Monocytes and monocytic-myeloid derived suppressor cells differentiating into Anti-tumor macrophages upon microrna modulation
By transfecting myeloid cells with microRNA modulators to induce anti-tumor macrophages, the method addresses the reliance of CLL cells on their microenvironment, enhancing immune response and providing a therapeutic strategy for CLL and other conditions.
Patent Information
- Application Number
- PCT/US2025/052077
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-22
- Filing Date
- 2025-10-22
- Publication Date
- 2026-04-30
AI Technical Summary
Chronic lymphocytic leukemia (CLL) cells rely heavily on their pro-leukemic microenvironment, including CLL-associated macrophages, which contribute to unsatisfactory treatment responses and disease progression, and existing treatments fail to effectively harness the immune system to combat the malignancy.
A method involving the transfection of myeloid cells, such as monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs), with a microRNA modulator to induce differentiation into anti-tumor macrophages, using miRNA mimics, anti-miRNA antisense oligonucleotides, or CRISPR/Cas systems, and administering these cells to a subject to promote anti-tumor activity.
The method generates anti-tumor macrophages capable of targeting and reducing CLL cells, offering a novel therapeutic approach for CLL and potentially other hematologic malignancies and autoimmune diseases by modulating microRNA expression to enhance immune response.
Smart Images

Figure US2025052077_30042026_PF_FP_ABST
Abstract
Description
MONOCYTES AND MONOCYTIC-MYELOID DERIVED SUPPRESSOR CELLS DIFFERENTIATING INTO ANTI-TUMOR MACROPHAGES UPON MICRORNA MODULATION CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to and the benefit of United States Provisional Patent Application Serial No. 63 / 710,421, filed October 22, 2024 and United States Provisional Patent Application Serial No. 63 / 710,547, filed October 22, 2024, the contents of which are incorporated herein by this reference as if fully set forth herein.SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said.xml copy, created on October 08, 2025, is named 090723-1525135-MDA24-013PCT, and is 2,994 bytes in size.BACKGROUND
[0003] Chronic lymphocytic leukemia (CLL) is a B-cell malignancy characterized by the expansion of CD5+B cells in the circulation and in lymphoid organs. CLL is the most common form of leukemia in adults. CLL is a complex disease with many patients still experiencing relapse and unsatisfactory treatment responses. CLL cells show a spectrum of genetic aberrations including chromosomal deletions and miRNA dysregulations.
[0004] CLL cells are highly dependent on their pro-leukemic microenvironment, which comprises different cells and soluble factors. Among those cells, CLL-associated macrophages play a pivotal role in maintaining CLL cell survival.
[0005] Macrophages are a crucial component of the innate immune system and can differentiate from monocytes. An essential function of macrophages is the phagocytosis of pathogens, dying or dead cells, and cell debris. Moreover, macrophages can exert pro-tumor or anti-tumor function in hematologic malignancies and solid tumors.BRIEF SUMMARY
[0006] The terms “invention,” “the invention,” “this invention” and “the present invention,” as used in this document, are intended to refer broadly to all of the subject matter of this patent application and the claims below. Statements containing these terms should be understood not to limit the subject matter described herein or to limit the meaning or scope of the patent claims below. Covered embodiments of the invention are defined by the claims, notthis summary. This summary is a high-level overview of various aspects of the invention and introduces some of the concepts that are described and illustrated in the present document and the accompanying figures. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used in isolation to determine the scope of the claimed subject matter. The subject matter should be understood by reference to appropriate portions of the entire specification, any or all figures and each claim. Some of the exemplary embodiments of the present invention are discussed below.
[0007] In one aspect, provided in this disclosure is a method for generating anti-tumor macrophages from myeloid cells, the method comprising: providing isolated myeloid cells from a first subject, the isolated myeloid cells comprising at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs); transfecting the isolated myeloid cells with a miRNA modulator to produce transfected myeloid cells; and administering the transfected myeloid cells into a second subject, the transfected myeloid cells differentiating into anti-tumor macrophages in the second subject.
[0008] In some embodiments, the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
[0009] In some embodiments, the miRNA modulator targets at least one miRNA in Table 8 or Table 9.
[0010] In some embodiments, the miRNA modulator targets at least one of miR15-a, miR16-l, miR511-3p, miR181c, or miR9-2.
[0011] In some embodiments, the miRNA modulator downmodulates at least one of miR15-a, miR16-l, or at least one miRNA listed in Table 8.
[0012] In some embodiments, the miRNA modulator upmodulates at least one miRNA listed in Table 9.
[0013] In some embodiments, the miRNA modulator is not incorporated into a plasmid or viral vector.
[0014] In some embodiments, the transfection is by electroporation.
[0015] In some embodiments, the electroporation is nanostructure-mediated physical delivery.
[0016] In some embodiments, the nanostructure-mediated physical delivery comprises delivery of the miRNA modulator into the isolated myeloid cells using nanostraws.
[0017] In some embodiments, the method comprises placing the nanostraws comprising the isolated myeloid cells therein on top of a cargo spacer comprising the miRNA modulator prior to the nanostructure-mediated physical delivery.
[0018] In some embodiments, the isolated myeloid cells are isolated from peripheral blood mononuclear cells (PBMCs) from the first subject. In some embodiments, the isolation of the isolated myeloid cells from PBMCs is by magnetic bead separation and / or fluorescence-assisted cell sorting (FACS).
[0019] In some embodiments, the first subject and the second subject are the same subject. In some embodiments, the first subject and the second subject are the not the same subject.
[0020] In second aspect, provided in this disclosure is a method for treating a solid tumor or hematologic malignancy in a subject in need thereof, the method comprising: performing steps (a)-(c) of the methods of the first aspect and embodiments described above, wherein the subject in need of treatment is the second subject.
[0021] In some embodiments, the hematologic malignancy is chronic lymphocytic leukemia (CLL).
[0022] In some embodiments, the method further comprises administrating an anti-cancer a co-therapy to the subject.
[0023] In third aspect, provided in this disclosure is a method for treating an autoimmune disease in a subject in need thereof, the method comprising: performing steps (a)-(c) of any one of the methods of the first aspect and embodiments described above, wherein the subject in need of treatment is the second subject.
[0024] In some embodiments, the autoimmune disease is systemic lupus erythematosus, rheumatoid arthritis, or multiple sclerosis.
[0025] In some embodiments, the method further comprises administrating an inflammatory co-therapy to the subject.
[0026] In fourth aspect, provided in this disclosure is an in vitro method for transfecting isolating myeloid cells with a microRNA modulator, the method comprising: providing isolated myeloid cells from a first subject, wherein the isolated myeloid cells are at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs); and transfecting the isolated myeloid cells with a microRNA modulator using nanostructure-mediated physical delivery to produce transfected myeloid cells.
[0027] In some embodiments, the miRNA modulator is not incorporated into a plasmid or viral vector.
[0028] In some embodiments, the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
[0029] In a fifth aspect, provided in this disclosure is a transfected myeloid cell produced by the method of any one of fourth aspect and embodiments described above.
[0030] In some embodiments, the transfected myeloid cells is in combination with a pharmaceutically acceptable carrier.
[0031] In a sixth aspect, provided in this disclosure is a method, the method comprising: inserting a cargo spacer over an electrode within a well; applying a solution comprising a liquid cargo on the electrode; inserting isolated cells and a nanostraw membrane into the well so that the nanostraw membrane is uniformly spaced at a distance above the electrode while maintaining the location of the liquid cargo directly underneath the nanostraw membrane; and applying energy to the electrode to perform nano-electroinjection using nanostraws.
[0032] In some embodiments, the cargo spacer is a mesh cargo spacer.
[0033] These and other aspects of the present invention may be realized as shown and described in the following figures and related description.BRIEF DESCRIPTION OF THE FIGURES
[0034] Figs. 1A-1B. Transcriptome analysis of murine monocytes / macrophages from xeno-transplanted mice in early-stage and overt leukemia. (Fig. 1A) is a schematic diagram of the experiment, showing Rag2- / -γc- / -mice were injected intravenously (i.v.) with MEC1 cells (day 0) and killed at early (day 21) and late (day 31) stage of leukemia with age-matched untransplanted Rag2- / -γc- / -mice (n=3 mice / group). RNA was isolated from BM murine monocytes / macrophages purified by magnetic separation. Affimetrix Clariom D assay was used to perform a broad transcriptome gene- and exon-level analysis of coding RNA and ncRNA isoforms including long non-coding RNAs (IncRNAs). (Fig. 1B) provides pie-charts representing enriched coding and ncRNAs in monocytes / macrophages during leukemia progression and after subtraction of the data for age-matched, untransplanted control mice-derived monocyte / macrophage. The multiple complex category includes genes that contain more than one locus type, such as a gene encompassing an miRNA in an intron or complex gene families (Brulport et al., 2020).
[0035] Figs. 2A-2H. Premature CLL-like expansion and shorter life span in TCL1 transgenic mice with MDR deletion. (Fig. 2A) Kaplan-Meier survival curves for TCL1tg / wt(n=51), TCLU'MDR- / -(TM; n=20), MDR- / -(n=18) and wild-type (WT; n=17) mice. A statistical analysis of the groups was performed using the log-rank test (median survival: 10 months for TM, 13 months for TCL1tg / wt, 17 months for MDR- / -, 24 months for WT mice). Mice were included in the analysis after spontaneous death or after they had been killed because of symptoms of illness. (Figs. 2B-2C) Using flow cytometry, 4-month-old TM mice (n = 7), age-matched TCL1tg / wt(n = 6), MDR- / -(n = 6) and WT control (n = 6) mice were analyzed for theaccumulation of CD19+CD5+B cells in the spleen. (Fig. 2B) The mean values ± the standard deviations (SDs) of the absolute numbers of CD19+CD5+cells gated on CD 19+ cells, and (Fig.2C) the mean values ± SDs of the absolute numbers of CD19+BCL2+cells gated on CD19+CD5+cells are shown in the graphs. A statistical analysis was performed using the Student t test *P < 0.05, ** P < 0.01. (Figs. 2D-2E) Using flow cytometry, 9-month-old TM (n = 9), age-matched TCL1tg / wt(n = 10), MDR- / -(n = 10), WT control (n = 7) mice and, 27-month-old MDR- / -(n = 3) were analyzed for the accumulation of CD19+CD5+B cells in the spleen. (Fig.2D) The mean values ± SDs of the absolute numbers of CD19+CD5+cells gated on CD19+cells and (Fig.2E) the mean values ± SDs of the absolute numbers of CD19+BCL2+cells gated on CD19+CD5+cells are shown in the graphs. A statistical analysis was performed using the Student t test *P < 0.05, **P < 0.01. (Figs. 2F-2H) B cells were purified from the spleen of 9-month-old TM, TCL1tg / wtand MDR mice using magnetic negative selection. Lysates were processed for the reverse phase protein Array (RPPA). The heatmaps of unsupervised hierarchical clustering display differentially expressed proteins between (Fig. 2F) leukemic cells from TCL1tg / wt(n = 3) and MDR- / -(n = 6) mice, (Fig. 2G) leukemic cells from TM (n = 3) and MDR- / -(n = 6) mice, and (Fig. 2H) leukemic cells from TM (n = 3) and TCL1tg / wt(n=3) mice.
[0036] Figs. 3A-3H. Characterization of the T-cell compartment of young TCL1 transgenic mice with MDR deletion. The splenic T-cell compartment of 4-month-old TCL1tg / wtMDR- / -(TM; n = 7), age-matched TCL1tg / wt(n = 6), MDR- / -(n = 6), and wild-type (WT) control (n = 6) mice was analyzed using flow cytometry. (Fig. 3A) The mean values ± the standard deviations (SD) of the absolute numbers of CD4+and CD8+T cells, (Fig. 3B) the mean values ± SD of the absolute numbers of CD44'CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD8+T cells, and (Fig. 3C) the mean value ± SDs of the absolute numbers of CD44'CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD8+T cells expressing BCL2 are shown in graphs. (Fig.3D) The mean value ± SDs of the absolute numbers of CD44'CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD4+T cells, (Fig. 3E) the mean value ± SD of the absolute number of CD44'CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD4+T cells expressing BCL2 or (Fig. 3F) PD1 are shown in graphs. (Fig. 3G) The mean value ± SD of the absolute number of CD4+CD25+T cells and (Fig. 3H) CD4+CD25+BCL2+T cells are shown in graphs. A statistical analysis was performed using the Student t test * < 0.05, ** < 0.01, *** < 0.001.
[0037] Figs. 4A-4J. Characterization of the monocytes and macrophages of young TCL1 transgenic mice with MDR deletion. Monocytes and macrophages of 4-month-old TCL1+ / -MDR- / -(TM; n = 7), age-matched TCL1tg / wt(n = 6), MDR " (n=6) and WT control (n = 6) mice were analyzed using flow cytometry. (Fig. 4A) The mean value of the relative contributions of CD1 lb+CSF1R+cells gated on CD45 in peripheral blood (PB) is shown in the graph. (Fig. 4B) The mean values of the absolute numbers of CD1 lb+CSF1R+cells gated on CD45 in BM and (Fig. 4C) SP are shown in the graphs. (Fig. 4D) The mean values of the absolute numbers of CDllb+CSF1R+BCL2+monocytes is shown in graph. (Fig. 4E) The mean value of the relative contributions of CD1 lb+Ly6Clowand CD1 lb+Ly6Chighcells to the whole monocyte subset (CDllb+CSF1R+) gated on CD45+in the PB is shown in the graph.(Fig. 4F) The mean values of the absolute numbers of CD1 lb+Ly6Clowand CD1 lb+Ly6Chighcells to the whole monocyte subset (CDllb+CSF1R+) gated on CD45+in the BM and (Fig.4G) SP are shown in the graphs. (Fig.4H) The mean values of the absolute numbers of CD1 lb+F4 / 80+cells gated on CD45+in the SP is shown in the graph. In Fig. 4I, the mean values of the absolute number of CD1 lb+F4 / 80+MRC1+cells, and in Fig.4J, of CD1 lb+F4 / 80+BCL2+cells and CD1 lb+F4 / 80+PD-Ll+cells gated on CD45+in the SP are shown in the graphs. A statistical analysis was performed using the Student t test *P < 0.05.
[0038] Figs. 5A-5D. Characterization of the T cell compartment of leukemic TCL1 transgenic mice with MDR deletion. The splenic T-cell compartment of 9-month-old TCL1tg / wtMDR " (TM; n = 9), age-matched TCL1tg / wt(n = 10), MDR- / -(n = 10), WT control (n = 7) mice and 27-month-old MDR " (n = 3) was analyzed using flow cytometry. (Fig. 5A) The relative contributions ± SD of the of the CD4+and CD8+T cells in the PB, (Fig. 5B) the mean values ± SDs of the absolute numbers of CD4+and CD8+T cells in the SP, (Fig. 5C) the mean values ± SDs of the absolute numbers of CD44 CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD8+T cells and, (Fig. 5D) the mean values ± SDs of the absolute numbers of CD44 CD62L+naive, CD44+CD62Llow / negeffector and CD44+CD62L+central memory CD8+T cells expressing PD1 are shown in the graphs. A statistical analysis was performed using the Student / test *P < 0.05, **P < 0.01, ***P< 0.001.
[0039] Figs. 6A-6J. Characterization of monocytes and macrophages of leukemic TCL1 transgenic mice with MDR deletion. The monocytes and macrophages of 9-month-old TCL1+ / -MDR- / -(TM; n =9), age-matched TCL1+ / ’ (n = 10), MDR " (n = 10), WT control (n=7) mice and 27-month-old MDR " (n = 3) were analyzed using flow cytometry. (Fig. 6A) The mean values ± SDs of the relative contributions of CD1 lb+CSF1R+cells gated on CD45 in PB is shown in the graph. (Fig. 6B) The mean values ± SDs of the absolute numbers ofCD1 lb+CSF1R+cells gated on CD45 in BM and (Fig. 6C) SP are shown in the graphs. (Fig.6D) The mean values ± SDs of relative contributions of CD1 lb+CSF1R+BCL2+monocytes is shown in the graph. (Fig. 6E) The mean values ± SDs of the absolute numbers of CDllb+CSF1R+BCL2+monocytes in BM and (Fig. 6F) SP are shown in the graphs. (Fig. 6G) The mean values ± SDs of relative contributions of CDllb+CSF1R+PDL1+monocytes in PB is shown in the graph. (Fig. 6H) The mean values ± SDs of the absolute numbers of CDllb+CSF1R+PDL1+monocytes in BM is shown in the graph. (Fig. 6I) The mean values ± SDs of the relative contributions of CDllb+F4 / 80+cells gated on CD45+in the PB is shown in the graph. (Fig.6 J) The mean values ± SDs of the relative contributions of CD1 lb+F4 / 80+MRC1+cells gated on CD45+in the PB is shown in the graph. A statistical analysis was performed using the Student t test *P < 0.05, ** < 0.01, *** < 0.001.
[0040] Figs. 7A-7O. Characterization of miR-15a / miR-16-l and related target proteins in human immune cells. (Fig. 7A) miR-15a and (Fig. 7B) miR-16-1 expression relative to U6 control in human CD19+B cells, effector memory hCD8+CD45RA' CD45RO+CD62L- TEM, central memory hCD8+CD45RA-CD45RO+CD62L+TCM, CD4+CD25+CD127low / -Treg, CD14+CD16++non classical (NC), CD14++CD16+intermediate (I), CD14++CD16' classical monocytes (C), and CD14+HLADRlow / -M-MDSCs, separated from fresh PBMCs of CLL patients (n = 7, patients 1-7, Table 1) using fluorescence-activated cell sorting are shown in the graphs. (Figs.7C-7D) Frozen PBMCs obtained from patients with CLL (n = 6, patients 1, 2, 3, 51, 52, 68) and healthy donors (n = 6) were plated for 2 hours in a 6-well plate at 6 x 106 / 1.8 mL after thawing and were then stained for fluorescence activated cell sorting (FACS). Patients 51, 52, 68 were enrolled into trial with ibrutinib (IBT) and venetoclax (Ven) after this study and are indicated as pre-treatment. (Fig. 7C) miR-15a and (Fig.7D) miR-16-1 expression relative to U6 control in human CD19+B cells, effector memory hCD8+CD45RA CD45RO+CD62L- TEM, central memory hCD8+CD45RA CD45RO+CD62L+TCM, CD4+CD25+CD127low / -Treg, CD14+CD16++non classical (NC), CD14++CD16+intermediate (I), CD14++CD16' classical monocytes (C), and CD14+HLADRlow / ' M-MDSC, separated from PBMCs of healthy donors and patients with CLL are shown in graphs. (Figs.7E-7J) Frozen PBMCs obtained from healthy donors (n = 6) and patients with CLL (n = 6, patients 1, 2, 3, 51, 52, 68) and were plated for 2 hours in a 6-well plate at 6 x 106 / 1.8mL after thawing and were then stained and analyzed for the expression of BCL2, PD1 and PD-L1 on CD19+B cells, effector memory hCD8+CD45RACD45RO+CD62L-TEM, central memory hCD8+CD45RA CD45RO+CD62L+TCM, CD4+CD25+CD1271OW / ’ Tregs, CD14+CD16++non classical, CD14++CD16+intermediate and CD14++CD16-classical monocytes andCD14+HLADRlow / -M-MDSCs using flow cytometry. The mean values ± SDs of the relative contributions of BCL2 expressing immune cells from (Fig. 7E) healthy donor controls and (Fig. 7F) patients with CLL are shown in the graphs. The mean values ± SDs of the absolute numbers of BCL2 expressing immune cells from (Fig. 7G) healthy donor controls and (Fig.7H) patients with CLL are shown in the graphs. (Fig. 7I) The mean values ± SDs of the relative contributions of PD-L1+CD14+CD16++non classical (NC), PD-L1+CD14++CD16+intermediate (I), PD-L1+CD14++CD16' classical monocytes (C) and PD-L1+CD14+HLADRlow / -M-MDSCs from healthy donor controls are shown in graph. (Fig. 7J) The mean values ± SDs of the relative contributions of PD1+CD8+CD45RACD45RO+CD62L-TEM and PD1+CD8+CD45RACD45RO+CD62L+TCM from healthy donor controls are shown in graph. (Fig. 7K) The mean values ± SDs of the relative contributions of PD-L1+CD14+CD16++non classical, PD-L1+CD14++CD 16+intermediate, PD-L1+CD14++CD16' classical monocytes and PD-L1+CD14+HLADRlow / -M-MDSCs from patients are shown in graph. (Fig.7L) The mean values ± SDs of the relative contributions of PD1+CD8+CD45RA' CD45RO+CD62L- TEM and PD1+CD8+CD45RACD45RO+CD62L+TCM from patients are shown in graph. (Fig.7M) MISTRG mice were adoptively transferred on day 0 with monocytes and M-MDSCs (i.v.: 50,000-546,000 cells depending on the patient, including NC, I, C monocyte subsets and M-MDSCs) separated using fluorescence-activated cell sorting from the PBMCs of patients 413, 680, 915 (Table 2) and NS-transfected for 15 min with 50pM of either miR-16-1 miRNA mimic or miRNA mimic control. Mice were euthanized 7 days later for the analysis of patient-derived macrophages. (Fig. 7N) miR-16-1 expression relative to U6 control in myeloid cell pools (including NC, I, C monocytes and M-MDSCs) separated from PBMCs of CLL patients (n=3, patients 413, 680, 915, Table 2) and then NS-transfected with miR-16-1 miRNA mimic (miR-16-1 mimic), with mimic control (mimic control) or left untreated (Unt) is shown in the graph. (Fig. 7O) The percentages of BCL2+, PD-L1+, CD206+, CD163+to the whole CD68+macrophage pool gated on live cells detected in the PB of MISTRG mice are shown in the graphs.
