NRP1-specific antisense oligonucleotides with reduced off-target binding for use in preventing and / or treating cancer

LNA-modified NRP1 antisense oligonucleotides with specific sequences reduce off-target effects, enhancing therapeutic efficacy for cancer and other disorders by effectively inhibiting NRP1 with minimal liver toxicity and improved tumor penetration.

WO2026087533A1PCT designated stage Publication Date: 2026-04-30SECARNA PHARMA GMBH & CO KG
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/080381
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-21
Filing Date
2025-10-21
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Existing NRP1 antisense oligonucleotides suffer from significant off-target effects, particularly affecting LARS1, posing risks for clinical development and potential liver damage, and are limited by penetration and efficacy due to their size and expression in various organs.

Method used

Development of LNA-modified oligonucleotides with specific core sequences (ATATTTAGGTCCAGCG or AATATTTAGGTCCAGCG) and additional nucleotides at the 3'-end, reducing off-target effects by enhancing target affinity and stability, allowing for simultaneous inhibition of multiple NRP1 functions.

Benefits of technology

The modified oligonucleotides effectively inhibit NRP1 expression with minimal off-target impact, providing a broad therapeutic spectrum for cancer, ophthalmic diseases, and immune disorders, while avoiding liver toxicity and improving tumor penetration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000013_0001_TABLE
    Figure IMGF000013_0001_TABLE
  • Figure IMGF000014_0001_TABLE
    Figure IMGF000014_0001_TABLE
Patent Text Reader

Abstract

The present invention refers to an oligonucleotide consisting of a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and at least one additional nucleotide at the 3´-end and optionally at least one additional nucleotide at the 5´-end. At least one of the nucleotides of the oligonucleotide is modified, and the oligonucleotide binds to pre-mRNA of neuropilin 1 (NRP1, CD304). The invention is further directed to a pharmaceutical composition comprising such oligonucleotide. The pharmaceutical composition and the oligonucleotide are for use in a method of preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P138069PC00

[0002] NRPl-specific antisense oligonucleotides with reduced off-target binding for use in preventing and / or treating cancer

[0003] The present invention refers to an LNA-modified oligonucleotide, hybridizing with neuropilin (NRP) such as NRP1 (CD304) pre-mRNA wherein off-target effects are reduced. The oligonucleotide inhibits the expression of NRP, NRP mRNA and / or NRP pre-mRNA and is used for preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder.

[0004] Technical background

[0005] Neuropilin 1 (NRP1, CD304) is a multi-domain co-receptor that is important for the function, stability and migration of various immune cell types, including regulatory T cells, cytotoxic T cells and tumour- associated macrophages. This factor also plays a role in the development of neurones and promotes the maturation of blood vessels (https: / / pubmed.ncbi.nlm.nih.gov / 32675311 / ). It is overexpressed in many tumours and its expression correlates negatively with patient survival. NRP1 is therefore a promising target for drug development for the treatment of tumours. The different tumour-promoting functions of NRP1 are mediated by different domains. Simultaneous inhibition of all functions is not possible with individual antibodies or small molecules. Therefore, inhibition of expression is more promising. In the past, specific and in vivo well-tolerated NRP1 antisense oligonucleotides have already been identified that lead to an effective downregulation of NRP1. Despite a stringent selection of sequences that show a low degree of homology to off-targets in silico (off-target: all target molecules that are not NRP1), detailed in vitro analyses have shown that the most suitable candidate causes the downregulation of a predicted off-target. This harbours potential risks for later clinical development. The aim was now to optimize NRP1 antisense oligonucleotides in order to achieve an even higher degree of specificity compared to previous antisense oligonucleotides. So far, two human monoclonal antibodies MNRP1685A (Genentech) and ASP1948 (Astellas) have been patented. The clinical development of both antibodies was stopped for various reasons.

[0006] The treatment with antibodies is likely to be limited to individual domains and thus functions of NRP1. Furthermore, antibodies are significantly larger molecules than antisense oligonucleotides, which can have an influence on the penetration depth and thus efficacy in tumours. Due to the expression of NRP1 in different organs (e.g. lung and liver) and the existence of a soluble form of NRP1, antibodies are susceptible to so-called “sink” effects, whereby therapeutic antibodies can be intercepted and are therefore no longer available for blocking in the tumour (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3415661 / ).

[0007] In addition, the small molecule inhibitor EG 00229 was developed (Tocris), which is intended to prevent the binding of VEGF (“vascular endothelial growth factor”) to NRP1.

[0008] WO 2018 / 127599 Al focuses on an anti-angiogenic effect in ophthalmological applications; in addition other NRPl-specific antisense oligonucleotides are disclosed focusing on the treatment of cancer and describing the identification of highly specific and efficient NRP1 antisense oligonucleotides.

[0009] Apart from NRP1, treatment with the previous NRPl-specific antisense oligonucleotides led to downregulation of Leucyl-tRNA synthetase (LARS1) compared to mock-treated cells and control oligonucleotide-treated cells.

[0010] The literature indicates that loss -of- function mutations in LARS1 lead to severe liver damage in early childhood (https: / / pubmed.ncbi.nlm.nih.gov / 33300650 / , https: / / ojrd.biomedcentral.com / articles / 10.1186 / sl3023-024-03229-3). LARS1 therefore has an essential function in the liver and downregulation by an antisense oligonucleotide harbours risks.

[0011] Yasuhara H et al. (Molecular Diagnosis & Therapy, 2022, 26:117-127) describe the reduction of off-target effects in gapmer antisense oligonucleotides hybridizing with the human glucocorticoid receptor mRNA by oligonucleotide extension. Oligonucleotides of the present invention are very successful in the inhibition of the expression and activity of NRP1, respectively, and in parallel show no or very reduced off-target effects. The mode of action of an oligonucleotide differs from the mode of action of an antibody or small molecule, and oligonucleotides are highly advantageous regarding for example

[0012] (i) the blocking of multiple functions and activities, respectively, of a target,

[0013] (ii) the penetration of tumor tissue in solid tumors due to their small molecular size, (iii) the combination of oligonucleotides with each other or an antibody or a small molecule, and

[0014] (iv) the inhibition of intracellular effects which are not accessible for an antibody or effects not inhibitable via a small molecule.

[0015] Oligonucleotides of the present invention are advantageous in comparison to previous generations of oligonucleotides due to their higher stability, stronger target affinity and potency, further reduced off-target effects and due to their independence from delivery reagents to achieve target suppression in cells.

[0016] Summary

[0017] The present invention refers to an oligonucleotide, such as an antisense oligonucleotide, consisting of a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and at least one additional nucleotide at the 3´-end, and optionally at least one additional nucleotide at the 5´-end, wherein at least one of the nucleotides of the oligonucleotide comprises a modification selected from the group consisting of LNA, ENA, cET, a 2'Fluoro modification, a 2'0-Methyl modification, a 2 "O -Methoxyethyl modification, FANA and a combination thereof. The modification is for example located at the 5´-end and / or 3´-end of the oligonucleotide

[0018] The oligonucleotide of the present invention consists for example of the core sequence and 1 to 10 additional nucleotides at the 3´-end and optionally 1 to 10 additional nucleotides at the 5´-end. For example, the oligonucleotide consists of the core sequence and 1 to 10 additional nucleotides at the 3´-end and optionally 1 to 10 additional nucleotides at the 5´-end, wherein the first additional nucleotide at the 3´-end is guanin (G). The core sequence and the additional nucleotide at the 3'-end and / or the 5'-end of the oligonucleotide of the present invention corresponds for example to a pre-mRNA sequence of neuropilin 1 (NRP1) of SEQ ID NO.187. The oligonucleotide binds for example within a binding active region consisting of SEQ ID NO.188.

[0019] The oligonucleotide of the present invention is characterized by a reduced off-target effect for example a reduced off-target effect on the off-target gene LARS1.

[0020] The oligonucleotide of the present invention comprises or consists of for example SEQ ID NO:137, SEQ ID NO:177, SEQ ID NO:169, SEQ ID NO:92, SEQ ID NO:151, SEQ ID NO:31, SEQ ID NO:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

[0021] Further, the oligonucleotide of the present invention has for example 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to any one of the oligonucleotides of SEQ ID NO:137, SEQ ID NO:177, SEQ ID NO:169, SEQ ID NO:92, SEQ ID NO:151, SEQ ID NO:31, SEQ ID NO:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

[0022] Further, the oligonucleotide of the present invention comprises for example at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 nucleotides of any one of the oligonucleotides of SEQ ID NO: 137, SEQ ID NO: 177, SEQ ID NO: 169, SEQ ID NO:92, SEQ ID NO:151, SEQ ID NO:31, SEQ ID NO:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

[0023] In addition, the present invention refers to a pharmaceutical composition comprising an oligonucleotide of the present invention and a pharmaceutically acceptable carrier, excipient, dilutant, stimulant such as an adjuvant, or a combination thereof. Optionally, the pharmaceutical composition comprises a further active agent for example selected from the group consisting of another oligonucleotide, a fusion protein, an antibody, a small molecule and a combination thereof.

