric RNA molecule containing modification.
[0263] In another preferred embodiment, the chimeric RNA contains one or more modified nucleotides.
[0264] In another preferred embodiment, a specific sequence region of the chimeric RNA contains one or more modified nucleotides.
[0265] In another preferred embodiment, a specific sequence region of the chimeric RNA contains one modified nucleotide, another specific sequence region of the chimeric RNA contains another modified nucleotide, and the types of chemical modification of the two specific sequence regions are different.
[0266] In another preferred embodiment, a specific sequence region of the chimeric RNA contains one modified nucleotide, another specific sequence region of the chimeric RNA contains the same modified nucleotide, and the proportions of chemical modification of the two specific sequence regions are different.
[0267] In another preferred embodiment, the specific sequence region of the chimeric RNA contains n different types of chemically modified nucleotides (n≥2), and the modification ratio of the plurality of chemical modification types in the specific sequence region is independent of each other (i.e., the modification ratio can be all the same, partially the same, or all different).
[0268] In another preferred embodiment, the chemical modification is as defined in the seventh aspect of the present application.
[0269] In another preferred embodiment, the chimeric RNA is a self-replicating RNA or a non-replicating RNA.
[0270] In another preferred embodiment, the chimeric RNA is a self-replicating RNA.
[0271] In another preferred embodiment, the self-replicating RNA comprises a 5’-Cap, a 5’-UTR, non-structural proteins 1-4 (NSP1-NSP4), a subgenomic promoter, a gene of interest (GOI), a 3’-UTR, and a polyA tail.
[0272] In another preferred embodiment, the non-structural proteins of the self-replicating RNA are derived from an alphavirus.
[0273] In another preferred embodiment, the alphavirus is selected from the group consisting of Venezuelan equine encephalitis virus (TC83 Venezuelan Equine Encephalitis Virus, VEEV), Sindbis virus (SINV), Semliki Forest virus (SFV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Western equine encephalitis virus, Mayaro virus, Semliki forest virus, Venezuelan equine encephalitis virus, or a combination thereof.
[0274] In another preferred embodiment, the gene of interest of the self-replicating mRNA contains a sequence encoding one or more antigens.
[0275] In another preferred embodiment, the specific region of the self-replicating mRNA contains one or more chemical modifications. In another preferred embodiment, the specific region of the self-replicating mRNA does not contain any chemical modification.
[0276] In another preferred embodiment, the specific region of the self-replicating mRNA comprises one or more chemical modifications, another specific region of the self-replicating mRNA does not comprise any chemical modification, and the self-replicating mRNA has a superior innate immunogenicity and protein translation level than a self-replicating mRNA of the same sequence but without any chemical modification, or a self-replicating mRNA of the same sequence but with random same type of chemical modifications throughout the sequence.
[0277] In another preferred embodiment, the chemical modifications comprised in the specific region of the self-replicating mRNA include, but are not limited to, pseudouridine (Ψ), N1-methylpseudouridine (m1Ψ), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hm5C), N6-methyladenosine (m6A), 5-methoxyuridine (5moU), 5-methyluridine (m5U), 2-thiouridine (s2U), 2'-O-methylation modification (Nm), or a combination thereof.
[0278] In another preferred embodiment, the self-replicating mRNA comprises 5-methylcytosine (m5C) modification.
[0279] In another preferred embodiment, the self-replicating mRNA comprises 5-hydroxymethylcytosine (5hm5C) modification.
[0280] In another preferred embodiment, the self-replicating mRNA comprises 5-methyluridine (m5U) modification.
[0281] In another preferred embodiment, the self-replicating mRNA comprises 2'-O-methylation uridine (Um) modification.
[0282] In another preferred embodiment, one region of the self-replicating mRNA comprises 5-methylcytosine (m5C) modification, and another region comprises one or more chemical modifications.
[0283] In another preferred embodiment, one region of the self-replicating mRNA comprises 5-hydroxymethylcytosine (5hm5C) modification, and another region comprises one or more chemical modifications.
[0284] In another preferred embodiment, the chimeric RNA with chemical modifications has controllable immunogenicity, for example, lower immunogenicity than a chimeric RNA of the same sequence but without modification.
[0285] In another preferred embodiment, the chimeric RNA has controllable immunogenicity, for example, lower immunogenicity or higher immunogenicity.
[0286] In another preferred embodiment, the chimeric RNA with chemical modifications has superior drugability properties compared to a chimeric RNA molecule with the same sequence but without chemical modifications.
[0287] In another preferred embodiment, the more preferable drug property includes: (S5) when the modified RNA is self-replicating RNA, the self-replicating activity is not affected, or substantially not affected.
[0288] In a ninth aspect of the present application, a composition is provided, comprising: (a) the polynucleotide combination of the first aspect of the present application, the polynucleotide combination of the second aspect of the present application, the polynucleotide combination of the third aspect of the present application, the circular RNA of the seventh aspect of the present application, the chimeric RNA of the eighth aspect of the present application, or a combination thereof; and (b) a pharmaceutically acceptable carrier.
[0289] In another preferred embodiment, the composition comprises: (a) the polynucleotide combination of the second aspect of the present application, or the circular RNA of the seventh aspect of the present application.
[0290] In another preferred embodiment, the composition comprises: (a) the polynucleotide combination of the third aspect of the present application, or the chimeric RNA of the eighth aspect of the present application.
[0291] In another preferred embodiment, the composition is a pharmaceutical composition.
[0292] In another preferred embodiment, the pharmaceutical composition comprises a vaccine composition.
[0293] In another preferred embodiment, the pharmaceutical composition is used for generating a protein in vivo.
[0294] In another preferred embodiment, the pharmaceutical composition is used for generating a chimeric antigen receptor (CAR) or a T cell receptor (TCR) in vivo.
[0295] In another preferred embodiment, the pharmaceutically acceptable carrier is a modified lipid nanoparticle (LNP).
[0296] In another preferred embodiment, the modified lipid nanoparticle has a targeted delivery function.
[0297] In another preferred embodiment, the modified lipid nanoparticle can target the encapsulated circular RNA to T cells to generate CAR-T cells.
[0298] In another preferred embodiment, the modified lipid nanoparticle can target the encapsulated circular RNA to monocytes to generate CAR-M cells.
[0299] In another preferred embodiment, the modified lipid nanoparticle can target the encapsulated circular RNA to macrophages to generate CAR-macrophage (CAR-Mac).
[0300] In another preferred embodiment, the modified lipid nanoparticle is capable of targeted delivery of the encapsulated circular RNA to NK cells, resulting in CAR-NK cells.
[0301] In another preferred embodiment, the CAR-T, CAR-M, CAR-Mac, CAR-NK is generated in vitro.
[0302] In another preferred embodiment, the CAR-T, CAR-M, CAR-Mac, CAR-NK is generated in vivo.
[0303] In another preferred embodiment, the pharmaceutical composition is a liquid formulation, a solid formulation, a gel formulation.
[0304] In another preferred embodiment, the pharmaceutical composition is administered by a method selected from the group consisting of: gene gun injection, intravenous injection, intratumoral injection, intramuscular injection, intramyelinic injection, intradermal injection, subcutaneous injection, intranodular, nasal inhalation, mucosal infiltration, microneedle.
[0305] In another preferred embodiment, the composition is used to reprogram a mammalian cell in vitro or in vivo.
[0306] In another preferred embodiment, the composition is used to reprogram a mammalian stem cell in vitro or in vivo.
[0307] In another preferred embodiment, the composition is used to edit a mammalian cell in vitro or in vivo.
[0308] In another preferred embodiment, the composition is used to edit a mammalian stem cell in vitro or in vivo.
[0309] In a tenth aspect of the present application, a cell is provided, which contains the vector as described in the fourth aspect of the present application, or contains the circular RNA as described in the seventh aspect of the present application, or contains the chimeric RNA as described in the eighth aspect of the present application, or contains the pharmaceutical composition as described in the ninth aspect of the present application, or has integrated into its genome the coding sequence of the polynucleotide combination as described in the first aspect of the present application, the polynucleotide combination as described in the second aspect of the present application, or the polynucleotide combination as described in the third aspect of the present application.
[0310] In another preferred embodiment, the cell is a mammalian host cell.
[0311] In another preferred embodiment, the host cell is a tumor cell. In another preferred embodiment, the host cell is a non-tumor cell.
[0312] In another preferred embodiment, the host cell is a stem cell.
[0313] In another preferred embodiment, the host cell is an immune cell. In another preferred embodiment, the host cell is a human T cell. In another preferred embodiment, the cell population comprises human monocytes. In another preferred embodiment, the host cell is a human macrophage. In another preferred embodiment, the host cell is a human NK cell. In another preferred embodiment, the host cell is a human tumor infiltrating lymphocyte (TIL).
[0314] In an eleventh aspect of the present application, a method of producing a cell as described in the tenth aspect of the present application is provided, the method comprising: contacting the cell with a composition comprising (a) the polynucleotide combination of the first aspect of the present application, the polynucleotide combination of the second aspect of the present application, the polynucleotide combination of the third aspect of the present application, the vector of the fourth aspect of the present application, the circular RNA of the seventh aspect of the present application, the chimeric RNA of the eighth aspect of the present application, the composition of the ninth aspect of the present application, or a combination thereof; and (b) a delivery vehicle for delivering the composition to the cell.
[0315] In another preferred embodiment, the delivery vehicle is selected from the group consisting of a lipid nanoparticle, a liposome, a polymeric carrier, a polypeptide carrier, protamine, a cell-penetrating peptide carrier, an extracellular vesicle, an exosome, or a combination thereof.
[0316] In another preferred embodiment, the delivery vehicle comprises a modified group.
[0317] In another preferred embodiment, the modified group increases the efficiency of the composition entering the cell.
[0318] In another preferred embodiment, the method does not comprise a delivery vehicle, and the composition is delivered into the cell directly by electroporation transfection.
[0319] In a twelfth aspect of the present application, a cell population is provided, the cells of the cell population comprising the vector of the fourth aspect of the present application, or the circular RNA of the seventh aspect of the present application, or the chimeric RNA of the eighth aspect of the present application, or the composition of the ninth aspect of the present application, or a coding sequence of the polynucleotide combination of the first aspect of the present application, the polynucleotide combination of the second aspect of the present application, or the polynucleotide combination of the third aspect of the present application integrated in the genome.
[0320] In another preferred embodiment, the cell population comprises a mammalian host cell.
[0321] In another preferred embodiment, the cell population comprises a stem cell.
[0322] In another preferred embodiment, the cell population comprises a tumor cell.
[0323] In another preferred embodiment, the cell population contains non-tumor cells.
[0324] In another preferred embodiment, the cell population contains immune cells.
[0325] In another preferred embodiment, the cell population contains human T cells.
[0326] In another preferred embodiment, the cell population contains human monocytes.
[0327] In another preferred embodiment, the cell population contains human macrophages.
[0328] In another preferred embodiment, the cell population contains human NK cells.
[0329] In another preferred embodiment, the cell population contains human tumor infiltrating lymphocytes (TILs).
[0330] In another preferred embodiment, the cell population contains human B cells.
[0331] In a thirteenth aspect of the present application, a method for producing the cell population of the twelfth aspect of the present application is provided, characterized in that the method comprises: contacting cells of the cell population with a composition comprising (a) the polynucleotide combination of the first aspect of the present application, the polynucleotide combination of the second aspect of the present application, the polynucleotide combination of the third aspect of the present application, the vector of the fourth aspect of the present application, the circular RNA of the seventh aspect of the present application, the chimeric RNA of the eighth aspect of the present application, the composition of the ninth aspect of the present application, or a combination thereof; and (b) a delivery vehicle for delivering the composition to the cells.
[0332] In another preferred embodiment, the delivery vehicle is selected from the group consisting of a lipid nanoparticle, a liposome, a polymeric carrier, a polypeptide carrier, protamine, a cell-penetrating peptide carrier, an extracellular vesicle, an exosome, or a combination thereof.
[0333] In another preferred embodiment, the delivery vehicle comprises a modified group.
[0334] In another preferred embodiment, the modified group is capable of increasing the efficiency of the composition entering the cells.
[0335] In another preferred embodiment, the method does not comprise a delivery vehicle, and the composition is delivered into the cells directly by electroporation transfection.
[0336] In a fourteenth aspect of the application, there is provided the use of a polynucleotide combination according to the first aspect of the application, a polynucleotide combination according to the second aspect of the application, a polynucleotide combination according to the third aspect of the application, a vector according to the fourth aspect of the application, a circular RNA according to the seventh aspect of the application, a chimeric RNA according to the eighth aspect of the application, a composition according to the ninth aspect of the application, a cell according to the tenth aspect of the application, a population of cells according to the twelfth aspect of the application, characterized in that it is for the manufacture of a pharmaceutical composition.
[0337] In another preferred embodiment, the pharmaceutical composition is a vaccine composition.
[0338] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding an antibody and a delivery vehicle.
[0339] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a fusion protein and a delivery vehicle.
[0340] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a cytokine and a delivery vehicle.
[0341] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a tumor neoantigen and a delivery vehicle.
[0342] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a transcription factor and a delivery vehicle.
[0343] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding Yamanaka factors and a delivery vehicle.
[0344] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a chimeric antigen receptor and a delivery vehicle targeting T cells.
[0345] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a chimeric antigen receptor and a delivery vehicle targeting monocytes.
[0346] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a chimeric antigen receptor and a delivery vehicle targeting macrophages.
[0347] In another preferred embodiment, the pharmaceutical composition is a pharmaceutical composition comprising a circular mRNA encoding a chimeric antigen receptor and a delivery vehicle targeting NK cells.
[0348] In another preferred embodiment, the pharmaceutical composition is used for treating a disease selected from the group consisting of a tumor, an autoimmune disease, an infectious disease, tissue fibrosis, aging, or a combination thereof.
[0349] In a fifteenth aspect of the present application, there is provided a method of treating a disease, administering to a subject in need thereof a polynucleotide combination as described in the first aspect of the present application, a polynucleotide combination as described in the second aspect of the present application, a polynucleotide combination as described in the third aspect of the present application, a vector as described in the fourth aspect of the present application, a circular RNA as described in the seventh aspect of the present application, a chimeric RNA as described in the eighth aspect of the present application, a composition as described in the ninth aspect of the present application, a cell as described in the tenth aspect of the present application, or a cell population as described in the twelfth aspect of the present application.
[0350] In another preferred embodiment, the disease is selected from the group consisting of a tumor, an autoimmune disease, an infectious disease, tissue fibrosis, aging, or a combination thereof.