[0041] Figs. 8A-8H. Leukemic expansion in the peripheral blood and bone marrow of TCL1 transgenic mice with MDR deletion. 4-month-old TCL1tg / wtMDR- / -(TM, n = 7), age-matched TCL1tg / wt(n = 6), MDR’’ (n = 6) and WT control (n = 6) mice were analyzed for the accumulation of CD19+CD5+B cells in the PB and BM by flow cytometry. (Fig. 8A) The mean value ± SD of the relative contributions of CD19+CD5+cells gated on CD19+cells in the PB is shown in the graph. (Fig.8B) The mean value ± SD of the absolute numbers of CD19+CD5+cells gated on CD19+cells in the BM. (Fig. 8C) The mean value ± SD of the relativecontributions of CD19+BCL2+cells gated on CD19+CD5+cells in the PB is shown in graph.(Fig. 8D) The mean value ± SD of the absolute number of CD19+BCL2+cells gated on CD19+CD5+cells in the BM is shown in the graph. (Figs. 8E-8H) 9-month-old TM (n = 9), age-matched TCL1tg / wt(n = 10), MDR- / -(n = 10), WT control (n = 7) mice and, 27-month-old MDR- / -(n = 3) were analyzed for the accumulation of CD19+CD5+B cells in the PB and BM using flow cytometry. (Fig. 8E) The mean value ± SD of the relative contributions of CD19+CD5+cells gated on CD19+cells in the PB is shown in the graph. (Fig. 8F) The mean value ± SD of the absolute numbers of CD19+CD5+cells gated on CD19+cells in the BM. (Fig. 8G) The mean value ± SD of the relative contributions of CD19+BCL2+cells gated on CD19+CD5+cells in the PB is shown in the graph. (Fig. 8H) The mean value ± SD of the absolute number of CD19+BCL2+cells gated on CD19+CD5+cells in the BM is shown in graph. A statistical analysis was performed using the Student’s t test *P < 0.05, **P < 0.01, *** P < 0.001.
[0042] Fig. 9. Schematic representation of SGK3 signaling pathway in cancer. In CLL PI3K is activated downstream of CD 19, B cell receptor (BCR) and CXCR4 and further activates AKT signaling and PDK1(Barragan et al., 2003; Dieterle et al., 2014; Xu et al., 2009). AKT independent alternate pathways involving SGK3 have been identified in solid tumors (Lien et al., 2017). PDK1 can activate SGK3 (serum- and glucocorticoid-inducible protein kinase 3) (Bruhn et al., 2013). SGK3 can be alternatively activated at the downstream of mTORC2(Bruhn et al., 2013). SGK3 has the same targets as AKT and can further activate BCL2 and BCL-XL (Liu et al., 2000; Hou et al., 2015; Wang et al., 2011) inducing cell survival and proliferation. SGK3 also inhibits the apoptosis players FOXO3, Caspases and Bad (Bruhn et al., 2013; Hou et al., 2015; Liu et al., 2000; Wang et al., 2011) and assist in cell survival. Furthermore, SGK3 can inhibit AIP4 on the endosome. AIP4 is required for CXCR4 sorting and further lysosomal degradation. Inhibition of AIP4 by SGK3 can block the degradation of CXCR4 and lead to its recycling which can increase the CXCR4 levels and further induce survival and migration of cancer cells (Slagsvold et al., 2006). Conclusively, in CLL as in solid tumors, SGK3 might play a crucial role in AKT independent CLL cell survival.
[0043] Figs. 10A-10D. Macrophage characterization in the spleen of leukemic TCL1 transgenic mice with MDR deletion. 9-month-old TCL1tg / wtMDR- / -(TM, n = 9), age-matched TCL1tg / wt(n = 10), MDR- / -(n = 10), WT control (n = 7) mice and 27-month-old MDR- / -mice (n = 3) were analyzed for the accumulation of CDllb+F4 / 80+macrophages in the spleen using flow cytometry. (Fig. 10A) The mean values ± SDs of the relative contributions of CDllb+F4 / 80+MRC1+cells and (Fig. 10B) CDllb+F4 / 80+BCL2+gated on CD45+in the SP are shown in the graphs. (Fig. 10C) The mean values ± SDs of the absolute numbers of CDllb+F4 / 80+MRC1+cells and (Fig. 10D) CDllb+F4 / 80+BCL2+gated on CD45+in the SP are shown in the graphs. A statistical analysis was performed using the Student t test *P < 0.05, **P < 0.01.
[0044] Figs. 11A-11F. Pro-tumor function of monocytes and macrophages from MDR- / _mice in the TCL1 transgenic transplantation system. (Fig. 11A) C57BL / 6 mice intraperitoneally (i.p.) transplanted with leukemic B cells from & Ku-TCL! transgenic mouse donor, were left untreated (n = 3, red squares) or adoptively transferred (day +84) with monocytes / macrophages purified from the BM of MDR " mice (n = 3, empty red squares). Mice were killed on day 91 and were analyzed using flow cytometry. (Fig. 11B) The mean values ± SD of the relative contributions of CD19+CD5+cells to the whole B cell pool at day 84 and (Fig. 11C) day 91 in the PB of mice are shown in the graphs. (Fig. 11D) The mean values ± SDs of the absolute number of CD19+CD5+cells gated on CD19+in BM and (Fig. 11E) SP are shown in the graphs. (Fig. 11F) The spleen weights of untreated and adoptively transferred mice are shown in the graph. A statistical analysis was performed using the Student t test *P < 0.05.
[0045] Figs. 12A-12D. Characterization of miR-15a / miR-16-l in human immune cells from patients with CLL and healthy donors. Frozen PBMCs obtained from patients with CLL (n = 6) and healthy donors (n = 6) were plated for 2 hours in a 6-well plate at 6 x 106 / l.8 mL after thawing and were then stained for fluorescence activated cell sorting (FACS). (Fig.12A) miR-15a expression relative to U6 control in human CD19+B cells, effector memory hCD8+CD45RA CD45RO+CD62L- TEM, central memory hCD8+CD45RA-CD45RO+CD62L+TCM, CD4+CD25+CD127low / -TREG, CD14+CD16++non classical (NC), CD14++CD16+intermediate (I) and CD14++CD16-classical (C) monocytes and CD14+HLADRlow / -M-MDSCs, separated from PBMCs of healthy donors (n = 6) and (Fig. 12B) CLL patients (n = 6, patients 1, 2, 3, 51, 52, 68, Table 1) is shown in graphs. (Fig. 12C) miR-16-1 expression relative to U6 control in human CD19+B cells, effector memory hCD8+CD45RA-CD45RO+CD62L- TEM, central memory hCD8+CD45RACD45RO+CD62L+TCM, CD4+CD25+CD1271OW / - TREG, CD14+CD16++non classical (NC), CD14++CD16+intermediate (I) and CD14++CD16' classical (C) monocytes and CD14+HLADRlow / -M-MDSCs, separated from PBMCs of healthy donor (n = 6) and (Fig. 12D) CLL patients (n = 6, patients 1, 2, 3, 51, 52, 68, Table 1) is shown in graphs.
[0046] Figs. 13A-13I. Immune cell composition in patients with CLL treated with ibrutinib and venetoclax. The absolute number of (Fig. 13A) CD8+, (Fig. 13B) CD8+CD45RA CD45RO+CD62L- TEM and (Fig. 13C) CD8+CD45RA CD45RO+CD62L+TCM cellsare shown in the graphs. (Fig. 13D) The absolute numbers of CD4+and of (Fig. 13E) CD4+CD25+FOXp3+TREG are shown in the graphs. (Fig. 13F) The absolute numbers of CD14+CD16++non classical, (Fig. 13G) CD14++CD16+intermediate, (Fig. 13H) CD14++CD 16' classical monocytes, and (Fig. 131) CD14+HLADRlow / -M-MDSCs are shown in the graphs. Using flow cytometry, immunophenotypic characterization was performed on fresh peripheral blood samples from patients with CLL (n = 6; patients 36, 42, 51, 52, 46, 68, Table 1) before and during treatment with ibrutinib and venetoclax. Each cycle lasted 4 weeks. Cycle 2 indicates samples obtained after 1 cycle (4 weeks into ibruitinib treatment), and cycle 4 indicates samples obtained after 3 cycles (12 weeks into ibrutinib treatment). Cycle 5 indicates samples obtained after 1 cycle of venetoclax (4 weeks into venetoclax treatment, and after 12 weeks into ibrutininb treatment). A statistical analysis was performed using the Student t test *P < 0.05; **P < 0.01.
[0047] Fig. 14. Patient-derived xenograft (PDX) studies in the humanized MISTRG mice. MISTRG mice were adoptively transferred on day 0 with either monocytes or M-MDSCs (i.v.: 4,286-259,649 cells depending on the patient, including NC, I, C monocyte subsets and M-MDSCs) separated using fluorescence-activated cell sorting from the PBMCs of patients 386, 654, 732 (Table 2). Mice were euthanized 30 hours later for the analysis of patient-derived macrophages.
[0048] Figs. 15A-15C. The effect of miR-15a on monocyte-derived macrophages from patients with CLL. (Fig. 15A) MISTRG mice were adoptively transferred on day 0 with a pool of monocytes and M-MDSCs (i.v.: 200,000-541,000 cells depending on the patient, including NC, I, C monocyte subsets and M-MDSCs) separated using fluorescence-activated cell sorting from the PBMCs of patients 181, 370, 967 (Table 2) and transfected for 15 min with 50pM of either miR-15a miRNA mimic or miRNA mimic control. Mice were euthanized 7 days later for the analysis of patient-derived macrophages. (Fig. 15B) miR15-a expression relative to U6 control in the myeloid cell pools (including NC, I, C monocytes and M-MDSCs) separated from PBMCs of CLL patients (n=3, Table 2) and then transfected with miR-15a miRNA mimic (miR-15a mimic), with mimic control (mimic control) or left untreated (Unt) is shown in the graph. (Fig. 15C) The percentages of BCL2, PD-L1, CD206, CD 163 to the whole CD68+macrophage pool gated on live cells detected in the PB of MISTRG mice are shown in the graphs.
[0049] Fig. 16. Adoptive transfer of human leukemic cells into transgenic mice.MISTRG mice intravenously (i.v.) injected with MEC1 cells (day 0) were adoptively transferred (AT) on day 11 with monocyte subsets (including NC, I, C monocytes) and M-MDSCs separated using fluorescence-activated cell sorting from the PBMCs of patients 107, 881, Oil, 953 and NS-transfected for 15 min with 50pM of either miR-16-1 miRNA mimic or miRNA mimic control. Two mice in each cohort (miR-16-1 miRNA mimic or control mimic) received myeloid cells from every patient sample (total number of mice in each cohort, n=8). Survival is ongoing. Preliminary Kaplan-Meier survival curve (updated to day 53) is represented in the Figure.
[0050] It will be appreciated that the drawings are illustrative and not limiting of the scope of the invention, which is defined by the appended claims. The embodiments shown accomplish various aspects and objects of the disclosure. It is appreciated that it is not possible to clearly show each element and aspect of the disclosure in a single figure, and as such, multiple figures are presented to separately illustrate the various details of the disclosure in greater clarity. Similarly, not every embodiment need accomplish all advantages of the present disclosure. Elements and acts in the figures are illustrated for simplicity and have not necessarily been rendered according to any particular sequence or embodiment.DETAILED DESCRIPTION
[0051] The following detailed description is presented to enable any person skilled in the art to make and use the aspects of the present application. For purposes of explanation, specific nomenclature is set forth to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that these specific details are not required to practice the aspects of the present application. Descriptions of specific embodiments are provided only as representative examples. The present application is not intended to be limited to the embodiments shown but is to be accorded the widest possible scope consistent with the principles and features disclosed herein. With respect to the teachings in the present application, any issued patent, pending patent application, patent application publication, or non-patent literature described in this application is expressly incorporated by reference herein.
[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. The phrase “as used herein” and variants thereof refer to the entire disclosure of this application, as well as to the appended claims.
[0053] Articles “a” and “an” as used herein refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
[0054] The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations, where interpreted in the alternative (“or”).
[0055] The present disclosure is directed to a novel ex vivo method to induce the differentiation of monocytes and monocytic myeloid-derived suppressor cells (M-MDSCs) into anti-tumor macrophages. As used herein, the term “myeloid cells” encompasses both monocytes and M-MDSCs. As described in this disclosure, the inventors investigated the molecular profile and immunophenotype of human and mouse immune cells exposed to CLL cells and investigated genetic drivers of protumor immune dysregulation. As described herein, the inventors are the first to demonstrate in mouse models and patients with CLL the involvement of the DLEU2 / miR-15a / miR-16-l cluster in the protumor function of nonmalignant immune cells. The inventors also expanded their studies and identified additional miRNAs of interest.
[0056] The heterogeneous clinical course of CLL reflects differences in the biology of the disease, particularly chromosomal alterations (Dohner et al., 2000). The most frequent chromosomal aberration is 13q deletion; 55% of patients with CLL carry this deletion and have the longest survival. Besides chromosomal aberrations, other crucial features of CLL include recurrent mutations, microRNA (miRNA) dysregulation and microenvironmental involvement (Svanberg et al., 2021; Rassenti et al., 2017).
[0057] miR-15a / miR-16-l are on the same gene cluster that maps the human chromosome 13q 14 region that encodes for several genes highly conserved in human and mice. The minimal deleted region (MDR) includes the DLEU2 long non-coding RNA (ncRNA), and the miR-15a / miR-16-l cluster. Mutations interfering with the normal expression of miR-15a / miR-16-l have been observed in patients with CLL (Calin et al., 2005), as well as in the NZB strain of mice that develop a CLL-like disease at old age (Scaglione et al., 2007).
[0058] To recapitulate the 13q 14 deletion, a transgenic mouse model carrying the deletion of the MDR was developed (Klein et al., 2010). Mice with the germline deletion of the MDR develop lymphoproliferations with low penetrance (50% develop CLL) and have indolent disease. Overall, the genetic inactivation of miR-15a / miR-16-l in mice has provided conclusive evidence of a tumor-suppressor role of these miRNAs in CLL pathogenesis (Simonetti et al., 2014). miR-15a / miR-16-l exerts tumor-suppression function by targeting bcl-2 oncogene on CLL cells (Calin et al., 2002; Calin et al., 2005; Calin et al., 2008). The tumor-suppressor roleof DLEU2 / miR-15a / miR-16-l locus has been extensively characterized on leukemic cells (Calin et al., 2008; Klein et al., 2010).
[0059] BCL2 has a multifunctional role beyond oncogenesis; several studies in murine models have reported its involvement in the development and function of the immune system (Renault et al., 2013). T cells begin to express BCL2 when they reach the single-positive stage, and BCL2 over-expression enhances the survival of T cells (Strasser et al., 1991; Veis et al., 1993). Interestingly, bcl2' / _mice have impaired immune system development; the loss of white pulp lymphoid tissue is the most remarkable abnormality observed in their spleens. Both B and T cell lineages are deleted by massive episodes of apoptosis that occur at various ages in bcl-2~'~ mice (Veis et al., 1993). The mechanism of regulation for theBCL2 family proteins includes several points of transcriptional and post-transcriptional control, including transcriptional regulation via transcription factors, miRNAs and alternative splicing. It is known that the prolonged survival of leukemic CLL cells is associated with defective apoptosis that triggers the nuclear factor kappa B (NF-kB) and phosphoinositide 3-kinase (PI3K) / AKT pathways. These pathways are constitutively activated in CLL and promote the overexpression of BCL2 family proteins that have become successful targets in the treatment of CLL with the development and approval of BCL2 targeting agents (Souers et al., 2013) (i.e. venetoclax). Given the broad expression of BCL2, it is known that the drug can also have an impact on the nonmalignant tumor immune microenvironment (TIME) (Jain et al., 2021).
[0060] The TIME of CLL is particularly populated by T cells, natural killer (NK) cells, monocytes, macrophages, and myeloid-derived suppressor cells (MDSCs) that provide critical survival signals to malignant cells and suppress natural immunosurveillance (Banerjee et al., 2019). Alterations of the T cell repertoire start at early stage and worsen during disease progression with functional impairment and exhaustion of memory T cells and expansion of CD4+regulatory T cells. The monocyte cell count is often increased in patients with CLL with subset skewing toward CD14+CD16+monocytes with protumor macrophage differentiation capacity.
[0061] The molecular mechanisms responsible for the protumor function of selected immunosuppressive cells are poorly investigated, as is the impact of currently used targeted therapies on the immune system of patients. Besides miR-15a / miR-16~rs well-known tumor suppressor function targeting BCL2 molecule on tumor cells (Calin et al., 2008), in mice there is evidence that BCL2-expressing monocytes can be forced to undergo macrophage differentiation (Lagasse et al., 1997). In addition, it is known that miR-16-1 regulatesmacrophage pro-tumor polarization through the critical immune suppressor PD-L1 (Jia et al., 2016).
[0062] The development and progression of chronic lymphocytic leukemia (CLL) depend on genetic abnormalities and on the immunosuppressive microenvironment. The present inventors have explored the possibility that genetic drivers might be responsible for the immune cell dysregulation that shapes the protumor microenvironment. Transcriptome analysis was performed of coding and non-coding RNAs (ncRNAs) during leukemia progression in the Rag2' / 'yc' / ' MECl-based xenotransplantation model. The DLEU2 / miR-16 locus was found downmodulated in monocytes / macrophages of leukemic mice. To validate the role of this cluster in the tumor immune microenvironment, a mouse model that simultaneously mimics the overexpression of hTCLl and the germline deletion of the minimal deleted region (MDR) encoding the DLEU2 / miR-15a / miR-16-l cluster was generated. This model provides an innovative and faster CLL system where monocyte differentiation and macrophage polarization are exacerbated, and T-cells are dysfunctional. MDR deletion inversely correlates with the levels of predicted target proteins including BCL2 and PD1 / PD-L1 on murine CLL cells and immune cells. The inverse correlation of miR-15a / miR-16-l with target proteins has been confirmed on patient-derived immune cells. Forced expression of miR-16-1 interferes with monocyte differentiation into tumor associated macrophages, indicating that selected ncRNAs drive the protumor phenotype of nonmalignant immune cells.
