BAK1 / BAX knockout in car-t cells, methods, uses, and compositions
By knocking out BAK1 and/or BAX genes in CAR T cells using CRISPR technology, the cells' persistence and therapeutic efficacy are enhanced, addressing the challenge of poor CAR T cell persistence in treating hematologic malignancies.
Patent Information
- Application Number
- PCT/IB2025/061578
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-12
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
Poor persistence of CAR T cells remains a barrier to the widespread adoption of CAR T cell therapy for treating hematologic malignancies, primarily due to activation of BAK1 and BAX leading to mitochondrial outer membrane permeabilization and cell death.
Engineering CAR T cells to knockout BAK1 and/or BAX genes using CRISPR protein-gRNA complexes, specifically targeting exons of these genes to prevent apoptosis and enhance cell persistence.
The engineered CAR T cells demonstrate increased resistance to apoptotic stimuli, leading to improved persistence and therapeutic efficacy against hematologic malignancies.
Smart Images

Figure 00000040_0000 
Figure 00000041_0000 
Figure 00000041_0001
Abstract
Description
MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOBAK1 / BAX KNOCKOUT IN CAR-T CELLS, METHODS, USES, AND COMPOSITIONSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application Serial No.63 / 719,489, filed on November 12, 2024, the disclosure of which is incorporated by reference herein in its entirety.SEQUENCE LISTING
[0002] This application contains a Sequence Listing electronically submitted via EFS-Web to the United States Patent and Trademark Office as an XML file entitled “0680003583W001.xml” having a size of 4,572 bytes and created on November 11, 2025. The information contained in the Sequence Listing is incorporated by reference herein.BACKGROUND
[0003] Over the past half-decade, chimeric antigen receptor (CAR) T cells have established themselves as a novel therapeutic method in certain hematologic malignancies. In particular, CAR T cell therapy has been demonstrated to be quite effective in the treatment of blood cancers such as in B-cell malignancies as well as multiple myeloma. However, poor persistence of CAR T cells remains a barrier to the adoption of this therapy more widely.
[0004] Activation of BAK1 and BAX causes permeabilization of the mitochondrial outer membrane via interaction with BCL-2. Permeabilization of the mitochondrial outer membrane, in turn, causes a release of proapoptotic factors like cytochrome c into the intracellular space, which results in death of the cell.SUMMARY
[0005] There are described CAR T cells, compositions, and methods, wherein CAR T cell persistence is improved by affecting expression of proapoptotic genes such as BAK1 and / or BAXMRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0006] Provided herein is a T cell engineered to express a chimeric antigen receptor (CAR) and engineered not to express BAK1 or BAX, or not to express both BAK1 and BAX.Specifically, provided herein is a T cell that includes: a chimeric antigen receptor (CAR); and a knockout of the BCL2 antagonist / killer 1 gene (BAK1), a knockout of the BCL2 associated X gene (BAX), or both.
[0007] The BAK1 and / or BAX knock-outs can be facilitated by using at least one CRISPR protein-gRNA complex. The one or more protein-gRNA complexes can include Cas9. One protein-gRNA complex may include a gRNA that targets exon 5 of BAKE One protein-gRNA complex may include a gRNA that targets exon 2 of BAX. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1, while the other protein-gRNA complex may include a gRNA that targets exon 2 of BAX.
[0008] The CAR may specifically bind to CD 19. Alternatively, the CAR may specifically bind to EGFR
[0009] A method of producing an engineered T cell is provided. The method includes delivering at least one protein-gRNA complex into the T cell; and delivering a polynucleotide encoding a CAR into the T cell.
[0010] The one or more protein-gRNA complexes can include Cas9. One protein-gRNA complex may include a gRNA that targets exon 5 of BAKE One protein-gRNA complex may include a gRNA that targets exon 2 of BAX. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1, while the other protein-gRNA complex may include a gRNA that targets exon 2 of BAX.
[0011] There is also provided a pharmaceutical composition. The pharmaceutical composition includes: a pharmaceutically acceptable carrier; and a T cell including a CAR and a knockout in at least one proapoptotic gene. The CAR desirably specifically binds to CD 19 or EGFR. The at least one knocked out gene can be BAK1, BAX, or both BAK1 and BAX.