[0351] In another preferred embodiment, the subject comprises a human and other mammals.
[0352] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described hereinafter (e.g., in the examples) can be combined with each other to constitute a new or preferred technical solution. Due to the limited space, they are not listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0353] FIG. 1 shows a typical case of spliceosome-dependent cis-splicing.
[0354] FIG. 2 shows a typical case of cis-splicing based on self-splicing introns. FIG. 2A shows cis-splicing based on group I introns. FIG. 2B shows cis-splicing based on group II introns.
[0355] FIG. 3 shows the principle of cis-splicing reaction based on group I self-splicing introns. FIG. 3A shows the common features of group I cis-splicing introns. FIG. 3B shows a simplified schematic diagram of two-step trans-fatty reaction in group I intron cis-splicing.
[0356] FIG. 4 shows cis-splicing circularization based on permutation intron exon (PIE). FIG. 4A shows the production of circular RNA products containing scar sequences in the classical PIE circularization. FIG. 4B shows the production of scar-free circular RNA products in the optimized PIE circularization system.
[0357] Figure 5 shows random base modification in PIE-based cis-splicing cyclization. Figure 5A shows a schematic diagram of random introduction of chemical modification in classic PIE cyclization reduces cyclization efficiency or leads to cyclization failure. Figure 5B shows a schematic diagram of random introduction of chemical modification in scarless PIE cyclization reduces cyclization efficiency or leads to cyclization failure.
[0358] Figure 6 shows that random modification of circular mRNA affects the protein translation activity of IRES.
[0359] Figure 7 shows that different RNA fragments fold to form ribozymes with self-splicing function. Figure 7A shows that natural trans-splicing ribozymes or fragments split from natural ribozymes can correctly fold into active conformation. Figure 7B, 7C, 7E show that different modification strategies are used to avoid the influence on the active conformation of self-splicing ribozymes. Figure 7D shows that chemical modification significantly affects the active conformation of self-splicing ribozymes.
[0360] Figure 8 shows a schematic diagram of the principle of trans-splicing method for precise ligation of different RNA fragments.
[0361] Figure 9 shows the principle of trans-splicing based on split fragments of self-splicing intron ribozymes. Figure 9A shows the process of placing two fragments of trans-splicing TSSP at the ends of two RNA molecules, respectively, to connect the two RNA molecules through trans-splicing. Figure 9B shows the composition of trans-splicing TSSP. Figure 9C shows the G1, TS1, TS2 and G2 modules contained in the trans-splicing precursor molecule, and the final chimeric RNA molecule.
[0362] Figure 10 shows a trans-splicing system based on integrated self-splicing introns. Figure 10A shows the process of placing integrated trans-splicing body TSSP at the end of one RNA molecule, and designing the recognition site of TSSP at the end of another RNA molecule, to connect the two RNA molecules through trans-splicing. Figure 10B shows the composition of integrated trans-splicing body TSSP. Figure 10C shows the G1, TS1, TS2 and G2 modules contained in the integrated trans-splicing precursor molecule, and the final chimeric RNA molecule.
[0363] Figure 11 shows that in the TScircle system, the two splicing reactions occur in sequence when preparing circular RNA.
[0364] Figure 12 shows that in the TScircle system, the two splicing reactions occur separately when preparing circular RNA.
[0365] Figure 13 shows a schematic diagram of the process of synthesizing target circular RNA in the TScircle system.
[0366] Figure 14 shows the synthesis of site-specifically modified circular RNAs by TScircle system (two splicing reactions occur in sequence).
[0367] Figure 15 shows the synthesis of site-specifically modified circular RNAs by TScircle system (two splicing reactions occur simultaneously).
[0368] Figure 16 shows the flowchart of the synthesis of site-specifically modified target circular RNAs by TScircle system.
[0369] Figure 17 shows the flowchart of the synthesis of site-specifically modified target circular RNAs by TScircle system, different sequence regions are introduced with different proportions of chemical modifications.
[0370] Figure 18 shows the flowchart of the synthesis of site-specifically modified target circular RNAs by TScircle system, different sequence regions are introduced with different types of chemical modifications.
[0371] Figure 19 shows the controllable chemical modification of TSSP self-splicing ribozyme fragments in TScircle system.
[0372] Figure 20 shows the influence of different site-specific modification strategies on the drug properties of circular mRNA, modification of IRES region reduces protein translation level. Figure 20A shows the case of site-specific modification of CDS region but keeping IRES region unmodified. Figure 20B shows the case of site-specific modification of IRES region but keeping CDS region unmodified.
[0373] Figure 21 shows the influence of different site-specific modification strategies on the drug properties of circular mRNA, modification strategies compatible with IRES translation initiation activity. Figure 21A shows the case of site-specific introduction of modification types that do not affect IRES activity in IRES region to avoid affecting IRES activity. Figure 21B shows the case of site-specific introduction of lower proportion of chemical modification in IRES region to avoid affecting IRES activity.
[0374] Figure 22 shows the realization of high-efficiency circular RNA preparation based on TScircle system. Figure 22A shows the schematic diagram of RNA-1 and RNA-2 forming circular RNA molecules by trans-splicing. Figure 22B shows the gel electrophoresis detection of RNA-1, RNA-2 and the product after trans-splicing circularization. Figure 22C shows whether the sequence near the two trans-splicing positions in the purified circular RNA product is correct detected by Sanger sequencing method.
[0375] Figure 23 shows CDS region of circular mRNA is site-directed modified 5%, 10%, 25%, 50% and 100% m6A based on TScircle system. Figure 23A shows the results of 5% modification ratio, Figure 23B shows the results of 10% modification ratio, Figure 23C shows the results of 25% modification ratio, Figure 23D shows the results of 50% modification ratio, Figure 23D shows the results of 100% modification ratio.
[0376] Figure 24 shows CDS region of circular mRNA is site-directed modified 50% m1Ψ based on TScircle system.
[0377] Figure 25 shows CDS region of circular mRNA is site-directed modified 50% 5moU based on TScircle system.
[0378] Figure 26 shows the immunogenicity of circular mRNA site-directed modified N1- methylpseudouridine in cells.
[0379] Figure 27 shows the dynamic changes of protein expression of circular mRNA site- directed modified N1-methylpseudouridine in cells.
[0380] Figure 28 shows the dynamic changes of protein expression of circular mRNA site- directed modified 5moU in cells.
[0381] Figure 29 shows the dynamic changes of protein expression of circular mRNA site- directed modified m6A in cells.
[0382] Figure 30 shows the protein translation duration of circular mRNA site-directed modified further prolongs the CDS sequence optimization.
[0383] Figure 31 shows a typical case of intracellular trans-splicing dependent on helper factors. Intracellular trans-splicing dependent on helper factors achieves replacement of RNA fragments.
[0384] Figure 32 shows the principle schematic diagram of TSmod system precisely connecting 2 RNA fragments.
[0385] Figure 33 shows the principle schematic diagram of TSmod system precisely connecting 3 RNA fragments.
[0386] Figure 34 shows the schematic diagram of TSmod system connecting RNA fragments to form chimeric RNA.
[0387] Figure 35 shows a simplified schematic diagram of TSmod system synthesizing linear RNA with controllable modification of specific fragments.
[0388] Figure 36 shows a schematic diagram of the process of synthesizing linear RNA with controllable modification of specific fragments by TSmod system, introducing one type of chemical modification in one specific region of the target chimeric RNA.
[0389] Figure 37 shows a schematic diagram of the process of synthesizing linear RNA with controllable modification of specific fragments by TSmod system, introducing one type of chemical modification in one specific region of the target chimeric RNA, and introducing the same type of modification in another region but with different modification ratios.
[0390] Figure 38 shows a schematic diagram of the process of synthesizing linear RNA with controllable modification of specific fragments by TSmod system, introducing one type of chemical modification in one specific region of the target chimeric RNA, and introducing another type of chemical modification in another specific region, with the modification ratios of different types of chemical modifications being independently controlled.
[0391] Figure 39 shows a schematic diagram of the process of synthesizing linear RNA with controllable modification of specific fragments by TSmod system, introducing one type of chemical modification in one specific region of the target chimeric RNA, and introducing another type of chemical modification in another specific region, with the modification ratios of different types of chemical modifications being independently controlled, and the modification of ribozyme fragments can be independently controlled.
[0392] Figure 40 shows the effect of different site-specific modification schemes in TSmod system on the drug properties of non-replicating mRNA. TSmod can achieve independent chemical modification in 5'-UTR, CDS, and 3'-UTR regions, respectively, to achieve better overall performance.
[0393] Figure 41 shows the effect of different site-specific modification schemes in TSmod system on the drug properties of self-replicating mRNA. TSmod can achieve independent chemical modification in 5'-UTR, NSP1-4, GOI, and 3'-UTR regions, respectively, to achieve better overall performance.
[0394] Figure 42 shows efficient RNA fragment ligation based on TSmod system. As shown in the figure, RNA1 and RNA2 form the target RNA molecule by trans-splicing, and the gel electrophoresis results are shown in Figure 42A using the first set of TSSP and Figure 42B using the second set of TSSP. Different TSSP can efficiently connect RNA fragments to form target RNA molecules.
[0395] Figure 43 shows efficient site-specific modified RNA preparation based on TSmod system. Gel electrophoresis results of RNA1 and RNA2 forming the target RNA molecule by trans-splicing, where different ratios of m1Ψ modification or m6A modification are introduced in RNA1, and no chemical modification is contained in RNA2 fragment. DETAILED DESCRIPTION
[0396] Through extensive and in-depth research, the inventors have developed a method for preparing site-specific controllable modified RNA. Specifically, the present application provides a trans-splicing pair for connecting two RNA molecules, which are respectively arranged at the ends of the two RNA molecules. The two ends of the two independent linear RNA molecules are connected by a trans-splicing reaction to synthesize a circular RNA molecule. The types and levels of chemical modification of the two linear RNA molecules can be independently regulated, and then connected to form a circular RNA, thereby achieving controllable and partial chemical modification of the circular RNA molecule. At the same time, the method of the present application has high cyclization efficiency and can achieve the purpose of improving the function of the circular RNA, breaking through the development bottleneck of chemically modified circular RNA vaccines and drugs, and has broad application prospects.
[0397] The method of the present application can also be used to prepare site-specific controllable modified chimeric RNA molecules. The two ends of the two independent linear RNA molecules are connected by a trans-splicing reaction. By designing the trans-splicing pair and the target RNA molecule, multiple RNA molecules can be sequentially connected in a predetermined manner to synthesize a chimeric RNA molecule. The types and levels of chemical modification of the multiple linear RNA molecules can be independently regulated, and then connected to form a chimeric RNA, thereby achieving controllable chemical modification of specific fragments of the RNA molecule. The method of the present application has the advantages of high connection efficiency and good specificity, and can introduce specific types and proportions of chemical modifications at designated regions of the target RNA molecule, thereby achieving the purpose of improving the function of the RNA, breaking through the common bottleneck of random chemical modification in the development of RNA vaccines and drugs, and having broad application prospects. On this basis, the present application is completed.
[0398] Chemical modification of RNA
[0399] As used herein, the terms "chemical modification of RNA", "chemically modified RNA", "modified RNA", "modRNA", "chemically modified nucleoside", "chemically modified nucleotide", "chemically modified nucleic acid", "nucleotide modification", "base modification" are used interchangeably. As used herein, "chemical modification" and "modification" are used interchangeably.
[0400] Chemically modified RNA has the advantages of stability, low immunogenicity and good function. Chemical modification is widely used in the development of RNA vaccines and drugs, such as siRNA, aptamer, ASO, sgRNA, mRNA, etc.
[0401] Unmodified RNA molecules can cause a strong immune response when introduced into the human body. This innate immune response can in turn affect the function of the RNA molecules, for example, accelerating the degradation of mRNA and inhibiting the protein translation process of mRNA. In general, unmodified mRNA molecules activate the innate immune system by stimulating Toll-like receptors (mainly TLR3, TLR7 and TLR8). In addition, 5'-triphosphate RNA mediates the activation of the RNA response immune sensor (RIG-I). RIG-I is a pathogenic RNA sensor that is ubiquitous in mammalian cells. After the 5'-triphosphate-containing RNA molecule enters the cytoplasm, it will stimulate the RIG-I sensor, thereby activating the secretion of type I interferons. When the mRNA molecule contains modified nucleosides, the activation of TLRs and RIG-I can be significantly inhibited, thereby reducing the immunogenicity of the nucleoside-modified mRNA molecule. In addition, mRNA containing chemically modified nucleotides has also been found to have better stability.
[0402] Different types of chemical modifications have diverse functions, and the proportion of modifications that function when endogenously modified varies greatly, and their functions are related to the distribution area of the chemical modification on the RNA molecule. This poses a challenge to how to accurately introduce chemical modifications into RNA molecules in vitro. First, the function of chemical modification is closely related to its location. Second, the proportion of modifications required for the function of chemical modification varies. In addition, chemical modification can disrupt the normal function of certain RNA elements, and the compatibility of programmable elements with chemical modification needs to be addressed. In summary, the widely used random modification method has many limitations, and the limitations of the existing modification strategy need to be addressed to achieve precise performance optimization of RNA vaccines and drugs and promote the development of RNA vaccines and drugs. In view of this common bottleneck, the present application discloses a method for efficiently synthesizing linear RNA with site-specific and controllable modifications.
[0403] In the present application, the type of modification is not limited, for example, including various naturally occurring modified nucleosides: pseudouridine (Ψ), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 5-methoxyuridine (5moU), 5-methyluridine (m5U), 2-thiouridine (s2U), 2'-O-methylation modification (Nm), but not limited to. Among them, in mammalian cells, m6A and pseudouracil (Ψ) modification are the two most common mRNA modification methods. m6A modification on mRNA can affect mRNA degradation, translation, nuclear export, splicing, etc., and Ψ modification is crucial for reducing the immunogenicity of exogenously synthesized mRNA.
[0404] Self-splicing ribozyme
[0405] The ribozyme described in the present application is a ribozyme with self-splicing activity. The self-splicing ribozyme, also known as a self-splicing intron, is a type of RNA sequence with splicing activity, widely present in the intron region of mRNA, tRNA, and rRNA in animals, plants, bacteria, and viruses. The self-splicing ribozyme is widely involved in the removal of intron fragments and the connection of exon fragments in the maturation process of pre-mRNA in mammalian cells, which requires the participation of a spliceosome. The process is schematically shown in FIG. 1. The self-splicing ribozyme described in the present application includes Group I intron and Group II intron.