[0063] The present disclosure demonstrates that DLEU2 / miR-15a / miR-16-l and its target proteins are involved in a wide molecular program of the nonmalignant immune system that is exacerbated during leukemia development, progression, and dissemination.
[0064] Previous studies have documented a variety of ncRNA molecular signatures in the mouse immune system (Rose et al., 2021). The present transcriptome analysis of coding and ncRNAs performed on murine monocytes and macrophages at different stages of leukemia in Rag2' / 'yc' / ' xeno-transplanted mice showed an enrichment of several miRNAs and IncRNAs involved in normal and malignant hematopoiesis. The inventors found differential expression of miR-51 l-3p, miR-181c and miR-9-2 on myeloid cells. These miRNAs modulate macrophage activation and function in solid tumors (Squadrito et al., 2013). miR-51 l-3p, the first miRNA whose activity was studied in TAMs in vivo, attenuates the expression of the genes that define TAMs’ protumor signature (Squadrito et al., 2013). In this study, ROCK2, a direct target of miR-511 -3p, was found differentially expressed in myeloid cells during leukemia progression. Likewise, 2 IncRNAs, HOTAIR4 and H0TAIRM1, showed differential expression in the present transcriptome analysis. Although these IncRNAs remain unexplored in CLL cells and CLL-associated myeloid cells, studies have demonstrated their role in the regulation of myeloid cells. HOX genes play a role in leukemogenesis, and their expression has been associated with the prognosis of patients with acute myeloid leukemia (AML). H0TAIRM1 is found in the HOXA genomic cluster and modulates the expression of genes involved in myeloid differentiation. Increased H0TAIRM1 expression has been observed in AML patients and correlated with shortened overall survival (Diaz-Beya et al., 2015).
[0065] As described in this disclosure, the inventors discovered that / J / . A7 / 2 and miR-16-1 were downmodulated on myeloid cells. This evidence supported the inventors’ hypothesis that the MDR locus has a role in the protumor function of myeloid cells during leukemia progression, and the results obtained in the TCL1+ / MDRAmouse model further supported this hypothesis. In patients with CLL, the inventors found that miR-16-1 drove the protumor phenotype of monocyte-derived macrophages.
[0066] Although 13ql4 deletion is the most frequent genetic lesion in CLL cells, occurring in more than 50% of cases, a mouse model recapitulating the 13ql4 deletion with optimal disease penetrance and latency for translational studies was lacking. The inventors developed the TCL1+ / MDR’ ’ mouse model characterized by the 13ql4 deletion, and overexpression of the hTCLl gene, present in the vast majority of human CLL cases. Of note, in patients with CLL either somatic or germline mutations of miR16-l have been reported (Calin, 2005) and the MDR ’’ mouse model recapitulating the germline 13ql4 deletion, allowed to investigate its impact on the biology of cells of both the lymphoid and myeloid lineage.
[0067] The peculiar TIME observed in the TM mouse model recalls crucial features of immune dysfunction observed in patients with CLL. Perturbation of the innate and adaptive immune system is observed in almost all the patients from the time of diagnosis (Forconi et al., 2015; Rossi et al., 2008). Alterations in T-cell populations start in early-stage and worsen during disease progression with initial increase of the absolute CD4+and CD8+T cell count, followed by reduction of the CD4+: CD8+T cell ratio, functional impairment of T-cell cytotoxic activity and immune synapse formation, exhaustion features and expansion of CD4+FoxP3+regulatory T cells (TREG). The monocyte cell count is often increased in patients with CLL and skews toward CD14+CD16+Non-Classical and Intermediate monocytes with immunosuppressive properties and protumor, M2-like macrophage differentiation capacity (Maffei et al., 2013). The TCL1+ / MDR- / -mice closely recapitulate some of these features, including the CD4: CD8 T cell ratio abnormality, T-cell exhaustion, monocyte populations more committed to macrophage differentiation, and exaggerated protumor and cell-autonomous macrophage phenotype. The present studies provide a means for profiling the ncRNA signatures of the immune cells in patients with CLL.
[0068] The BCL2 upregulation observed on leukemic cells and immune cells in the TCL1+ / MDR’’ mice by the inventors confirmed previous data demonstrating in patients with CLL that miR-15a / miR-16-l exerts its tumor-suppression function by targeting BCL2 (Calin et al., 2002; Calin et al., 2005; Calin et al., 2008). Additionally, BCL2 was found expressed on immune cells from both patients with CLL and age-matched healthy donors, confirming the role of BCL2 molecule in the development and function of the whole immune system (as reviewed in Renault et al., 2013). This latter finding could be due to various mechanisms.
[0069] For example, without wishing to be bound by theory, it is possible that low expression level of miR-15a / miR-16-l in immune cells might be an age-related phenomenon like that observed in aged wild-type NZB mice where a point mutation in the 3 ’-flanking sequence of Mirnl6-1 results in decreased levels of miR-16 in lymphoid tissues (Scaglione et al., 2007). The status of miR-15a / miR-16-l cluster in the immune cells of < 40-year-old healthy donors has not been investigated.
[0070] Alternatively, without wishing to be bound by theory, it is possible that DLEU2 might have an immune-related role. It encodes a IncRNA (1.0-1.8 kb) that targets several miRNAs, and it might be a regulator of immune cells from patients with CLL compared with healthy donors. The initial identified transcript was thought to be a tumor suppressor IncRNA through negative regulation of cell cycle progression (Liu et al., 1997). A certain alternative transcript of DLEU2 has been shown to facilitate cell cycle transition through modulation of expression of angiotensin I- converting enzyme 2 (ACE2) and cyclin DI (Li et al., 2017). Overall, studies on cancer cell lines and mouse models assessed the effects of DLEU2 overexpression or silencing on tumor progression (Ghafouri-Fard et al., 2021) but its impact on immune cells of the lymphoid and myeloid lineage has not been investigated.
[0071] The present study indicates that DLEU2 / miR-15a / miR-16-l and its target proteins are responsible for the dysregulation of immune cells that shapes the protumor microenvironment during CLL development, progression, and dissemination and underlines the relevance of investigating the role of ncRNAs in the human immune system.
[0072] Through these studies, the present inventors have found that myeloid cells isolated and transfected ex vivo according to the methods described here can be administered to a subject such that the myeloid cells differentiate in vivo when administered to a subject into macrophages having anti-tumor function.
[0073] Additionally, it is well known in the art that altered miRNA levels are observed in most autoimmune diseases and are recognized to influence autoimmunity through different mechanisms. Moreover, it is known that monocytes and macrophages are involved in the development of autoimmune diseases. Accordingly, the method of ex vivo transfection of myeloid cells as described in this disclosure can be used to generate macrophages useful for the treatment of a variety of autoimmune diseases. Thus, also provided in this disclosure are compositions and methods for the treatment autoimmune diseases.
[0074] Thus, in one aspect, provided in this disclosure are methods for generating antitumor macrophages from myeloid cells. In another aspect, provided in this disclosure are methods of treating cancer in a subject. In another aspect, provided in this disclosure are methods of reducing PD-L1 expression in macrophages in a subject. Also provided in this disclosure are compositions and methods for the treatment of cancer. In another aspect, provided in this disclosure are methods of targeting BCL2 / PD-L1 protein on myeloid cells using the provided methods. In another aspect, provided in this disclosure are methods of downregulating BCL2 / PD-L1 proteins on tumor-associated macrophages produced by the provided methods. In another aspect, provided in this disclosure are methods of downmodulating macrophage protumor markers, such as CD 163 and CD206, using the provided methods. In another aspect, provided in this disclosure are methods of treating an autoimmune disease in a subject.A. Transfection of Myeloid Cells
[0075] An aspect of the present application is directed to an ex vivo method for generating anti -tumor myeloid cells. The method comprises obtaining monocytes and monocytic myeloid-derived suppressor cells (myeloid cells) from peripheral blood mononuclear cells (PBMCs) and transfecting the myeloid cells with a miRNA modulator of interest. The modulation of the miRNAs of interest induces differentiation of the transfected myeloid cells into anti-tumor macrophages when the transfected myeloid cells are introduced into a subject.1. Myeloid Cells
[0076] Myeloid cells are obtained from a subject. The subject can be any subject as defined below in Section C. In some instances, the subject is human and the PBMCs are human cells. In some instances, peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood from a subject and identified as any blood cell with a round nucleus (i.e. lymphocytes, monocytes, natural killer cells (NK cells) or dendritic cells). The most common PBMC isolation method involves using a density gradient medium (e.g. Ficoll™ or Lymphoprep™)and centrifugation. This method takes advantage of the differences in density between the cells in blood and the density gradient medium. From the PMBCs, myeloid cells can be isolated. Various methods for myeloid cell isolation are known, such as those described previously (Bertilaccio, 2019).
[0077] In some embodiments, PBMCs are first incubated with LIVE / DEAD fixable Aqua dye; then, after the blocking of Fc receptors, live myeloid cells are isolated using 4-way fluorescence-activated cell sorting, after surface staining. In some embodiments, antibodies for surface staining include antibodies that bind to one or more of CD66b, CD3, CD 19, CD20, CD56, CD14, or CD16. Exemplary antibodies that are useful for such purposes include antibody clones G10F5. UCHTI, HIB19, 2H7, 5.1H11, McpP9, 3G8: or L243 as identified below in Table 6. In some instances, the antibodies can include one or more of Alexa Fluor 700 mouse anti-human CD66b (G10F5), APC mouse anti-human Lineage Cocktail (CD3 / CD19 / CD20 / CD56; UCHTI, HIB19, 2H7, 5.1H11), Brilliant Violet 786 mouse antihuman CD 14 (McpP9), each available from BD Biosciences, PE mouse anti-human CD 16 (3G8) purchased from Biolegend (San Diego, CA, USA), or APC-Cy7 mouse anti-human HL A DR (L243). In some embodiments, the separation of myeloid cells from PBMCs is by magnetic bead separation or fluorescence-activated cell sorting (FACS).
[0078] In some embodiments, the myeloid cells are monocytes or M-MDSCs, which can be isolated by methods described previously (Bertilaccio, 2019; Banerjee, 2019). Monocyte subsets may be identified and isolated by using fluorescence-activated cell sorting through the negative exclusion gating strategy described below. For example, CD66b+neutrophils can be excluded, then T cells, B cells, and NK cells, respectively, can be excluded using a lineage (Lin) cocktail including monoclonal antibodies specific for CD3, CD19, CD20, and CD56. CD 14 and CD 16 expression may then used to identify CD14+CD16++, CD14++CD16+intermediate, and CDI4 CDI6 monocytes. For example, M-MDSCs are identified as CD14+HLADR10W” cells.
[0079] In some embodiments, the PBMCs, and thus the myeloid cells obtained therefrom, are allogenic cells or autologous cells with respect to the subject to which the transfected myeloid cells will be administered.2. miRNAs and miRNA modulators
[0080] The inventors identified various miRNAs of interest that impact differentiation of myeloid cells into macrophages. Upon the modulation of a miRNA of interest in isolated myeloid cells, the myeloid cells are forced to differentiate into anti-tumor macrophages whenthe myeloid cells are introduced into a subject. In the methods provided in this disclosure, a miRNA modulator that modulates the expression or level of the targeted miRNA of interest is introduced into isolated myeloid cells so as to effect modulation of the miRNAs of interest in the myeloid cells and result in the desired differentiation when the myeloid cells are introduced into a subject. In some embodiments, miRNA modulator is a miRNA mimic, an anti -miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
[0081] In some embodiments, the miRNA of interest is a miRNA encoded by the miR-15a / 16-l cluster. In some embodiments, the miRNA is miR-15-a or miR-16-1. In some embodiments, the miRNA modulator downmodulates at least one of miR-15-a or miR-16-1. In some embodiments, the miRNA modulator is a miR-15-a mimic or a miR-16-1 mimic.
[0082] In some embodiments, the miRNA is one that is downmodulated in myeloid cells from xeno-transplanted mice at late stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia as described in Example 2. In some embodiments, the miRNA that is downmodulated in myeloid cells from xeno-transplanted mice at late stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia is listed in Table S9 of Zhang, R. et al., Blood Cancer Journal, Vol. 14, Article 168 (2024). In some embodiments, the miRNA is one of those listed in Table 9. In some embodiments, the miRNA modulator upmodulates at least one miRNA listed in Table 9. In some embodiments, the miRNA modulator is an inhibitor of a miRNA listed in Table S9 of Zhang, R. et al., Blood Cancer Journal, Vol. 14, Article 168 (2024).
[0083] In some embodiments, the miRNA is one that is upmodulated in myeloid cells from xeno-transplanted mice at late-stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia as described in Example 2. In some embodiments, the miRNA that is upmodulated in myeloid cells from xeno-transplanted mice at late stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia is listed in Table S9 of Zhang, R. et al., Blood Cancer Journal, Vol. 14, Article 168 (2024). In some embodiments, the miRNA modulator is an inhibitor of a miRNA listed in Table 8. In some embodiments, the miRNA is miR-51 l-3p, miR-181c, or miR-9-2. In some embodiments, the miRNA modulator downmodulates at least one miRNA listed in Table 8. In some embodiments, the miRNA modulator is an inhibitor of a miRNA listed in Table S8 of Zhang, R. et al., Blood Cancer Journal, Vol. 14, Article 168 (2024).
[0084] Mature miRNA sequences can be found in the miRNA database, miRBase, available at mirbase.org and as described in Kozomara, 2011; Griffiths- Jones, 2008; Griffiths-Jones, 2006; and Frankel 2008.
[0085] In some embodiments, the miRNA modulator is a miRNA mimic. miRNA mimics are non-natural, chemically modified, double-stranded RNA molecules that are designed to specifically bind to and mimic endogenous miRNA molecules. miRNA mimics are designed to have a 5 '-end bearing a partially complementary motif to the selected sequence in the 3' UTR unique to the target gene. Once introduced into cells, this RNA fragment, mimicking an endogenous miRNA, can bind specifically to its target gene and produce posttranscri phonal repression, more specifically translational inhibition, of the gene. Like native miRNAs, miRNA mimics have two strands — the mature, or guide strand, which is functional and used by the Argonaute (Ago) protein to target mRNAs, and the passenger strand (formerly called the star strand), which may or may not have native targets of its own. Unlike endogenous miRNAs, miRNA mimics act in a gene-specific fashion. In some embodiments, the miRNA mimic is a mirVana miRNA mimic (ThermoFisher Scientific). The chemical modifications in mirVana miRNA mimics inactivate the passenger strand to help ensure that the guide strand (representing the desired mature miRNA) is taken up by Ago to produce the miRNA effect. Various design considerations for developing miRNA mimics are described in Wang, 2011.
[0086] In some embodiments, the miRNA modulator is an anti-miRNA antisense oligonucleotide (ASO). These oligonucleotides are complementary to mature miRNAs and prevent them from binding to their natural targets by steric blocking. For effective miRNA inhibition, the binding affinity between the oligo inhibitor and the miRNA must be significantly higher than that between the miRNA guide strand and the passenger strand. The miRNA inhibitor must be capable of binding to the miRNA guide strand either in single-stranded form, or when bound to an Argonaute protein in a miRNA-induced silencing complex (miRISC). The inhibitor should also be capable of displacing the natural passenger strand in double-stranded miRNA. By base-pairing, it is possible to design an anti-miRNA oligonucleotide sequence that is fully complementary to the 5' end of the mature miRNA, especially matching the seed region. The designed sequence can have the same length, be shorter or even longer than the target. Various design considerations for developing ASO for miRNA inhibition (also referred to as anti-miRNA oligonucleotides) are described in Lima, 2018.
[0087] Anti-miRNA antisense oligonucleotides can include various chemical modifications to improve function or stability. Chemical modifications are mainly introduced in the sugar ring, especially at the C2' position, and / or in the backbone of the oligonucleotide structure. Backbone substitutions may include either internucleotide linkage modifications or the substitution of the entire backbone for structures analogous to the DNA. Internucleotide modifications are often combined with sugar modifications to improve potency and resistanceto the oligonucleotide sequence. In some embodiments, adding a 2' modification to ribose sugars in an RNA oligonucleotide can increase melting temperature (Tm) and confer resistance to nucleases (Lennox, 2013). For example, an anti-miRNA ASO may have some or all of the ribonucleotides modified, such as 2'-O-methylated RNA, locked nucleic acids, or 2'-methoxy ethylated RNA. 2'-(9-methyl RNA (2'0Me) is a naturally occurring, nontoxic nucleic acid with a high binding affinity for RNA that provides the required resistance to mammalian endonucleases. Other modifications include phosphorothioate substitutions, addition of flanking sequences and lipids. These modifications can increase their affinity towards miRNA sequences and protect the oligos from processing by cellular nucleases. For example, adding ZEN modifications to the termini of an anti-miRNA ASO can further increase the binding affinity of the miRNA inhibitors and gives resistance to exonucleases (Lennox, 2013). Other chemically modified antisense oligonucleotides with a 2'-fluoro / 2'-methoxyethyl modified antisense oligonucleotide motif can improve in vivo inhibition of miRNA activity.
[0088] In some embodiments, the miRNA modulator is a CRISPR / Cas system component. In some embodiments, the CRISPR / Cas system component comprises at least one of a gRNA, a Cas protein, a Cas mRNA. In some embodiments, the CRISPR / Cas system component comprises a gRNA and a Cas protein or a Cas mRNA. In some embodiments, the CRISPR / Cas system component comprises at least one of a guide RNA (gRNA). In some embodiments, the CRISPR / Cas system component comprises a ribonucleoprotein particle (RNP) comprising a Cas protein and an sgRNA.
[0089] The CRISPR / Cas system, an RNA-guided nuclease system that employs a Cas endonuclease, can be used to edit the genome of a host cell or organism. See Sanders and Joung, 2014; Liang, 2015; and Mitsunobu, 2017. The CRISPR / Cas system includes a Cas protein and at least one or two ribonucleic acids that are capable of directing the Cas protein to and hybridizing to a target motif in a target genomic sequence. The Cas protein then cleaves the target motif and results in a double-strand break or a single-strand break. CRISPR / Cas systems include type I, II, and III sub-types. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, for example, Cas9, in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Guide RNAs having the activity of both a guide RNA and an activating RNA are also known in the art. In some cases, such dual activity guide RNAs are referred to as a single guide RNA (sgRNA). Any CRISPR / Cas system that is capable of altering a target polynucleotide sequence in a cell can be used in methods described here. In some embodiments, the CRISPR / Cas system is a CRISPR type I system. In some embodiments, the CRISPR / Cas system is a CRISPR type II system. In some embodiments, the CRISPR / Cas1system is a CRISPR type V system. In the methods provided in this disclosure, the CRISPR / Cas system can be used to downregulate a miRNA of interest as described herein.
[0090] The Cas protein used in the methods described herein can be a naturally occurring Cas protein or a functional derivative thereof. A "functional derivative" includes, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with the corresponding native sequence polypeptide. A biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate (i.e. a target genomic sequence) into fragments. The term "derivative" encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof. Suitable derivatives of a Cas protein or a fragment thereof include but are not limited to mutants, fusions, or covalent modifications of Cas protein.