[0024] The pharmaceutical composition or the antisense oligonucleotide of the present invention is for example for use in preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder. The preventable and / or treatable ophthalmic disease is for example an angiogenic eye disease such as age related macular disease (AMD), diabetic retinopathy (DME), retinopathy of prematurity (Retinopathia praematurorum) or corneal neovascularization. The preventable and / or treatable cancer is for example bladder carcinoma, breast cancer, colorectal carcinoma, lung cancer, malignant melanoma, mesothelioma, lymphoma, skin cancer, bone cancer, prostate cancer, hepatocarcinoma, brain cancer, cancer of the larynx, liver, gall bladder, pancreas, testicular, rectum, parathyroid, thyroid, adrenal, neural tissue, head and neck, colon, stomach, bronchi, kidneys, basal cell carcinoma, neuroblastoma, squamous cell carcinoma, metastatic skin carcinoma, osteo sarcoma, Ewing's sarcoma, reticulum cell sarcoma, liposarcoma, leukemia, myeloma, giant cell tumor, small-cell lung tumor, islet cell tumor, primary brain tumor, meningioma, acute and chronic lymphocytic and granulocytic tumors, acute and chronic myeloid leukemia, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma, intestinal ganglioneuromas, Wilm's tumor, seminoma, ovarian tumor, leiomyomater tumor, cervical dysplasia, retinoblastoma, soft tissue sarcoma, malignant carcinoid, topical skin lesion, rhabdomyosarcoma, Kaposi's sarcoma, osteogenic sarcoma, malignant hypercalcemia, renal cell tumor, polycythaemia vera, adenocarcinoma, anaplastic astrocytoma, glioblastoma multiforma, leukemia, or epidermoid carcinoma.

[0025] The pharmaceutical composition or the antisense oligonucleotide of the present invention is for example administrable locally or systemically.

[0026] Description of figures

[0027] Fig. 1 shows 166 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line PANC-1. The mRNA levels of NRP1, LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 or LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0028] Fig. 2 shows 166 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line PANC-1. The mRNA levels of NRP1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples. Fig. 3 shows 166 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line PANC-1. The mRNA levels of the off-target gene LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0029] Fig. 4 depicts the mRNA levels of LARS 1 normalized to the housekeeping gene HRPT1 as determined by QuantiGene Singleplex Assay (Thermo Fisher) compared to mock-treated samples in PANC-1 cells. The mRNA levels of NRP1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples. ASOs were grouped according to the NRP1 expression levels in PANC-1 cells after treatment with the respective ASOs:

[0030] Residual NRP1 mRNA expression ≤0.03 or Residual NRP1 expression >0.03.

[0031] Fig. 5 depicts the sequence characteristics of selected NRPl-specific ASOs that lead to <0.03 Residual NRP1 expression in PANC-1 cells. Treatment with ASO sequences with at least one nucleotide elongation at the 3’ end resulted in Residual LARS1 expression >0.8 (Fig. 5A, 5C), while sequences without 3’ end elongation led to Residual LARS1 expression <0.8 (Fig. 5A, 5B). Fig. 5B discloses SEQ ID NOS 189, 195, 196, 190-192, 249, 253, 257, 259, 289 and 299, respectively, inorder of appearance. Fig. 5C discloses SEQ ID NOS 260, 263, 266, 278-280, 323, 325, 337, 338, 198-201, 203, 209, 216, 217, 233, 234, 237, 355, 361, 363 and 364, respectively, in order of appearance.

[0032] Fig. 6 depicts 168 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line SKOV3. The mRNA levels of NRP1, LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 and LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0033] Fig. 7 shows 168 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line SKOV3. The mRNA levels of NRP1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0034] Fig. 8 shows 168 variants of the parent ASO A15091HI (shown in grey) used for screening in the human cancer cell line SKOV3. The mRNA levels of LARS 1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0035] Fig. 9 depicts the mRNA levels of LARS 1 normalized to the housekeeping gene HRPT1 as determined by QuantiGene Singleplex Assay (Thermo Fisher) compared to mock-treated samples in SKOV3 cells. The mRNA levels of NRP1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples. ASOs were grouped according to the NRP1 expression levels in SKOV3 cells after treatment with the respective ASOs: Residual NRP1 mRNA expression ≤0.16 or Residual NRP1 expression >0.16.

[0036] Fig. 10 depicts sequence characteristics of selected NRPl-specific ASOs that lead to <0.16 NRP1 expression. Treatment with ASO sequences with at least one nucleotide elongation at the 3’ end resulted in LARS1 expression >0.8 (Fig. 10A, 10C), while sequences without 3’ end elongation led to LARS1 expression <0.8 (Fig. 10A, 10B). Fig, 10B discloses SEQ ID NOS 189, 195, 193, 249, 250, 252, 253 and 257, respectively, in order of appearance. Fig. 10C discloses SEQ ID NOS 260, 262, 263, 268, 271, 273, 277-279, 323, 337, 341, 342, 197-200, 215-218, 220, 221, 232, 311, 344, 354, 355, 361-364, respectively, in order of appearance.

[0037] Fig. 11 depicts sequence characteristics of selected NRPl-specific ASOs that lead to <0.03 NRP1 expression in PANC-1 cells and <0.16 NRP1 expression in SKOV3 cells. Treatment with ASO sequences with at least one nucleotide elongation at the 3’ end resulted in LARS1 expression >0.8 (Fig. 11A, 11C), while sequences without 3’ end elongation led to LARS1 expression <0.8 (Fig. 11A, 11B). Fig. 11B discloses SEQ ID NOS 189, 195, 193, 249, 253 and 257, respectively, in order of appearance. Fig. 11C discloses SEQ ID NOS 260, 263, 278, 279, 323, 337, 198-200, 216, 217, 355, 361, 363 and 364, respectively, in order of appearance. Fig. 12 shows results of the investigation of concentration-dependent knockdown of NRP1 and LARS1 mRNA expression by NRPl-specific ASOs A15091HI, A15529HI, A15530HI, A15531HI, A15533HI, A15547HI, A15552HI, A15556HI, A15574HI, A15575HI, A15578HI, A15605HI, A15634HI, A15646HI, A15649HI, A15656HI, A15657HI, A15659HI, A15670HI, A15676HI, A15677HI, A15678HI, and A15679HI investigated in PANC-1 cells. NRP1, LARS1 as well as HPRT1 mRNA expression was analyzed using the QuantiGene Singleplex assay (ThermoFisher). NRP1 and LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0038] Detailed description

[0039] The present invention provides oligonucleotides, in particular antisense oligonucleotides (ASO), which hybridize with mRNA sequences of neuropilin such as NRP1, in particular human NRP1, and inhibit the expression and activity, respectively, of NRP1. The oligonucleotide has a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and comprises at least one additional nucleotide at the 3'-end. The additional nucleotide corresponds to the corresponding sequence of SEQ ID NO: 187. At least one additional nucleotide at the 3'-end is obligatory to reduce off-target effects of this antisense oligonucleotides significantly. The core sequence and the additional nucleotide at the 3'-end and / or the 5'-end corresponds to a corresponding sequence of a pre-mRNA sequence of NRP1 for example of SEQ ID NO.187. SEQ ID NO:1 and 2 are for example described in WO 2018 / 127599 Al.

[0040] The oligonucleotide of the present invention binds to I hybridizes with the target such as a pre-mRNA and / or mRNA target for example at a temperature of 20 °C to 45 °C, 25 °C to 40 °C, 28 °C to 37 °C, 32 °C to 39 °C, or 30 °C to 35 °C. The pH during the binding I hybridizing of the oligonucleotide to I with the target such as a pre-mRNA and / or mRNA target, is for example 1 to 9, 2 to 8, 3 to 7, 4 to 6, 6 to 8, or 5. The oligonucleotide binds to I hybridizes with the pre-mRNA and / or mRNA for example at a temperature of 25 °C to 40 °C and a pH of 6 to 8, at a temperature of 28 °C to 37 °C and a pH of 6 to 7, or at a temperature of 32 °C to 39 °C and a pH of 7 to 8. NRP1 as a multi-domain receptor binds to several different types of ligands and receptors relevant for immunosuppression, cell migration, angiogenesis, cell survival, metastasis and cell proliferation. Many ligands of NRP1 act as protumorigenic and / or pro- angiogenic growth factors and / or are immunosuppressive. Therefore, inhibition of expression of NRP1 using antisense oligonucleotides allows targeting of a broad spectrum of different activities of NRP1 simultaneously, thereby significantly increasing the feasibility of a successful therapy. Due to the reduced off-target effects of the oligonucleotides of the present invention, for example preferably on LARS1, potential undesired side effects of a therapy will be reduced. Thus, the oligonucleotides of the present invention represent an interesting and highly efficient tool for use in a method of preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder.

[0041] In the following, the elements of the present invention will be described in more detail. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

[0042] Throughout this specification and the claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as", “for example”), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention. The term “about” refers to a figure indicated and + / - 10 % of this figure.