[0406] The self-splicing principle of Group I intron is shown in FIG. 2A. Under natural conditions, in the RNA sequence containing Group I intron, the ribozyme intron is located between two exons, forming a structure of 5'Exon-ribozyme-3'Exon. The specific process is shown in FIG. 3, wherein the 3' end of 5'Exon contains a 5' splice site (5'ss), and the 5' end of 3'Exon contains a 3' splice site (3'ss). The 3' end of 5'Exon forms a complementary pairing with the internal guide sequence (IGS) in the intron ribozyme, the 5'ss is U, which forms a U-G mismatch with G in the IGS sequence, and the U-G mismatch is the key to the trans-esterification reaction, and the 3'ss is G. The final product of the splicing reaction is the formation of a covalent bond between 5'ss and 3'ss. There are two trans-esterification reactions in this process. The first trans-esterification reaction is that the free G attacks 5'ss to expose -OH, and the second trans-esterification reaction is that the -OH of 5'ss attacks 3'ss to form a phosphodiester bond between 5'ss and 3'ss. FIG. 3B shows the simplified two-step trans-esterification process.
[0407] The self-splicing principle of Group II intron is shown in FIG. 2B. Group II intron is a highly structured ribozyme widely distributed in nature, with a conserved secondary structure, containing six domains (I to VI), which recognize the flanking 5' and 3' exons through Watson Crick base pairing between the intron "EBS" (exon binding site) and exon "IBS" (intron binding site) sequences.
[0408] RNA circularization mediated by self-splicing ribozyme
[0409] A self-splicing ribozyme can circularize a linear RNA molecule to a circular RNA molecule. As used herein, “circular RNA”, “circular RNA”, “circular RNA”, “circRNA”, “RNA circle” are used interchangeably.
[0410] In nature, the purpose of the self-splicing reaction mediated by group I or group II intron is to remove a specific nucleic acid fragment inside the RNA sequence. Based on this principle, by rearranging the group I or group II intron ribozyme, a construct for producing circular RNA can be formed, which is called PIE (permuted intron exon). The PIE circularization method has the advantages of high circularization efficiency, simple reaction system, easy scale-up, etc., and is the mainstream technology for preparing circular RNA at present.
[0411] The PIE method based on the principle of self-splicing is a commonly used method for preparing circular RNA molecules, and has significant advantages in circularizing long RNA molecules, for example, circular RNA for therapeutic use, which usually needs to be circularized in an in vitro reaction system (such as mRNA molecules encoding vaccine or therapeutic proteins), has the advantages of high circularization efficiency and simple process. In recent years, various circularization systems based on the PIE principle have been reported for preparing scar-containing circular RNA (Figure 4A) and scar-free circular RNA (Figure 4B).
[0412] The PIE strategy is to split and rearrange the intron ribozyme with splicing activity, design at both ends of the RNA sequence to be circularized, and then circularize the RNA molecule through the self-splicing reaction of the ribozyme. In addition, the intron ribozyme with splicing activity can also be redesigned and placed at one end of the RNA molecule to be circularized, and the other end of the RNA molecule to be circularized contains the recognition sequence and the splicing site of the ribozyme. With the help of the ribozyme recognition sequence, the splicing donor site in the ribozyme sequence and the splicing acceptor site at the other end of the RNA to be circularized are close in space, thereby triggering the occurrence of the ribozyme trans-fat reaction, realizing the circularization of circular RNA.
[0413] Chemical modification of circular RNA molecules
[0414] For the aforementioned PIE ribozyme autocatalytic circularization method, whether the ribozyme is split and placed at both ends or the ribozyme is placed at one end, it is difficult to achieve chemical modification of the circular RNA molecule. In the process of preparing linear circular RNA precursor molecules, natural nucleotides in the reaction system can be replaced by a certain proportion (part or all) of nucleotides containing chemical modifications, thereby preparing circular RNA containing chemical modifications, but in this strategy, the modification is random, which can lead to the failure of the modified precursor RNA molecule to fold correctly, resulting in the destruction of the ribozyme activity and the failure of circularization (Figure 5A, Figure 5B).
[0415] The reason is that random modification of precursor RNA molecules will lead to random modification of ribozyme fragments. Ribozymes need to rely on the correct folding of the spatial structure to function, and random modification may cause the ribozyme to be unable to fold correctly and affect activity.
[0416] In addition, random modification of bases may also affect the function of regulatory sites. Circular RNA molecules may contain various sequence regions for regulatory functions, including IRES sequence modules for initiating protein translation, miRNA binding sites for regulating circular RNA-specific degradation, and protein binding sites for regulating the biological function of circular RNA. Random modification may seriously affect the function of these sequence regions. For example, the translation initiation activity of the IRES sequence depends on the correct folding structure of the IRES module. Studies have found that the incorporation of modified bases at random will affect the structure of the IRES in an unpredictable way, thereby affecting its efficiency in initiating protein translation and reducing the function of circular mRNA (as shown in Figure 6). In addition, studies have found that pseudouridine modification can weaken the binding activity of the miRNA binding site, and thus may affect the design of miRNA-responsive circular RNA.
[0417] In order to overcome the above problems, the present application provides a preparation strategy for circular RNA capable of introducing chemical modification in a specified region (or avoiding chemical modification in a specified region). The strategy connects two linear RNA fragments end to end in sequence, and realizes circularization through two ligation reactions, thereby producing circular RNA. By performing any type and any proportion of chemical modification on the specified fragment, high-efficiency preparation of the circular RNA molecule with site-specific modification is realized. The key of the strategy lies in the selection and improvement of the ligation method for RNA fragments.
[0418] Random chemical modification and site-specific controllable chemical modification of linear RNA
[0419] RNA molecules may contain various sequence regions for regulatory functions, and random modification of bases may affect the function of regulatory sites. The regulatory templates of RNA include but are not limited to: IRES sequence modules for initiating protein translation, miRNA binding sites for regulating RNA-specific degradation, and protein binding sites for regulating the biological function of RNA.
[0420] Random modification can severely affect the function of the regulatory sequence region. For example, the translation initiation activity of IRES sequence depends on the correct folding structure of IRES module. Studies have found that the random incorporation of modified bases will affect the structure of IRES in an unpredictable way, thereby affecting its efficiency in initiating protein translation and reducing the function of mRNA. In addition, the proportion of pseudouridine modification will weaken the binding activity of the miRNA binding site, thus affecting the design of miRNA-responsive RNA.
[0421] To overcome the above problems, the present application provides a preparation strategy of RNA capable of introducing chemical modification in a specified region (or avoiding chemical modification in a specified region). The strategy connects two RNA fragments end to end to produce a chimeric RNA, and through any type and any proportion of chemical modification of the specified fragment, the efficient preparation of a site-specific and controllable modified RNA molecule is achieved.
[0422] Function and chemical modification of self-replicating mRNA
[0423] Self-replicating mRNA (srRNA) is a type of mRNA molecule that has the function of replicating its own RNA sequence in cells, which is very different from traditional mRNA (non-replicating mRNA). In terms of sequence composition, traditional mRNA contains 5' cap (5'-Cap), 5' untranslated region (5'-UTR), gene of interest (GOI), 3' untranslated region (3'-UTR), and polyA tail; in addition to the components of non-replicating mRNA, self-replicating RNA also contains self-replicating components. For example, self-replicating mRNA contains 5'-Cap, 5'-UTR, non-structural protein 1-4 (NSP1-4), subgenomic promoter, gene of interest (GOI), 3'-UTR, and polyA tail. The function of the above four non-structural proteins is to achieve self-replication, and the self-replicating RNA synthesized in vitro can also be referred to as genomic RNA or positive strand RNA (+RNA).
[0424] In terms of function, non-replicating mRNA enters the cytoplasm to directly translate the target protein as a translation template. After the self-replicating mRNA enters the cell, four non-structural proteins are first expressed, which use the initial self-replicating RNA as a template to synthesize RNA complementary to it (also known as -RNA), and then use it as a template to synthesize a complete self-replicating RNA genome, which is called the replication process. At the same time, the non-structural proteins also bind to the subgenomic promoter of the self-replicating RNA genome and transcribe a shorter RNA, called subgenomic RNA, which contains the target gene encoding the target protein, so the transcribed mRNA can be used as a template to translate the target protein. Therefore, in terms of function, the self-replicating mRNA has the activity of first replicating to produce a large amount of mRNA encoding the target protein, and then translating the replicated mRNA to produce the protein, and the final amount of target protein produced is hundreds to thousands of times that of the same number of non-replicating mRNA. Therefore, when self-replicating mRNA is used as a vaccine or a therapeutic drug, the dosage can be significantly reduced.
[0425] However, self-replicating RNA has strong innate immunogenicity, which not only produces potential toxic side effects, but also reduces mRNA stability and protein expression.
[0426] Chemical modification is a general method for controlling immunogenicity. However, in self-replicating mRNA, random chemical modification introduction can damage the function of the replication component in the RNA genome, resulting in impaired self-replication ability. For example, random (or all) addition of N1-pseudouridine modification in self-replicating mRNA can significantly reduce its innate immunogenicity, but N1-pseudouridine modification significantly reduces the initial replication efficiency of self-replicating RNA, affecting the final protein expression effect.
[0427] Therefore, there is an urgent need in the field of self-replicating mRNA for new methods that can introduce diverse chemical modifications without affecting the function of the self-replication component. Although a few types of chemical modifications have been found to be compatible with the self-replication component, most modification types will damage the function of the self-replication component. Compared with traditional linear mRNA, self-replicating mRNA has absolute advantages in protein expression performance, but how to achieve flexible chemical modification is a common challenge and bottleneck faced by the entire field.
[0428] Introducing (or not introducing) different types and / or different proportions of chemical modifications in different component regions of self-replicating mRNA is the key to solving the common bottleneck of self-replicating mRNA drugability. The method of the present application can achieve controllable chemical modification of specific fragments of self-replicating mRNA.
[0429] Connection strategy of RNA molecules
[0430] Currently, there are methods based on protease catalysis for connecting different RNA fragments, but there is no report on connecting different RNA fragments based on ribozyme autocatalysis.
[0431] The connection of different RNA fragments based on protease catalysis includes enzyme catalysis based on proteins such as T4 RNA ligase I, T4 RNA ligase II, and T4 DNA ligase. These methods usually have high connection efficiency for shorter RNA fragments, but almost cannot effectively connect longer RNA fragments. There is no report on connecting different RNA fragments by using ribozyme autocatalysis trans-splicing.
[0432] For the connection / cyclization within the same RNA molecule, based on reasonable sequence design, the connection method based on protease catalysis can efficiently realize the intramolecular connection / cyclization. For example, based on the secondary structure of RNA, the 5' end and the 3' end are designed to be in a spatially close position, or the distance between the 5' end and the 3' end is shortened by introducing base complementary homologous arm fragments, and then the protease catalysis is used to form a phosphodiester bond between the ends to form a circular RNA molecule product. This type of connection is also called protease catalyzed cis connection.
[0433] As used herein, the term "cis connection" refers to a connection occurring in one RNA molecule, i.e., connecting the 5' end and the 3' end of one RNA molecule.
[0434] In addition to using protease to catalyze the connection of RNA molecules, the present application provides a method for connecting RNA molecules using ribozyme catalyzed self-splicing reaction, which is mainly divided into cis-splicing and trans-self-splicing. The two types of self-splicing reactions are described in detail below.
[0435] In the method of the present application for cyclizing two linear RNA fragments through two connection reactions, the types of the two connection reactions can be flexibly selected, for example, 2-step self-splicing reaction is used to prepare circular RNA, or 1-step trans-self-splicing reaction plus 1-step cis-splicing reaction is used to prepare circular RNA, or 1-step trans-self-splicing reaction plus 1-step protease catalyzed cis connection reaction is used to prepare circular RNA.
[0436] In the present application, the connection method of chimeric RNA has flexible selection, for example, multi-step trans-self-splicing reaction is used to prepare chimeric RNA, or multi-step trans-self-splicing and protease catalyzed connection are used to prepare chimeric RNA.
[0437] RNA cis-splicing
[0438] As used herein, the terms "cis-splicing", "cis-self-splicing" are used interchangeably, and all refer to the ligation of two ends of one RNA molecule by a ribozyme through a self-splicing reaction.
[0439] PIE cyclization strategy (including variants based on this principle) all belong to the principle of cis-splicing, that is, the self-splicing ribozyme fragment is designed at both ends of the same RNA molecule to be cyclized (or the self-splicing ribozyme is designed at one end of the RNA molecule to be cyclized), and the splicing event of the RNA molecule occurs inside the same molecule (as shown in Figure 4).
[0440] Even for mRNA molecules with long sequences (e.g., hundreds of nt to thousands of nt), due to the formation of abundant base pairing and secondary structures inside the molecule, the 5' end and the 3' end of the mRNA are usually not far apart in space, but close to each other. Therefore, by designing a self-splicing ribozyme, the cyclization of mRNA can be efficiently achieved through a cis-splicing reaction. This cis-splicing cyclization method does not require the assistance of spliceosomes or additional proteins, and is therefore very suitable for large-scale production of circular RNA. However, the way of RNA cyclization by cis-splicing only once is difficult to achieve site-specific and controllable modification of RNA.
[0441] RNA trans-splicing
[0442] As used herein, the terms "trans-splicing", "trans-self-splicing", "Trans-Splicing", "Trans-Self-Splicing", "TS" are used interchangeably, and all refer to a splicing reaction between two different RNA molecules, thereby connecting two different RNA molecules to form a chimeric RNA molecule.
[0443] In vivo, trans-splicing usually refers to the process of two or more pre-mRNA molecules being spliced to form a mature mRNA, which is a way of producing a chimeric RNA at the post-transcriptional level. RNA trans-splicing can achieve the connection between two RNA molecules. Compared with cis-splicing occurring inside the molecule, the trans-splicing reaction occurring between molecules is much more difficult, so the trans-splicing in nature usually requires the participation of additional molecular machines (such as spliceosome or other protein-based splicing factors).
[0444] Trans-splicing was first discovered in lower eukaryotes such as trypanosomes or nematodes, which have a special trans-splicing mechanism called SL-trans-splicing. In these organisms, a short non-coding leader sequence (Spliced Leader, SL) is attached to the 5' end (upstream) of the chimeric transcript, further facilitating the recruitment of splicing. In the process of SL trans-splicing, the organism utilizes the SD (Splicing Donor) site on the SL RNA molecule and the SA (Splicing Acceptor) site on the pre-mRNA molecule to add the SL as a small exon to the pre-mRNA to form a mature mRNA under the action of a spliceosome.