[0012] Methods of treating cancer in a subject are provided. The method includes administering to the subject a pharmaceutical composition that includes: a pharmaceutically acceptable carrier; and a T cell including a CAR and a knockout in at least one proapoptotic gene. The CAR may specifically bind to CD 19 or EGFR. The at least one knocked out gene mayMRGRef: 0680.003583W001DFCI Ref: 3583.W01WObe BAK1, BAX, or both BAK1 and BAX may be knocked out. The cancer may be a blood cancer, such as multiple myeloma or other B cell malignancy.
[0013] The summary of the present disclosure is not intended to describe each disclosed embodiment or every implementation of the present disclosure. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description.
[0015] FIG. 1 shows a BAK1 / BAX double knockout (DKO) CAR T cell production workflow.
[0016] FIG.2 shows the results of the BAK1 and BAX knockouts in non-transduced T cells and CAR T cells. (A) An image of a Western blot. (B) A graphical illustration of the Western blot results in relation to the BAX protein. (C) A graphical illustration of the Western blot results in relation to the BAK protein. (NT: non-targeted; BBko: BAK1 / BAX double knockout).
[0017] FIG.3 shows the results of flow cytometry conducted on knockout CAR T cells and on non-targeted CAR T cells. (A) A graph showing CD4 / CD8 ratios. (B) A plot showing the immunophenotypes. (C) A plot showing PD-1 expression. (NT: non-targeted; BBko:BAK1 / BAX double knockout).
[0018] FIG.4 shows functional outcomes of a knockout of BAX in a CAR T cell. (A) A cytotoxicity assay plot of the T cells. (B) An ELISA plot showing IL-2 and IFN-y production.
[0019] FIG. 5 shows a schematic diagram for the generation of BAK1 / BAX DKO CD 19-CAR T cells.
[0020] FIG.6 shows protein-level validation of BAX-SKO, BAK1 -SKO, and DKO-CAR19 T cells. (A) CRISPR / Cas9 nucleofection protocol was used to knock out BAX and BAK1 genes individually or in combination to create BAX-SKO (single knockout), BAK1SKO or DKO (BAX and BAK1 double knockout) in CAR19 T cells. FIG. 6A shows a Western blot showingMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOthe levels of BAX and BAK protein expression in WT, BAX-SKO, BAK1-SK0 and the DKO-CAR19 T cells. (B) Quantification of BAX levels from the Western blot shown in (A). BAX is 100% knocked out in BAX-SKO cells and in DKO-CAR19 T cells. (C) Quantification of BAK levels from the Western blot shown in (A). BAK is 90% knocked out in BAK1-SKO cells and about 60% knocked out in DKO-CAR19 T cells.
[0021] FIG. 7 shows the sensitivity of single or double knockout T cells to mitochondrial apoptosis and BH3 mimetics. (A) A graph showing cytochrome c loss as a function of Bim peptide treatment. Bim peptide binds to anti-apoptotic proteins to induce mitochondrial outer membrane permeabilization (MOMP) and cytochrome c release. Cytochrome c loss was used as a measure of mitochondrial apoptosis. BAK1-SKO and DKO exhibited a similar reduction in sensitivity to mitochondrial apoptosis indicated by a reduction in the percentage of cells that lost cytochrome c when compared to WT CAR19 T cells. (B) Quantification of the cytochrome C loss shown in (A). (C) A graph showing that SKO, DKO, and WT CAR19 T cells were not sensitive to ABT-263, an inhibitor of anti-apoptotic proteins BCL-2, BCL-xl, and BCL-w. (D) A graph showing that WT CAR19 T cells, but not BAX-SKO, BAK1-SKO, or DKO-CAR19 T cells, were sensitive to AZD5991, an inhibitor of anti-apoptotic protein Mell. (E) A graph showing that WT, BAX-SKO, and BAK1-SKO CAR19 T cells, but not DKO-CAR19 T cells, were sensitive to ABT-263 in combination with AZD5991. Viability was assessed using a CELLTITER-GLO assay.