[0043] Oligonucleotides of the present invention are for example antisense oligonucleotides consisting of or comprising 16 to 30 nucleotides, 18 to 29 nucleotides, 19 to 28 nucleotides, 20 to 27 nucleotides, 21 to 26 nucleotides, 22 to 25 nucleotides or 23 to 24 nucleotides. The oligonucleotides for example consist of or comprise 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. The oligonucleotides of the present invention comprise for example at least one nucleotide which is modified. The modified nucleotide is for example abridged nucleotide such as a locked nucleic acid (LNA, e.g., 2´,4´-LNA such as beta-D-LNA and / or alpha-L-LNA), cET, ENA, a 2'Fluoro modified nucleotide, a 2'O-Methyl, a 2’0 -Methoxyethyl modified nucleotide or a combination thereof. The modified nucleotide is preferably an LNA-modified nucleotide. The oligonucleotide of the present invention comprises nucleotides having for example one or more, two or more, three or more or four or more of the same or different of these modifications. Further, the oligonucleotide of the present invention comprises a backbone, wherein the internucleotide linkage is, for example, a phosphodiester, phosphorothioate, methylphosphonate, mesyl-phosphoramidate (MsPA; e.g., WO 2021 / 030778) phosphoryl guanidine or a combination thereof. The phosphate is preferably a phosphorothioate. Optionally the cytosines of the oligonucleotide comprises one or more methyl group (s).

[0044] A mesyl-phosphoramidate for example is introduced as a stereorandom and / or stereoselective internucleotide linkage in the gap and / or one or both wings of a gapmer oligonucleotide. Optionally all phosphate or phosphorothioate linkages of the oligonucleotide are replaced by mesyl-phosphoramidate, or all phosphate or phosphorothioate linkages of the gap or all phosphate or phosphorothioate linkages of one or both wings are replaced by mesyl-phosphoramidate. For example 1 to 5 phosphate or phosphorothioate linkages of the gap are replaced by mesyl- phosphoramidate and / or 3 to 5 phosphate or phosphorothioate linkages near the 5'-side of the gap are replaced by mesyl-phosphoramidate. The mesyl-phosphoramidate is for example introduced into the oligonucleotide by means of a Staudinger reaction, e.g., between methanesulfonyl azide (MsN3, 0.5M solution in 1:1 acetonitrile / toluene) and the trivalent phosphite intermediate produced upon phosphoramidite coupling (as described for example in Anderson B. A. et al., Nucleic Acid Research, 2021, Vol. 49, No. 16, 9026-9041).

[0045] Also a phosphorothioate introduces for example a stereorandom and / or a stereoselective linkage in the gap and / or one or both wings of a gapmer oligonucleotide.

[0046] According to the present invention, “gapmer” means an oligonucleotide having a central region comprising a plurality of nucleosides. These nucleotides for example support RNase H cleavage positioned between a 5’-region and a 3’-region. The positions of the central region refer to the order of the nucleosides of the central region and are counted starting from the 5’-end of the central region. Thus, the 5’-most nucleoside of the central region is at position 1 of the central region. The “central region” may be referred to as a “gap”, and the “5’-region” and “3’-region” may be referred to as “wings”.

[0047] The oligonucleotide of the present invention is for example an antisense oligonucleotide (e.g., DNA or RNA), siRNA, or miRNA. Preferably, the oligonucleotide is an antisense oligonucleotide.

[0048] “Reducing” according to the present invention includes inhibiting an effect such as expression in different percentages and amounts, respectively. “Reducing” includes complete inhibition.

[0049] The present invention refers to the provision of an oligonucleotide, such as an antisense oligonucleotide, having a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and comprising at least one, at least two, at least three, at least four, at least five additional nucleotide(s) at the 3'- end. The oligonucleotide comprises for example 1 to 10, 2 to 8, 3 to 7, 4 or 5 to 6 additional nucleotides at the 3 '-end of the core sequence. The oligonucleotide comprises for example 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at the 3'- end of the core sequence. The additional nucleotide at the 3'-end corresponds to the mRNA and / or pre-mRNA sequence of the corresponding target of the oligonucleotide. A target sequence is for example shown in SEQ ID NO: 187.

[0050] Optionally, the oligonucleotide of the present invention having the core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and comprising an additional nucleotide at the 3'- end, comprises one or more, two or more, three or more, four or more, or five or more additional nucleotides also at the 5'-end. The oligonucleotide comprises for example 1 to 10, 2 to 8, 3 to 7, 4 or 5 to 6 additional nucleotides at the 5'-end of the core sequence having additional nucleotides at the 3'-end. The oligonucleotide comprises for example 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at the 5'-end of the core sequence having additional nucleotides at the 3 '-end.

[0051] The additional nucleotide at the 3'-end and optionally at the 5'-end corresponds to the mRNA and / or pre-mRNA sequence of the corresponding target of the oligonucleotide. Such target sequence for example comprised by SEQ ID NO: 187.

[0052] The oligonucleotide mediates the limitation of available NRP1 mRNA for protein expression without causing an off-target effect or reducing an off-target effect such as LARS1.

[0053] The oligonucleotide of the present invention inhibits the expression of NRP1 for example to an expression rate of < 0.03 and the expression rate of an off-target gene for example to an expression rate of >0.8, or an expression rate of < 0.16 of the NRP1 expression and the expression rate of an off-target gene such as LARS1 for example to an expression rate > 0.8. Alternatively, the oligonucleotide of the present invention inhibits the expression of NRP1 for example to an expression rate of < 0.02 and the expression rate of an off-target gene for example to an expression rate of >0.9, or the oligonucleotide of the present invention inhibits the expression of NRP1 for example to an expression rate of < 0.01 and the expression rate of an off-target gene for example to an expression rate of > 0.99. The off-target gene is for example LARS1. In order to limit protein expression, the oligonucleotide requires the presence of a complementary nucleic acid sequence representing a hybridization target, which allows the formation of heteroduplexes. The oligonucleotide of the present invention hybridize for example with pre-mRNA of SEQ ID NO.187 (GRCh38p13_Chr 10_33177492-33336262-1). The formation of a heteroduplex between the oligonucleotide and the target RNA leads to recruitment of enzymes such as RNaseH leading to degradation or inactivation of the target RNA or termination of transcription, and thus, limits the amount of available NRP1 mRNA for protein expression.

[0054] The oligonucleotide of the present invention comprises one or more, two or more, three or more, four or more or five or more modified nucleotide(s) for example at least at the 3'- and / or 5'- end of the oligonucleotide and / or at any position within the oligonucleotide. The oligonucleotide comprises the modified nucleotide for example in a row of 1, 2, 3, 4, 5, or 6 modified nucleotides, or a modified nucleotide is combined with one or more, two or more, three or more, four or more, or five or more unmodified nucleotides. The modified nucleotides are for example in a sequence of 5 nucleotides at the 3'- and / or 5'- end of the oligonucleotide. This sequence needs not to start with the first nucleotide of the 3'- or 5'- end of the oligonucleotide. The following Table 1 presents embodiments of oligonucleotides of the present invention comprising modified nucleotides for example LNA which are indicated by (+) and phosphorothioate (PTO) indicated by (*). Alternatively, in the oligonucleotides of Table 1 one or more PTO linkages are replaced by mesyl- phosphoramidate or other internucleotide linkages such as a phosphodiester, methylphosphonate, phosphoryl guanidine or a combination thereof.. The oligonucleotides consisting of or comprising the sequences of Table 1 may comprise any other modified nucleotide and any other combination of modified and unmodified nucleotides. Oligonucleotides of Table 1 hybridize with pre-mRNA of human, monkey, mouse and / or rat NRP1, preferably human NRP1:

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062] Table 1: List of human NRPl-specific oligonucleotides, in particular ASOs. An “HI” after the ASO ID indicates a human NRPl-specific sequence that binds to an intronic region of the pre-mRNA. **The human NRP1 gene is located on the lagging strand of the DNA (indicated by

[0063]

[0064] which has been used to determine binding sites of the respective ASOs.

[0065] The ASOs of the present invention hybridize with / bind to, for example, a hybridizing / binding active region of SEQ ID NOs.187. This region comprises or consists, for example, of position 6688-6724 of SEQ ID NO: 187. For example, the sequence of position 6688-6724 of SEQ ID NO: 187 comprises or consists of CTACTGCTACCGCTGGACCTAAATATTATTTTGCAAG (SEQ ID NO: 188).

[0066] The oligonucleotides of the present invention hybridize with / bind to, for example, pre-mRNA of SEQ ID NO.187. Such oligonucleotides are called NRP1 antisense oligonucleotides. Oligonucleotides of the present invention, which are for example antisense oligonucleotides, are shown in Table 1. The present invention further refers to oligonucleotides such as antisense oligonucleotides having about 80 % to 99 %, about 85 % to 98 %, about 90 % to 95 %, about 90 % to 99%, about 93% to about 99%, about 94% to about 99%, about 95% to about 99%, at least about 85 %, 86 %, 87 %, 88 %, 89 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, or 99 % sequence homology to an oligonucleotide of Table 1.

[0067] Moreover, the present invention refers to oligonucleotides such as antisense oligonucleotides comprising or consisting of at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 or at least 24 nucleotides of any one of the oligonucleotides of SEQ ID NO.1 – SEQ ID NO.178 depending on the length of each oligonucleotide. The oligonucleotide of the present invention comprises or consists of for example the following additional nucleotides shown in Table 2:

[0068]

[0069] Table 2: Combination of different numbers of additional nucleotides at the 3'- and 5'-end, wherein at least one additional nucleotide is located at the 3'-end.

[0070] Each nucleotide of the sequence can be modified. The modified nucleotide is for example a bridged nucleotide such as a locked nucleic acid (LNA, e.g., 2´,4´-LNA such as beta-D-LNA and / or alpha- L-LNA), cET, ENA, a 2'Fluoro modified nucleotide, a 2'0-Methyl, or a 2’0-Methoxyethyl modified nucleotide. The modified nucleotide is preferably an LNA-modified nucleotide.