[0445] In eukaryotic cells, RNA trans-splicing is one of the mechanisms for the maturation of pre-mRNA. The process of RNA trans-splicing is mediated by a spliceosome, and is therefore referred to as spliceosome-mediated RNA trans-splicing (SMaRT). The spliceosome is a ribonucleoprotein complex dynamically composed of small nuclear RNAs (snRNAs, U1, U2, U4, U5, U6, etc.) and protein factors, which can recognize the splicing sites of pre-RNA and catalyze the splicing reaction. SMaRT occurs in the nucleus, in which two different RNA molecules are spliced together to generate a chimeric mRNA molecule in the nucleus. After nuclear export, the chimeric mRNA molecule is translated in the cytoplasm to produce a chimeric protein.
[0446] Various group I introns and group II introns can trans-splice in the natural environment of the cell to connect different RNA molecules together to form a chimeric RNA molecule, and this process usually also requires the assistance of additional splicing factors (such as a spliceosome complex or other protein-based splicing factors).
[0447] In addition, engineered trans-splicing systems have been used to replace mutant mRNAs in cells, detect endogenous RNAs, and respond to gene expression control, etc. However, the reported engineered trans-splicing systems work in cells and usually also require the participation of additional auxiliary proteins (or complexes) (such as a spliceosome or a Cas9 protein). FIG. 31 shows a typical class of trans-splicing systems that rely on auxiliary factors to achieve trans-splicing to replace mRNA fragments containing pathogenic mutations in cells.
[0448] In both natural and engineered RNA transsplicing mechanisms, the spliceosome or accessory proteins are indispensable. Their most important role is to spatially bring the splice donor and acceptor sites, where the transsplicing reaction occurs, closer together, thereby triggering the splicing reaction. These transsplicing methods, which require intracellular reactions and / or the assistance of additional proteins (or complexes), are difficult to use for efficient and large-scale RNA preparation in in vitro reaction systems.
[0449] This invention provides a method for efficiently preparing long RNA molecules by applying the principle of trans-splicing in an in vitro reaction system without relying on additional proteins (or complexes). Furthermore, this invention also provides a method for efficiently preparing circular RNA by applying the principle of trans-splicing, without relying on additional helper splicing factors (such as spliceosomes or other protein helpers).
[0450] RNA trans self-splicing pairs (TSSP)
[0451] In this invention, RNA trans-self-splicing pairs (TSSPs) for in vitro reactions are provided. Through the rational design of ribozyme elements and trans-interacting elements, highly efficient self-splicing reactions can be achieved without the need for spliceosome complexes or other protein splicing factors. That is, the TSSPs of this invention are cofactor-independent trans-self-splicing pairs.
[0452] As used in this article, the terms “reverse self-splicing pair”, “reverse splicing pair”, “TSSP”, “reverse self-splicing body”, and “reverse splicing body” are used interchangeably.
[0453] The TSSP of this invention combines the characteristics of trans-splicing and cis-splicing in vivo, and does not require the assistance of spliceosomes or additional proteins. It can react in cell-free systems, is simple in method and has high splicing efficiency, and is suitable for large-scale preparation and production.
[0454] The TSSP of this invention consists of two interacting fragments, SS1 and SS2, each fragment including a ribozyme element and / or a trans-interacting element. The ribozyme element plays a core self-splicing role, while the trans-interacting element promotes successful ribozyme folding, restores ribozyme splicing activity, triggers trans-self-splicing reactions, or brings the ribozyme and its acceptor region closer together.
[0455] The splicing-active ribozymes include, but are not limited to: natural introns derived from mammals, natural introns derived from bacteria, natural introns derived from viruses, group I introns, and group II introns. In some embodiments, the ribozymes are derived from natural ribozymes, artificially modified ribozymes, or computer-designed self-splicing ribozymes.
[0456] As used herein, the term "trans-acting element" is also referred to as Intermolecular RNA-RNA Interaction Region for TSSP fragments (TSSP-RRI). The TSSP-RRI comprises two sequence fragments, which are located in the SS1 and SS2 fragments, respectively.
[0457] In the present application, the trans-acting element is two RNA fragments with specific interaction, which are connected to two ribozyme fragments, respectively, and can form a very stable structure after interaction.
[0458] The features of the TSSP-RRI include: ① the intermolecular interaction between the two paired trans-acting elements (sequence fragments) is specific; ② the intermolecular interaction between the two paired trans-acting elements is highly efficient.
[0459] The design methods of the TSSP-RRI include but are not limited to: splitting the sequence of a highly structured RNA structure into two fragments to obtain two paired trans-acting elements, or randomly designing homologous arm sequences as two trans-acting elements.
[0460] The present application provides two different types of TSSP, including "split ribozyme-based trans-splicing pair" and "integrated ribozyme-based trans-splicing pair".
[0461] Split ribozyme-based trans-splicing pair
[0462] The split ribozyme-based trans-splicing pair provided in the present application is based on the principle of splitting the complete ribozyme into two fragments, which are placed at one end of the two trans-splicing fragments, respectively. In addition, the two trans-splicing fragments can also optionally contain trans-acting fragments.
[0463] Firstly, the basic principle of splitting the ribozyme into two fragments is that the two fragments can be co-folded into a structured module after interaction, and the structured module can restore the activity of the self-splicing ribozyme. The methods and principles of splitting the ribozyme into two fragments are known to those skilled in the art.
[0464] Specifically, in the design of the split ribozyme (or referred to as the split ribozyme) of the TSSP, a set of general splitting principles should be followed first to ensure efficient and specific assembly and catalysis under splicing reaction conditions. The core idea is to retain the three-dimensional folding of the catalytic core and the divalent metal ion (usually Mg 2+) coordination network, so that the split ribozyme can still reconstitute an active site in space. Specifically, the split site is preferentially selected in the peripheral, non-conserved or modular loop region and the stem end, away from the conserved motif and long-range interaction network involved in catalysis (such as A-minor insertion, triple base and triple helix stacking), and a short and programmable "trans-acting element" is introduced on both sides of the split site to establish a controllable split complex interface; meanwhile, the two RNA ends to be connected contain recognition arms (P1-like pairing regions) near the active center, ensuring that the 3' OH and 5' ends are precisely introduced into the catalytic geometry.
[0465] For specific ribozyme families, the split principles of group I and group II self-splicing introns have different focuses. For group I introns, the P4-P6 folding core and the P3-P9 interaction region form the catalytic framework, and the metal network and G-binding site in the P7 region are the key functional centers, all of which are forbidden cutting regions; it is recommended to arrange the split site in the peripheral stem loop outside P1, the non-conserved loop region of P2 / P8, or the partially verified J region that can tolerate, and then guide the two RNA ends to the active center through the P1 / P10 type recognition pairing. For group II introns, domain V (DV) is the catalytic core and bears the metal coordination function, and DV and its key contact with domain I (DI) are strictly forbidden to cut; the regions suitable for splitting are concentrated in the non-conserved loop region and the edge stem end of DI / DII / DIII, while the long-range interaction between DV and other domains must be preserved. The modular advantage of group II is that DI can be engineered to recognize substrates as a guide domain carried on the RNA end; combined with programmable docking tags and conditional triggers (Mg 2+ / K + / temperature / ligand), efficient connection is achieved only in the target scenario. Whether it is a group I or a group II intron, in implementation, site-directed mutagenesis and small-scale scanning can be carried out on the neighborhood of the split site to construct a "minimal functional unit-tolerance boundary" structure-function map, and in vitro tests of specificity and background activity with non-target sequences can be carried out to systematically avoid the risk of inactivation caused by damaging the catalytic core, disturbing the metal coordination, or cutting the long-range stable network.
[0466] For small ribozyme families (including hammerhead ribozyme, hairpin ribozyme, VS ribozyme, and ligase-type ribozymes obtained by in vitro screening, such as R3C / R18, etc.), the principles of peripheral splitting, core preservation, geometric accessibility, and conditional assembly are adopted. Without damaging the catalytic core geometry and metal ion coordination, the split site is arranged in the peripheral stem end or non-conserved loop region, and orthogonal docking tags are configured on the two split bodies. Through Tm and mismatch fine adjustment of assembly affinity, it is ensured that the split ribozyme can still reconstitute an active site in space. Specifically, the split site is preferentially selected in the peripheral, non-conserved or modular loop region and the stem end, away from the conserved motif and long-range interaction network involved in catalysis (such as A-minor insertion, triple base and triple helix stacking), and a short and programmable "trans-acting element" is introduced on both sides of the split site to establish a controllable split complex interface; meanwhile, the two RNA ends to be connected contain recognition arms (P1-like pairing regions) near the active center, ensuring that the 3' OH and 5' ends are precisely introduced into the catalytic geometry. 2+ / K +Under the condition of high-efficiency reassembly (temperature / small molecules), while maintaining a low background without triggering; verification level can use SHAPE / DMS-MaPseq and other chemical probes to evaluate the secondary and tertiary folding of the split reassembly, and quantify the connection efficiency and specificity with time course dynamics, metal ion titration and non-target sequence panel. To each member, hammerhead ribozyme must strictly avoid splitting at the three-helix intersection core and the conserved catalytic trinucleotide (such as G12-A13-G8 family site) and its metal coordination node, while retaining the triple base and stacking contact near the core of HII / HIII; It is recommended to set breakpoints at the distal stem ends or loop regions of arms I / II / III, and introduce docking tags and recognition arms at the arm ends to accurately guide the two RNA ends into the active pocket. For hairpin ribozymes, A-C platform, tetrad junction and core catalytic loop (loop A / B) are forbidden to cut, and metal-dependent sites and key triplets must be kept intact; you can split in the peripheral stem end or non-conserved loop region at the distal end of Stem A / B, and establish P1-like pairing through the extension of the recognition arm to achieve end alignment and connection. VS ribozyme and other autocatalytic small ribozymes should avoid splitting the active site loop and the core docking interface (such as the key site related to S translocation), and place the breakpoints in the peripheral auxiliary stem loop or replaceable loop region, while maintaining the long-range contact and metal coordination network unchanged, and can be combined with cis / trans guide sequences or secondary structure switches to achieve conditional assembly. For ligase-type ribozymes (R3C / R18, etc.), active loops, substrate binding pockets, and metal coordination cores are not split at all, and breakpoints are preferably located in peripheral support stems / loops and auxiliary recognition regions; this framework is more suitable for 3'-5' connection geometry and is suitable for high-efficiency applications. Docking tags should be short and orthogonal to reduce the risk of mismatches. In summary, small ribozyme splitting needs to avoid disrupting the three-dimensional organization and metal coordination of the catalytic core, avoid cutting long-range stable networks, and prevent introducing new steric hindrance or non-specific assembly channels; within this boundary, through peripheral splitting, orthogonal tags, and conditional triggers, we can obtain efficient and controllable RNA end connection activity.
[0467] Merely introducing the two split fragments into two independent RNA molecules respectively is not enough to trigger the trans-splicing reaction between the two independent RNA molecules, because the ribozyme fragments are located on two independent molecules, and the co-folding between the two molecules is more difficult than the folding within the molecule, so it is difficult to make the two ribozyme fragments co-fold to restore the splicing activity to trigger the splicing reaction. This is also an important reason why most RNA trans-splicing in the cell in the natural state needs to rely on spliceosomes.
[0468] To increase the success rate of intermolecular folding, trans-acting elements are further added to both ribozyme fragments to increase the probability of intermolecular interaction. The addition of this module enables split self-splicing ribozymes to interact and co-fold with high efficiency, thus restoring the splicing activity and triggering the trans-splicing reaction. The addition of trans-acting elements enables TSSP to achieve high efficiency of trans-splicing in a simple system similar to cis-splicing. The trans-splicing process does not depend on additional complex auxiliary groups (such as spliceosomes), and the splicing efficiency is high, with the ability to produce large-scale industrial production.
[0469] In a preferred embodiment, the trans-acting element of the present application is two reverse complementary RNA sequences, also known as homology arm sequences, each with a length of n, 0 < n < 200 nt; preferably, 0 < n < 100 nt; more preferably, 0 < n < 50 nt. The reverse complementary pairing of the sequences facilitates the co-folding of ribozyme fragments and can shorten the spatial distance between the ribozyme and its acceptor.
[0470] In another preferred embodiment, the trans-acting element is derived from a naturally occurring RNA structure with super stability, such as tRNA halves or their derivatives that are widely present in cells.
[0471] In another preferred embodiment, the trans-acting element is a combination of RNA fragments designed by RNA co-folding prediction methods to have high stability (such as very low minimum free energy) after co-folding.
[0472] Figure 9 shows a typical design method for a class of trans-splicing systems based on “split ribozyme trans-splicing pairs” TSSP. In this case, the natural group I intron (as shown in Figure 3A) is redesigned. The designed trans-splicing system is shown in Figure 9A. The trans-splicing body TSSP formed by the trans-splicing system retains the spatial conformation required for the two-step trans-esterification reaction of group I intron, including the 5’ss, U-G mismatch, and 3’ss sites (as shown in Figure 9B).
[0473] Figure 9C shows the design method of TSSP: first, split the ribozyme into two parts at a suitable position, where the fragment near the 3'ss end does not have a complete ribozyme folding structure (and function), and the fragment near the 5'ss end also does not have a ribozyme folding structure (and function), but the two fragments can restore the folding structure (and function) of the core region of the ribozyme after interacting with each other. Second, modify the ribozyme fragment near the 5'ss end, and the modified sequence is named TSA1. Modify the ribozyme fragment near the 3'ss end, and the modified sequence is named TSA2. The modification methods include adding a segment of trans-acting element (such as a homologous arm sequence) at the 3' end of TSA1 and the 5' end of TSA2, so that when TSA1 and TSA2 are located on two independent RNA molecules, they can interact to form base complementary pairing, thereby restoring the splicing conformation of the core region of the ribozyme as described in Figure 9B. The first RNA (G1-TSA1) is formed by the target sequence G1 and TSA1, and the second RNA (TSA2-G2) is formed by TSA2 and the target sequence G2. The splicing site 5'ss is located at the 3' end of G1, and the splicing site 3'ss is located at the 5' end of G2. The first RNA and the second RNA undergo trans-splicing reaction under the self-splicing reaction conditions to produce a chimeric RNA product G1-G2 (as shown in Figure 9A).