[0022] FIG. 8 shows a schematic of an example of a nucleofection protocol to knock out BAX and BAK1 followed by CD19 CAR transduction to generate BAX and BAK1 DKO-CAR19 T cells.
[0023] FIG.9 shows Western blot and intracellular flow cytometry staining showing BAX, BAK, and actin (control) levels in Non-Targeting (NT)- CAR19 and DKO-CAR19 T cells. In DKO cells, little to no BAX or BAK protein was detected.
[0024] FIG. 10 shows DKO-CAR19 T cells were resistant to mitochondrial apoptosis and several chemotherapeutic treatments. (A) A graph showing BIM-induced cytochrome c loss in NT-CAR19 and DKO-CAR19 T cells, used to assess sensitivity to mitochondrial apoptosis. Cytochrome c loss was measured using flow cytometry (n=3 donors, quadruplicate technical replicates). (B) The integrated area under each Bim curve from (A). (C) ) Sensitivity of NT-MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOCAR19 and DK0-CAR19 to 24h treatment with ABT-263, cell viability was assessed by CELLTITER-GLO (n=3 donor, duplicate technical replicates). (D) ) Sensitivity of NT-CAR19 and DK0-CAR19 to 24 hour treatment with AZD5991, cell viability was assessed by CELLTITER-GLO (n=3 donor, duplicate technical replicates). (E) ) Sensitivity of NT-CAR19 and DK0-CAR19 to 24 hour treatment with AZD5991 and ABT-263, cell viability was assessed by CELLTITER-GLO (n=3 donor, duplicate technical replicates).
[0025] FIG. 11 shows additional validation that DKO-CAR19 T cells are resistant to mitochondrial apoptosis and retain their antitumor activity. (A) Caspase-3 / 7 activation in NT-CAR19 and DKO-CAR19 T cells following 0.5 hour, 1 hour, 1,5 hour, 2.0 hour and 2.5 hour treatment with ABT-263, AZD5991, or AZD5991 with ABT-263 using a Caspase-Gio assay (n=l donor, triplicate technical replicates). (B) NT- and DKO-CAR19 T cells were treated with dual BH3 mimetics for 3 days (1 pM ABT-263 and 1 pM AZD5991) treatment. Cells were washed twice with PBS to remove the drugs. NT- and DKO-CAR19 T cells were then cocultured with NALM6-luc cells for 24 hours at increasing effector to target ratios (E:T) (NT- or DKO-CAR19 T cells:NALM6-luc cells) for 24 hours. Viability of NALM6-luc cells was assessed using a luciferase assay (data depicts 1 donor). * p < 0.05, to compare between two groups, Mann- Whitney U test.
[0026] FIG. 12 shows activation and activity of NT- and DKO-CAR19T cells. (A) NT- and DKO-CAR19 T cells were transiently restimulated with anti-CD3 and anti-CD28 beads for three days. The beads were removed and the number of viable NT and DKO-CAR19 T cells were counted every two days using trypan blue and an automated cell counter to identify and quantify live cells (data depicts one donor). (B) A schematic of the culture protocol used to collect the data shown in FIG. 13. NT- and DKO-CAR19 T cells were co-cultured with NALM6 B-ALL tumor cells for 14 days in an E:T ratio of 1:2.5 (10k:50k). Every two days an additional 25k NALM6 lymphoma cells were added to the culture. NT- and DKO-CAR19 T cells were counted every 2-3 days using counting beads by flow cytometry to assess CAR T expansion and persistence.
[0027] FIG. 13 shows CAR19 T cell persistence and proliferation and tumor growth of Nalm6 cells treated with NT CAR19 T cells and DKO-CAR 19 T cells from three different donors. (A) Co-culture of NT-CAR19 T cells and DKO-CAR 19 T cells from three differentMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOdonors with Nalm6 tumor cells. CAR19 T cell population was characterized over 15 days. DKO-CAR19 T cells exhibited higher rates of survival and proliferation than WT-CAR19 T cells. (B) Tumor growth of Nalm6 cells co-cultured with WT- and DK0-CAR19 T cells from donors 1 and 2. The number of viable NALM6 tumor cells (CD3-CD22+) was counted every 2-3 days using counting beads by flow cytometry. * p < 0.05, to compare between two groups, Mann-Whitney U test
[0028] FIG. 14 shows viability over time of NT- and DKO-CAR19 T cells that were chronically restimulated with anti-CD3 and anti-CD28 beads continuously for 31 days (beads were replenished on day 20) (data depicts one donor). The number of viable NT and DKO-CAR19 T cells were counted every two days using an automatic cell counter and trypan blue to exclude dead cells.