[0091] The ribonucleic acids that are capable of directing the Cas protein to and hybridizing to a target motif in the genomic sequence encoding the miRNA of interest are referred to as single guide RNA (“sgRNA”). The sgRNAs can be selected depending on the particular CRISPR / Cas system employed, and the sequence of the target polynucleotide, as will be appreciated by those skilled in the art. In some embodiments, the one or two ribonucleic acids can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids are designed to hybridize to a target motif immediately adj acent to a deoxyribonucleic acid motif recognized by the Cas protein. Guide RNAs can also be designed using available software, for example, CRISPR Design Tool (Massachusetts Institute of Technology).
[0092] In some embodiments, the target motif in the genomic sequence(s) encoding the miRNA of interest, to which the Cas protein is directed by the guide RNA(s), may be between 15 and 25 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). In some embodiments, the target motif is at least 20 nucleotides in length. In some embodiments, the target motif in the genomic sequence encoding the miRNA of interest immediately precedes a short conserved sequence known as a protospacer-associated motif (PAM), recognized by the Cas protein. In some embodiments, the PAM motif is an NGG motif. In some embodiments, the target motifs can be selected to minimize off-target effects of the CRISPR / Cas systems. Those skilled in the art will appreciate that a variety of techniques can be used to select suitable target motifs for minimizing off-target effects (e.g., bioinformatics analyses).
[0093] The active CRISPR complex is a ribonucleoprotein particle (RNP) containing a Cas protein and an sgRNA. The RNP components can be introduced into the isolated myeloid cells in various ways. In some embodiments, a mRNA encoding the Cas protein (i.e. a Cas mRNA) is introduced into the isolated myeloid cells. In some embodiments, the Cas mRNA is introduced into the isolated myeloid cells with the sgRNA. In some embodiments, a Cas protein is introduced into the isolated myeloid cells. In some embodiments, the Cas protein is introduced into the isolated myeloid cells with the sgRNA. In some embodiments, the Cas protein and gRNA are assembled into RNPs in vitro and introduced into the isolated myeloid cells as RNPs. In some embodiments, a mRNA encoding the Cas protein (i.e. a Cas mRNA) is introduced into the isolated myeloid cells.
[0094] In some embodiments, the gRNA and Cas protein or Cas mRNA are introduced into the myeloid cells using the transfection methods described below in Section A.3. In some embodiments, the Cas protein is introduced into the isolated myeloid cells in polypeptide form. In certain embodiments, the Cas protein may be conjugated to a cell-penetrating polypeptide. Non-limiting examples of cell-penetrating peptides include, but are not limited to, e.g., those provided in Milletti et al., Drug Discov. Today 17: 850-860, 2012, the relevant disclosure of which is hereby incorporated by reference in its entirety.3. Transfection
[0095] Methods of introducing miRNA modulators into a myeloid cell, such as a monocyte or M-MDSC, according to the present disclosure include transfection by biological, physical, or chemical means. Transfection is the delivery of molecular species across the lipid bilayer and into the cytosol or nucleus. The aim of the transfection method is to traverse the cellular membranes with as little detriment to the cell and as high efficiency as possible.
[0096] Physical methods for introducing a miRNA modulator into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, mechanoporation (e.g., cell squeezing, microfluidic vortex shredding, convectively-driven intracellular delivery) and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al., (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
[0097] Chemical means for introducing miRNA modulator into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, andliposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0098] An exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the miRNA modulator into a host monocyte or M-MDSC in vitro or ex vivo. The miRNA modulator may be associated with a lipid. The ncRNA associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the miRNA modulator, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid or lipid / miRNA modulator associated compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
[0099] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about-20? C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Mumtaz et al., 1991). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellarstructure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-ncRNA complexes.
[0100] In some embodiments, the transfection method comprises lipofectamine. Briefly, Lipofectamine consists of a 3:1 mixture of DOSPA (2,3 -di oleoyloxy -N-[2(sperminecarboxamido)ethyl]-N, N-dimethyl-l-propaniminium trifluoroacetate) and 1,2-Dioleoyl-sw-glycerophosphoethanolamine, which complexes with negatively charged nucleic acid molecules to allow them to overcome the electrostatic repulsion of the cell membrane. Lipofectamine' s cationic lipid molecules are formulated with a neutral co-lipid (helper lipid). The DNA-containing liposomes (positively charged on their surface) fuse with the negatively charged plasma membrane of living cells, due to the neutral co-lipid mediating fusion of the liposome with the cell membrane, allowing nucleic acid cargo molecules to cross into the cytoplasm for replication or expression.
[0101] In some embodiments, the miRNA modulator is not present on a viral vector or plasmid.
[0102] In some embodiments, the transfection method comprises electroporation. Electroporation is an electro-physical, non-viral approach to perform DNA, RNA, and protein transfections of cells. Upon application of an electric field, the cell membrane is compromised, allowing the delivery of exogenous materials into cells.
[0103] In some embodiments, the transfection method comprises nanostructure-mediated physical delivery. Over the past ten years, a rapidly expanding effort has been made to develop nanostructures for cellular delivery of nucleic acids, proteins, and small molecule sensors. A wide variety of nanomaterials have been developed for this purpose, including nanowires, nanostraws, nanospears, and nanopores. Details of various nanostructures are described in Tay, 2019. One feature that distinguishes nanostructures from other transfection techniques is that they interface with cells highly locally, on the nanoscale. By limiting the nano-bio interface to such a small scale, cell health may be improved by limiting the extent of the perturbation. At the same time, the magnitude of the physical effect, such as electric field strength or mechanical pressure, may be extremely high in that local region, allowing for more effective cargo delivery.
[0104] VanDersarl et. al. (U. S. Pat. No. 9,266,725) described a biomimetic innovation in the bionanotechnology field in 2012 involving the processing of commonly used nanoporous membrane filters into nanofluidic substrates containing cell-penetrating architectures, referred to as nanostraws. Nanostraws are essentially metal oxide nanotube structures, with diameters on the order of 100 nm, embedded in polymer films.. Nanostraw technology establishes non-destructive intracellular access in real-time, vital for the delivery, or extraction, of bioactive molecular cargo. Cells cultured on nanostraw devices are penetrated, providing a stable, external handle on the delivery of fluidic material species into, or out of cells.
[0105] In some embodiments, the cells are transfected by seeding cells into nanostraw wells for nano-electroinjection, as described in U. S. Pat. No. 9,266,725, U. S. Patent No. 11,530,378, and U. S. Patent Application Publication Nos. US 2022 / 0389364 Al and US 2023 / 0348938 Al, which are each incorporated herein by reference in their entirety for the devices, apparatuses, and transfection methods described therein.
[0106] In some embodiments, the nanostructure devices includes a structure having a porous structure, where the porous structure includes a plurality of nanotubes extending through the porous structure. The nanotubes extend a distance above the porous structure and extend through the porous structure. The term “nanotube” is also referred to as a hollow nanowire or a nanostraw. In some embodiments, nanostraw devices and systems that are useful for the methods provided in this disclosure include nanotubes extending through and out of a porous structure, such as a membrane, so that a material can pass through the membrane from a fluid reservoir depot and into a cell deposited onto the nanotubes when electrical energy (e.g., electroporation energy) is applied. In some instances, the apparatuses (device and systems) and methods may be adapted for long term cell growth viability (>5 days) and transfection efficiency (e.g., >70%). These apparatuses may be readily integratable into cell culturing (and / or separation / isolation) processes for improved transfection efficiency, intracellular transport, and cell viability.
[0107] In some embodiments, the transfecting of cells comprising: culturing one or more cells in a nanostraw well insert device for a period of time, wherein the nanostraw well insert device comprises a cylindrical wall and a membrane extending across a base of the cylindrical wall to form a well, wherein a plurality of nanostraws project through the membrane and into the well greater than 0.1 microns (e.g., between 0.5 and 5 microns, etc.); placing the nanostraw well insert device into a base of an adapter so that the plurality of nanostraws are in fluid communication with a reservoir depot in the base, wherein the reservoir depot is in electrical communication with a base electrode in the base; placing a cover over the base, wherein the cover comprises a top electrode, so that the top electrode extends into the nanostraw well insert device and the top electrode is separated from the base electrode; applying a voltage between the base electrode and the top electrode to deliver a material from the reservoir depot, through the plurality of nanostraws and into the one or more cells; removing the nanostraw well insert from the adapter. In some embodiments, transfecting the cells comprises simultaneoustransfection of more than 1 nanostraw well. An exemplary device capable of performing simultaneous transfection of more than 1 nanostraw well is the multi-well simultaneous pulsing system (Navan Bio, San Carlos, CA).
[0108] In some embodiments, the physical features of the nanostraws can be optimized for nano-electroinjection of miRNA modulators into isolated myeloid cells. In some embodiments, the outer diameter of the nanostraws are lOOnm to 600nm (e.g. lOOnm to 150nm, 150 to 200nm, 200nm to 250nm, 250nm to 300nm, 300nm to 350nm, 350 to 400nm, 400 to 450nm, 450 to 500nm, 500nm to 550nm, or 550nm to 600nm), and the length of the nanostraws relative to the top surface of the membrane filter is lOOnm to 1 micron (e.g. lOOnm to 200nm, 200nm to 300nm, 300nm to 400nm, 400nm to 500nm, 500nm to 600nm, 600nm to 700nm, 700nm to 800nm, 800nm to 800nm, or 900nm to 1 micron). In some embodiments, the combination of nanostraw outer diameter and length can be optimized for enhanced nano-electroinjection of miRNA modulators into myeloid cells through maintaining an aspect ratio (i.e. ratio of nanostraw length to outer diameter) of 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.25, or 0.125. In some embodiments, the aspect ratio is between 0.125 and 0.25, 0.25 and 0.5, 0.5 to 0.75 or 0.75 to 1.
[0109] The isolated myeloid cells are seeded in sterile nanostraw wells for transfection. In some embodiments, the number of cells seeded per nanostraw is between 1 (inclusive) and 500,000. In some embodiments, about 1,000 to about 400,000 cells are seeded per nanostraw. In some embodiments, about 10,000 to about 350,000 cells are seeded per nanostraw. In some embodiments, about 20,000 to about 300,000 cells are seeded per nanostraw. In some embodiments, about 50,000 to about 250,000 cells are seeded per nanostraw. In some embodiments, at least 100,000 cells but not more than 200,000 cells are seeded per nanostraw. In some embodiments, following seeding of the cells into the nanostraw, the cell-containing nanostraws are centrifuged at 5 minutes to 1) bring the myeloid cells in close contact with the nanostraws surfaces and 2) form a monolayer to ensure delivery to a plurality of cells. The seeded nanostraw wells are then placed on the bottom electrode containing the cargo reservoir with the miRNA modulator.
[0110] The miRNA modulator added to the cargo reservoir with a cargo spacer prior to placement of the nanostraw wells seeded with isolated myeloid cells on the bottom electrode. The mesh cargo spacer is useful for precision delivery of miRNA modulators by enabling uniform dosage control across the nanostraw well. This is achieved by at least 1) providing support to the underside of the nanostraw membrane and 2) allowing for complete and uniform fluidic contact with a plurality of nanostraws. The cargo spacer may be placed on the bottom electrode, followed by dispensing of a cargo droplet directly on top of the cargo space. Thenanostraw well may then be placed down on top of the cargo spacer to thereby uniformly fill and spread the cargo droplet down into any vacant space between the bottom electrode and bottom side of the nanostraw well. Use of the cargo spacer can facilitate maintaining a uniform distance between the nanostraw membrane and the bottom electrode across the nanostraw well insert while maintaining direct fluidic contact. Use of the cargo spacer may also avoid undesired cargo displacement out from under a nanostraw well insert when placed directly down onto a flat bottom electrode. In some embodiments, the miRNA modulator is diluted in a suitable buffer to a volume sufficient to achieve delivery of the miRNA modulator uniformly across the nanostraw well. In some instances, the suitable buffer is acidic. In some instances, the suitable buffer is an acidic phosphate buffer. In some embodiments, a suitable volume is at least 15 pl, at least 20 pl, or at least 50 pl. In some instances the suitable volume is 16 pl, 17 pl, 18 pl, 19 pl, 20 pl, 21 pl, 22 pl, 23 pl, 24 pl, 25 pl, 26 pl, 27 pl, 28 pl, 29 pl, 30 pl, 31 pl, 32 pl, 33 pl, 34 pl, 35 pl, 36 pl, 37 pl, 38 pl, 39 pl, 40 pl, 41 pl, 42 pl, 43 pl, 44 pl, 45 pl, 46 pl, 47 pl, 48 pl, 49 pl,, or 50 pl.[OHl] The cargo spacer may be comprised of a variety of different materials, thicknesses, mesh weave patterns, shapes, and outer diameters. In some embodiments, the cargo spacer is a circular disk with an outer diameter equivalent to, less than, or greater than that of the outer diameter of the nanostraw wells. In some embodiments, the cargo spacer is a nylon, polyester, or polypropylene mesh material with a weave pattern / style of plain, double, twill square, or Plain Dutch, and open area greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%. In some embodiments, the cargo spacer can be temporarily placed onto the bottom electrode, or permanently or semi-permanently bonded to the bottom electrode or bottom side of the nanostraw well insert. In some embodiments, the cargo space is electrically insulative or conductive, compatible with a hydrogel, and / or hydrophobic or hydrophilic coating. In some embodiments, the cargo spacer may be 2mm thick and utilized with a 15 to 20 microliter cargo droplet. The cargo spacer may have a thickness between 0.1mm and 5mm (e.g. between 0.1 mm and 0.5 mm, 0.5 mm and 2 mm, and 1 mm and 5 mm).
[0112] In some embodiments, the miRNA modulator is added at 10 pM to 100 pM to 150,000 myeloid cells per well. For example, in some embodiments the miRNA modulator is added at 20 pM-200 pM to 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at 50 pM-500 pMto 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at least at 20 pM, 30 pM, 40 pM, 50 pM, 60 pM, 70 pM, 80 pM, 90 pM, 100 pM, 110 pM, 120 pM, 130 pM, 140 pM, 150 pM, 160 pM, 170 pM, 180 pM, 190 pM, or 200 pM to 150,000 myeloid cells per well. In some embodiments, the miRNAmodulator is added at 500 pM-1 nM to 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at 750 pM-2 nM to 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at 2 nM-5 nM to 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at 5 nM-100 nM to 150,000 myeloid cells per well. In some embodiments, the miRNA modulator is added at a concentration of 1 pM-100 pM per 150,000 myeloid cells per well.
[0113] Transfection of the miRNA modulator comprises applying a square-wave electrical pulse width of 200 microseconds at a pulse frequency of 40 Hz using 20 V to 50 V. The total duration of the pulse sequence may be 1 to 600 seconds (e.g., the net time with a pulse may be 20 to 120 seconds, 25 seconds to 100 seconds, 30 seconds and 80 seconds, 40 seconds and 60 seconds, etc.). After nanostraw electro-injection, the cells are promptly removed from the nanostraw well for subsequent downstream processes. In some embodiments, prompt removal of the myeloid cells facilitates optimal cell health and recovery. In some embodiments, cells are removed from the nanostraw well within 5 minutes, removed within 10 minutes, or removed within 15 minutes of the completion of nanostraw electro-injection.
[0114] In some embodiments, the one or more cells are cultured in the nanostraw well insert or are removed from the nanostraw device and cultured using conventional in vitro cell culturing apparatuses. In some embodiments, the one or more cells are removed from the nanostraw device for cell, molecular, or biochemical analysis. In some embodiments, the one or more cells are removed from the nanostraw device and are prepared for administration to a subject.
[0115] Regardless of the method used to introduce miRNA modulator into a myeloid cell (such as a monocyte or M-MDSC) or otherwise expose a myeloid cell (such as a monocyte or M-MDSC) to the miRNA modulator of the present invention, in order to confirm the presence of the miRNA sequence in the myeloid cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as quantitative reverse transcription-polymerase chain reaction (RT-PCR) assays, such as TaqMan miRNA assays (e.g., available from ThermoFisher Scientific), other amplication methods (e.g., hybridization chain reaction, exponential amplification reaction, rolling cycle amplification), microarray analysis, next-generation sequencing analysis (such as miRNA sequencing (miRNA-seq) and small RNA-sequencing (Small RNA-seq), hybridization assays (in situ or solution), nanostructured biosensors and nanopore-based single molecule detection, Northern blotting (e.g., using locked nucleic acid (LNA)-modified oligonucleotide probes); “biochemical” assays, such as detecting the presence or absence of a particular protein, e.g., byimmunological means (flow cytometry, ELISAs, Western blots, duplex-specific nuclease (DSN) assay) or by assays described herein to identify agents falling within the scope of the invention. Exemplary methods are also described in Martino, 2023.4. Preparation for administration
[0116] As described further in Section C of this disclosure, the transfected myeloid cells may then be administered to a subject. The transfected myeloid cells may be washed in preparation for administration to the subject. In one example, cells are centrifuged at 1500 rpm for 5 minutes in phosphate-buffered saline, followed by removal of the supernatant. To prepare the transfected myeloid cells for administration, the cells can be suspended in suitable solution or buffer, such as, e.g., phosphate-buffered saline. More details on compositions and administration are provided in Sections B and C of this disclosure. Once the cells are ready for administration, they may be maintained, for example, at 4 °C on ice or on a CoolRack module. Within the subject, the transfected myeloid cells, with the miRNA modulator of interest, differentiate into anti-tumor macrophages.B. Compositions
[0117] Another aspect of the present disclosure are isolated transfected myeloid cells (such as monocytes or M-MDSCs) produced according to any of the embodiments described herein.
[0118] Another aspect of the present disclosure is pharmaceutical composition comprising a population of transfected myeloid cells (such as monocytes or M-MDSCs) produced according to any of the embodiments described herein and a pharmaceutically acceptable carrier.
[0119] The transfected myeloid cells of the present disclosure are suitable for administration in vivo as part of a pharmaceutically acceptable composition comprising a carrier or delivery vehicle (such as a liquid, for example, such as phosphate-buffered saline prepared in a research lab). A pharmaceutically acceptable carrier (excipient) is a material that is not biologically or otherwise undesirable, z.e., the material is administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained. The carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject. The compositions may further comprise a diluent, solubilizer, emulsifier, preservative, and / or adjuvant to be used with the methods disclosed herein. Such compositions can be used, for example, in a subject with a neurologic disease or disorder, aninflammatory disease or inflammation, cancer, or non-cancerous malignancy that would benefit from any of the myeloid cells (such as monocytes or M-MDSCs) as described herein.
[0120] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy, 22ndEdition, Lloyd V. Allen, Jr., ed., The Pharmaceutical Press (2014). In certain embodiments, acceptable formulation materials preferably are nontoxic to recipients at the dosages and concentrations employed. In certain embodiments, the formulation material(s) are for subcutaneous and / or intravenous administration. In certain embodiments, the formulation comprises an appropriate amount of a pharmaceutically-acceptable salt to render the formulation isotonic. In certain embodiments, the pharmaceutical composition can contain formulation materials for modifying, maintaining, or preserving, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. In certain embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen- sulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta- cyclodextrin); fillers; monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants. In certain embodiments, the optimal pharmaceutical composition is determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format and desired dosage. See, for example, Remington, ibid.
[0121] In certain embodiments, the pharmaceutical composition can be selected for parenteral delivery (e.g., through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebral, intraventricular, intramuscular, subcutaneous, intra-ocular, intraarterial, intraportal, or intralesional routes). Preparations for parenteral administration can be in the form of a pyrogen-free, parenterally acceptable aqueous solution ( / .<., water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media) comprising a transfected myeloid cell (such as a monocyte or M-MDSC) in a pharmaceutically acceptable vehicle. Preparations for parenteral administration can also include non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives are optionally present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. In certain embodiments, the preparation can involve the formulation of the desired molecule with an agent, such as injectable microspheres, bio-erodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads or liposomes, that can provide for the controlled or sustained release of the product which can then be delivered via a depot injection. In certain embodiments, hyaluronic acid can also be used, and can have the effect of promoting sustained duration in the circulation. In certain embodiments, implantable drug delivery devices can be used to introduce the desired molecule.