[0474] The self-splicing ribozyme is a highly structured RNA ribozyme, and the self-splicing activity depends on whether its structure is in an active conformation. As shown in Figure 7, the scientific principle of designing TSSP is that two RNA fragments (labeled as SS1 and SS2, respectively) can restore the active conformation of the ribozyme after interacting and co-folding. However, the introduction of chemical modifications on the ribozyme sequence can affect the folding of the RNA, and thus affect the active conformation of the ribozyme. Therefore, for sequences from natural ribozymes, as few chemical modifications as possible should be introduced, or modifications of types that have less effect on the structure should be introduced. In cis-splicing, this goal is difficult to achieve, but in the trans-self-splicing system, the influence of the introduction of chemical modifications on the activity of the ribozyme can be minimized by using different modification ratios and modification types for the two ribozyme fragments, or by modifying only one of the fragments. At the same time, experimental detection or computer prediction methods can be used to predict the influence of the type and ratio of chemical modifications on the RNA structure, thereby assisting the design and optimization of TSSP. In addition, experimental screening and / or computer virtual screening methods can be used to screen for chemical modification types (and / or ratios) that do not affect the function of a specific ribozyme, i.e., to obtain chemical modification types (and / or ratios) that are compatible with the function of TSSP.
[0475] Functionally, TSSP has the activity of splicing two different RNA molecules, and can efficiently catalyze the trans-splicing between two independent RNA molecules, and connect the two independent RNA molecules to form a fused RNA molecule, as shown in Figure 32. Due to the specific combination of the internal ribozyme fragments of TSSP, by designing two pairs of independent TSSP, it is easy to realize the connection of three independent RNA molecules to form a fused RNA molecule (or called chimeric RNA), as shown in Figure 33.
[0476] In some embodiments, the TSSP comprises two RNA fragments capable of forming a ribozyme having self-splicing activity.
[0477] In some embodiments, the TSSP comprises two RNA fragments, wherein only one RNA fragment contains chemically modified unnatural nucleotides.
[0478] In some embodiments, the TSSP comprises two RNA fragments, both of which contain chemically modified unnatural nucleotides.
[0479] In some embodiments, the TSSP comprises two RNA fragments, both of which contain different types of chemically modified unnatural nucleotides.
[0480] In some embodiments, the TSSP comprises two RNA fragments, both of which contain different proportions of chemically modified unnatural nucleotides.
[0481] In some embodiments, the TSSP comprises two RNA fragments, and when the RNA fragments contain chemically modified unnatural nucleotides, the structure of the TSSP is determined by experimental detection method to speculate whether the active conformation of the ribozyme is destroyed.
[0482] In some embodiments, the TSSP comprises two RNA fragments, and when the RNA fragments contain chemically modified unnatural nucleotides, the structure of the TSSP is predicted by computer prediction method to speculate whether the active conformation of the ribozyme is destroyed.
[0483] Structurally, the two fragments of the TSSP of the present application can form a structured module having splicing activity when combined together. When the two fragments are located on two different RNA molecules, the two fragments form a TSSP, and then form a covalent bond between the splicing sites of the two different RNA molecules, and finally the two RNA molecules are connected together at the splicing site to form a fused RNA molecule, while the TSSP fragment is cut off.
[0484] Functionally, TSSP has the activity of splicing two different RNA molecules, and can efficiently catalyze the trans-splicing between two independent RNA molecules, and connect the two independent RNA molecules to form a fused RNA molecule, as shown in FIG. 8. By selectively modifying (or selectively not modifying) the two independent RNA molecules, this circular RNA preparation method can achieve efficient and controllable modification of the circular RNA, and solve the technical bottleneck of large-scale and efficient preparation of chemically modified circular RNA in vitro.
[0485] Trans-splicing pair based on integrated ribozyme
[0486] The present application also provides another design method of trans-splicing pair, i.e. the self-splicing active region of the ribozyme is taken as a complete sequence element in one of the fragments, and the other fragment only contains the TSSP-RRI trans-acting element. Such TSSP is referred to as "trans-splicing pair based on integrated ribozyme". For the trans-splicing pair based on integrated ribozyme, the TSSP-RRI trans-acting elements are arranged on the two TSSP fragments to facilitate the formation of the ribozyme self-splicing active region, which contains the ribozyme sequence, 5'ss and 3'ss.
[0487] In some embodiments, one of the two fragments of the TSSP contains an integrated ribozyme and a trans-acting fragment, and the other fragment only contains a trans-acting fragment.
[0488] In some embodiments, the trans-acting fragment is two homologous arm sequences, which are reverse complementary. The number of reverse complementary nucleotides n is 0≤n≤200nt. After the two homologous arm sequences are reverse complementary, the splice sites in the two independent RNA molecules to be spliced are close to each other in space, thereby facilitating the occurrence of trans-splicing reaction.
[0489] In the system of the trans-splicing pair based on integrated ribozyme TSSP, the trans-splicing trans-splicing trans-splicing trans-splicing body based on integrated ribozyme contains an intact ribozyme sequence which is not divided, so that the ribozyme can form a correct active conformation through intramolecular folding. However, at this time, it is difficult for another RNA molecule to interact with the RNA molecule containing the intact ribozyme sequence and correctly place the splice site (5'ss or 3'ss) on the other RNA molecule in the active conformation of the ribozyme. In contrast, the two ribozyme fragments in the trans-splicing pair TSSP of the divided ribozyme have a high natural interaction ability, so the interaction activity of the trans-acting element is relatively low (for example, relatively short homologous arms, and in some embodiments, the reverse complementary length of the homologous arms is n (5<n<50)).
[0490] For the trans-splicing pair of integrated ribozymes, a relatively more complex trans- interacting element (e.g., longer homology arms, in some embodiments, the reverse complement of the homology arms is n (10 < n < 200) bases long) needs to be designed. The region on the other RNA that interacts with the integrated ribozyme and the attached trans-interacting element is also referred to as the trans-splicing body recognition region. When the trans-splicing body binds to the trans-splicing body recognition region, the splice site on the first RNA, the trans-splicing body ribozyme, the splice site on the second RNA form the conditions to trigger the self-splicing reaction, and the transesterification reaction occurs between the two splice sites, forming a covalent bond, and the first RNA and the second RNA are connected.
[0491] Figure 10 shows a typical design of a trans-splicing system based on the trans-splicing pair of integrated ribozymes TSSP. In this case, the natural group I intron (shown in Figure 3A) is redesigned. The designed trans-splicing system is shown in Figure 10A. The trans-splicing body TSSP formed by the trans-splicing system retains the spatial conformation of the group I intron required for the two-step transesterification reaction (i.e., the active region of the ribozyme, shown as the left dashed box in Figure 10B) containing the 5'ss, U-G mismatch, and 3'ss sites. Compared to the TSSP of the split ribozyme, the spatial conformation of the active region of the ribozyme is more difficult to form when this integrated TSSP is used to trans-link two RNA molecules. Therefore, a set of more efficient trans-interacting elements (e.g., longer homology arms, such as the third complementary region in Figure 10A) usually needs to be designed. By designing the second and third complementary regions as shown in Figure 10A, the spatial conformation of the active region of the ribozyme is assisted by the 5'ss and 3'ss and the ribozyme sequence.
[0492] Figure 10C shows the design of a one-piece TSSP: first, split the ribozyme into two pieces at a suitable position downstream of the 5'ss, where the piece near the 3'ss end has the complete ribozyme fold (and function), and the piece near the 5'ss end has no ribozyme fold (and function), but contains a recognition region (e.g., the first complementary region shown in Figure 10A) that forms a complementary sequence with the ribozyme IGS sequence. Second, engineer the ribozyme piece near the 5'ss end, and name the engineered sequence TSA1. The engineering includes adding a trans-acting element downstream of TSA1 that can specifically interact with the 5' end of the ribozyme piece near the 3'ss end. Third, engineer the ribozyme piece near the 3'ss end, and name the engineered sequence TSA2. The engineering includes adding a specific sequence upstream of TSA2 that can form a base-pairing with TSA1, and a trans-acting element that can specifically interact with the trans-acting element in TSA1. Form a first RNA (G1-TSA1) from the target sequence G1 and TSA1, and a second RNA (TSA2-G2) from TSA2 and the target sequence G2, with the 5'ss at the 3' end of G1 and the 3'ss at the 5' end of G2. The first and second RNAs undergo trans-splicing under the self-splicing reaction conditions to produce the chimeric RNA product G1-G2 (as shown in Figure 10A).
[0493] The TSSP of a one-piece ribozyme can be flexibly designed at either end of the two RNA ends to be connected. Figure 10 shows the design of a one-piece ribozyme at the 5' end of the second RNA for connecting the 3' end of the first RNA with the 5' end of the second RNA. Conversely, placing the one-piece TSSP ribozyme at the 3' end of the first RNA can also achieve the same connection effect. By analogy, similar design principles can be used to connect the 5' end of the first RNA with the 3' end of the second RNA.
[0494] In some embodiments, the trans-splicing ribozyme contained in the TSSP is formed by folding one of the RNA fragments of the TSSP.
[0495] In some embodiments, the one-piece trans-splicing ribozyme contained in the TSSP is designed at the 5' end of the second RNA for connecting the 3' end of the first RNA with the 5' end of the second RNA.
[0496] TScircle circularization system: preparation of circular RNA based on the TSSP trans-splicing strategy
[0497] Based on the TSSP designed according to the application, a system for preparing circular RNA is developed, named TScircle. When two TSSPs of the application are introduced into two ends of two independent RNA molecules respectively, the two TSSPs will undergo splicing reactions respectively, and then the two independent RNA molecules will be connected in sequence at the ends, forming a fused circular RNA molecule. The schematic diagram of the TScircle circularization system is shown in Figures 11-13.
[0498] The TScircle circularization system of the application involves two orthogonal TSSPs, i.e., the trans-splicing fragments in each TSSP can interact with each other to undergo a self-splicing reaction, while the trans-splicing fragments from two different TSSPs cannot interact to undergo a reaction. As shown in Figures 11-13, one TSSP is named TSB1 and TSB2, and the other TSSP is named TSA1 and TSA2; TSB1 and TSB2 can recognize each other and undergo a self-splicing reaction, TSA1 and TSA2 can recognize each other and undergo a self-splicing reaction, but TSA1 / 2 and TSB1 / 2 cannot recognize each other and do not undergo a reaction.
[0499] The two orthogonal TSSPs can each independently be a split ribozyme-based TSSP or a one-piece ribozyme-based TSSP. For example, TSA1 and TSA2 can be a split ribozyme-based TSSP or a one-piece ribozyme-based TSSP; TSB1 and TSB2 can be a split ribozyme-based TSSP or a one-piece ribozyme-based TSSP without limitation.
[0500] In some embodiments, one TSSP is used to first connect two different RNA molecules into a fused RNA molecule, and then other means are used to connect the ends of the fused RNA molecule, thereby preparing a circular RNA molecule.
[0501] In the TScircle circularization system, the two trans-splicing fragments of a trans-splicing body pair are located at the ends to be connected of two different RNA molecules to be connected. The ribozyme fragments are combined, each ribozyme fragment combination contains two ribozyme fragments, and the two ribozyme fragments in each ribozyme fragment combination have splicing activity when combined together, and the two ribozyme fragment combinations from different ribozyme fragment combinations do not have splicing activity when combined together.
[0502] To meet the purpose of trans-splicing of diverse sequences, a large number of ribozyme fragment combinations can be designed, which can be from natural self-splicing ribozymes (such as from group I introns and group II introns), can be modified according to natural ribozymes, or can be computer-designed ribozymes. In theory, ribozymes with splicing activity usually depend on their unique RNA spatial structure. In an extracellular reaction system, ribozymes with splicing activity can be divided into two fragments, and the two ribozyme fragments can be combined to fold correctly and restore ribozyme activity. The two fragments in the ribozyme fragment combination can be respectively connected to the ends of two RNA sequences, so as to connect the two RNA sequences through the trans-splicing of the ribozyme fragment combination.
[0503] Common ribozymes with splicing function include group I introns and group II introns. For example, ribozymes from Anabaena pre-tRNA-Leu gene intron, T4 phage Td gene intron, Tetrahymena intron, etc. These natural self-splicing ribozymes can be appropriately divided into two ribozyme fragments, and the two ribozyme fragments form a complex with ribozyme activity through hybridization to exert splicing function (as shown in FIG. 7A).
[0504] TScircle cyclization system for preparing site-specifically modified circular RNA
[0505] Long RNA fragments are usually synthesized using the IVT method. In the synthesis process, the nucleotide raw materials in the reaction system are replaced with chemically modified nucleotides, and then chemically modified RNA products, i.e., modified RNAs, can be synthesized. By adjusting the types and proportions of modified nucleotide raw materials, synthesis of RNA fragments with different types and proportions of modifications can be easily achieved, and then site-specifically controllable modified circular RNA can be prepared through the TScircle cyclization system.
[0506] Currently, more than 150 different types of chemical modifications have been found on endogenous RNA in human body. The biological functions of some of these modification types have been identified. For example, m6A modification is one of the most common types of RNA modification in human body. Studies have found that m6A modification can regulate the immunogenicity of mRNA, enhance the translation activity of mRNA, and initiate the translation of circular mRNA. In addition, the biological functions of a large number of natural RNA modification types are still unclear. At the same time, a variety of non-natural RNA modification methods have been proposed to improve the function of RNA therapy. For example, N1-methyl pseudouridine modification can significantly reduce the immunogenicity of mRNA and enhance the protein translation level, and is widely used in the production of mRNA vaccines. With further research, more modification types that can improve RNA therapy will be discovered or designed. These new RNA modification methods can be prepared by TScircle strategy to prepare circular RNA with site-specific modification.
[0507] The TScircle strategy enables flexible control of chemical modification schemes during the preparation of circular RNA, including the following common modification schemes: (1) selectively modifying a sequence region of the circular RNA while keeping the remaining sequence region unmodified; (2) using different chemical modification methods in different sequence regions of the circular RNA; (3) using the same chemical modification method but different modification ratios in different sequence regions of the circular RNA. In addition, multiple types of chemical modifications can also be used simultaneously in specified regions of the circular RNA. Figures 14-19 show the working principles of several typical TScircle cyclization systems.
[0508] Site-specific modification of circular mRNA is crucial for the development of circular mRNA-based vaccines and therapeutic products. The TScircle cyclization system can selectively perform different types or different ratios of chemical modification on the CDS region of circular mRNA, while keeping the IRES region unmodified to avoid affecting the translation initiation efficiency, thereby achieving the effect of reducing immunogenicity and enhancing protein translation (Figure 20). In addition, there are chemical modification types that are compatible with IRES activity. TScircle can achieve different types (and ratios) of chemical modification on the CDS region and the IRES region to maximize the drug properties of the circular mRNA molecule (Figure 21).