[0071] ASOs of the present invention having the core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and comprising an additional nucleotide at the 3´- end, comprise for example a region of 6 to 8 unmodified nucleotides in the core sequence.

[0072] ASOs of the present invention comprise, for example, one or more modified nucleotides, e.g., 1, 2, 3, 4 or 5 nucleotides at the 5'- and / or 3´-end of the oligonucleotide. The 5Z- and 3´-end are modified identically or differently. If the 5Z-and 3´-ends are modified identically the nucleotides are modified at the same positions counted from the 5'- and 3´-end (in each case starting the counting with 1 from the end), respectively, having the same modification for example LNA-modification. If the 5'- and 3´-ends are modified differently the position of the modified nucleotide and / or the type of modification at the 5Z- and 3´-ends differ; the type of nucleotide modification is the same (e.g., LNA) or different. Modified nucleotides such as LNA-modified nucleotides need not to follow in a row, but may be separated by one or more unmodified nucleotides. In the following table exemplary modification patterns at the 5'- and 3´-end of the ASOs of the present invention are described, wherein an unmodified nucleotide is indicated by “ and the number on either side of the “ refers to the number of modified nucleotides such as LNA-modified nucleotides in a row. The modified nucleotide(s) is / are at any position of the 5'- and / or 3´-end of the ASO as shown for example in the following Table 3:

[0073]

[0074]

[0075] which indicates specific positions of the LNA modifications at the 5'- and 3'-end of each ASO in the following Table 4:

[0076]

[0077]

[0078] In some embodiments, an oligonucleotide of the present invention reduces the amount of NRP1 mRNA and / or the NRP1 protein expression for example by about 30 % - 100 %, 35 % - 99 %, 40 % - 98 %, 45 % - 97 %, 50 % - 96 %, 55 % - 95 %, 60 % - 90 %, 65 % - 85 %, 70 % - 80 % or at least about 30 %, 35 %, 40 %, 45 %, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The NRP1 mRNA and / or protein expression is for example reduced in a cell, tissue, organ, or a subject.

[0079] The reduction of the amount of the NRP1 mRNA and / or NRP1 protein expression is for example determined by the comparison of the amount of the NRP1 mRNA and / or NRP1 protein expression in a sample treated with an oligonucleotide of the present invention and a corresponding untreated control. The untreated control is, for example, NRP1, NRP1 mRNA, NRP1 pre-mRNA expression, or a combination thereof in a subject prior to administration of an oligonucleotide of the present invention is administered or an untreated sample such as a cell, blood, urine, saliva etc.. A cell is for example from a cell line such as PANC-1 or SKOV3 cells. The untreated sample is, for example, taken from a subject before an oligonucleotide of the present invention is administered.

[0080] The oligonucleotide of the present invention reduces the amount of NRP1 mRNA and / or the expression of NRP1 protein expression at a nanomolar or micromolar concentration for example at a concentration of about 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 nM, or 1, 10 or 100 μM.

[0081] The present invention also refers to a pharmaceutical composition comprising an oligonucleotide of the present invention and a pharmaceutically acceptable carrier, excipient and / or diluent. Optionally the pharmaceutical composition further comprises for example a chemotherapeutic, another oligonucleotide either from the present invention or different from the present invention, an antagonistic protein such as a fusion protein, an antibody and / or a small molecule.

[0082] In some embodiments, the oligonucleotide or the pharmaceutical composition of the present invention is for use in a method of preventing and / or treating a disorder. In some embodiments, the use of the oligonucleotide or the pharmaceutical composition of the present invention in a method of preventing and / or treating a disorder is combined with radiotherapy and / or laser treatment. The radiotherapy may be further combined with a chemotherapy (e.g., platinum, gemcitabine).

[0083] The disorder is, for example, characterized by activity of NRP1, such as overactivity or a NRP1 mRNA and / or protein imbalance, i.e., the NRP1 mRNA and / or protein level is abnormal (e.g., increased) in comparison to the level in a normal, healthy cell, tissue, organ or subject, or NRP1 activity is abnormal. The NRP1 level is, for example, increased by an increased amount of NRP1 mRNA and / or NRP1 protein expression. Overactivity of NRP1 function is, for example, caused by activating mutations or by unknown genetic, epigenetic or environmental mechanisms.

[0084] The NRP1 mRNA and protein level, respectively, is measured for example by any standard method known to a person skilled in the art, such as immunohistochemistry, western blot, quantitative real time PCR or QuantiGene assay.

[0085] The oligonucleotide and the pharmaceutical composition comprising the oligonucleotide, respectively, of the present invention has an inhibitory effect on the NRP1 expression for example for 1, 2, 3, 4, 5 or 6 days, 1, 2, 3 or 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 months or 1 or 2 years. The treatment effect of the oligonucleotides of the present invention for example corresponds to the duration of the inhibitory effect. An oligonucleotide or a pharmaceutical composition of the present invention is administered locally or systemically for example intravitreal, intracameral or subconjunctival, e.g., injection, topically via eye drops, orally, sublingually, nasally, subcutaneously, intravenously, intraperitoneally, intramuscularly, intratumorally, intrathecally, intraventricularily, transdermally, and / or rectally. Alternatively or in combination ex vivo treated immune cells are administered. The oligonucleotide is administered alone or in combination with another oligonucleotide of the present invention and optionally in combination with another compound such as another oligonucleotide, an antagonistic protein such as a fusion protein, an antibody, a small molecule and / or a chemotherapeutic (e.g., platinum, gemcitabine). Further, two or more oligonucleotides of the present invention are, for example, administered together, at the same time point, e.g., in a pharmaceutical composition or separately, or on staggered intervals.

[0086] In some embodiments, the other oligonucleotide (i.e., not being part of the present invention), the antagonistic protein such as a fusion protein, the antibody, and / or the small molecule are effective in preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder. An autoimmune disorder is for example autoimmune arthritis or gastrointestinal autoimmune diseases such as inflammatory bowel disease (IBD) or colitis, an immune disorder for example an immune exhaustion due to chronic viral infections such as HIV infection, a cardiovascular disorder, an inflammatory disorder for example a chronic airway inflammation, a bacterial, viral and / or fungal infection for example sepsis, a corona virus infection or a Mycobacterium bovis infection, a liver disorder, a chronic kidney disorder, a psychiatric disorder (e.g., schizophrenia, bipolar disorders, Alzheimer's disease), cancer or a combination thereof.

[0087] An oligonucleotide or a pharmaceutical composition of the present invention is used for example in a method of preventing and / or treating a solid tumor or a hematologic tumor. Examples of cancers preventable and / or treatable by use of the oligonucleotide or pharmaceutical composition of the present invention are bladder carcinoma, breast cancer, colorectal carcinoma, lung cancer, malignant melanoma, mesothelioma, lymphoma, skin cancer, bone cancer, prostate cancer, hepatocarcinoma, brain cancer, cancer of the larynx, liver, gall bladder, pancreas, testicular, rectum, parathyroid, thyroid, adrenal, neural tissue, head and neck, colon, stomach, bronchi, kidneys, esophagastric junction cancer, basal cell carcinoma, neuroblastoma, squamous cell carcinoma, metastatic skin carcinoma, osteo sarcoma, Ewing's sarcoma, reticulum cell sarcoma, liposarcoma, leukemia, myeloma, giant cell tumor, small-cell lung tumor, islet cell tumor, primary brain tumor, meningioma, acute and chronic lymphocytic and granulocytic tumors, acute and chronic myeloid leukemia, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma, intestinal ganglioneuromas, Wilm's tumor, seminoma, ovarian tumor, leiomyomater tumor, cervical dysplasia, retinoblastoma, soft tissue sarcoma, malignant carcinoid, topical skin lesion, rhabdomyosarcoma, Kaposi's sarcoma, osteogenic sarcoma, malignant hypercalcemia, renal cell tumor, polycythaemia vera, adenocarcinoma, anaplastic astrocytoma, glioblastoma multiforma, leukemia, or epidermoid carcinoma.

[0088] In some embodiments two or more oligonucleotides of the present invention are administered together. The oligonucleotides are administered at the same time point for example in a pharmaceutical composition or separately, or on staggered intervals. In other embodiments, one or more oligonucleotides of the present invention are administered together with another compound such as another oligonucleotide (i.e., not being part of the present invention), an antagonistic protein such as a fusion protein, an antibody, a small molecule and / or a chemotherapeutic, at the same time point for example in a pharmaceutical composition or separately, or on staggered intervals. In some embodiments of these combinations, the oligonucleotide inhibits the expression and activity, respectively, of an receptor such as an growth receptor and the other oligonucleotide (i.e., not being part of the present invention), an antagonistic protein such as a fusion protein, the antibody and / or small molecule inhibits (antagonist) the identical or a different growth receptor or it inhibits (antagonist) a signal transduction factor; alternatively, it inhibits an immune checkpoint or activates an immune activator. The growth receptor is for example TGF-beta receptor I (TBRI), TGF-beta receptor II (TBRII), or receptors for VEGF, HGF, PDGF and / or SEMA3 (Plexin). The signal transduction factor is for example p38MAPK, ERK1, ERK2, PI3K, Akt, NF-KB, pSMAD2, pSMAD3, Src, Pyk2, FAK and / or p-pl30Cas. The immune checkpoint is for example lymphocyte activation gene 3 (LAG3), T cell immunoglobulin and mucin domain-containing protein 3 (TIM3) and / or cytotoxic T-lymphocyte-associated Protein 4 (CTLA4). The immune activator is for example CD 137, CD40, CD27, glucocorticoid-induced TNFR-related protein (GITR) and / or a toll like receptor such as toll like receptor 9 (TLR9). In case of an ophthalmic disease such as AMD or DME an oligonucleotide of the present invention may be combined with an anti-VEGF antibody or an antagonistic protein such as a fusion protein, laser therapy and / or a corticosteroid such as cortisol (C21H30O5), corticosterone (C21H30O4), cortisone (C21H28O5) and / or aldosterone (C21H28O5).