[0122] Another aspect of the present disclosure is an isolated anti-tumor macrophage derived from transfected myeloid cell (such as a monocyte or M-MDSC) of the present disclosure.C. Treatment with Transfected Myeloid Cells
[0123] Another aspect of the present disclosure is directed to methods of treating a subject in need thereof comprising, administering to the subject, a therapeutically effective amount of a pharmaceutical composition comprising a population of transfected myeloid cells (such as monocytes or M-MDSCs) produced according to any of the embodiments described herein and a pharmaceutically acceptable carrier. In some embodiments, the monocytes or M-MDSCs are allogenic cells or autologous cells.
[0124] As used herein, the term, “subject,” “individual,” and “patient” are used interchangeably and refer to an animal. In some embodiments, the subject is a mammal, such as a human, non-human primate, rat, mouse, dog, cat, cow, pig, sheep, goat or horse. In particular embodiments, the subject is a human. “A subject in need thereof’ refers to a subject that is suffering from or at risk for a disease or condition. In some embodiments, the disease or condition is a solid tumor, which can be benign, pre-malignant or malignant. In some embodiments, the disease or condition is a hematologic pre-malignancy or malignancy. In some embodiments, the disease or condition is autoimmune or inflammatory in nature and can be systemic or organ-specific.
[0125] Treat,” “treatment,” and the like are used herein to generally mean obtaining a desired pharmacologic and / or physiologic effect. “Treating,” “treatment,” and the like may refer to any indicia of success in the treatment or amelioration of a disease, such as cancer, an auto-immune disease, or an inflammatory condition. Treating or treatment of these diseases / conditions refers to ameliorating the disease / condition in a subject or any one or more symptoms thereof. The term ameliorating refers to any therapeutically beneficial result in the treatment of the disease / condition, lessening in the severity or progression, promoting remission or durations of remission, or curing thereof. Thus, treating or treatment includes ameliorating at least one physical parameter or symptom. Treating or treatment includes modulating the disease / condition, either physically (e.g., stabilization of a discernible symptom) or physiologically (e.g., stabilization of a physical parameter) or both. For example, “treating” or “treatment” with respect to cancer includes the administration of an agent to impede growth of a cancer, to do one or more of the following: cause a cancer to shrink by weight or volume (i.e., shrink from a first weight or volume to a second weight or volume, wherein the second weight or volume is less than the first), delay or prevent metastasis, extend the expected survival time of the subject, or extend the expected time to progression of the tumor, or the like. Thus, in the disclosed methods, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in an established disease or condition or symptom of the disease or condition. For example, a method for treating a cancer, an autoimmune disease, or inflammatory condition in a subject by administering a pharmaceutical composition as described in this disclosure is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease / condition in a subject as compared to a control subject. Thus, the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels of one or more symptoms. The effect of treatment can be compared to anindividual or pool of individuals not receiving the treatment, or to the same patient prior to treatment or at a different time during treatment. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease / condition or symptoms of the disease / condition.
[0126] The transfected myeloid cells (such as monocytes or M-MDSCs) can be administered to a subject by absolute numbers of cells, e.g., said individual can be administered from about 1000 cells / inj ection to up to about 10 billion cells / inj ection, such as at about, at least about, or at most about, IxlO8, IxlO7,IxlO3, 5*103(and so forth) transfected myeloid cells (such as monocytes or M-MDSCs)per injection, or any ranges between any two of the numbers, end points inclusive. Therefore, this disclosure also provides a composition comprising a plurality of transfected myeloid cells (such as monocytes or M-MDSCs), wherein the number of cells are IxlO8, l><107, 5xl07, IxlO6, 5xl06, IxlO5, 5xl05, IxlO4, 5xl04, IxlO3, or 5xl03(and so forth).
[0127] In some embodiments, the total dose may be calculated by m2of body surface area, including about IxlO11, IxlO10, IxlO9, IxlO8, IxlO7, per m2, or any ranges between any two of the numbers, end points inclusive. The average person is about 1.6 to about 1.8 m2. In a preferred embodiment, between about 1 billion and about 3 billion transfected monocytes or M-MDSC cells are administered to a patient. In other embodiments, the amount of transfected monocytes or M-MDSC cells injected per dose may calculated by m2of body surface area, including IxlO11, IxlO10, IxlO9, IxlO8, IxlO7, per m2. The average body surface area for a person is 1.6-1.8 m2. In other embodiments, said individual can be administered from about 1000 cells / inj ection / m2to up to about 10 billion cells / inj ection / m2, such as at about, at least about, or at most about, lxl08 / m2, lxl07 / m2, 5xl07 / m2, lxl06 / m2, 5xl06 / m2, lxl05 / m2, 5xl05 / m2, lxl04 / m2, 5xl04 / m2, lxl03 / m2, 5xl03 / m2(and so forth) transfected myeloid cells (such as monocytes or M-MDSCs)per injection, or any ranges between any two of the numbers, end points inclusive.
[0128] In other embodiments, transfected myeloid cells (such as monocytes or M-MDSCs) can be administered to such individual by relative numbers of cells, e.g., said individual can be administered about 1000 cells to up to about 10 billion cells per kilogram of the individual, such as at about, at least about, or at most about, IxlO8, IxlO7, 5xl07, IxlO6, 5xl06, IxlO5, 5xl05, IxlO4, 5xl04, IxlO3, or 5xl03(and so forth) transfected myeloid cells (such as monocytes or M-MDSCs) per kilogram of the individual, or any ranges between any two of the numbers, end points inclusive. In other embodiments, transfected myeloid cells (such as monocytes or M-MDSCs) can be administered to such individual by relative numbers of cells,e.g., said individual can be administered about 1000 cells to up to about 10 billion cells per kilogram of the individual, such as at about, at least about, or at most about, l*108, IMO7, 5xio7, Ixio6, 5*106, l*105, 5*105, l*104, 5*104, l*103, or 5*103(and so forth) transfected monocytes or M-MDSC cells per kilogram of the individual, or any ranges between any two of the numbers, end points inclusive.
[0129] Transfected monocytes or M-MDSC cells can be administered once to a patient with cancer or they can be administered multiple times, e.g., once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours, or once every 1, 2, 3, 4, 5, 6 or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks during therapy, or any ranges between any two of the numbers, end points inclusive.1. Cancer
[0130] One aspect of the present application is a method of treating cancer in a patient in need thereof comprising administering the miRNA modulator-transfected myeloid cells (monocytes or M-MDSCs) described herein.
[0131] Another aspect of the present application is directed to a method of reducing PD-L1 expression on anti-tumor macrophages differentiating from monocytes or M-MDSCs transfected with a miRNA modulator described herein.
[0132] Another aspect of the present application is directed to a method of targeting BCL2 protein on anti-tumor macrophages differentiating from monocytes or M-MDSCs transfected with a miRNA modulator described herein.
[0133] Another aspect of the present application is directed to a method of modulating proteins targeted by a miRNA of interest, such as, e.g., CD206 and / or CD163, on anti-tumor macrophages deriving from the monocytes and M-MDSCs transfected with a miRNA modulator described herein targeting the miRNA of interest.
[0134] In some embodiments, the cancer is a solid tumor or hematologic malignancy. In some embodiments, the solid tumor is benign, pre-malignant or malignant.
[0135] In some embodiments, the benign tumor is an ossifying fibromyxoid tumor, perivascular epitheloid cell tumor, lymphangioleiomyomatosis, angiomyolipoma, sugar cell tumor, giant cell tumor of tendon sheath and pigmented villonodular synovitis, myoepithelial tumors of soft tissue, or glomus tissue tumor.
[0136] In some embodiments, the pre-malignant or malignant tumor is a sarcoma, such as a rhabdomyosarcoma, Ewing sarcoma, desmoplastic round cell tumor, gastrointestinal stromal tumor, liposarcoma, leiomyosarcoma, undifferentiated pleomorphic sarcoma, synovialsarcoma, peripheral nerve sheath tumor, desmoid tumor, solitary fibrous tumor, hemangiopericytoma, fibrosarcoma, vascular sarcoma, epithelioid sarcoma, alveolar soft part sarcoma, clear cell sarcoma, melanoma, or extraskeletal myxoid chondrosarcoma.
[0137] In some embodiments, the pre-malignant or malignant tumor is a carcinoma, such as ductal carcinoma in situ, invasive ductal carcinoma, adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, or transitional cell carcinoma.
[0138] In some embodiments, the hematologic malignancy is a leukemia, such as chronic lymphocytic leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, or acute myeloid leukemia. In some embodiments, the hematologic malignancy is a lymphoma. In some embodiments, the hematologic malignancy is a myeloma.
[0139] In some embodiments, the is also treated with anti-cancer a co-therapy. Exemplary anti-cancer co-therapies include an anti-tumor antibody, a small molecule therapeutic, a checkpoint inhibitor, radiation, or a chemotherapeutic agent to the patient. The subject may also be treated with surgery to remove the cancer. The anti-cancer co-therapy may be administered to the subject before, concomitantly with, and / or after administration of the transfected myeloid cells as provided in this disclosure.
[0140] As referred to herein, a chemotherapeutic agent is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include erlotinib (such as TARCEVA®, Genentech / OSI Pharm.), bortezomib (such as VELCADE®, Millenium Pharm.), fulvestrant (such as FASLODEX®, AstraZeneca), sutent (such as SU11248, Pfizer), letrozole (such as FEMARA®, Novartis), imatinib mesylate (such as GLEEVEC®, Novartis), PTK787 / ZK222584 (Novartis), oxaliplatin (such as Eloxatin®, Sanofi), 5 -fluorouracil (5-FU), leucovorin, rapamycin (also known as sirolimus) (such as RAPAMUNE®, Wyeth), lapatinib (such as TYKERB®, GSK572016, GlaxoSmithKline), lonafamib (such as SCH 66336), sorafenib (such as BAY43-9006, Bayer Labs.), capecitabine (such as XELODA®, Roche), docetaxel (such as TAXOTERE®), and gefitinib (such as IRESSA®, Astrazeneca), AG1478, AG1571 (such as SU 5271; Sugen Inc.), alkylating agents such as thiotepa and cyclosphosphamide (such as CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancrati statin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, particularly calicheamicin yi1and calicheamicin Oi1); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (such as ADRIAMYCIN®, including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5 -fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; antiadrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; Trametes Versicolor polysaccharide-K (Krestin, PSK) (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2', 2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; cytarabine (cytosine arabinoside, “Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel (such as TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N. J.), ABRAXANE™ (a Cremophor-free, albumin-engineerednanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, IL)), and doxetaxel (such as TAXOTERE®, Rhone-Poulenc Rorer, Antony, France); chloranbucil; gemcitabine (such as GEMZAR®); 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine (such as NAVELBINE®); novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluorometlhylomithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0141] Chemotherapeutic agents, as used herein, also refers to (i) anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX® tamoxifen), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY 117018, onapristone, and toremifene (such as FARESTON®); (ii) aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate (such as MEGASE®), exemestane (such as AROMASIN®), formestanie, fadrozole, vorozole (such as RIVISOR®), letrozole (such as FEMARA®), and anastrozole (such as ARIMIDEX®); (iii) anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); (iv) aromatase inhibitors; (v) protein kinase inhibitors; (vi) lipid kinase inhibitors; (vii) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (viii) VEGF receptor and angiogenesis inhibitors (including ribozymes such as ANGIOZYME®) and a HER2 expression inhibitor; (ix) vaccines such as gene therapy vaccines, for example, ALLOVECTIN-7® vaccine (plasmid / lipid complex containing the DNA sequences encoding HLA-B7 and 132 microglobulin), LEUVECTIN® vaccine (plasmid DNA expression vector encoding interleukin-2 (IL-2) complexed with a lipid delivery vehicle (DMRIE / DOPE)), and VAXID® vaccine (patient-specific naked DNA vaccine); IL-2 or aldesleukin (such as PROLEUKIN®); topoisomerase 1 inhibitors (such as TOPOTECAN®); gonadotropinreleasing hormone antagonists (such as ABARELIX®); (x) anti-angiogenic agents such as bevacizumab (such as AVASTIN®, Genentech); and (xi) pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0142] In some embodiments, the treatment methods provided herein may further comprise administering an immunosuppressive agent such as an immune checkpoint inhibitor as part ofthe method. These treatments work by “taking the brakes off’ the immune system (are immunosuppressive), allowing it to mount a stronger and more effective attack against cancer. Several different types of checkpoint inhibitors, targeting different checkpoints or “brakes” on immune cells, are currently in use. Immune checkpoint proteins that may be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuator (BTLA), CCL5, CD27, CD38, CD8A, CMKLR1, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, also known as CD152), CXCL9, CXCR5, glucocorticoid-induced tumor necrosis factor receptor-related protein (GITR), HLA-DRB 1, ICOS (also known as CD278), HLA-DQA1, HLA-E, indoleamine 2,3 -dioxygenase 1 (IDO1), killer-cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAG-3, also known as CD223), Mer tyrosine kinase (MerTK), NKG7, 0X40 (also known as CD134), programmed death 1 (PD-1), programmed death-ligand 1 (PD-L1, also known as CD274), PDCD1LG2, PSMB 10, ST A Tl, T cell immunoreceptor with 1g and ITIM domains (TI GIT), T-cell immunoglobulin domain and mucin domain 3 (TIM-3), and V-domain 1g suppressor of T cell activation (VISTA, also known as C10orf54). In particular, the immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4. Exemplary immunosuppressive agents are PD-1 inhibitors (such as nivolumab and pembrolizumab), PD-L1 inhibitors (such as atezolizumab, durvalumab, and avelumab), and CTLA-4 inhibitors (such as ipilimumab). In one example, the second form of cancer therapy comprises a PD-L1 inhibitor, a PD-1 inhibitor, or a CTLA4 inhibitor. In some instances, combinations of such inhibitors can be administered. In some instances, the PD-L1 inhibitor, the PD-1 inhibitor, and / or the CTLA4 inhibitor may be an inhibitory antibody that binds specifically to PD-L1, PD-1, or CTLA4, respectively.
[0143] In some instances, the treatment methods provided herein may further comprise administering radiation therapy to the subject. Radiation therapy uses high-energy radiation to shrink tumors and kill cancer cells. X-rays, gamma rays, and charged particles are types of radiation used for cancer treatment. The radiation may be delivered by a machine outside the body (external -beam radiation therapy), or it may come from radioactive material placed in the body near cancer cells (internal radiation therapy, also called brachytherapy). Systemic radiation therapy uses radioactive substances, such as radioactive iodine, that travel in the blood to kill cancer cells.2. Autoimmune Disease and Inflammatory Conditions
[0144] Another aspect of the present application is a method of treating an autoimmune disease or inflammatory condition in a patient in need thereof comprising administering the miRNA modulator-transfected myeloid cells (monocytes or M-MDSCs) described herein.
[0145] In some embodiments, the autoimmune disease is a systemic autoimmune disease. Examples of systemic autoimmune diseases include, but are not limited to, systemic lupus erythematosus, multiple sclerosis, rheumatoid arthritis, scleroderma, Sjogren’s syndrome, polymyositis, and polymyalgia rheumatica.
[0146] In some embodiments, the autoimmune disease is an organ-specific autoimmune disease. Examples of organ-specific autoimmune diseases include, but are not limited to, Addison’s disease, autoimmune hepatitis, celiac disease, Crohn’s disease, type 1 diabetes mellitus, Grave’s disease, Guillan-Barre syndrome, Hashimoto’s thyroiditis, and myasthenia gravis.
[0147] In some embodiments, the subject is also treated with an inflammatory co-therapy. For example, the co-therapy can be a steroid, an anti-inflammatory drug (such as an anti -turn or necrosis factor (TNF) medication, a nonsteroidal anti-inflammatory drug (NS AID), a plasma exchange (to remove problematic antibodies), intravenous immune globulin (IVIg), or other appropriate therapy.Exemplary Embodiments
[0148] Listed hereafter are non-limiting examples of certain embodiments of the technology. As used below, any reference to a series of embodiments is to be understood as a reference to each of those embodiments disjunctively (e.g., "Embodiments 1-4" is to be understood as "Embodiments 1, 2, 3, or 4").
[0149] Embodiment 1. A method for generating anti -tumor macrophages from myeloid cells, the method comprising: providing isolated myeloid cells from a first subject, the isolated myeloid cells comprising at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs); transfecting the isolated myeloid cells with a miRNA modulator to produce transfected myeloid cells; and administering the transfected myeloid cells into a second subject, the transfected myeloid cells differentiating into anti -tumor macrophages in the second subject.
[0150] Embodiment 2. The method of embodiment 1, wherein the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
[0151] Embodiment 3. The method of embodiment 1 or 2, wherein the miRNA modulator targets at least one miRNA in Table 8 or Table 9.
[0152] Embodiment 4. The method of any one of embodiments 1-3, wherein the miRNA modulator targets at least one of miR15-a, miR16-l, miR51 l-3p, miR181c, or miR9-2.
[0153] Embodiment 5. The method of any one of embodiments 1-4, wherein the miRNA modulator downmodulates at least one of miR15-a, miR16-l, or at least one miRNA listed in Table 8
[0154] Embodiment 6. The method of any one of embodiments 1-4, wherein the miRNA modulator upmodulates at least one miRNA listed in Table 9.
[0155] Embodiment 7. The method of any one of embodiments 1-6, wherein the miRNA modulator is not incorporated into a plasmid or viral vector.
[0156] Embodiment 8. The method of any one of embodiments 1-7, wherein the transfection is by electroporation.
[0157] Embodiment 9. The method of any one of embodiments 1-8, wherein the electroporation is nanostructure-mediated physical delivery.
[0158] Embodiment 10. The method of embodiment 9, wherein the nanostructure-mediated physical delivery comprises delivery of the miRNA modulator into the isolated myeloid cells using nanostraws.
[0159] Embodiment 11. The method of embodiment 9 or 10, wherein the method comprises placing the nanostraws comprising the isolated myeloid cells therein on top of a cargo spacer comprising the miRNA modulator prior to the nanostructure-mediated physical delivery.
[0160] Embodiment 12. The method of any one of embodiments 1-11, wherein the isolated myeloid cells are isolated from peripheral blood mononuclear cells (PBMCs) from the first subject.
[0161] Embodiment 13. The method of embodiment 12, wherein the isolation of the isolated myeloid cells from PBMCs is by magnetic bead separation and / or fluorescence-assisted cell sorting (FACS).
[0162] Embodiment 14. The method of any one of embodiments 1-13, wherein the first subject and the second subject are the same subject.
[0163] Embodiment 15. The method of any one of embodiments 1-13, wherein the first subject and the second subject are the not the same subject.
[0164] Embodiment 16. A method for treating a solid tumor or hematologic malignancy in a subject in need thereof, the method comprising: performing steps (a)-(c) of any one of embodiments 1-15, wherein the subject in need of treatment is the second subject.
[0165] Embodiment 17. The method of embodiment 16, wherein the hematologic malignancy is chronic lymphocytic leukemia (CLL).
[0166] Embodiment 18. The method of embodiment 16 or 17, further comprising administrating an anti-cancer a co-therapy to the subject.
[0167] Embodiment 19. A method for treating an autoimmune disease in a subject in need thereof, the method comprising: performing steps (a)-(c) of any one of embodiments 1-15, wherein the subject in need of treatment is the second subject.
[0168] Embodiment 20. The method of embodiment 19, wherein the autoimmune disease is systemic lupus erythematosus, rheumatoid arthritis, or multiple sclerosis.