[0509] TSmod site-specific modification platform based on TSSP trans-splicing strategy
[0510] Based on the TSSP designed in this application, a system for preparing controllable modification of specific fragments of RNA was developed, named TSmod. The working principle of the TSmod system is shown in Figures 34-39.
[0511] The TSSP designed in the present application can be used to synthesize a chimeric RNA in vitro. When two independent RNA molecules are each introduced with a trans-self-splicing pair of TSSP at their ends, the two self-splicing pairs undergo a splicing reaction, and the two independent RNA molecules are connected head to tail to form a chimeric RNA molecule (Figure 34).
[0512] The TSmod system of the present application involves two orthogonal TSSPs, i.e., the trans-self-splicing fragments in each TSSP can interact with each other to undergo a self-splicing reaction, while the trans-self-splicing fragments from two different TSSPs cannot interact with each other to undergo a reaction. As shown in Figures 34-39, one TSSP is named TSB1 and TSB2, and the other TSSP is named TSA1 and TSA2; TSB1 and TSB2 can recognize each other and undergo a self-splicing reaction, TSA1 and TSA2 can recognize each other and undergo a self-splicing reaction, but TSA1 / 2 and TSB1 / 2 cannot recognize each other and do not undergo a reaction.
[0513] The two orthogonal TSSPs can each independently be a split-ribozyme-based TSSP or a one-piece ribozyme-based TSSP. For example, TSA1 and TSA2 can be split-ribozyme-based TSSPs or one-piece ribozyme-based TSSPs; TSB1 and TSB2 can be split-ribozyme-based TSSPs or one-piece ribozyme-based TSSPs without limitation.
[0514] In some embodiments, one TSSP is used to first connect two different RNA molecules into a fused RNA molecule, and then other means are used to connect the ends of the fused RNA molecule to prepare an RNA molecule.
[0515] In the TSmod system, the two trans-self-splicing fragments of a trans-self-splicing pair are located at the ends to be connected of two different RNA molecules to be connected. The ribozyme fragments are combined, each ribozyme fragment combination contains two ribozyme fragments, and the two ribozyme fragments in each ribozyme fragment combination have splicing activity when combined together, and the two ribozyme fragments from different ribozyme fragment combinations do not have splicing activity when combined together.
[0516] To meet the purpose of trans-splicing of diverse sequences, a large number of ribozyme fragment combinations can be designed, which can be from natural self-splicing ribozymes (such as from group I introns and group II introns), can be modified according to natural ribozymes, or can be computer-designed ribozymes. In theory, ribozymes with splicing activity usually depend on their unique RNA spatial structure. In an extracellular reaction system, ribozymes with splicing activity can be divided into two fragments, and the two ribozyme fragments can be combined to fold correctly and restore ribozyme activity. The two fragments in the ribozyme fragment combination can be respectively connected to the ends of two RNA sequences, so as to connect the two RNA sequences through the trans-splicing of the ribozyme fragment combination.
[0517] Common ribozymes with splicing function include group I introns and group II introns. For example, ribozymes from Anabaena pre-tRNA-Leu gene intron, T4 phage Td gene intron, Tetrahymena intron, etc. These natural self-splicing ribozymes can be appropriately divided into two ribozyme fragments, and the two ribozyme fragments form a complex with ribozyme activity through hybridization to exert splicing function.
[0518] Preparation of linear RNA with controllable modification of specific fragments by TSmod platform
[0519] Long RNA fragments are usually synthesized by IVT method. In the synthesis process, the nucleotide raw materials in the reaction system are replaced with chemically modified nucleotides, and then chemically modified RNA products, i.e. modified RNA, can be synthesized. By adjusting the type and proportion of modified nucleotide raw materials, synthesis of RNA fragments with different modification types and proportions can be easily realized, and then RNA with site-specific controllable modification can be prepared by TSmod system.
[0520] Currently, more than 150 different types of chemical modifications have been found on endogenous RNA in human body. The biological functions of some of these modification types have been identified. For example, m6A modification is one of the most common types of RNA modification in human body. Studies have found that m6A modification can regulate the immunogenicity of mRNA, enhance the translation activity of mRNA, and initiate mRNA translation. In addition, the biological functions of a large number of natural RNA modification types are still unclear. At the same time, a variety of unnatural RNA modification methods have been proposed to improve the function of RNA therapy. For example, N1-methyl pseudouridine modification can significantly reduce the immunogenicity of mRNA and enhance the protein translation level, and is widely used in the production of mRNA vaccines. With further research, more modifications that can improve RNA therapy will be discovered or designed. These new RNA modification methods can be prepared by the TSmod strategy to prepare site-specific modified RNA.
[0521] The TSmod strategy enables flexible control of chemical modification schemes during the preparation of RNA, including the following common modification schemes: (1) selectively modifying a sequence region of RNA while leaving the remaining sequence region unmodified; (2) using different chemical modification methods in different sequence regions of RNA; (3) using the same chemical modification method but different modification ratios in different sequence regions of RNA. In addition, multiple types of chemical modifications can also be used simultaneously in specified regions of RNA. Figures 35-39 show the working principles of several typical TSmod systems for synthesizing site-specific modified chimeric RNA.
[0522] Site-specific modification of mRNA is crucial for the development of mRNA-based vaccines and therapeutic products. The TSmod system can selectively perform different types or different ratios of chemical modifications on the CDS region of mRNA, while leaving the IRES region unmodified to avoid affecting the translation initiation efficiency, thereby achieving the effects of reducing immunogenicity and enhancing protein translation. In addition, there are chemical modification types that are compatible with IRES activity. TSmod can achieve different types (and ratios) of chemical modifications on the CDS region and the IRES region to maximize the drug properties of mRNA molecules.
[0523] As shown in Figures 40 and 41, the preparation of mRNA molecules with controllable modification of specific fragments based on the TSmod system can maximize the optimization of the drug properties of linear non-replicating mRNA and self-replicating mRNA, such as reducing their inherent immunogenicity, increasing the stability of RNA molecules, improving protein translation levels, and not affecting the replication function of self-replicating RNA, and a variety of drug properties.
[0524] Optimization of TSSP in TScircle or TSmod system for preparing site-specifically modified RNA
[0525] It has been found that certain types of chemical modifications can affect the folding structure of RNA and thus affect its function. Therefore, chemical modification can cause the TSSP to lose the pre-designed ribozyme activity, or the ribozyme activity is weakened. For example, in the PIE system (cis-splicing system), the introduction of more than 25% of N1-methyl pseudouracil in the circular RNA precursor sequence greatly reduces the cyclization efficiency. A high proportion of chemical modification greatly reduces the cyclization efficiency of the self-splicing-based cyclization reaction, which is also the core bottleneck of the current inability to mass-produce circular RNA with a high proportion of chemical modification.
[0526] Compared with existing circular RNA preparation methods, the most core advantage of TScircle is that it can split the target circular RNA into two independent RNA fragments at any position, and the two independent RNA fragments are synthesized separately. During synthesis, selective chemical modification can be performed on one of the RNA fragments, thereby achieving the purpose of chemical modification (or avoiding chemical modification) in the specified region of the circular RNA product. Similarly, TSmod can split the target RNA into multiple independent RNA fragments at any position, and the multiple independent RNA fragments are synthesized separately. During synthesis, selective chemical modification can be performed on one of the RNA fragments, thereby achieving the purpose of chemical modification (or avoiding chemical modification) in the specified region of the RNA product. This strategy means that only one ribozyme fragment in the TSSP is chemically modified, which usually does not destroy the ribozyme activity of the TSSP, ensuring the efficiency of circular RNA preparation.
[0527] However, when chemical modification is required for two or more RNA fragments split from the target RNA, the TSSP may be excessively modified, affecting the ribozyme activity. To address this challenge, the present application provides a variety of new strategies:
[0528] (Z1) Keep the trans-self-splicing pair unmodified to maximize the splicing activity of the trans-self-splicing pair. To achieve this effect, a variety of methods can be used. For example: first, synthesize the modified RNA fragment to be cyclized and the unmodified trans-self-splicing pair separately, and then use appropriate methods to connect the modified RNA fragment to be cyclized and the unmodified trans-self-splicing pair. Methods for achieving this connection reaction can use methods known in the art, such as using a ligase to catalyze.
[0529] (Z2) For the designed ribozyme fragment combination, different types and different degrees of chemical modification can be performed (for example, only one of the fragments is modified, or different proportions of modifications are applied to the two fragments, or different types of modifications are applied to the two fragments), and the modified ribozyme fragment combination can still exert splicing function without destroying the active conformation of the ribozyme fragment complex (as shown in Figures 7B, 7C, and 7E). When the chemical modification significantly affects the spatial conformation of the ribozyme complex, the ribozyme activity can be lost and cannot exert splicing function (as shown in Figure 7D).
[0530] (Z3) A certain degree of chemical modification does not significantly affect the splicing activity of the trans-self-splicing body. Therefore, the RNA fragment to be circularized or to be connected can be synthesized together with the trans-self-splicing body fragment connected thereto to obtain a modified RNA trans-self-splicing precursor.
[0531] (Z4) The modification type and / or modification proportion that does not destroy the splicing activity of the trans-self-splicing body can be screened by appropriate means, such as experimental screening or computer-predicted virtual screening, and this type of modification strategy is also called trans-self-splicing body compatible modification.
[0532] The main advantages of the present application include:
[0533] (1) Realize site-specific and controllable RNA modification: realize site-specific (modify the specified fragment of the circular RNA or chimeric RNA) and controllable (the type and percentage of modification can be regulated) circular or chimeric RNA modification; and no sequence from the ribozyme is left, realizing “traceless” trans-linking, ensuring sequence-accurate RNA fragment connection or circularization under the site-specific modification mode, and being suitable for the preparation of site-specific modified RNA vaccines and drugs;
[0534] (2) High circularization efficiency: under the site-specific modification strategy, the efficiency of circularizing or connecting RNA is high, and is suitable for large-scale production;
[0535] (3) Strong platform expandability: the region where the chemical modification is introduced in the circular RNA or chimeric RNA, the type of chemical modification, the proportion of chemical modification, and the combination of different chemical modifications can all be flexibly designed.
[0536] (4) High platform universality: suitable for any type of base modification, and can perform site-specific and controllable modification on the circular RNA molecule or chimeric RNA; suitable for any target sequence, and can realize the preparation of chemically modified circular RNA or chimeric RNA with high efficiency and any type.
[0537] (5) High practical value: The fixed-point modification can significantly improve the drug properties of RNA vaccines and drugs. For example, the TScircle fixed-point modification strategy can simultaneously consider high cyclization or ligation efficiency, significantly reduced immunogenicity of molecules, significantly improved protein expression, and other multiple advantages in the preparation and use of circular mRNA or the TSmod fixed-point modification strategy in the preparation and use of mRNA, which has important application value in the field of biological medicine;
[0538] (6) Wide application range: The fixed-point modified circular RNA or chimeric RNA will significantly improve the use effect of circular RNA in vaccines, therapeutic drugs, cell drugs, and other fields, and has a wide range of uses.
[0539] The application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application. The experimental methods in the following examples are not specified, and the conditions are generally according to the conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and fractions are weight percentages and weight fractions.
[0540] Example 1. Preparation of circular RNA molecules based on the TScircle trans- self-splicing system
[0541] In this embodiment, it is demonstrated that by designing a reasonable nucleic acid trans- self-splicing body pair, two RNA fragments can be connected in a predetermined manner based on the trans- self-splicing strategy, thereby efficiently producing circular RNA.
[0542] First, two pairs of TSSP were designed, including four RNA fragments: SS1, SS2, SS3, and SS4, whose sequences were SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively. Among them, SS1 and SS2 form a pair of active ribozymes, and SS3 and SS4 form a pair of active ribozymes. The first target RNA to be circularized in this embodiment is named G1 (SEQ ID NO: 5), and the second target RNA to be circularized is named G2 (SEQ ID NO: 6). The TScircle method is used to connect G1 and G2 to form a circular molecule with the correct order, and the expected connection mode is to connect the 3' end of G1 with the 5' end of G2, and the 3' end of G2 with the 5' end of G1, and the sequence of the target circular RNA formed finally is G1-G2 (SEQ ID NO: 7).
[0543] Linking SS4-G1-SS1 from the 5' end to the 3' end yields the first RNA in the polynucleotide combination used to prepare circular RNA, named RNA-1 (SEQ ID NO:8); linking SS2-G2-SS3 from the 5' end to the 3' end yields the second RNA, named RNA-2 (SEQ ID NO:9).
[0544] Two RNA sequences, RNA-1 and RNA-2, were synthesized separately and reacted in a splicing reaction system. Gel electrophoresis was then used to detect the nucleic acid bands before and after the reaction, as well as after purification. The molecular weight was determined by comparing the relative positions of the bands. RNase R treatment was used to confirm the presence of circular RNA molecules, and PCR sequencing was used to verify the correctness of the sequence surrounding the trans-joint site. The specific procedures and results are as follows:
[0545]
Experimental Methods
[0546] Synthesis of the designed RNA-1 and RNA-2: First, the DNA sequences corresponding to RNA-1 and RNA-2 were synthesized (Beijing Qingke Biotechnology Co., Ltd.). These DNA sequences were then cloned into the PCR-generated linear plasmid vector pUC57 containing the T7 promoter using molecular cloning methods (GenBuilder Plus Cloning Kit, L00744, GenScript Biotech Co., Ltd.). The following plasmids were obtained: pUC57-RNA-1 and pUC57-RNA-2.
[0547] Preparation of linear plasmid templates: The plasmid was transformed into Top10 competent cells, plated, and clones were picked the next day and cultured in LB medium containing Amp resistance (37℃ / 200rpm / overnight). Plasmid extraction was then performed (endotoxin-free plasmid mini-extraction kit, DP118, Tiangen Biotech (Beijing) Co., Ltd.). Linearized plasmid templates were then prepared by EcoI (1040, Takara) single-enzyme digestion (37℃, 1 hour). The digestion products were recovered using a PCR & DNA Cleanup Kit (T1030, New England Biolabs), and their concentrations were determined using Nano-Drop (Thermo). The digestion products were identified by 1.5% agarose gel electrophoresis. The purified linear plasmids were used as templates for in vitro transcription.
[0548] In vitro transcription: using T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) was used to synthesize fragments A and B by in vitro transcription (37°C, 2 hours) using linearized plasmid DNA templates. After in vitro transcription, the linear DNA templates were digested with DNase I (M0303S, New England Biolabs) (37°C, 15 min). Then, the above product was column-purified using RNA Cleanup Kit (T2050, New England Biolabs).