[0089] A subject of the present invention is for example a mammalian (e.g., a human, monkey, dog, cat horse, cow, pig), bird, or fish.

[0090] Examples

[0091] The following examples illustrate different embodiments of the present invention, but the invention is not limited to these examples.

[0092] Example 1: Screening of NRP1 antisense oligonucleotides in human PANC-1 cells

[0093] 166 variants of the ASO A15091HI (SEQ ID NO:3, shown in grey) comprising the core sequence SEQ ID NO:1 were used for screening in the human cancer cell line PANC-1. Cells were treated with 5 μM of the indicated ASOs. After 3 days of treatment, cells were lysed and the mRNA levels of NRP1, LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 and LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples. Boxes show preferred ASO characteristics in Fig. 1.

[0094] As shown in Fig. 1, the success of the adaptations of the core sequence of SEQ ID NO:1 in terms of NRP1 specificity varied. While most ASOs comprising the core sequence had a similar effect on the target mRNA as A15091HI of SEQ ID NO:3, others had decreased capability to knockdown NRP1. Conversely, not all A15091HI variations led to elimination of the unwanted knockdown of the off-target gene LARS1.

[0095] Example 2: Target knockdown efficacy screen of human NRPl-specific ASOs in human PANC-1 cells In order to investigate the knockdown efficacy of the NRPl-specific ASOs, efficacy screening rounds in human cell lines were performed. Therefore, cells were treated with the respective ASO at a concentration of 5 μM for three days without the addition of a transfection reagent. Cells were lysed after the three days treatment period, NRP1 and HPRT1 mRNA expression was analyzed using the QuantiGene Singleplex assay (ThermoFisher) and the NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples. The results are shown in Fig. 2 and Table 5. As depicted in Fig. 2 and Table 5, treatment of PANC-1 cells with 37 of the 167 tested ASOs (22% of the tested ASOs) resulted in a target inhibition of >97% (represented by a residual NRP1 mRNA expression of <0.03 as compared to mock treated cells).

[0096]

[0097]

[0098]

[0099] Table 5: List of the mean NRP1 mRNA expression values in ASO-treated PANC-1 cells compared to mock treated cells. Expression values are normalized to HPRT1.

[0100] Example 3: Off-Target knockdown efficacy screen of human NRPl-specific ASOs on LARS1 mRNA expression

[0101] 166 variants of the ASO A15091HI (SEQ ID NO:3, shown in grey) comprising the core sequence SEQ ID NO:1 were used for screening in the human cancer cell line PANC-1. Cells were treated with 5 μM of the indicated ASOs. After 3 days treatment, cells were lysed and the mRNA levels of the off-target gene LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0102] As shown in Fig. 3 and Table 6, treatment with the ASO of SEQ ID NO:3 (A15091HI) decreased the expression of the off-target gene LARS1 by more than 75% (Residual mRNA expression <0.25, shown in grey). Part of the adapted ASOs diminished the expression of the off-target gene LARS1 by equal or more than 20% (39 / 166 tested A15091HI variants: residual mRNA expression <0.8), while 127 / 166 of the tested A15091HI variants diminished the expression less than 20% (residual mRNA expression >0.8).

[0103]

[0104]

[0105]

[0106] Table 6: List of the mean LARS1 mRNA expression values in ASO-treated PANC-1 cells compared to mock treated cells. Expression values are normalized to HPRT1.

[0107] Example 4: Grouping of PANC-1 screening data according to NRP1 expression

[0108] Screening data shown in example 1, 2 and 3 were grouped according to the NRP1 expression levels measured after 3 days treatment of PANC-1 cells with 5 μM of the indicated ASOs. First group comprises all NRPl-specific ASOs with residual NRP1 mRNA expression less than or equal to 0.03, while the second group comprises all NRPl-specific ASOs leading to residual NRP1 mRNA expression greater than 0.03. On the y-axis of the graph (Fig. 4) the LARS1 mRNA expression levels (normalized to the housekeeping gene HPRT1) are depicted. Box shows preferred ASO characteristics in Fig. 4 (residual NRP1 expression <0.03, residual LARS1 expression >0.8).

[0109] Example 5: Sequence characteristics of ASOs that result in residual NRP1 expression <0.03 and either >0.8 or <0.8 expression in PANC-1 cells

[0110] The first group of Example 4 containing all NRPl-specific ASOs with residual NRP1 mRNA expression less than or equal to 0.03 was analyzed for sequence characteristics of the comprised ASOs. As shown in Fig. 5A and 5C all ASOs with residual LARS1 mRNA expression >0.8 had an elongation at the 3’-end of at least one nucleotide (guanin), while ASOs that led to equal to or more than 20% knockdown of LARS1 (residual LARS1 mRNA expression <0.8) were not elongated at the 3’-end of the core sequence (SEQ ID NO.l) (Fig. 5A and 5B).

[0111] Example 6: Screening of NRPl-specific antisense oligonucleotides in human SKOV3 cells

[0112] 168 variants of the ASO A15091HI (SEQ ID NO:3, shown in grey) comprising the core sequence SEQ ID NO:1 were used for screening in the human cancer cell line SKOV3. Cells were treated with 5 μM of the indicated ASOs. After 3 days of treatment, cells were lysed and the mRNA levels of NRP1, LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1, and LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples. Boxes show preferred ASO characteristics.

[0113] As shown in Fig. 6, the success of the adaptations of the core sequence (SEQ ID NO:1) in terms of NRP1 specificity varied. While some ASOs had similar effect on the target mRNA as the parent molecule A15091HI (SEQ ID NO:3), most A15091HI variants had decreased capability to knockdown NRP1. Conversely, not all A15091HI variations led to elimination of the unwanted knockdown of the off-target gene LARS1.

[0114] Example 7: Target knockdown efficacy screen of human NRPl-specific ASOs in human SKOV3 cells

[0115] 168 variants of the ASO A15091HI (SEQ ID NO:3, shown in grey) comprising the core sequence SEQ ID NO:1 were used for screening in the human cancer cell line SKOV3. Cells were treated with 5 μM of the indicated ASOs. After 3 days treatment, cells were lysed and the mRNA levels of NRP1 the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). NRP1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0116] As shown in Fig. 7 and Table 7, 40 of the tested 168 A15091HI variants led to efficient down regulation of NRP1 mRNA by equal to or more than 84% (Residual NRP1 mRNA expression<0.16).

[0117]

[0118]

[0119]

[0120] Table 7: List of the mean NRP1 mRNA expression values in ASO-treated SKOV3 cells compared to mock treated cells. Expression values are normalized to HPRT1.

[0121] Example 8: Off-Target knockdown efficacy screen of human NRPl-specific ASOs on LARS1 mRNA expression in SKOV3 cells 168 variants of the ASO A15091HI (SEQ ID NO:3, shown in grey) comprising the core sequence SEQ ID NO:1 were used for screening in the human cancer cell line SKOV3. Cells were treated with 5 μM of the indicated ASOs. After 3 days treatment, cells were lysed and the mRNA levels of LARS1 and the housekeeping gene HRPT1 were determined by QuantiGene Singleplex Assay (Thermo Fisher). LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples.

[0122] As shown in Fig. 8 and Table 8, treatment with the NRPl-specific ASO of SEQ ID NO:3 (A15091HI; shown in grey) led to downregulation of the off-target gene LARS1 by more than 45% (Residual mRNA expression <0.55), while 10 of the tested variants decreased the expression of human LARS1 to a similar extent (10 / 166 A15091HI variants: residual mRNA expression <0.55). In total, 29 of the tested variants decreased the expression of human LARS1 equal to or more than 20% (residual mRNA expression <0.8), while 139 of the tested A15091HI variants diminished the expression less than 20% (residual mRNA expression >0.8).

[0123]

[0124]

[0125]

[0126] Table 8: List of the mean LARS1 mRNA expression values in ASO-treated SKOV3 cells compared to mock treated cells. Expression values are normalized to HPRT1.