[0169] Embodiment 21. The method of embodiment 19 or 20, further comprising administrating an inflammatory co-therapy to the subject.
[0170] Embodiment 22. An in vitro method for transfecting isolating myeloid cells with a microRNA modulator, the method comprising: providing isolated myeloid cells from a first subject, wherein the isolated myeloid cells are at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs); and transfecting the isolated myeloid cells with a microRNA modulator using nanostructure-mediated physical delivery to produce transfected myeloid cells.
[0171] Embodiment 23. The method of embodiments 22, wherein the miRNA modulator is not incorporated into a plasmid or viral vector.
[0172] Embodiment 24. The method of embodiment 22 or 23, wherein the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
[0173] Embodiment 25. A transfected cell produced by the method of any one of embodiments 22-24.
[0174] Embodiment 26. The transfected myeloid cell of embodiment 25 in combination with a pharmaceutically acceptable carrier.
[0175] Embodiment 27. A method comprising: inserting a cargo spacer over an electrode within a well; applying a solution comprising a liquid cargo on the electrode; inserting isolated cells and a nanostraw membrane into the well so that the nanostraw membrane is uniformly spaced at a distance above the electrode while maintaining the location of the liquid cargo directly underneath the nanostraw membrane; and applying energy to the electrode to perform nano-electroinjection using nanostraws.
[0176] Embodiment 28. The method of embodiment 27, wherein the cargo spacer is a mesh cargo spacer.EXAMPLES
[0177] The following examples are offered to illustrate, but not to limit, the claimed invention. The experiments described in the Examples below are also described in Zhang, R. et al., Blood Cancer Journal, Vol. 14, Article 168 (2024) (available at www.nature.com / articles / s41408-024-01142-3#Secl6) (referred to herein as “Zhang, 2024”) and in U. S. Provisional Patent Application Serial No. 63 / 710,421, filed October 24, 2024 and U. S. Provisional Patent Application Serial No. 63 / 710,547, filed October 24, 2024 (referred to herein as the “Provisional Applications”), all of which are incorporated in their entirety herein in this disclosure for all purposes.EXAMPLE 1, MATERIALS AND METHODS
[0178] The following materials and methods were used to perform the experiments described in the subsequent Examples. Reference also may be made to the data, for example in the figures, disclosed in Zhang et al. or the Provisional Applications.
[0179] Cells and reagents. MEC1 cell line is a CD5low / ' CLL cell line established from a CLL patient in prolymphocytoid transformation to B-cell prolymphocytic leukemia (B-PLL). It was obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DMSZ, Braunschweig, Germany) and cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum and gentamicin (15 pg / mL; Sigma-Aldrich, St. Louis, MO, USA). MEC1 cell line regularly tested negative for Mycoplasma contamination.
[0180] Primary Cells. Human primary samples were obtained from patients with CLL (all Rai stages) referred to the Leukemia Department at The University of Texas MD Anderson Cancer Center with the approval of MD Anderson’s Institutional Review Board (protocol LAB04-0678; NCT02756897 phase 2 trial (Jain et al., 2021)) and, in accordance with the Declaration of Helsinki. Written informed consent was obtained from the donors. The clinical and biological features of the patients analyzed are described in Tables 1 and 2. All patients were either untreated or off therapy for at least 8 months before the beginning of the study. Frozen human peripheral blood mononuclear cells (PBMCs) from healthy donors (50-59 years old, 3 females and 3 males) were purchased from STEMCELL Technologies (Vancouver, Canada).
[0181] Mice. All mice were housed and bred in specific pathogen-free animal facilities at IRCCS San Raffaele Hospital and at MD Anderson Cancer Center. Depending on the animal experiment, mice were treated in accordance with European Union guidelines and with theapproval of the IRCCS San Raffaele Hospital’s Institutional Ethical Committee (protocols 601 and 726) or with the approval of the Institutional Animal Care and Use Committee of MD Anderson Cancer Center (protocol 00001627-RN02) and conducted in accordance with the Animal Welfare Act, the Guide for the Care and Use of Laboratory Animals, and the Public Health Service (PHS) Policy. For detailed information on immunocompetent mice and related genotype, xenograft and TCL1 -related transplantation studies.
[0182] Rag2' / 'gc' / ' mice on a BALB / c background were kindly provided by CIEA or purchased from Taconic (Rensselaer, NY, USA). E -TCLl transgenic mice were kindly provided by Dr. Byrd (The Ohio State University, Columbus, OH) and by Dr. Chiorazzi (Feinstein Institutes for Medical Research, New York). MISTRG mice were kindly provided by Regeneron (Tarrytown, NY). MISTRG mice are on the Rag2' / 'gc' / ‘ background and carry genes encoding human M-CSF, human IL-3 and GM-CSF, human TPO and a BAC -transgene encoding human SIRP-a (Rongvaux et al., 2014).
[0183] Mice that constitutively carry a deletion of the dLeu2 gene and MiR- 15a MiR- 16-1 cluster, here referred to as MDR" ' mice, were kindly provided by Dr. Klein and Dr. Dalla-Favera (Columbia University, New York), and wild-type C57BL / 6 mice were supplied by Taconic. Homozygous E -TCLl mice (referred as TCLltg / tg, background strain C57BL / 6) were crossed with MDR ' mice (background strain C57BL / 6) and TCLltg / wtMDR " (referred as TM), TCLltg / wtMDR"1"l(referred as TCLltg / wt), TCLlwt / wtMDR"1"1(referred as WT) were used for the experiments (F2 progeny). Mice were genotyped for the hTCLl transgene or the MDR allele by PCR-based screening assay as previously described (Bertilaccio et al., 2011; Klein et al., 2010).
[0184] Xenograft studies. For gene expression profiling studies, eight-week-old Rag2‘ ' gc'Amale mice were challenged intravenously (i.v., day 0) with 10xl06MEC1 cells in 0.1 mL of saline through a 27-gauge needle, as described (Bertilaccio et al., 2010). Mice were monitored once a week for weight and were euthanized at early stage of leukemia (days 21) or at late stage of leukemia (day 31). For gene expression profiling analysis, BM cells were flushed from mice femurs for the magnetic separation of monocytes / macrophages.
[0185] For patient-derived xenograft (PDX) and miRNA mimic studies, eight- week-old MISTRG female mice were injected i.v. with patient-derived monocytes and M-MDSCs in 0.1 mL of saline through a 27-gauge needle. Xeno-transplanted mice were euthanized 30h or one week after the injection depending on the experiment.
[0186] Gene expression profiling analysis. hCD19- cells from murine bone marrow (BM) of Rag2- / -yc- / - mice xeno-transplanted with MEC1 cells were secondarily enriched formonocytes / macrophages by depletion of T, NK, dendritic cells, progenitors, granulocytes and red blood cells using the Easysep negative selection monocyte enrichment kit on an EasySep Magnet (STEMCELL Technologies, Vancouver, Canada), following the manufacturer’s instructions. RNA extraction was performed using a RNeasy Mini Kit (QIAGEN, Hilden, Germany).
[0187] The total RNA concentration was assessed using a Qubit RNA High Sensitivity Assay (Invitrogen, Life Technologies, Waltham, MA, USA). Once the sample concentration was determined, the integrity of the Total RNA was assessed using the Agilent 2100 Bioanalyzer Pico Assay (Agilent Technologies, Santa Clara, CA, USA). Samples with a concentration under 33 ng / pl were selected for target amplification with the GeneChip Whole Transcript (WT) Pico Reagent Assay (ThermoFisher Scientific, Waltham, MA, USA).
[0188] 4.5 nanograms of total RNA input were used to process the samples for whole transcriptome expression analysis with the GeneChip WT Pico Reagent assay (ThermoFisher Scientifc). The samples were reverse transcribed to generate amplified, fragmented and biotinylated sense-strand cDNA, according to manufacturer’s standard protocol. The fragmented and labeled sscDNA (5.2 pg) was then hybridized to the mouse Affymetrix GeneChip Clariom D array at 45°C for 16 hours, washed and stained using the ThermoFisher proprietary reagents in the GeneChip Fluidics Station 450 (FS450), and scanned at the GeneChip Scanner 30007G (ThermoFisher Scientific).
[0189] CEL files generated after the GeneChip microarrays scanning were uploaded onto the Expression Console software for analysis with SST-RMA algorithm (ThermoFisher)).
[0190] Standard expression microarray analysis consisted of normalizing the signal intensity distributions of all probe features on all arrays. A probe feature is a location on the array that contains many copies of the same 25-mer DNA sequence. Normalizing these distributions enabled the comparison of probe signals between groups. Next, the signal intensities for all probes in a probe set that defined a gene or exon were aggregated into a single value for each array or sample. The aggregate signal value was used to compare gene-level or exon-level expression changes between sample groups or conditions. The SST-RMA analysis algorithm incorporated pre-processing steps into the CEL files before normalization and summarization with RMA. This algorithm reduced fold change compression by applying a GC correction and by transforming the microarray data signal to a similar signal space of other methods such as RT-PCR or RNA-Seq. Differential expressed mRNAs in a comparative analysis were further identified by analysis of variance(eBay) with a p-value less than 0.05 and a fold change more than 1.1 or less than -1.1. Data analysis was performed through theTranscriptome Analysis Console (TAC) 3.0 software program (Thermo Fisher Scientific, Inc.) using default settings and SST-RMA as summarization. Average fold-change values were calculated using Tukey’s bi-weight average algorithm in log2 scale (“Bi. weight. Avg. Signal. Iog2”). Fold Change for each transcript was defined by the algorithm 2[Conditionl Bi-weight Avg Signal (log2) - Condition2 Bi-weight Avg Signal (log2)] comparing condition 1 versus condition 2 in linear space.Table 1: Clinical and Biological Feature of CLL PatientsCLL ImmunePatient Notes Age, Se WBC Treatment Clinical diagnosis suppression / Multiplerlol, no. year x course (,yearv) - in ffect*ions cancers faAr / Ui Ions % # MS1 IBT 78 M 42.4 PRIOR RX progressive 2012 N / A 1. DLBCL N / A M Trisomy12 & Del(13q) intolerant2 83 M 44.5 Unt stable 1985 No excessive I. Cancerof NEG N / A Del(13q)infections paratiroid gland2. Squamous cellcarcinoma3 (started IBT 80 F 222.8 Unt progressive 2009 N / A N / A POS U Trisomy12 day after ourstudy: 2017- 0039protocol4 71 M 24.8 Unt stable 2007 Immune N / A NEG M Trisomy12suppression(monthly IVIG)5 Pt started 49 M 81.4 Unt progressive 2010 chronic sinusitis N / A NEG U Del(11q) Ven in the (monthly IVIG)followingmonths6 69 F 48.3 Unt stable 2016 No N / A NEG M Del(13q) 7 61 F 82.6 Unt stable 2010 N / A Breast cancer N / A U Trisomy 12 *36 Apheresis 70 F 253.9 Unt progressive 2015 history of N / A U Del(13q) Del(17p) one month pneumoniabefore ourstudy,due toincreasedWBC*42 Relapse 56 M 5.8 PRIOR RX progressive 2007 viral pneumonia N / A N / A M Del(17p) Trisomy12 (after IBT / Ven)Relapse 65 M 220.1 PRIOR RX progressive 2008 N / A N / A NEG U Trisomy1257 F 311.7 Unt progressive 2016 N / A N / A N / A M Del(13q) Del (11 q) 52*46 51 M 13.0 Unt progressive 2015 No N / A POS U NEG *x6868 F 252.2 Unt progressive 2003 N / A N / A NEG M Del(13q) iBT, ibrutinib; Pt: patient; Ven, venetoclax; iVIG, intravenous immunoglobulin therapy for patients with antibody deficiencies and immunosuppression; NEG, negative; POS, positive; DLBCL, diffuse large B-cell lymphoma; Del, deletion; WBC, white blood cell count; IGHV MS, immunoglobulin heavy chain variable mutation status (M, mutated; U: unmutated); FISH, fluorescence in situ hybridization; PRIOR RX, prior therapies; Unt, untreated; N / A, not available; ‘Patients enrolled in investigator-initiated phase 2 trial NCT02756897 IBT+ Ven; color-coded symbols refer to Figures 7-8; Determined by flow cytometry.Table 2: Clinical and Biological Feature of CLL PatientsCLL ImmunePatient Notes Age, Sex WBC Treatment Clinical diagnosis suppression / Multiple ZAP70 _ f / KsHV i1IoOLn1(year) infections cancers % #no. years course MS386 fresh 69 F 84.3 Unt stable 2010 N / A N / A NEG M N / A 654 fresh 55 M 27.2 Unt progressive 2018 N / A N / A N / A U N / A 732 fresh 53 M 24.6 Unt stable 2016 N / A N / A N / A M Del(13q) 413 fresh 69 M 45.2 Unt stable 2014 Covid-19 Prostate N / A M Del(13q) infections in 2020 adenocarcinomaand 2022 (2004-2015)680 frozen 71 F 46.1 Unt stable 2012 N / A N / A N / A M N / A 915 frozen 75 M 33.9 Unt stable 2007 Sinusitis (IVIG N / A N / A U Trisomy12 treatment)181 fresh 71 M 49.0 Unt stable 2007 Covid-19 N / A N / A M Del(13q) infectionsresolved 6 monthsbefore370 frozen 70 F 37.2 Unt stable 2013 N / A N / A NEG M Del(13q) 967 fresh 87 M 18.4 PRIOR RX stable 1985 Pneumonia 1. Prostate NEG N / A Del(13q)6 months adenocarcinomabefore 2. Squamous cellcarcinoma3. Cancer ofparatiroid glandIVIG, intravenous immunoglobulin therapy for patients with antibody deficiencies and immunosuppression; NEG, negative; POS, positive; Dei, deletion; WBC, white blood cell count; IGHV MS, immunoglobulin heavy chain variable mutation status (M, mutated; U: unmutated); FISH, fluorescence in situ hybridization;
[0191] Murine cell preparations and flow cytometry. Peripheral blood (PB), spleen (SP), and femurs were collected from mice, and cells were isolated. Erythrocytes from bone marrow (BM), SP and PB samples were lysed by incubation in ammonium chloride solution (ACK) lysis buffer (NH4Q 0.15 M, KHCO3 10 mM, Na2 / ethylenediaminetetraacetic acid 0.1 mM, pH 7.2-7.4) for 5 min at room temperature. After blocking of fragment crystallizable (Fc) receptors with Fc block (BD Biosciences, San Jose, CA, USA) for 10 minutes at room temperature, cells from PB, BM and SP were stained with the antibodies (15 min. at 4°C) listed in Table 3 and Table 4. Cells were analyzed with a BD LSRFortessa X-20 flow cytometer and data analyzed with FCS Express 6 Flow-Cytometry software. Ten-color flow cytometry phenotype analyses of live myeloid cell singlets and 13 -color flow cytometry phenotype analyses of live lymphoid cell singlets were performed using an LSRFortessa X-20 (BD Biosciences, San Joce, CA) with the antibodies described in Table 3 and Table 4. To develop the multi-color flow cytometry panels, antibody-capture beads (UltraComp eBeads Invitrogen, Waltham, MA, USA) were used for single-color compensation controls. A Live / Dead Fixable Aqua Dead Cell Stain Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used first to gate out dead cells. Further gating adjustments were made based on fluorescence-minus-one (FMO) controls.
[0192] Absolute cell numbers were obtained by multiplying the percentage of the cells by the total number of splenocytes, mesenteric lymph nodes, peritoneal cells, and BM cells flushed from 1 femur and tibiae.
[0193] TCLl-transgenic transplantation studies. Eight-week-old male syngeneic immunocompetent C57BL / 6 mice were challenged intraperitoneally (i.p., day 0) with 10xl06cells purified from the spleen of leukemic male E -TCLl transgenic mice using the EasySep mouse B-cell enrichment kit (STEMCELL Technologies, Vancouver, BC, Canada). The purity of the transplanted CD19+CD5+IgK+cells was assessed by flow cytometry. Mice were monitored weekly for weight and leukemia development using flow cytometric analysis of PB samples. Mice were i.v. injected with murine monocytes / macrophages purified from the BM of MDR- / - mice, when the frequency of CD19+CD5+leukemic cells in the PB was 60-70%, compared with C57BL / 6 wild-type mice. Mice were monitored weekly for weight and leukemia progression by flow cytometric analysis of the PB samples and, humanely euthanized at day 91. PB, and organs (SP, femoral BM) were collected and analyzed.
[0194] Reverse-phase protein array (RPPA) assay. Functional proteomics reverse phase protein array (RPPA) was performed at the Functional Proteomics Reverse Phase Protein Array Core Facility at MD Anderson.
[0195] Leukemic cells were purified from the spleen of MDR- / -, TM, TCLltg / wtMDR111"'1and TCL Iwl wlMDR111"'1mice using an EasySep mouse B-cell enrichment kit (STEMCELL Technologies, Vancouver, BC, Canada). The purity of the CD19+cells was assessed using flow cytometry.
[0196] Cells were lysed with ice-cold lysis buffer (1% Triton X-100, 50mM HEPES, pH 7.4, 150mM NaCl, 1.5mM MgC12, ImM EGTA, lOOmM NaF, lOmM Na pyrophosphate, ImM Na3VO4, 10% glycerol) containing freshly added protease and phosphatase inhibitors (Roche Applied Science). Proteins were denatured in sodium dodecyl sulfate containing P-mercaptoethanol. Lysates were serially diluted and printed on nitrocellulose-coated plates to produce sample spots (Grace Bio-Labs) at the Functional Proteomics Reverse Phase Protein Array Core Facility at MD Anderson Cancer Center.
[0197] Sample spots were probed with 485 antibodies using a tyramide-based signal amplification approach and were visualized by DAB colorimetric reaction to produce stained slides. Stained slides were scanned on a Huron TissueScope scanner to produce 16-bit tiff images. Sample spots in the tiff images were identified, and their densities were quantified using an Array -Pro Analyzer 6.3. The relative protein levels for each sample were determined by interpolating each dilution curve produced from the densities of the 5-dilution sample spotsusing a "standard curve" (SuperCurve) for each slide (antibody). The superCurve was constructed using a script in R. Relative protein levels were designated as log2 values. All relative protein level data points were normalized for protein loading and transformed to linear values. Differentially expressed proteins (log2(x+l) transformed) between groups were identified using the moderated t-test from LIMMA package. The level of significance was set to a p-value less than 0.05 and a fold-change in absolute value equal or greater to 1.1. In order to visualize differently expressed proteins, heatmaps of unsupervised hierarchical clustering were generated.
[0198] Human cell flow cytometry and cell sorting. After blood withdrawal, flow cytometry phenotype analysis and fluorescence-activated cell sorting of human live myeloid cells and of human live lymphoid cells were performed using LSRFortessa X-20 and BD FACS Aria II (BD Biosciences) instruments, respectively. Flow cytometry data were analyzed with FCS Express 6 Flow Cytometry software. Antibodies are described in Tables 5-7.
[0199] PBMCs were first incubated with LIVE / DEAD fixable Aqua dye; then, after the blocking of Fc receptors, the cells were stained with the surface antibodies described in Table 5 and Table 6. Finally, the cells were incubated with ammonium chloride solution (STEMCELL Technologies) to lyse the red cells. For lymphoid cell Foxp3 detection, surface-stained cells were further fixed and permeabilized using a Treg detection Kit (Miltenyi Biotec, Bergisch Gladbach, Germany) and finally stained with an anti-Foxp3 antibody. For macrophage cell detection in PDX studies, cells were stained with the antibodies described in Table 7. For CD68 and BCL2 detection, surface-stained cells were further fixed and permeabilized using the IntraPrep permeabilization kit (Beckman Coulter, Brea, CA, USA).