[0549] circRNA synthesis: RNA-1 and RNA-2 were added to a buffer containing GTP (final concentration 2 mM) (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5), and the above solution was heated at 55°C for 15 min, and column-purified using RNA Cleanup Kit (T2050, New England Biolabs). Then, the reaction was analyzed by agarose gel electrophoresis, and if the amount of circular product was small, the reaction was repeated, and GTP and buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) were added to the purified product, and heated at 55°C for 15 min, and column-purified using RNA Cleanup Kit (T2050, New England Biolabs).
[0550] Purification of circRNA: The above reaction product was tailed using E. coli Poly(A) polymerase (M0276, New England Biolabs) (37°C, 30 min). The linear RNA was digested with RNA Cleanup Kit (T2050, New England Biolabs). The purified product was heated at 65°C for 3 min, and then immediately ice-bathed for 2 min. Then, the linear RNA was digested with RNase R (E224, Coastal Green) (37°C, 60 min). After the reaction was terminated, the RNase R-digested RNA was column-purified using RNA Cleanup Kit (T2050, New England Biolabs). Then, a 2% agarose gel was prepared for agarose gel electrophoresis analysis.
[0551]
Experimental Results
[0552] The experimental results are shown in Figure 22. Figure 22A shows a schematic diagram of RNA-1 and RNA-2 circularizing to generate a circular RNA molecule with the correct sequence by the TScircle principle. Figure 22B shows the results of gel electrophoresis detection of RNA-1, RNA-2 and the product after ligation and circularization. Lanes 2 and 3 are the bands of RNA-1 and RNA-2, respectively. Lane 4 is the product after the circularization reaction. From top to bottom, the bands are a partially spliced by-product, the target circular RNA, unspliced RNA-1 and RNA-2, and four ribozyme fragments generated after the formation of the target circular RNA. Lane 5 is the product after RNAse R treatment.
[0553] Figure 22C shows the use of Sanger sequencing to detect the sequence around the ligation site 1 and the ligation site 2. The results show that the sequence is completely consistent with the expected sequence, proving that the circularization reaction successfully produced a circular RNA product with a sequence completely consistent with the expected sequence.
[0554] The above results show that, in this embodiment, by designing a reasonable combination of spliced ribozyme fragments, two RNA fragments can be spliced in a predetermined manner based on the trans-splicing strategy, and finally high-efficiency circular RNA can be produced.
[0555] Example 2. Site-directed modification and controllable modification of specific fragments in circular RNA
[0556] In this embodiment, the target circular RNA containing IRES and GLuc CDS sequences is used as an example to test the efficiency of the TScircle system in efficiently preparing site-directed modified circular RNA. In this embodiment, fragment A (GLuc CDS region) is modified before circularization, while fragment B (IRES region) is not modified, and then the TScircle system is used for circularization to achieve controllable modification of specific fragments in circular RNA. The specific method is as follows:
[0557]
Experimental method
[0558] During in vitro transcription, 5% (95% A), 10% (90% A), 25% (75% A) and 50% (50% A) m6A, 50% m1Ψ (50% U) and 50% 5moU (50% U) were added to the reaction system of fragment A, respectively. Then, the circRNA synthesis and purification method described in Example 1 was used for processing, and then a 2% agarose gel was configured for agarose gel electrophoresis analysis.
[0559]
Experimental results
[0560] The results of circularization are shown in FIGS. 23-25. FIGS. 23A-D show that when the non-CDS region is not modified and the CDS region is modified by m6A at a ratio of 5%, 10%, 25%, and 50%, the circular RNA can be successfully prepared; FIG. 23E shows that when the non-CDS region is not modified and the CDS region is modified by m6A at a ratio of 100%, the circular RNA cannot be successfully prepared.
[0561] FIG. 24 shows that when the non-CDS region is not modified and the CDS region is modified by mlΨ at a ratio of 50%, the circular RNA can be successfully prepared.
[0562] FIG. 25 shows that when the non-CDS region is not modified and the CDS region is modified by 5moU at a ratio of 50%, the circular RNA can be successfully prepared.
[0563] The above results show that the circular RNA in which part of the region is modified and part of the region is not modified is successfully prepared in this embodiment, and the site-specific controllable modification of the circular RNA is achieved. In addition, this embodiment verifies that the modification of the CDS region of the circular mRNA at a certain ratio does not affect the preparation of the circular RNA, for example, a modification ratio of 5%, 10%, 25%, and 50%.
[0564] Example 3. Site-specifically modified circular mRNA has lower immunogenicity
[0565] In this embodiment, the target circular RNA containing the IRES and GLuc CDS sequence is used as a case, and the immunogenicity of the CDS region site-specifically modified modified circular RNA prepared by the TScircle system in cells is tested. The immunogenicity of the circular mRNA modified by different methods is detected, and the specific operation is as follows:
[0566]
Experimental method
[0567] Cell culture: A549 cells were cultured in a 37°C, 5% CO2 incubator (Thermo Fisher Scientific). A549 was cultured in RPMI-1640 medium (L210KJ, Shanghai Yuenp Biotech Co., Ltd.) containing 10% fetal bovine serum (SH30396.03, Hyclone) and 1% double antibody (S110JV, Shanghai Yuenp Biotech Co., Ltd.). The cells were subcultured every 2-3 days.
[0568] Experimental grouping: a total of 8 groups, each group is described as follows:
[0569] Group 1: positive control group 3hp-RNA;
[0570] Group 2: linear modification;
[0571] Group 3: Circular GLuc - (no modification);
[0572] Group 4: Circular GLuc - random m1Ψ 5%;
[0573] Group 5: Circular GLuc - m1Ψ - CDS site-directed modification 5%;
[0574] Group 6: Circular GLuc - m1Ψ - CDS site-directed modification 10%;
[0575] Group 7: Circular GLuc - m1Ψ - CDS site-directed modification 25%;
[0576] Group 8: Circular GLuc - m1Ψ - CDS site-directed modification 50%;
[0577] Immunogenicity detection: A549 cells were seeded at 100000 cells / well in 12-well plates, and after the cells reached 70-90% confluency, 1000 ng / well RNase R treated circular RNA and 3-hpRNA (tlrl-hprna, InvivoGen) were transfected into 12-well plates using Lipofectamine 3000 transfection reagent (L3000001, Thermo Fisher Scientific). After 16 hours of transfection, the cells were lysed using Trizol and RNA was extracted. Then the first strand of cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific). Then the expression of two immune response proteins, INF-1B and RIG-1, were detected by fluorescent quantitative PCR.
[0578] The sequences used for fluorescent quantitative PCR are shown below:
[0579] GAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 11)
[0580] GAPDH-R: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 12)
[0581] RIG-1-F: CACCTCAGTTGCTGATGAAGGC (SEQ ID NO: 13)
[0582] RIG-1-R: GTCAGAAGGAAGCACTTGCTACC (SEQ ID NO: 14)
[0583] IFNB1-F: CTTGGATTCCTACAAAGAAGCAGC (SEQ ID NO: 15)
[0584] IFNB1-R: TCCTCCTTCTGGAACTGCTGCA (SEQ ID NO: 16)
[0585] Different ratios of m1Ψ site-directed modified circular mRNA were detected for inducing the expression of immunogenic cytokines in A549 cells, wherein unmodified circular RNA was used as a control for immunogenicity comparison. 3p-hpRNA is a triphosphate hairpin RNA, which is a characteristic structure recognized by RIG-I, and is an effective and specific agonist of RIG-I.
[0586]
Research Results
[0587] The results are shown in FIG. 26. Compared with unmodified circular RNA, the modified RNA (linear modification, circular RNA random modification and different ratios of circular RNA site-directed modification) showed lower expression levels in 2 cytokines. Among them, circular RNA site-directed modification 25% and 50% showed lower / equivalent RIG-1 and INF-B1 expression than classic linear modification.
[0588] The results show that the TScircle system of the present application can realize site-directed and controllable modification of fragments of circular mRNA, thereby improving the immunogenicity of circular mRNA.
[0589] Example 4. Site-directed modified circular mRNA has higher protein expression efficiency
[0590] The efficiency of circular mRNA site-directed modified by TScircle system for expressing protein was detected, taking GLuc protein as a representative, and the specific operation was as follows:
[0591]
Experimental Methods
[0592] Cell culture: HEK-293T and HeLa were cultured in a 37℃, 5% CO2 incubator (Thermo Fisher Scientific). HEK-293T and HeLa were cultured with high glucose DMEM medium (L110KJ, Shanghai Yuenp Biotech Co., Ltd.) containing 10% fetal bovine serum (SH30396.03, Hyclone) and 1% double antibody (S110JV, Shanghai Yuenp Biotech Co., Ltd.). Cells were subcultured every 2-3 days.
[0593] Cell transfection: For HEK-293T cells, 30 microliters of culture supernatant were taken at 24 hours (Day 1), 48 hours (Day 2), 72 hours (Day 3), and 96 hours (Day 4) post-transfection, respectively, and the activity value of luciferase in the supernatant was detected using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). For HeLa cells, 100 microliters of culture supernatant were taken at 24 hours (Day 1), 72 hours (Day 3), and 120 hours (Day 5) post-transfection, respectively, and the activity value of luciferase in the supernatant was detected using the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific). The activity detection of luciferase used the SpectraMax i3 microplate reader (Molecular Devices). After detection every day, the culture medium was completely removed and replaced with new culture medium in the culture plate.
[0594] The experimental groups are as follows:
[0595] The m1Ψ-CDS site-directed modification experiment is divided into 4 groups:
[0596] Group 1: Circular GLuc-no modification;
[0597] Group 2: Circular GLuc-m1Ψ-CDS site-directed modification 5%;
[0598] Group 3: Circular GLuc-m1Ψ-CDS site-directed modification 10%;
[0599] Group 4: Circular GLuc-m1Ψ-CDS site-directed modification 25%;
[0600] The 5moU-CDS site-directed modification experiment is divided into 4 groups:
[0601] Group 1: Circular GLuc-no modification;
[0602] Group 2: Circular GLuc-5moU-CDS site-directed modification 5%;
[0603] Group 3: Circular GLuc-5moU-CDS site-directed modification 10%;
[0604] Group 4: Circular GLuc-5moU-CDS site-directed modification 25%;
[0605] The m6A-CDS site-directed modification experiment is divided into 4 groups:
[0606] Group 1: Circular GLuc-no modification;
[0607] Group 2: 5% of the circular GLuc-m6A-CDS site-directed modification;
[0608] Group 3: 10% of the circular GLuc-m6A-CDS site-directed modification;
[0609] Group 4: 25% of the circular GLuc-m6A-CDS site-directed modification;
[0610] Detect the trend of the protein expression level of each group of circular RNA in HEK-293T cells over time.
[0611]
Research Results
[0612] The results are shown in Figures 27-29. Figure 27 shows that in HEK-293T cells, m1Ψ modified circular RNA can stably and continuously express Gaussia Luciferase protein, and is significantly better than unmodified circular RNA.
[0613] Figures 28 and 29 show the trend of protein expression level of circular RNA modified with different proportions of 5moU and m6A in HeLa cells over time, respectively. These results show that the stability of the modified circular mRNA is prolonged, the half-life in vivo is long, and the protein expression efficiency is significantly increased compared with unmodified circular mRNA.
[0614] The above results show that the protein expression efficiency of the site-directed and controllable modified mRNA prepared by the TScircle system of the present application is higher.
[0615] Example 5. Site-directed modification can further enhance the protein expression efficiency of sequence-optimized circular mRNA
[0616] Sequence optimization of the CDS region (such as codon optimization and / or stability optimization) can significantly enhance the stability of mRNA and thus improve its protein expression efficiency. This embodiment demonstrates that even in the case of a fully optimized CDS region, site-directed modification can still significantly enhance the protein expression efficiency of circular mRNA.
[0617]
Experimental Methods
[0618] CDS sequence optimization: The LinearDesign algorithm was used to optimize the CDS region RNA sequence of the coding amino acid of GLuc, and the optimized sequence was SEQ ID NO: 10.
[0619] Cell culture: HeLa was cultured in a 37 °C, 5% CO2 incubator (Thermo Fisher Scientific). HeLa was cultured with high glucose DMEM medium (L110KJ, Shanghai Yuenpui Biotech Co., Ltd.) containing 10% fetal bovine serum (SH30396.03, Hyclone), 1% double antibody (S110JV, Shanghai Yuenpui Biotech Co., Ltd.). Cells were subcultured every 2-3 days.
[0620] Cell transfection: For HeLa cells, 100 microliters of culture supernatant were taken at 24 hours (Day 1), 48 hours (Day 2), 72 hours (Day 3), 96 hours (Day 4), 120 hours (Day 5), 144 hours (Day 6) and 168 hours (Day 7) after transfection, respectively, and the activity value of luciferase in the supernatant was detected using Pierce Gaussia luciferase fluorescence detection kit (Thermo Fisher Scientific). The activity of luciferase was detected using SpectraMax i3 enzyme labeler (Molecular Devices). After daily detection, the culture medium was completely removed and replaced with new culture medium in the culture plate.
[0621] The experimental groups are as follows:
[0622] The m1Ψ-CDS site-directed modification experiment is divided into 5 groups:
[0623] Group 1: circular GLuc-no modification;
[0624] Group 2: circular GLuc-m1Ψ-CDS site-directed modification 5%;
[0625] Group 3: circular GLuc-m1Ψ-CDS site-directed modification 10%;
[0626] Group 4: circular GLuc-m1Ψ-CDS site-directed modification 25%;
[0627] Group 5: circular GLuc-m6A-CDS site-directed modification 50%;
[0628] The change trend of protein expression level of each group of circular RNA in cells over time was detected.
[0629]
Research results
[0630] The time-dependent trend of protein expression level of different proportions of m1Ψ modified circular RNA in HEK-293T cells was detected, and the results are shown in Figure 30. In HEK-293T cells, m1Ψ modified circular RNA can continuously and stably express Gaussia Luciferase protein, and is significantly better than unmodified circular RNA.
[0631] The time-dependent trend of protein expression level of different proportions of 5moU and m6A modified circular RNA in HeLa cells was detected.
[0632] These results show that the stability of modified circular mRNA is prolonged compared with unmodified circular mRNA, the half-life in vivo is long, and the protein expression efficiency is significantly increased.
[0633] The above results show that the protein expression efficiency of the site-specific and controllable modified mRNA prepared by the TScircle system of the application is higher.