[0127] Example 9: Grouping of SKOV3 screening data according to NRP1 expression

[0128] Screening data shown in example 6, 7 and 8 were grouped according to the NRP1 expression levels measured after 3 days treatment of SKOV3 cells with 5 μM of the indicated ASOs. First group comprises all NRPl-specific ASOs that result in residual NRP1 mRNA expression less than or equal to 0.16, while the second group comprised all NRPl-specific ASOs leading to residual NRP1 mRNA expression greater than 0.16. On the y-axis of the graph (Fig. 9) the LARS1 mRNA expression levels (normalized to the housekeeping gene HPRT1) are depicted. Box shows preferred ASO characteristics in Fig. 9 (residual NRP1 expression <0.16, residual LARS1 expression >0.8). Example 10: Sequence characteristics of ASOs that result in residual NRP1 expression <0.16 and either >0.8 or <0.8 expression in SKOV3 cells

[0129] The first group of example 9 containing all NRP1-specific ASOs with residual NRP1 mRNA expression less than or equal to 0.16 was analyzed for sequence characteristics of the comprised ASOs. As shown in Fig. 10A and 10C all ASOs that led to a reduction of LARS1 less than 20% (residual LARS1 mRNA expression >0.8) had an elongation at the 3’-end of at least one nucleotide (guanin), while ASOs that led to equal or more than 20% knockdown of LARS1 (residual LARS1 mRNA expression <0.8) were not elongated at the 3’-end of the core sequence (SEQ ID NO.l) (Fig. 10A and 10B).

[0130] Example 11: Sequence characteristics of ASOs that result in <0.03 residual NRP1 expression in PANC-1 cells and <0.16 residual NRP1 expression in SKOV3 cells and either >0.8 or <0.8 residual LARS1 expression in both cell lines

[0131] Screening data shown in examples 1,2,3 and 6,7,8 were filtered for ASOs that result in a residual NRP1 mRNA expression in PANC-1 cells less than or equal to 0.03 and in SKOV3 cells less than or equal to 0.16. As shown in Fig. 11A and 11C all ASOs that led to a reduction of LARS1 less than 20% (residual LARS1 mRNA expression >0.8) had an elongation at the 3’-end of at least one nucleotide (guanin), while ASOs that led to equal or more than 20% knockdown of LARS1 (residual LARS1 mRNA expression <0.8) were not elongated at the 3’-end of the core sequence (SEQ ID NO.l) (Fig. 11A and 11B).

[0132] Example 12: Concentration- dependent knockdown in PANC-1 cells

[0133] Concentration- dependent knockdown of NRP1 and LARS1 mRNA expression by NRPl-specific ASOs investigated in PANC-1 cells. PANC-1 cells were treated for three days with A15091HI, A15529HI, A15530HI, A15531HI, A15533HI, A15547HI, A15552HI, A15556HI, A15574HI, A15575HI, A15578HI, A15605HI, A15634HI, A15646HI, A15649HI, A15656HI, A15657HI, A15659HI, A15670HI, A15676HI, A15677HI, A15678HI, and A15679HI at the following concentrations: 10000 nM, 3333 nM, 1111 nM, 370 nM, 123 nM, 41 nM and 14 nM. After the treatment period, cells were lysed and NRP1, LARS1 as well as HPRT1 mRNA expression was analyzed using the QuantiGene Singleplex assay (ThermoFisher). NRP1 and LARS1 expression values were normalized to HPRT1 values and compared to mock-treated samples. The results are shown in Fig. 12.

[0134] A concentration- dependent knockdown of NRP1 mRNA after treatment with all selected NRPl-specific ASOs in PANC-1 cells (Fig. 12, Table 9) was observed with IC50 values between 170 nM (A15547HI, Table 9) and 548 nM (A15659HI, Table 9). ASO A15091HI led to concentration dependent knockdown of LARS 1 in PANC-1 cells (Fig. 12). Treatment with most of the selected A15091HI variants did no longer decrease the expression of the off-target gene LARS1. However, in some cases adaption of the parent oligonucleotide sequence (A15091HI) was not sufficient to completely eliminate the effect on the off-target gene. The ASOs A15634HI (IC50 = 2070 nM; Fig. 12 and Table 10), A15646HI (IC50 = 3415 nM; Fig. 12 and Table 10), A15656HI (IC50 = 807 nM; Fig. 12 and Table 9), A15657HI (IC50 = 136 nM; Fig. 12 and Table 10) still lead to downregulation of LARS 1 mRNA expression.

[0135] The knockdown of NRP1 and LARS1 was investigated and results are shown in the following Tables 9 and 10:

[0136]

[0137] Table 9: Concentration- dependent reduction of NRP1 mRNA expression (mean of triplicates) in PANC1 cells by selected NRP1-specific ASOs and respective IC50values. ND = Not determined.

[0138] Embodiments of the invention

[0139] 1. An oligonucleotide consisting of a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and at least one additional nucleotide at the 3'-end, and optionally at least one additional nucleotide at the d'end, wherein at least one of the nucleotides of the oligonucleotide comprises a modification selected from the group consisting of LNA, ENA, cET, a 2'Fluoro modification, a 2'0-Methyl modification, a 2 'O -Methoxyethyl modification, FANA and a combination thereof.

[0140] 2. The oligonucleotide of embodiment 1, wherein the core sequence is ATATTTAGGTCCAGCG (SEQ ID NO:1). 3. The oligonucleotide of embodiment 1, wherein the core sequence is AATATTTAGGTCCAGCG (SEQ ID NO:2)

[0141] 4. The oligonucleotide of any one of embodiments 1 to 3 consisting of the core sequence and 1 to 10 additional nucleotides at the 3'-end and optionally 1 to 10 additional nucleotides at the 5 '-end.

[0142] 5. The oligonucleotide of any one of embodiments 1 to 4 wherein the additional nucleotide at the 3'-end and optionally at the 5'-end corresponds to a pre-mRNA sequence of NRP1 of SEQ ID NO.187.

[0143] 6. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 1 additional nucleotide at the 3'-end and optionally 1 additional nucleotide at the 5'-end.

[0144] 7. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 2 additional nucleotides at the 3 '-end and optionally 1 additional nucleotide at the 5'-end.

[0145] 8. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 3 additional nucleotides at the 3 '-end and optionally 1 additional nucleotide at the 5'-end.

[0146] 9. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 4 additional nucleotides at the 3 '-end and optionally 1 additional nucleotide at the 5'-end.

[0147] 10. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 5 additional nucleotides at the 3 '-end and optionally 1 additional nucleotide at the 5'-end.

[0148] 11. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 1 additional nucleotide at the 3'-end and optionally 2 additional nucleotides at the 5 '-end.

[0149] 12. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 2 additional nucleotides at the 3 '-end and optionally 2 additional nucleotides at the 5 '-end.

[0150] 13. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 3 additional nucleotides at the 3 '-end and optionally 2 additional nucleotides at the 5 '-end.

[0151] 14. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 4 additional nucleotides at the 3 '-end and optionally 2 additional nucleotides at the 5 '-end. 15. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 5 additional nucleotides at the 3 '-end and optionally 2 additional nucleotides at the 5 '-end.

[0152] 16. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 1 additional nucleotide at the 3'-end and optionally 3 additional nucleotides at the 5 '-end.

[0153] 17. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 2 additional nucleotides at the 3 '-end and optionally 3 additional nucleotides at the 5 '-end.

[0154] 18. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 3 additional nucleotides at the 3 '-end and optionally 3 additional nucleotides at the 5 '-end.

[0155] 19. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 4 additional nucleotides at the 3 '-end and optionally 3 additional nucleotides at the 5 '-end.

[0156] 20. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 5 additional nucleotides at the 3 '-end and optionally 3 additional nucleotides at the 5 '-end.

[0157] 21. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 1 additional nucleotide at the 3'-end and optionally 4 additional nucleotides at the 5 '-end.

[0158] 22. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 2 additional nucleotides at the 3 '-end and optionally 4 additional nucleotides at the 5 '-end.

[0159] 23. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 3 additional nucleotides at the 3 '-end and optionally 4 additional nucleotides at the 5 '-end.

[0160] 24. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 4 additional nucleotides at the 3 '-end and optionally 4 additional nucleotides at the 5 '-end.

[0161] 25. The oligonucleotide of any one of embodiments 1 to 5consisting of the core sequence and 5 additional nucleotides at the 3 '-end and optionally 4 additional nucleotides at the 5 '-end. 26. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 1 additional nucleotide at the 3'-end and optionally 5 additional nucleotides at the 5 '-end.

[0162] 27. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 2 additional nucleotides at the 3 '-end and optionally 5 additional nucleotides at the 5 '-end.

[0163] 28. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 3 additional nucleotides at the 3 '-end and optionally 5 additional nucleotides at the 5 '-end.

[0164] 29. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 4 additional nucleotides at the 3 '-end and optionally 5 additional nucleotides at the 5 '-end.

[0165] 30. The oligonucleotide of any one of embodiments 1 to 5 consisting of the core sequence and 5 additional nucleotides at the 3 '-end and optionally 5 additional nucleotides at the 5 '-end.

[0166] 31. The oligonucleotide of any one of embodiments 1 to 30, wherein the 1 additional nucleotide at the 3'-end is G.

[0167] 32. The oligonucleotide of any one of embodiments 1 to 30, wherein the 2 additional nucleotides at the 3'-end are G and T.

[0168] 33. The oligonucleotide of any one of embodiments 1 to 30, wherein the 3 additional nucleotides at the 3 '-end are G, T and A.

[0169] 34. The oligonucleotide of any one of embodiments 1 to 30, wherein the 4 additional nucleotides at the 3 '-end are G, T, A and G.