[0200] For the miRNA studies, live myeloid cells were isolated using 4-way fluorescence-activated cell sorting on a BD FACS Aria II (BD Biosciences), after surface staining with the following antibodies: Alexa Fluor 700 mouse anti-human CD66b (G10F5), APC mouse antihuman Lineage Cocktail (CD3 / CD19 / CD20 / CD56; UCHTI, HIB19, 2H7, 5.1H11), Brilliant Violet 786 mouse anti-human CD14 (McpP9) purchased from BD Biosciences, PE mouse antihuman CD 16 (3G8) purchased from Biolegend (San Diego, CA, USA), and APC-Cy7 mouse anti-human HLA DR (L243).
[0201] Live lymphoid cells were isolated using 4-way fluorescence-activated cell sorting on a BD FACS Aria II after surface staining with the following antibodies: eFluor 450 mouse anti-human CD8a (SKI) purchased from eBiosciences (Waltham, MA, USA), PerCP mouse anti-human CD45RO (UCHL1) purchased from Biolegend, PE-Cy7 mouse anti -human CD45RA (L48) purchased from BD Biosciences, Brilliant Violet 605 mouse anti-humanCD62L (DREG-56), PE-Dazzle 594 mouse anti-human CD4 (SK3), PE mouse anti-human CD25 (4E3) purchased from Milteny Biotec, APC mouse anti-human CD19 (J3-119) purchased from Beckman Coulter, FITC mouse anti-human CD 127 (HIL-7R-M21) purchased from BD Biosciences. Live / Dead Fixable Aqua staining (Thermo Fisher Scientific) was first performed to allow the discrimination of Live / Dead cells. Flow cytometry phenotype analysis and fluorescence-activated cell sorting of human live myeloid cells and of human live lymphoid cells were performed using LSRFortessa X-20 and BD FACS Aria II (BD Biosciences) instruments, respectively. Flow cytometry data were analyzed with FCS Express 6 Flow Cytometry software. Antibodies are described in Tables 5-7.
[0202] RNA extraction and Taqman assay on human cells. RNA extraction from sorted myeloid and lymphoid cells was performed using a Mini Kit (QIAGEN, Hilden, Germany). RNA sample quality and quantity checks (QC) were performed using an Agilent RNA 6000 Pico Assay (Agilent Technologies, Santa Clara, CA, USA).
[0203] The total RNA was isolated from cells using a Qiagen RNeasy Plus Micro Kit. The quantity of total RNA was measured using Qubit and ND- 1000. The Quality of the total RNA was checked using an Agilent 2100 Bio-analyzer. Mature miRNAs were detected and quantified using TaqMan MicroRNA assays (Life Technologies, Carlsband, CA, USA). cDNA was reverse transcribed from the total RNA samples using specific miRNA primers from the TaqMan MicroRNA assays and reagents from the TaqMan® MicroRNA Reverse Transcription Kit (Life Technologies). In the PCR step, PCR products were amplified from cDNA samples using the TaqMan MicroRNA Assay together with the TaqMan® Universal PCR Master Mix (Life Technologies). RT reactions and qRT-PCR were performed with TaqMan miRNA assays for hsa-miR-15a and hsa-miR-16 (Life Technologies), as previously described (Van Roosbroeck et al., 2019). U6 was used as the endogenous control for miRNA expression. The relative expression levels of / ?z / 7?-l 5a and miR-16-1 were calculated using the 2-ΔΔCtmethod.
[0204] NanoStraw (NS) intracellular delivery. Pools of monocytes and M-MDSCs separated by fluorescent-activated cell sorting from PBMCs of patients with CLL, were transfected with either human miR-15a-5p (“Hsa-miR-15a”, UAGCAGCACAUAAUGGUUUGUG (SEQ ID NO: 1)) or human miR-16-l-3p (“Hsa-miR-16-l-3p”, CCAGUAUUAACUGUGCUGCUGA (SEQ ID NO: 2)) mirVana miRNA mimic (ThermoFisher Scientific, Waltham, MA, USA). / iwVana miRNA mimic negative control (Thermofisher Scientific) was used as negative control for both miRNA mimics.
[0205] A prototype NS-delivery system (prototype NAV8; Navan Technologies, San Carlos, CA, USA) was used to deliver miRNA mimics into patient-derived cells, as previously described (Pop et al., 2021; Schmiderer et al., 2020). NS-technology was selected for rapid (<15 min), direct intracellular delivery based on demonstrated gentleness and precision with human primary cells (Pop et al., 2021; Schmiderer et al., 2020).
[0206] After sorting, patient-derived myeloid cells were seeded at 150,000 cells per NS-well in 300 pl of RPMI medium and 10% FBS. The NS-wells were centrifuged at 600 ref x 5 min, then miRNA mimics were added at 50pM in the delivery buffer in the cargo droplet. Intracellular delivery was performed using a low electric field for ~1 min to effect transient plasma membrane pore formation and cargo mobilization through the NS. After delivery, cells were either analyzed for viability by flow cytometry or injected into MISTRG mice. Total RNA was also extracted from each sample to evaluate miRNA expression levels using Taqman analysis.
[0207] Statistical analysis. The statistical analysis of the data was performed using GraphPad Prism 9.0 Software. Data were expressed as means ± standard deviations (SDs), and comparison of curves or differences between experimental groups were assessed with an unpaired, 2-tailed Student t test (95% confidence interval) and considered statistically significant for -value less than 0.05. The comparison of survival curves was performed using the log-rank test.
[0208] The outliers at end points were never excluded. The numbers of biological and technical replicates for each experiment are detailed in the figure legends. All the experiments were repeated independently and are described in the figures and figure legends. The investigators were not blinded when assessing the analyses of the experimental outcomes.
[0209] Data sharing statement. Microarray data are available at GEO under accession number GSE224048.
[0210] Clinical Trial data sharing. The NCT02756897 phase 2 trial information is available at clinicaltrials.gov.Table 3: Anti-Murine Antibodies Used for Flow Cytometry, Lymphoid Cell PanelTable 4: Anti-Murine Antibodies Used for Flow Cytometry, Myeloid Cell PanelTable 5: Anti-Human Antibodies Used for Flow Cytometry, Lymphoid Cell PanelTable 6: Anti-Human Antibodies Used for Flow Cytometry, Myeloid Cell PanelTable 7: Anti-Human Antibodies Used for Flow Cytometry, Macrophage PanelEXAMPLE 2, TRANSCRIPTOME ANALYSIS OF MYELOID CELLS EXPOSED TO LEUKEMIC CELLS IN A CLL-XENOGRAFT SYSTEM
[0211] Immune cells of the myeloid lineage and CLL cells support each other during leukemia progression and dissemination (Galletti et al., 2016). The molecular interactions supporting this cell-cell interdependence were investigated with a special focus on ncRNAs, whose role in nonmalignant immune cells is largely unknown.
[0212] A mouse Affymetrix Clariom D assay and Transcriptome Analysis Console (TAC) 3.0 software was employed to perform a broad transcriptome-gene- and exon-level analysis of coding and ncRNA isoforms in different stages of leukemia (day 21, early stage; day 31, latestage leukemia) in Rag2' / 'yc' / ' mice xeno-transplanted with MEC1 cells (Fig. 1A). As shown in Fig. 1B, a significant enrichment of both upregulated and downregulated ncRNAs was observed. A complete summary of the ncRNA found to be downmodulated in myeloid cells from xeno-transplanted mice at late stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia was evaluated (data not shown; see Table S8 of Zhang, 2024). A complete summary of the ncRNA found to be upmodulated in myeloid cells from xeno-transplanted mice at late stage leukemia compared to myeloid cells from xeno-transplanted mice at early-stage leukemia was evaluated (data not shown; see Table S9 of Zhang, 2024).
[0213] MiRNAs miR-511-3p, miR-181c, miR-9-2 and the long ncRNAs (IncRNAs) HOX transcript antisense RNA 4 (HOTAIR 4) and HOX antisense intergenic RNA myeloid 1 (HOTAIRM!) were found upregulated in murine myeloid cells during leukemia progression (Table 8)Table 8: Upregulated Non-coding RNAs of Interest
[0214] ROCK2, a direct target of miR-511-3p (Squadrito et al., 2012), and DLEU2 / miR-16-1, which are on the same gene cluster that maps the human chromosome 13ql4 region, were found downmodulated in murine myeloid cells during leukemia progression (Table 9).Although the deletion of 13ql4 is the most frequent genetic lesion in CLL cells, miR-15a / miR-7d-7-mediated regulation of non-malignant myeloid cells has not been characterized. The MDR includes the first exon of the DLEU1 ncRNA, the deleted in leukemia (DLEU) 2 gene, encoding for a primary transcript, and the miR-15a / miR-16-l cluster, which is located in an intron of DLEU2. It was previously reported that DLEU2 transcript is downregulated in myeloid cells isolated from the BM of MECl-xenotransplanted mice at early stage of leukemia development compared with myeloid cells from age-matched, wild-type (WT), untransplanted mice (Galletti et al., 2016). It has been previously demonstrated that miR-16-1 regulates macrophage protumor activation and polarization through the critical immune suppressor molecule PD-L1 (Jia et al., 2016; Liang et al., 2016). Recent findings have also demonstrated that myeloid cells are required for PD1 / PD-L1 checkpoint activation (Zhang et al., 2017) and that PD-L1 expression can be induced in protumor and immunosuppressive cell types of the myeloid lineage (Prima et al., 2017).
[0215] The findings described herein corroborate the hypothesis that DLEU2 / miR-15a / miR-16-l has a role in the protumor function of myeloid cells during leukemia progression.Table 9: Downregulated Non-coding RNAs of InterestEXAMPLE 3, THE TCLU’MDR7' MOUSE MODEL OF CLL
[0216] Mice with the germline deletion of the MDR (MDR7'; Klein et al., 2010) were utilized to further explore the hypothesis that DLEU2 / miR-15a / miR-16-l affects the protumor function of nonmalignant myeloid and lymphoid cells during leukemia progression. MDR " mice were crossed with E -TCLl transgenic (tg) mice (Bichi et al., 2002). TCLU', TCLU' MDR7' (TM), MDR ' and WT mice were developed, and their survival was analyzed. The MDR deletion significantly shortened the life spans of the mice (Fig.2A), thus offering a more rapid and reliable model of CLL development. Subsequently, 4- and 9-month-old TCLU', TCLU’MDR7’, MDR7' and WT mice (n=6-10 mice / group) were characterized. By using multi-color flow cytometry, the accumulation of CD19+CD5+leukemic cells and key molecules (e.g., BCL2) potentially involved in the miR-15a / miR- 16-1 -mediated control of cell proliferation and differentiation were analyzed. An increase of CD19+CD5+leukemic cells in the spleen (SP) of 4-month-old TCLU’MDR7’ mice correlated with the upregulation of BCL2 (Figs. 2B-2C) The splenic CD19+CD5+leukemic expansion and BCL2 upregulation were exacerbated in 9-month-old TCLU’MDR7’ mice (Figs.2D-2E). The same trend was observed in the peripheral blood (PB) and bone marrow (BM), but it did not reach statistical significance due to the heterogeneity of the mice (Figs. 8A-8H).
[0217] To examine the proteomic profile of the leukemic cells purified from the spleen of leukemic TCLU ’MDR’ ’ mice compared to TCLU' and to MDR’ ’ mice, reverse-phase protein array (RPPA) high-throughput technology (Figs. 2F-2H) was employed. Several components of the BCR and PI3K / AKT signaling pathways (e.g., PKCa, Lyn, ERK1 / 2, JNK2)(Bresin A, et al., 2016) were found upregulated in the TCL1tg / wtcompared with the MDR ' mice (Fig. 2F).The same signaling pathways were found activated in the TCL1tg / wtMDR ' mice compared to MDR7' mice including the downstream upregulation of the anti-apoptotic protein MCL1, a well-known target of miR-15a / miR-16-l(Calin et al., 2008) (Fig. 2G). Of note, serum- and glucocorticoid-inducible protein kinase 3 (SGK3) was upregulated in the splenic CLL cells of TCLU’MDR7' mice compared with TCLU' and MDR7' mice (Figs. 2G-2H). SGK3, also known as cytokine-independent survival kinase, is a well-known downstream mediator of PI3K oncogenic signaling in various cancers, including breast cancer and ovarian cancer (Dieterle et al., 2014; Lien et al., 2017). SGK3 is involved in cell proliferation, growth, survival, andmigration and is considered an intriguing target for anticancer drug development (Liu et al., 2000; Bruhn et al., 2013) (Fig. 9).
[0218] Overall, the result demonstrates the successful generation of a faster CLL mouse model with two known pro-tumorigenic genes, the hTCLl oncogene and the MDR tumorsuppressor, in the context of a murine immunocompetent microenvironment.EXAMPLE 4, CHARACTERIZATION OF THE IMMUNE CELLS IN THE TCL1+ / -MDR- / - MOUSE MODEL
[0219] To investigate the involvement of miR-15a / miR-16-l in the protumor function of myeloid and lymphoid nonmalignant cells in the leukemic microenvironment during leukemia progression, the lymphoid and myeloid cell populations including lymphocytes, monocytes, macrophages, and monocytic-myeloid derived suppressor cells (M-MDSCs) in the circulation and lymphoid tissues of TCLU’MDR’’ and age-matched control mice were investigated. Key molecules, potentially involved in the miR- 16-1 -mediated control of myeloid cell proliferation and differentiation (e.g., BCL2 and checkpoint molecules PD-1 and PD-L1), were analyzed in 4- and 9-month-old mice. An altered composition of the T lymphocyte population and of the CD4: CD8 T cell ratio was observed in the spleen of 4-month-old mice (Fig. 3A), and a significant increase of the whole pool of CD8+T cells and of CD8+and CD4+memory T cells expressing BCL2 was observed in TCLU’MDR’’ and MDR’ ’ mice compared with TCLU’ and WT mice (Fig.3B-3E). Furthermore, high numbers of PDU CD4+effector memory (TEM) T cells (Fig. 3F) and an increase of potentially regulatory CD4+CD25+T cells expressing BCL2 in TCLU’MDR ’’ were observed when compared with TCLU’ mice (Fig.3G-3H). This aberrant T cell composition was associated with the significant increase of Ly6Clowmonocytes in the circulation, BM, and SP of the 4-month-old TCLU’MDR ’’ mice (Fig. 4A-4G). Ly6Clowmonocytes differentiate into protumor-associated macrophages (TAMs) (Ingersoll MA et al., 2010). Of note, in the SP, a high frequency of protumor TAMs expressing MRC1, BCL2 and PD-L1 (Figs. 4H-5J) was observed. These findings demonstrate that the deletion of the DLEU2 / miR-15a / miR-16-l cluster impacts the myeloid and lymphoid cell compartment at early stage of leukemia development.
[0220] In 9-month-old mice, it was confirmed that there was an altered CD4: CD8 T-cell ratio in the circulation of TCLU ’MDR’ ’ and MDR’ ’ mice with a significant increase of CD8+effector memory TEM cells and of CD8+central memory TCM expressing PD-1 in the SP (Fig.5A-5D). A small cohort of 27-month-old MDR’7’ was included in the study to rule out the possibility of age-related effects in the mice with the germline deletion.
[0221] In addition, an increase in CD19+CD5+leukemic cells was associated with an increased number of BCL2 expressing monocytes in the (PB), BM and SP (Figs. 6A-6F); increased numbers of PD-L1 expressing monocytes in the PB and BM (Figs. 6G-6H); and an increased percentage of protumor F4 / 80+MRC1+macrophages in the PB (Figs. 61-6 J) and SP (Fig. 10)
[0222] To finally demonstrate the cell-autonomous, pro-leukemic activity of monocytes from 13ql4 MDR" ' mice, a TCL1 tg transplantation system was utilized where leukemic cells obtained from the SP of an / LI-TCLI tg mouse were transplanted into syngeneic, immunocompetent recipients. At day 84 post-transplantation, mice were injected intravenously (i.v.) with monocytes purified from the BM of MDR ’ ’ mice. Seven days later, they were killed. As shown in Figs. 11A-11F, a significantly higher frequency of CD19+CD5+leukemic cells was observed in the spleen of mice adoptively transferred with M DR; '-derived monocytes that was accompanied by an increased spleen weight.EXAMPLE 5, MIR- 15 A / MIR- 16-1 IN CLL PATIENT-DERIVED IMMUNE CELLS
[0223] To validate the molecular and functional information gathered from mouse models in human samples, miR-15a / miR-16-l expression was evaluated in human immune cells, including CD19+B cells, CD8+effector and central memory T cells (TEM and TCM), CD4+TREG cells, CD14+CD16++non-classical (NC), CD14++CD16+intermediate (I) and CD14++CD16‘ classical (C) monocytes, and CD14+HLA-DRlow / negmonocytic-myeloid derived suppressor cells (M-MDSCs). Figs. 7A-7B show the expression level of miR-15a and miR-16-1 relative to U6 control on CD19+B cells, T cells, and monocyte subsets separated from fresh peripheral blood mononuclear cells (PBMCs) of a cohort of 7 patient samples from MDACC (cohort 1, patients 1-7; Table 1).
[0224] Finally, as frozen samples became available, the levels of human BCL2 / PD1 / PD-L1 target proteins on immune cells from patients with CLL were analyzed along with the miRNAs and subsequently compared with the levels in age-matched, healthy donor controls (n=6; Fig. 7C-7L; additional data not shown; see Published Applications). This set of patient samples includes sub-cohort 1A within cohort 1 (Table 1, patients 1, 2, 3) and 3 patients enrolled into the investigator-initiated phase 2 trial NCT02756897 (Jain et al., 2021) with BTK inhibitor ibrutinib (IBT) and the BCL2 inhibitor venetoclax (Ven) (Table 1, patients 51, 52, 68). The immune cell composition of patients treated with IBT / Ven was longitudinally investigated in a larger cohort of patients, including the 3 patients mentioned in regard to Fig.7, and is described in Figs.13A-13I. Low levels of miR-15a / miR-16-l and high levels of BCL2 protein have been observed in B cells and immune cells from patients with CLL and from healthy donor controls (Fig. 7C-7F, while increasing levels of PD1 / PD-L1 checkpoint molecules were observed in immune cells from patients with CLL compared with healthy donor controls (Figs. 7E-7F; additional data not shown; see Published Applications). As expected, in patients with CLL the majority of cells expressing BCL2 were B cells (Fig. 7F).
[0225] To mechanistically evaluate the involvement of miR-15a / miR-16-l in the differentiation of monocytes into macrophages and ultimately their protumor immunophenotype, a patient-derived xenograft (PDX) system was established in the humanized MISTRG mice. This strain particularly facilitates the engraftment of human innate immune cells including monocytes (Rongvaux et al., 2014). When adoptively transferred into MISTRG mice, patient-derived monocyte subsets and M-MDSCs differentiate in vivo into tumor-associated macrophages. This was observed by first isolating CD14+CD16++non classical (NC), CD14++CD16+intermediate (I), and CD14++CD16-classical (C) monocytes and CD14+HLADRlow / M-MDSCs from PBMCs of patients 386, 654, and 732 (Table 2) and then injecting them into MISTRG mice. The percentage of CD68+macrophages originating from monocytes and M-MDCs is shown in Table 10, below.Table 10: Expression of both CD163 and CD206 by human CD68+macrophages in the peripheral blood of MISTRG mice transplanted with monocytes and M-MDSCs.