[0634] The results of Example 4 and Example 5 collectively show that site-specific modification can significantly enhance the drug properties of circular mRNA, including lower immunogenicity and higher protein translation efficiency, which has important practical value in the medical field.
[0635] Example 6. Preparation of site-specific modified linear RNA molecules based on the TSmod trans-splicing system
[0636] In this embodiment, it is demonstrated that by designing a reasonable nucleic acid trans-splicing body pair, two RNA fragments can be connected in a predetermined manner based on the trans-splicing strategy, thereby efficiently producing site-specific modified linear RNA molecules.
[0637] First, two pairs of TSSP were designed to determine whether the TSmod trans-splicing system could prepare site-specific modified linear RNA molecules. The first pair of TSSP comprises two RNA fragments: SS1 and SS2, whose sequences are SEQ ID NO: 17 and SEQ ID NO: 18, respectively. Among them, SS1 and SS2 form an active ribozyme. The first target RNA to be connected in this embodiment is named G1 (SEQ ID NO: 19), and the second target RNA to be connected is named G2 (SEQ ID NO: 20). The expected connection mode is to connect the 3' end of G1 with the 5' end of G2 to form the sequence of the target linear RNA G1-G2 (SEQ ID NO: 21). From 5' to 3', G1-SS1 is connected to obtain the first RNA, named RNA-1 (SEQ ID NO: 22); from 5' to 3', SS2-G2 is connected to obtain the second RNA, named RNA-2 (SEQ ID NO: 23).
[0638] The second TSSP pair also contains two RNA fragments: SS3 and SS4, with sequences SEQ ID NO:24 and SEQ ID NO:25, respectively. SS3 and SS4 form a pair of active ribozymes. In this embodiment, the first target RNA to be ligated is named G3 (SEQ ID NO:26), and the second target RNA to be ligated is named G4 (SEQ ID NO:27). The expected ligation method is to connect the 3' end of G3 to the 5' end of G4, forming the target linear RNA sequence G3-G4 (SEQ ID NO:28). Ligating G3-SS3 from the 5' end to the 3' end yields the first RNA, named RNA-3 (SEQ ID NO:29); ligating SS2-G2 from the 5' end to the 3' end yields the second RNA, named RNA-4 (SEQ ID NO:30).
[0639] Four RNA sequences, RNA1, RNA2, RNA3, and RNA4, were synthesized. RNA1 and RNA2 sequences were reacted in a splicing reaction system, as were RNA3 and RNA4 sequences. Gel electrophoresis was then used to detect the nucleic acid bands before and after the reaction, as well as after purification. The molecular weight was determined by comparing the relative positions of the bands. PCR sequencing was used to verify the correctness of the sequence surrounding the trans-joint site. The specific implementation process and results are as follows:
[0640] [Experimental Procedure]
[0641] The synthesis of the designed RNA1, RNA2, RNA3, and RNA4 was as follows: First, the DNA sequences corresponding to RNA1, RNA2, RNA3, and RNA4 were synthesized (Beijing Qingke Biotechnology Co., Ltd.). Linear templates were then prepared from these DNA sequences using PCR.
[0642] In vitro transcription: using The linearized plasmid DNA template was transcribed in vitro (37°C, 2 hours) using the T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) to synthesize RNA fragments A and B. After in vitro transcription, the linear DNA template was digested with DNase I (M0303S, New England Biolabs) (37°C, 15 min). The products were then... RNA purification was performed using the RNA Cleanup Kit (T2050, New England Biolabs).
[0643] Linear RNA molecule synthesis: RNA1, RNA2, RNA3 and RNA4 were added to a buffer containing GTP (final concentration of 2 mM) (50 mM Tris HC1, 10 mM MgCl2, 1 mM DTT, pH 7.5), and the solution was heated at 55 °C for 15 min, and then column-purified (RNA Cleanup Kit, T2050, New England Biolabs). Then, the reaction was determined by agarose gel electrophoresis.
[0644]
Experimental results
[0645] The experimental results are shown in FIG. 42. FIG. 42A shows the gel electrophoresis detection of RNA1, RNA2 and the product after ligation, lanes 1 and 2 are the bands of RNA2 and RNA1 respectively, and lanes 3 and 4 are the products after ligation reaction, and the target linear RNA and the ribozyme fragment formed after the formation of the target chimeric RNA are indicated in the figure. FIG. 42B shows a gel map of the linear RNA molecule generated by the TSmod trans-splicing system using another ribozyme design RNA sequence. The results are similar to those in FIG. 42A.
[0646] The above results show that by designing a reasonable combination of splicing ribozyme fragments, two RNA fragments can be spliced in a predetermined manner based on the trans-splicing strategy, and finally efficiently produce linear RNA.
[0647] Example 7. Site-specific modification of specific fragments in linear RNA and controllable modification
[0648] In this example, the efficiency of the TSmod system for efficiently preparing site-specific modified linear RNA was tested. In this example, RNA1 was modified before ligation, and RNA2 was not modified, and then the TSmod system was used for ligation to achieve controllable modification of specific fragments in linear RNA. The specific method is as follows:
[0649]
Experimental methods
[0650] During in vitro transcription, 5% (95% U), 10% (90% U) and 25% (75% U) of m1Ψ were added to the reaction system of RNA1, respectively, and 5% (95% A), 10% (90% A) and 25% (75% A) of m6A were added. Then, according to the RNA synthesis and purification method described in Example 1, 2% agarose gel was configured for agarose gel electrophoresis analysis.
[0651]
Experimental results
[0652] The results are shown in Figure 43, lanes 7 and 8 are RNA2 and RNA1 fragment samples respectively, lanes 1-3 are samples of RNA1 sample with different proportions of m1Ψ and unmodified RNA2 sample after reaction in the trans-splicing system, and lanes 4-6 are samples of RNA1 sample with different proportions of m6A and unmodified RNA2 sample after reaction in the trans-splicing system.
[0653] As shown in the target RNA band position in Figure 43, in this embodiment, linear RNA molecules with part of the region modified and part of the region unmodified are successfully prepared, and site-specific controllable modification of linear RNA is achieved.
[0654] All the documents mentioned in the present application are cited as references in the present application, as if each document is cited as a reference individually. In addition, it should be understood that, after reading the above teaching of the present application, those skilled in the art can make various modifications or amendments to the present application, and these equivalent forms also fall within the scope defined by the claims of the present application.
Claims
1. A polynucleotide combination comprising, The polynucleotide combination comprises a first RNA and a second RNA, wherein one end of the first RNA is provided with a trans-self-splicing fragment, one end of the second RNA is provided with a trans-self-splicing fragment, and the two trans-self-splicing fragments combine to form an active self-splicing body, thereby removing the trans-splicing fragment from the first RNA and / or removing the trans-splicing fragment from the second RNA, so that the first RNA and the second RNA are connected together through the ends formed after removal. The trans-self-splicing fragment comprises a ribozyme element and a trans-interacting element.
2. A polynucleotide combination for preparing a circular RNA, characterized by, The polynucleotide combination comprises a first RNA and a second RNA, wherein one end of the first RNA is provided with a trans-self-splicing fragment B1, one end of the second RNA is provided with a trans-self-splicing fragment B2, and the trans-self-splicing fragment B1 and the trans-self-splicing fragment B2 combine to form an active self-splicing body B, thereby removing the trans-splicing fragment B1 from the first RNA and / or removing the trans-splicing fragment B2 from the second RNA, so that the first RNA and the second RNA are connected together through the ends formed after removal. The trans-self-splicing fragment comprises a ribozyme element and a trans-interacting element.
3. The polynucleotide combination of claim 2, wherein The trans-self-splicing fragment B1 comprises a ribozyme fragment b1 and a homologous arm sequence z1, and the trans-self-splicing fragment B2 comprises a ribozyme fragment b2 and a homologous arm sequence z2, wherein b1 and b2 combine to form a self-splicing active ribozyme b; or The trans-self-splicing fragment B1 comprises a ribozyme b and a homologous arm sequence z1, and the trans-self-splicing fragment B2 comprises a homologous arm sequence z2. The homologous arm sequence z1 and the homologous arm sequence z2 are reverse complements.
4. The polynucleotide combination of claim 2, wherein The other end of the first RNA is further provided with a self-splicing fragment A1, and the other end of the second RNA is further provided with a self-splicing fragment A2, wherein the self-splicing fragment A1 and the self-splicing fragment A2 combine to form an active self-splicing body A, thereby removing the trans-splicing fragment A1 from the first RNA and / or removing the trans-splicing fragment A2 from the second RNA, so that the first RNA and the second RNA are connected together through the ends formed after removal, forming a circular RNA molecule.
5. The polynucleotide combination of claim 4, wherein The first RNA and the second RNA have the following structure: The first RNA comprises the structure TSA1-G1-TSB1 from 5' end to 3' end, wherein G1 is a first target sequence, TSA1 is a self-splicing fragment A1, and TSB1 is a trans-self-splicing fragment B1; The second RNA comprises the structure TSB2-G2-TSA2 from 5' end to 3' end, wherein G2 is a second target sequence, TSB2 is a trans-self-splicing fragment B2, and TSA2 is a self-splicing fragment A2; Preferably, TSB1 and TSB2 undergo a first splicing reaction to connect the 3' end of G1 with the 5' end of G2; TSA1 and TSA2 undergo a second splicing reaction to connect the 5' end of G1 with the 3' end of G2; thereby obtaining a circular RNA molecule with a sequence comprising G1-G2.
6. A polynucleotide combination for preparing a chimeric linear RNA, characterized in that, The polynucleotide combination comprises n linear RNA fragment precursor molecules, respectively named RNA1-RNA n ; wherein the n RNA fragment precursor molecules respectively comprise G1-G n n target RNA sequences, and the n RNA fragment precursor molecules are connected into a chimeric linear RNA in order through ribozyme self-splicing reaction; RNA x comprising G x and a trans-self-cleaving ribozyme fragment TSx located 3' to G x ; RNA x+1 comprising G x+1 and a trans-self-cleaving ribozyme fragment TSx' located 5' to G x+1 ; said TSx and TSx' in combination form an active self-cleaving ribozyme, thereby cleaving TSx from RNA x and TSx' from RNA x+1 precursor, such that G x and G x+1 are joined together by the ends formed upon cleavage. The trans-self-splicing body fragment comprises a ribozyme element and a trans-acting element.
7. The polynucleotide combination of claim 6, wherein The trans-self-splicing body fragment TSx comprises a ribozyme fragment a1 and a homologous arm sequence z1, and the trans-self-splicing body fragment TSx' comprises a ribozyme fragment a2 and a homologous arm sequence z2, wherein the ribozyme fragment a1 and the ribozyme fragment a2 combine to form a ribozyme a with self-splicing activity; or The trans-self-splicing body fragment TSx comprises a ribozyme a and a homologous arm sequence z1, and the trans-self-splicing body fragment TSx' comprises a homologous arm sequence z2; or The trans-self-splicing body fragment TSx comprises a homologous arm sequence z1, and the trans-self-splicing body fragment TSx' comprises a ribozyme a and a homologous arm sequence z2. The homologous arm sequence z1 and the homologous arm sequence z2 are reverse complements.
8. A method of preparing a circular RNA, characterized by, The method comprises the steps of: A. preparing a polynucleotide combination as claimed in claim 2, comprising a first RNA and a second RNA; B. the first RNA and the second RNA undergo a first ligation reaction and a second ligation reaction to generate a target circular RNA; the first ligation reaction is a ribozyme autocatalytic splicing reaction or an enzyme-catalyzed ligation reaction, and the second ligation reaction is a ribozyme autocatalytic splicing reaction or an enzyme-catalyzed ligation reaction, and the first ligation reaction and the second ligation reaction are not enzyme-catalyzed ligation reactions at the same time.
9. A method of preparing a chimeric RNA product, characterized in that, The chimeric RNA product is sequentially connected by n linear RNA fragments, n≥2; in the chimeric RNA product, from the upstream 5' end to the downstream 3' end, the xth linear RNA fragment is named G x , 1≤x≤n, and x is an integer; The method comprises the steps of: (1) providing n linear RNA fragments each corresponding to a precursor molecule; when 1≤x x The structure of the precursor molecule comprises: the 3' end of G x is connected with a trans self-splicing body fragment TS, and the 5' end of G x downstream of the chimeric RNA product is connected with a trans self-splicing body fragment TS'; x+1 downstream of the chimeric RNA product is connected with a trans self-splicing body fragment TS'; (2) under suitable conditions, the self-splicing reaction occurs after the combination of the trans self-splicing body fragments TS and TS' and TS is excised from G x , TS' is excised from G x+1 , and the 3' end of G x is linked to the 5' end of G x+1 .
10. A circular RNA molecule, characterized in that, The circular RNA molecule is formed by self-splicing of the polynucleotide combination as claimed in claim 2, or is prepared by the method as claimed in claim 8; the circular RNA molecule does not contain chemical modifications, or contains one or more chemical modifications.
11. A site-directed modifying chimeric RNA molecule, characterized in that, The chimeric RNA molecule is prepared by the method as claimed in claim 9, or is formed by self-splicing of the polynucleotide combination as claimed in claim 6; the specific sequence region of the chimeric RNA molecule contains one or more modified nucleotides.
12. A composition characterized in that, The composition contains: (a) the polynucleotide combination as claimed in claim 1, the polynucleotide combination as claimed in claim 2, the polynucleotide combination as claimed in claim 6, the circular RNA as claimed in claim 10, the chimeric RNA molecule as claimed in claim 11, or a combination thereof; and (b) a pharmaceutically acceptable carrier.
13. A cell, wherein, The cell contains the circular RNA as claimed in claim 10, or the chimeric RNA as claimed in claim 11, or contains the composition as claimed in claim 12, or has integrated into the genome the coding sequence of the polynucleotide combination as claimed in claim 1, the polynucleotide combination as claimed in claim 2, or the polynucleotide combination as claimed in claim 6.
14. Use of a polynucleotide combination according to claim 1, a polynucleotide combination according to claim 2, a polynucleotide combination according to claim 6, a circular RNA according to claim 10, a chimeric RNA molecule according to claim 11, a composition according to claim 12, or a cell according to claim 13, characterized in that, For preparing a pharmaceutical composition. For preparing a pharmaceutical composition.
Citation Information
Patent Citations
Intron-mediated recombinant techniques and reagents
US5498531A
Method of effecting DNA splicing
WO2001034793A1
Circular RNA and preparation method thereof
WO2023046153A1
Systems and methods for promoting trans-splicing
WO2024019801A1
Regulated control of RNA interference by alternative splicing
WO2024186892A2