[0170] 35. The oligonucleotide of any one of embodiments 1 to 30, wherein the 5 additional nucleotides at the 3'-end are G, T, A, G and C.

[0171] 36. The oligonucleotide of any one of embodiments 1 to 35, wherein the 1 additional nucleotide at the 5'-end is A.

[0172] 37. The oligonucleotide of any one of embodiments 1 to 35, wherein the 2 additional nucleotides at the 5 '-end are A and T.

[0173] 38. The oligonucleotide of any one of embodiments 1 to 35, wherein the 3 additional nucleotides at the 5 '-end are A, T and A.

[0174] 39. The oligonucleotide of any one of embodiments 1 to 35, wherein the 4 additional nucleotides at the 5 '-end are A, T, A and A.

[0175] 40. The oligonucleotide of any one of embodiments 1 to 35, wherein the 4 additional nucleotides at the 5 '-end are A, T, A, A and A. 41. The oligonucleotide of any one of embodiments 1 to 40, inhibiting the expression of NRP1 to an expression rate in the range of ≤ 0.16 to ≤ 0.03 and the expression rate of an off-target gene to an expression rate of >0.8.

[0176] 42. The oligonucleotide of any one of embodiments 1 to 40, inhibiting the expression of NRP1 to an expression rate of ≤ 0.16 and the expression rate of an off-target gene to an expression rate of >0.8.

[0177] 43. The oligonucleotide of any one of embodiments 1 to 40, inhibiting the expression of NRP1 to an expression rate of ≤ 0.03 and the expression rate of an off-target gene to an expression rate of >0.8.

[0178] 44. The oligonucleotide according to any one of embodiments 1 to 40, inhibiting the expression of NRP1 to an expression rate of ≤ 0.02 and the expression rate of an off-target gene to an expression rate of > 0.9.

[0179] 45. The oligonucleotide according to any one of embodiments 1 to 40, inhibiting the expression of NRP1 to an expression rate of ≤ 0.01 and the expression rate of an off-target gene to an expression rate of > 0.99.

[0180] 46. The oligonucleotide according to any one of embodiments 1 to 45, wherein the off-target gene is LARS1.

[0181] 47. The oligonucleotide according to any one of embodiments 1 to 46, wherein the oligonucleotide is an antisense oligonucleotide.

[0182] 48. The oligonucleotide according to any one of embodiments 1 to 47, wherein the oligonucleotide comprises a LNA-modified nucleotide.

[0183] 49. The oligonucleotide according to any one of embodiments 1 to 48, wherein the oligonucleotide comprises a ENA-modified nucleotide.

[0184] 50. The oligonucleotide according to any one of embodiments 1 to 49, wherein the oligonucleotide comprises a FANA-modified nucleotide.

[0185] 51. The oligonucleotide according to any one of embodiments 1 to 50, wherein the oligonucleotide comprises a 2'O-Methyl modified nucleotide.

[0186] 52. The oligonucleotide according to any one of embodiments 1 to 51 wherein the oligonucleotide comprises a 2'0 -Methoxyethyl modified nucleotide.

[0187] 53. The oligonucleotide according to any one of embodiments 1 to 52, wherein the oligonucleotide binds within a binding active region of position 6688-6724.

[0188] 54. The oligonucleotide according to any one of embodiments 1 to 53, wherein the off-target gene is LARS1.

[0189] 55. The oligonucleotide of any one of embodiments 1 to 54, wherein the modification is located at the 5'-end and / or 3'-end of the oligonucleotide. 56. The oligonucleotide of any one of embodiments 1 to 55, wherein the oligonucleotide binds to a transcript of neuropilin 1 (NRP1) of SEQ ID NO.187. 57. The oligonucleotide of any one of embodiments 1 to 55, wherein the oligonucleotide binds to pre-mRNA of neuropilin 1 (NRP1) of SEQ ID NO.187.

[0190] 58. The oligonucleotide of any one of embodiments 1 to 57, wherein the oligonucleotide binds within a binding active region consisting of position 6688-6724 of SEQ ID NO.187.

[0191] 59. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 137 (A15533HI).

[0192] 60. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 177 (A15678HI).

[0193] 61. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 169 (A15670HI).

[0194] 62. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO:92 (A15530HI).

[0195] 63. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO:151 (A15547HI).

[0196] 64. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO:31 (A15574HI).

[0197] 65. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 13 (A15556HI).

[0198] 66. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO:93 (A15531HI).

[0199] 67. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 175 (A15676HI).

[0200] 68. The oligonucleotide of any one of embodiments 1 to 58, wherein the oligonucleotide comprises or consists of SEQ ID NO: 156 (A15552HI).

[0201] 69. The oligonucleotide according to embodiment 59, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:137.

[0202] 70. The oligonucleotide according to embodiment 60, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:177. 71. The oligonucleotide according to embodiment 61, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO: 169.

[0203] 72. The oligonucleotide according to embodiment 62, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:92.

[0204] 73. The oligonucleotide according to embodiment 63, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:151.

[0205] 74. The oligonucleotide according to embodiment 64, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:31.

[0206] 75. The oligonucleotide according to embodiment 65, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:13.

[0207] 76. The oligonucleotide according to embodiment 66, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:93.

[0208] 77. The oligonucleotide according to embodiment 67, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:175.

[0209] 78. The oligonucleotide according to embodiment 68, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to the oligonucleotide of SEQ ID NO:156.

[0210] 79. The oligonucleotide of embodiment 59, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 137.

[0211] 80. The oligonucleotide of embodiment 60, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 177.

[0212] 81. The oligonucleotide of embodiment 61, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 169.

[0213] 82. The oligonucleotide of embodiment 62, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO:92.

[0214] 83. The oligonucleotide of embodiment 63, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO:151.

[0215] 84. The oligonucleotide of embodiment 64, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO:31.

[0216] 85. The oligonucleotide of embodiment 65, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 13

[0217] 86. The oligonucleotide of embodiment 66, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO:93.

[0218] 87. The oligonucleotide of embodiment 67, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 175.

[0219] 88. The oligonucleotide of embodiment 68, wherein the oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, nucleotides of the oligonucleotides of SEQ ID NO: 156.

[0220] 89. A pharmaceutical composition comprising an oligonucleotide according to any one of embodiments 1 to 88 and a pharmaceutically acceptable carrier, excipient, dilutant, stimulant such as an adjuvant, or a combination thereof.

[0221] 90. The pharmaceutical composition according to embodiment 89, comprising a further active agent. 91. The pharmaceutical composition according to embodiment 90, wherein the active agent is selected from the group consisting of another oligonucleotide, a fusion protein, an antibody, a small molecule and a combination thereof.

[0222] 92. The pharmaceutical composition according to embodiment 91, wherein the other oligonucleotide is siRNA, miRNA, or an antisense oligonucleotide.

[0223] 93. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in preventing cancer.

[0224] 94. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in preventing an ophthalmic disease.

[0225] 95. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in preventing an autoimmune disorder.

[0226] 96. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in preventing an immune disorder.

[0227] 97. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in treating cancer.

[0228] 98. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in treating an ophthalmic disease.

[0229] 99. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in treating an autoimmune disorder.

[0230] 100. The pharmaceutical composition of any one of embodiments 89 to 92, or the antisense oligonucleotide according to any one of embodiments 1 to 88 for use in treating an immune disorder

[0231] 101. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 94 or 98, wherein the ophthalmic disease is an angiogenic eye disease.

[0232] 102. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 101 wherein the angiogenic eye disease is age related macular disease (AMD). 103. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 101 wherein the angiogenic eye disease is diabetic retinopathy (DME).

[0233] 104. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment101 wherein the angiogenic eye disease is retinopathy of prematurity (Retinopathia praematurorum).

[0234] 105. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 101 wherein the angiogenic eye disease is corneal neovascularization.

[0235] 106. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 93 or 97, wherein the cancer is bladder carcinoma, breast cancer, colorectal carcinoma, lung cancer, malignant melanoma, mesothelioma, lymphoma, skin cancer, bone cancer, prostate cancer, hepatocarcinoma, brain cancer, cancer of the larynx, liver, gall bladder, pancreas, testicular, rectum, parathyroid, thyroid, adrenal, neural tissue, head and neck, colon, stomach, bronchi, kidneys, gastric cancer, esophagastric junction cancer, basal cell carcinoma, neuroblastoma, squamous cell carcinoma, metastatic skin carcinoma, osteo sarcoma, Ewing's sarcoma, reticulum cell sarcoma, liposarcoma, leukemia, myeloma, giant cell tumor, small-cell lung tumor, islet cell tumor, primary brain tumor, meningioma, acute and chronic lymphocytic and granulocytic tumors, acute and chronic myeloid leukemia, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma, intestinal ganglioneuromas, Wilm's tumor, seminoma, ovarian tumor, leiomyomater tumor, cervical dysplasia, retinoblastoma, soft tissue sarcoma, malignant carcinoid, topical skin lesion, rhabdomyosarcoma, Kaposi's sarcoma, osteogenic sarcoma, malignant hypercalcemia, renal cell tumor, polycythaemia vera, adenocarcinoma, anaplastic astrocytoma, glioblastoma multiforma, leukemia, or epidermoid carcinoma.

[0236] 107. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is bladder carcinoma.

[0237] 108. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is breast cancer.

[0238] 109. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is colorectal carcinoma.