[0226] NanoStraw technology was employed (Pop et al., 2021, Schmiderer et al., 2020) to transfect patient derived monocytes and M-MDSCs Fig. 14 (Additional data not shown, See Fig. 14B-14C of Provisional Applications) with either miR-16-1 or miR-15a mimics. For example, CD14+CD16++non classical (NC), CD14++CD16+intermediate (I), and CD14++CD16' classical (C) monocytes and CD 14+HL ADRlow / M-MDSCs were characterized before mimic NanoStraw delivery. The monocyte populations in sample915 were roughly 1.41%NC,65.71% I, 24.28% C, and 5.92% M-MDSCs (Data not shown; see Fig. 15 of Provisional Applications). BCL2 expression was found in 97.78% of NC monocytes, 99.08% of I monocytes, 98.21% of C monocytes, and 99.15% of M-MDSCs. Similarly, in sample 915, high expression of PD-L1 was observed in NC monocytes (47.41%), I monocytes (52.14%), C monocytes (48.76%), and M-MDSCs (100%). When the expression of miR-16-1 was forced on a pool of monocytes and M-MDSCs from 3 patients with CLL (Table 2, patients 413, 680, 915) and macrophages were analyzed in MISTRG mice (Figs. 7M-7O), a downregulation of BCL2 / PD-L1 related target proteins together with a downmodulation of TAM protumor markers including CD 163 and CD206 was observed (Fig. 7O; additional data not shown; see Fig. 7J of Provisional Applications). For example, the percentage of macrophages from sample 915 expressing BCL2 and PD-L1 target proteins isolated from MISTRG mice post treatment with a control miRNA mimic was 7.53 and 4.39, respectively. Whereas the percentage of macrophages from sample 915 expressing BCL2 and PD-L1 target proteins isolated from MISTRG mice post incubation with miR-16-1 mimic was 3.66% and 1.96 %, respectively. A similar trend was observed in CD163 and CD206 expressing macrophages (e.g., a decrease in expression from 4.47% and 7.38% to 1.47% and 4.94%, respectively; data not shown; see Fig.7J of Provisional Applications).
[0227] As patient-derived monocyte subsets and M-MDSCa differentiate in vivo into tumor-associated macrophages, this programming was exploited to transfect the patient derived monocytes and MDSCs with a miR mimic control. The monocyte population in sample 915 was roughly 3.19% NC, 46.40% I, 40.58% C, and 11.59% M-MDSCs (Data not shown, See Fig. 16 of Provisional Applications). Furthermore, expression of BCL2 and PD-L1 proteins were evaluated in each subpopulation. BCL2 expression was found in 98.75% of NC monocytes, 99.44% of I monocytes, 98.88% of C monocytes, and 98.75% of M-MDSCs. Similarly, high expression of PD-L1 was observed in NC monocytes (49.69%), I monocytes (55.42%), C monocytes (53.75%), and M-MDSCs (100%).
[0228] As patient-derived monocyte subsets and M-MDSCa differentiate in vivo into tumor-associated macrophages, this programming was exploited to transfect the patient derived monocytes and MDSCs with a miR-16-1 mimic. The monocyte population in sample 915 was roughly 3.81% NC, 49.95% I, 37.62% C, and 12.3% M-MDSCs (Data not shown, See Fig.17A of Provisional Applications). Furthermore, expression of BCL2 and PD-L1 proteins were evaluated in each subpopulation. BCL2 expression was found in 95.54% of NC monocytes, 99.18% of I monocytes, 99.76% of C monocytes, and 98.64% of M-MDSCs (Data not shown, See Fig. 17C of Provisional Applications). Similarly, high expression of PD-L1 was observedin NC monocytes (60.10%), I monocytes (65.02%), C monocytes (66.20%), and M-MDSCs (100%) (Data not shown, See Fig. 17D of Provisional Applications).
[0229] The regulation on macrophages was not induced by the forced expression of miR-15a (Fig. 15A). Specifically, miR-15a mimic was evaluated in a similar experiment as the miR-16-1 mimic discussed above. In brief, MISTRG mice were adoptively transferred on day 0 with a pool of monocytes and M-MDSCs (i.v.: 200,000-541,000 cells depending on the patient, including NC, I, C monocyte subsets and M-MDSCs) separated using fluorescence-activated cell sorting from the PBMCs of patients 181, 370, and 967 (Table 2) and transfected for 15 minutes with 50 pM of either miR-15a mimic or mimic control. Mice were euthanized after 7 days for analysis of patient-derived macrophages. miR15-a expression relative to U6 control in the myeloid cell pools (including NC, I, C monocytes and M-MDSCs) separated from PBMCs of CLL patients (n=3, see Table S2 of Zhang, 2024) and then transfected with miR-15a miRNA mimic (miR-15a mimic), with mimic control (mimic control) or left untreated (Unt) is shown in FIG. 15B. The percentage of macrophages expressing BCL2 and PD-L1 target proteins increased in mice treated with miR-15a when compared to the mimic control (Fig. 15C). A similar trend was observed in all three patients for CD 163 and CD206 (Fig.15C)
[0230] Overall, the findings confirmed the previous evidence on miR-15a / miR-16-l on B and T cells, and the study was the first to investigate the role of miR-15a / miR-16-l cluster on human monocyte subsets, M-MDSCs and macrophages. It was successfully demonstrated that human monocyte subsets and M-MDSCs have low expression levels of miR-15a / miR-16-l and express BCL2 and PD-L1. And further, it was demonstrated that forced expression of miR-16-1 mitigates the protumor immunophenotype of monocyte-derived macrophages.EXAMPLE 6, ADOPTIVE TRANSFER OF HUMAN LEUKEMIC CELLS INTO IMMUNODEFICIENT MICE
[0231] MISTRG mice intravenously (i.v.) injected with MEC1 cells (day 0) were adoptively transferred (AT) on day 11 with monocyte subsets (including NC, I, C monocytes) and M-MDSCs separated using fluorescence-activated cell sorting from the PBMCs of patients 107, 881, Oil, 953 and NS-transfected for 15 min with 50pM of either miR-16-1 miRNA mimic or miRNA mimic control. Two mice in each cohort (miR-16-1 miRNA mimic or control mimic) received myeloid cells from every patient sample (total number of mice in each cohort, n=8). Survival is ongoing. Preliminary Kaplan-Meier survival curve (updated to day 53) is represented in Fig. 16.
[0232] Two of the eight (2 / 8) mice in the miRNA mimic control cohort survived through day 53. In comparison, five of the eight (5 / 8) mice in the miR-16-1 miRNA mimic cohort survived through day 53. However, one mouse was found prematurely dead in the miR-16-1 miRNA mimic cohort (injected with cells from pt 881). This mouse did not have signs of leukemia, but it was noted to be smaller in body size since birth than the other mice in the cohort. The mouse was found beheaded in the cage and it is believed that the cause of death might be related to aggressiveness by the larger mice or other factors.References• Baneijee P, et al. Trabectedin Reveals a Strategy of Immunomodulation in Chronic Lymphocytic Leukemia. Cancer Immunol Res. 2019;7(12):2036-51.• Bertilaccio MT, et al. A novel Rag2- / -gammac- / — xenograft model of human CLL. Blood. 2010;! 15(8): 1605-1609.• Bertilaccio MT, et al. Lack of TIR8 / SIGIRR triggers progression of chronic lymphocytic leukemia in mouse models. Blood. 2011;118(3):660-669.• Bertilaccio MTS, et al. In vitro assay to study CLL and monocyte interactions.Methods Mol Biol. 2019; 1881:113-119.• Bichi R, et al. Human chronic lymphocytic leukemia modeled in mouse by targeted TCL1 expression. Proc Natl Acad Sci U S A. 2002;99(10):6955-60.• Bresin A, et al. TCL1 transgenic mouse model as a tool for the study of therapeutic targets and microenvironment in human B-cell chronic lymphocytic leukemia. Cell Death Dis. 2016;7:e2071.• Bruhn MA, et al. AKT-independent PI3-K signaling in cancer - emerging role for SGK3. Cancer Manag Res. 2013;5:281-92.• Calin GA, et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q 14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A.2002;99(24): 15524-9.• Calin GA, et al. A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med. 2005;353(17): 1793-801.• Calin GA, et al. MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008; 105(13):5166-71.• Dieterle AM, et al. PDK1 controls upstream PI3K expression and PIP3 generation. Oncogene. 2014;33(23):3043-53.• Dohner H, et al. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med. 2000;343(26): 1910-6.• Frankel LB, et al. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008;283(2): 1026-1033.• Forconi F, Moss P. Perturbation of the normal immune system in patients with CLL. Blood. 2015;126(5):573-81.• Galletti G, et al. Targeting Macrophages Sensitizes Chronic Lymphocytic Leukemia to Apoptosis and Inhibits Disease Progression. Cell Rep. 2016; 14(7): 1748-60.• Ghafouri-Fard S, et al. Deleted in lymphocytic leukemia 2 (DLEU2): An IncRNA with dissimilar roles in different cancers. Biomed Pharmacother. 2021; 133: 111093.• Griffiths-Jones S, et al. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006;34(Database issue): D140-144.• Griffiths-Jones S, et al. miRBase: tools for microRNA genomics. Nucleic Acids Res.2008;36(Database issue): D154-158.• Ingersoll MA, et al. Comparison of gene expression profiles between human and mouse monocyte subsets. Blood. 2010;115(3):el0-9.• Jain N, et al. Ibrutinib Plus Venetoclax for First-line Treatment of Chronic Lymphocytic Leukemia: A Nonrandomized Phase 2 Trial. JAMA Oncol. 2021;7(8): 1213-9.• Jia X, et al. MiR-16 regulates mouse peritoneal macrophage polarization and affects T-cell activation. J Cell Mol Med. 2016;20(10):1898-907.• Klein U, et al. The DLEU2 / miR-15a / 16-l cluster controls B cell proliferation and its deletion leads to chronic lymphocytic leukemia. Cancer Cell. 2010;17(l):28-40.• Kozomara A, Griffiths-Jones S. miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011;39(Database issue): D152-157.• Lagasse E, Weissman IL. Enforced expression of Bcl-2 in monocytes rescues macrophages and partially reverses osteopetrosis in op / op mice. Cell. 1997;89(7): 1021-31.• Lennox KA, et al. Improved performance of anti-miRNA oligonucleotides using a novel non-nucleotide modifier. Mol Ther Nucleic Acids. 2013;2(8):ell7.• Li W, et al. A Human Long Non-Coding RNA ALT1 Controls the Cell Cycle of Vascular Endothelial Cells Via ACE2 and Cyclin DI Pathway. Cell Physiol Biochem.2017;43(3): 1152-67.• Liang X, et al. MicroRNA- 16 suppresses the activation of inflammatory macrophages in atherosclerosis by targeting PDCD4. Int J Mol Med. 2016;37(4):967-75.• Liang P, et al. CRISPR / Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 2015 May;6(5):363-372.• Lien EC, et al. PI3K signaling in cancer: beyond AKT. Curr Opin Cell Biol.2017;45:62-71.• Lima, LF et al., Anti-miRNA oligonucleotides: A comprehensive guide for design. RNABiol. 2018 Mar 4; 15(3):338-352• Liu Y, et al. Cloning of two candidate tumor suppressor genes within a 10 kb region on chromosome 13ql4, frequently deleted in chronic lymphocytic leukemia. Oncogene. 1997;15(20):2463-73.• Liu D, et al. Identification of CISK, a new member of the SGK kinase family that promotes IL-3 -dependent survival. Curr Biol. 2000; 10(19): 1233-6.• Maffei R, et al. The monocytic population in chronic lymphocytic leukemia shows altered composition and deregulation of genes involved in phagocytosis and inflammation. Haematologica. 2013;98(7):l 115-23.• Martino S, et al. microRNA Detection via Nanostructured Biochips for Early Cancer Diagnostics. Int JMol Sci. 2023 Apr 24;24(9):7762.• Mitsunobu H, Teramoto J, Nishida K, Kondo A. Beyond Native Cas9: Manipulating Genomic Information and Function. Trends Biotechnol. 2017 Oct;35(10):983-996.• Mumtaz S, et al. Design of liposomes for circumventing the reticuloendothelial cells. Glycobiology. 1991 Nov;l(5):505-10.• Pop MA, Almquist BD. Controlled Delivery of MicroRNAs into Primary Cells Using Nanostraw Technology. Adv Nanobiomed Res. 2021;l(6):2000061.• Prima V, et al. COX2 / mPGESl / PGE2 pathway regulates PD-L1 expression in tumor-associated macrophages and myeloid-derived suppressor cells. Proc Natl Acad Sci U S A. 2017;l 14(5):1117-22.• Rassenti LZ, et al. MicroRNA dysregulation to identify therapeutic target combinations for chronic lymphocytic leukemia. Proc Natl Acad Sci U S A.2017; 114(40): 10731-6.• Renault TT, Chipuk JE. Getting away with murder: how does the BCL-2 family of proteins kill with immunity? Ann N Y Acad Sci. 2013; 1285:59-79.• Rongvaux A, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Biotechnol. 2014;32(4):364-72.• Rose SA, et al. A microRNA expression and regulatory element activity atlas of the mouse immune system. Nat Immunol. 2021;22(7):914-27.• Rossi D, et al. Early stage chronic lymphocytic leukaemia carrying unmutated IGHV genes is at risk of recurrent infections during watch and wait. Br J Haematol.2008;141(5):734-6.• Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 2014 Apr;32(4):347-55.• Scaglione BJ, et al. Murine models of chronic lymphocytic leukaemia: role of microRNA-16 in the New Zealand Black mouse model. Br J Haematol. 2007;139(5):645-57.• Schmiderer L, et al. Efficient and nontoxic biomolecule delivery to primary human hematopoietic stem cells using nanostraws. Proc Natl Acad Sci U S A. 2020;117(35):21267-73.• Simonetti G, et al. Mouse models in the study of chronic lymphocytic leukemia pathogenesis and therapy. Blood. 2014; 124(7): 1010-9.• Souers AJ, et al. ABT- 199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets. Nat Med. 2013;19(2):202-8.• Squadrito ML, et al. miR-511 -3p modulates genetic programs of tumor-associated macrophages. Cell Rep. 2012; 1(2): 141-54.• Squadrito ML, et al. MicroRNA-mediated control of macrophages and its implications for cancer. Trends Immunol. 2013;34(7):350-9.• Strasser A, et al. bcl-2 transgene inhibits T cell death and perturbs thymic selfcensorship. Cell. 1991;67(5):889-99.• Svanberg R, et al. Targeting the tumor microenvironment in chronic lymphocytic leukemia. Haematologica. 2021;106(9):2312-24.• Tay A, Melosh N. Nanostructured Materials for Intracellular Cargo Delivery. Acc Chem Res. 2019 Sep 17;52(9):2462-2471• Van Roosbroeck K, et al. The involvement of microRNA in the pathogenesis of Richter syndrome. Haematologica. 2019; 104(5): 1004-1015.• Veis DJ, et al, Korsmeyer SJ. Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell. 1993;75(2):229-40.• Veis DJ, et al. Expression of the Bcl-2 protein in murine and human thymocytes and in peripheral T lymphocytes. J Immunol. 1993;151(5):2546-54.• Wang Z. The guideline of the.design and validation of MiRNA mimics. Methods Mol Biol. 2011;676:211-23• Zhang Y, et al. Myeloid cells are required for PD-1 / PD-L1 checkpoint activation and the establishment of an immunosuppressive environment in pancreatic cancer. Gut.2017;66(1):124-36.• Zhang, R. et al. The DLEU2 / miR-15a / miR-16-l cluster shapes the immune microenvironment of chronic lymphocytic leukemia. Blood Cancer Journal, Vol. 14, Article 168 (2024), doi: 10.1038 / s41408-024-01142-3.***
[0233] One skilled in the art will readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present disclosures described herein are presently representative of representative embodiments, are exemplary, and are not intended as limitations on the scope of the present disclosure. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the present disclosure as defined by the scope of the claims.
[0234] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references.
Claims
WHAT IS CLAIMED IS:
1. A method for generating anti-tumor macrophages from myeloid cells, the method comprising:(a) providing isolated myeloid cells from a first subject, the isolated myeloid cells comprising at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs);(b) transfecting the isolated myeloid cells with a miRNA modulator to produce transfected myeloid cells; and(c) administering the transfected myeloid cells into a second subject, the transfected myeloid cells differentiating into anti-tumor macrophages in the second subject.
2. The method of claim 1, wherein the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
3. The method of claim 1 or 2, wherein the miRNA modulator targets at least one miRNA in Table 8 or Table 9.
4. The method of claim 1 or 2, wherein the miRNA modulator targets at least one of miR15-a, miR16-l, miR51 l-3p, miR181c, or miR9-2.
5. The method of claim 1 or 2, wherein the miRNA modulator downmodulates at least one of miR15-a, miR16-l, or at least one miRNA listed in Table 8.
6. The method of claim 1 or 2, wherein the miRNA modulator upmodulates at least one miRNA listed in Table 9.
7. The method of claim 1 or 2, wherein the miRNA modulator is not incorporated into a plasmid or viral vector.
8. The method of claim 1 or 2, wherein the transfection is by electroporation.
9. The method of claim 8, wherein the electroporation is nanostructure-mediated physical delivery.
10. The method of claim 9, wherein the nanostructure-mediated physical delivery comprises delivery of the miRNA modulator into the isolated myeloid cells using nanostraws.
11. The method of claim 9, wherein the method comprises placing the nanostraws comprising the isolated myeloid cells therein on top of a cargo spacer comprising the miRNA modulator prior to the nanostructure-mediated physical delivery.
12. The method of claim 1 or 2, wherein the isolated myeloid cells are isolated from peripheral blood mononuclear cells (PBMCs) from the first subject.
13. The method claim 12, wherein the isolation of the isolated myeloid cells from PBMCs is by magnetic bead separation and / or fluorescence-assisted cell sorting (FACS).
14. The method of claim 1 or 2, wherein the first subject and the second subject are the same subject.
15. The method of claim 1 or 2, wherein the first subject and the second subject are not the same subject.
16. A method for treating a solid tumor or hematologic malignancy in a subject in need thereof, the method comprising:performing steps (a)-(c) of claim 1, wherein the subject in need of treatment is the second subject.
17. The method of claim 16, wherein the hematologic malignancy is chronic lymphocytic leukemia (CLL).
18. The method of claim 16 or 17, further comprising administrating an anti-cancer a cotherapy to the subject.
19. A method for treating an autoimmune disease in a subject in need thereof, the method comprising:performing steps (a)-(c) of claim 1, wherein the subject in need of treatment is the second subject.
20. The method of claim 19, wherein the autoimmune disease is systemic lupus erythematosus, rheumatoid arthritis, or multiple sclerosis.
21. The method of claim 19 or 20, further comprising administrating an inflammatory cotherapy to the subject.
22. An in vitro method for transfecting isolating myeloid cells with a microRNA (miRNA) modulator, the method comprising:(d) providing isolated myeloid cells from a first subject, wherein the isolated myeloid cells are at least one of monocytes or monocytic myeloid-derived suppressor cells (M-MDSCs); and(e) transfecting the isolated myeloid cells with a microRNA modulator using nanostructure-mediated physical delivery to produce transfected myeloid cells.
23. The method of claim 22, wherein the miRNA modulator is not incorporated into a plasmid or viral vector.
24. The method of claim 22, wherein the miRNA modulator is a miRNA mimic, anti-miRNA antisense oligonucleotide, or a CRISPR / Cas system component.
25. A transfected myeloid cell produced by the method of any one of claims 22-24.
26. The transfected myeloid cell of claim 25 in combination with a pharmaceutically acceptable carrier.
27. A method comprising:inserting a cargo spacer over an electrode within a well;applying a solution comprising a liquid cargo on the electrode;inserting isolated cells and a nanostraw membrane into the well so that the nanostraw membrane is uniformly spaced at a distance above the electrode while maintaining a location of the liquid cargo directly underneath the nanostraw membrane; andapplying energy to the electrode to perform nano-electroinjection using nanostraws.
28. The method of claim 27, wherein the cargo spacer is a mesh cargo spacer.