[0239] 110. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is lung cancer. 111. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is malignant melanoma.

[0240] 112. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is mesothelioma.

[0241] 113. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is brain cancer.

[0242] 114. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is gastric cancer.

[0243] 115. The pharmaceutical composition or the antisense oligonucleotide for use according to embodiment 106, wherein the cancer is esophagastric junction cancer.

[0244] 116. The pharmaceutical composition or the antisense oligonucleotide for use according to any one of embodiments 93 to 115, wherein the oligonucleotide or the composition is administrable locally or systemically.

[0245] 117. The pharmaceutical composition of any one of embodiments 89 to 116, or the oligonucleotide according to any one of embodiments 1 to 88 and 93 to 116, further inhibiting the activity of a receptor such as a growth receptor selected from the group consisting of TGF-beta receptor I (TBRI), TGF-beta receptor II (TBRII), VEGF, HGF, PDGF, SEMA3 (Plexin), and a combination thereof.

[0246] 118. The pharmaceutical composition of any one of embodiments 89 to 117, or the oligonucleotide according to any one of embodiments 1 to 88 and 93 to 117, further inhibiting the activity of a signal transduction factor such as p38MAPK, ERK1, ERK2, PI3K, Akt, NF-KB, pSMAD2, pSMAD3, Src, Pyk2, FAK, p-pl30Cas, and a combination thereof.

[0247] 119. The pharmaceutical composition of any one of embodiments 89 to 118, or the oligonucleotide according to any one of embodiments 1 to 88 and 93 to 118, further inhibiting the activity of an immunosuppressive molecule such as an immune checkpoint selected from the group consisting of lymphocyte activation gene 3 (LAG3), T cell immunoglobulin and mucin domain-containing protein 3 (TIM3) and / or cytotoxic T-lymphocyte-associated Protein 4 (CTLA4) and a combination thereof.

[0248] 120. The pharmaceutical composition of any one of embodiments 89 to 119, or the oligonucleotide according to any one of embodiments 1 to 88 and 93 to 119, further inhibiting an immunostimulatory molecule such as an immune activator selected from the group consisting of CD 137, CD40, CD27, glucocorticoid-induced TNFR-related protein (GITR) and / or a toll like receptor such as toll like receptor 9 (TLR9) and a combination thereof. 121. The pharmaceutical composition of any one of embodiments 89 to 120 or the oligonucleotide according to any one of embodiments 1 to 88 and 92 to 119 inhibiting the immigration of a Tregcell into a tumor.

[0249] 122. The pharmaceutical composition of any one of the embodiments 89 to 121 or the oligonucleotide according to any one of the embodiments 1 to 88 and 93 to 121 inhibiting the immigration of a suppressive macrophage into a tumor.

[0250] 123. The oligonucleotide according to any one of claims 1 to 88 inhibiting the expression and activity of NRP1.

[0251] 124. The oligonucleotide according to any one of claims 1 to 88 inhibiting the expression of NRP1.

[0252] 125. The oligonucleotide according to any one of claims 1 to 88 inhibiting the activity ofNRPl.

[0253] 126. The oligonucleotide according to any one of claims 1 to 88 or 123 to 125, wherein the additional nucleotide is complementary to the mRNA or pre-mRNA ofNRPl. 126. The pharmaceutical composition of any one of claims 89 to 122 inhibiting the expression and activity ofNRPl.

[0254] 127. The pharmaceutical composition of any one of claims 89 to 122 inhibiting the expression ofNRPl.

[0255] 128. The pharmaceutical composition of any one of claims 89 to 122 inhibiting the activity ofNRPl.

Claims

Claims1. An oligonucleotide consisting of a core sequence of ATATTTAGGTCCAGCG (SEQ ID NO:1) or AATATTTAGGTCCAGCG (SEQ ID NO:2) and at least one additional nucleotide at the 3'-end, and optionally at least one additional nucleotide at the d'end, wherein at least one of the nucleotides of the oligonucleotide comprises a modification selected from the group consisting of LNA, ENA, cET, a 2'Fluoro modification, a 2'0-Methyl modification, a 2 'O -Methoxyethyl modification, FANA and a combination thereof.

2. The oligonucleotide of claim 1 consisting of the core sequence and 1 to 10 additional nucleotides at the 3 '-end and optionally 1 to 10 additional nucleotides at the 5'-end.

3. The oligonucleotide of claim 1 or 2 consisting of the core sequence and 1 to 10 additional nucleotides at the 3 '-end and optionally 1 to 10 additional nucleotides at the 5'-end, wherein the first additional nucleotide at the 3'-end is guanin (G).

4. The oligonucleotide of any one of claims 1 to 3, wherein the oligonucleotide has a reduced off-target effect for example on the off- target gene LARS1 compared to an oligonucleotide consisting of the core sequence.

5. The oligonucleotide of any one of claims 1 to 4, wherein the modification is located at the 5'-end and / or 3'-end of the oligonucleotide.

6. The oligonucleotide of any one of claims 1 to 5, wherein the core sequence and the additional nucleotide at the 3'-end and / or the 5'-end corresponds to a pre-mRNA sequence of neuropilin 1 (NRP1) of SEQ ID NO.187.

7. The oligonucleotide of any one of claims 1 to 6, wherein the oligonucleotide binds within a binding active region consisting of SEQ ID NO.188.

8. The oligonucleotide of any one of claims 1 to 7, wherein the oligonucleotide has 80 to 99 %, 85 to 98 %, 90 to 95 or 93 % sequence identity to any one of the oligonucleotides of SEQ ID NO: 137, SEQ ID NO: 177, SEQ ID NO: 169, SEQ IDNO:92, SEQ ID N0:151, SEQ ID N0:31, SEQ ID N0:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

9. The oligonucleotide according to claim 8, wherein said oligonucleotide comprises at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 nucleotides of any one of the oligonucleotides of SEQ ID NO: 137, SEQ ID NO: 177, SEQ ID NO: 169, SEQ ID NO:92, SEQ ID NO:151, SEQ ID NO:31, SEQ ID NO:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

10. The oligonucleotide according to claim 8 or 9, wherein the oligonucleotide comprises or consists of SEQ ID NO: 137, SEQ ID NO: 177, SEQ ID NO: 169, SEQ ID NO:92, SEQ ID NO:151, SEQ ID NO:31, SEQ ID NO:13, SEQ ID NO:93, SEQ ID NO:175 or SEQ ID NO:156.

11. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 10 and a pharmaceutically acceptable carrier, excipient, dilutant, stimulant such as an adjuvant, or a combination thereof.

12. The pharmaceutical composition according to claim 11, comprising a further active agent for example selected from the group consisting of another oligonucleotide, a fusion protein, an antibody, a small molecule and a combination thereof.

13. The pharmaceutical composition of claim 11 or 12, or the antisense oligonucleotide according to any one of claims 1 to 10 for use in preventing and / or treating cancer, an ophthalmic disease, an autoimmune disorder and / or an immune disorder.

14. The pharmaceutical composition or the antisense oligonucleotide for use according to claim 13, wherein the ophthalmic disease is an angiogenic eye disease such as age related macular disease (AMD), diabetic retinopathy (DME), retinopathy of prematurity (Retinopathia praematurorum) or corneal neovascularization.

15. The pharmaceutical composition or the antisense oligonucleotide for use according to claim 13, wherein the cancer is bladder carcinoma, breast cancer, colorectal carcinoma, lung cancer, malignant melanoma, mesothelioma, lymphoma, skin cancer,bone cancer, prostate cancer, hepatocarcinoma, brain cancer, cancer of the larynx, liver, gall bladder, pancreas, testicular, rectum, parathyroid, thyroid, adrenal, neural tissue, head and neck, colon, stomach, bronchi, kidneys, basal cell carcinoma, neuroblastoma, squamous cell carcinoma, metastatic skin carcinoma, osteo sarcoma, Ewing's sarcoma, reticulum cell sarcoma, liposarcoma, leukemia, myeloma, giant cell tumor, small-cell lung tumor, islet cell tumor, primary brain tumor, meningioma, acute and chronic lymphocytic and granulocytic tumors, acute and chronic myeloid leukemia, hairy-cell tumor, adenoma, hyperplasia, medullary carcinoma, intestinal ganglioneuromas, Wilm's tumor, seminoma, ovarian tumor, leiomyomater tumor, cervical dysplasia, retinoblastoma, soft tissue sarcoma, malignant carcinoid, topical skin lesion, rhabdomyosarcoma, Kaposi's sarcoma, osteogenic sarcoma, malignant hypercalcemia, renal cell tumor, polycythaemia vera, adenocarcinoma, anaplastic astrocytoma, glioblastoma multiforma, leukemia, or epidermoid carcinoma.

16. The pharmaceutical composition or the antisense oligonucleotide for use according to any one of claims 13 to 15, wherein the oligonucleotide or the composition is administrable locally or systemically.

Citation Information

Patent Citations

  • Linkage modified oligomeric compounds and uses thereof

    WO2021030778A1

  • Neuropilin antisense oligonucleotide sequences and methods of using same to modulate cell growth

    WO1999055855A2

  • Oligonucleotides inhibiting the expression of NRP1

    WO2018127599A1

  • NRP1-specific antisense oligonucleotides and their use in preventing and / or treating diseases

    WO2024218302A1