[0029] FIG. 15 shows that BAX / BAK1 DKO-CAR19 T cells possess a survival advantage when treated with chemotherapeutics and under IL-2 deprivation. NT-CAR19 and DKO-CAR19 T cells were treated with increasing concentrations of each chemotherapeutics for 24 hours. Viability was assessed by CELLTITER-GLO assay. Data depicts 4 independent donors. (A) Cells treated with etoposide. (B) Cells treated with doxorubicin. (C) Cells treated with panobinostat. (D) Cells treated with dinaciclib (E) NT- and DKO-CAR19 T cells were cultured in 20 IU of IL-2 for 24 hours. Following 24 hours, cells were washed with PBS to remove the IL-2. NT- and DKO-CAR19 T cells were then cultured without IL-2 for 12 days. The number of viable NT- and DKO-CAR19 T cells were counted every 1-2 days using a COUNTESS automatic cell counter and trypan blue to exclude dead cells (data depicts 1 independent donor).
[0030] FIG. 16 shows a graph of viability indicating that DKO-EGFR CAR T cells demonstrated superior killing of HCT116-luc (luciferase expressing HCT116 cells) cells compared to NT-EGFR-CAR T cells when treated mitochondrial apoptosis inducing agents. NT and DKO EGFR-CAR T cells were co-cultured with HCT116-luc cells. The co-culture was treated with two mitochondrial apoptosis inducing agents known as BH3 mimetics (ABT-263 and AZD5991 0.8 pM each) concurrently. 24-hours after treatment, tumor cell viability was assessed using a luciferase assay. Viable HCT116-luc cells were identified by their ability to produce light, detected using a luminescent plate reader. The luminescence was directly proportional to tumor cell viabilityMRGRef: 0680.003583W001DFCI Ref: 3583.W01WODETAILED DESCRIPTION
[0031] The singular forms “a,” “an” and “the” include plural reference unless the context clearly dictates otherwise. The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0032] Wherever any of the phrases “for example,” “such as,” “including” and the like are used herein, the phrase “and without limitation” is understood to follow unless explicitly stated otherwise. Similarly, “an example,” “exemplary” and the like are understood to be nonlimiting.
[0033] The term “substantially” allows for deviations from the descriptor that do not negatively impact the intended purpose. Descriptive terms are understood to be modified by the term “substantially” even if the word “substantially” is not explicitly recited.
[0034] The terms “comprising” and “including” and “having” and “involving” (and similarly “comprises,” “includes,” “has,” and “involves”) and the like are used interchangeably and have the same meaning.
[0035] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The terms “about” or “approximately” when used in connection with a value can mean that the value or a statement reciting the value encompasses a range within ±1%, ±2%, ±3%, ±4%, ±5%, ±6%, ±7%, ±8%, ±9%, ±10%, ±1-5%, ±2-7%, ±3-8%, ±4-9%, or ±5-10% of the value.
[0036] The terms “decrease,” “reduced,” “reduction,” or “inhibit” are all used herein to mean a decrease by a statistically significant amount. “Reduce,” “reduction,” or “decrease” or “inhibit” typically means a decrease by at least 10% as compared to a reference level (for example, the absence of a given treatment or agent) and can include, for example, a decrease by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or more. “Complete inhibition” is a 100%MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOinhibition as compared to a reference level. Where applicable, a decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder. The terms “increased,” “increase,” “enhance,” or “activate” are all used herein to mean an increase by a statically significant amount. The terms “increased,” “increase,” “enhance,” or “activate” can mean an increase of at least 10% as compared to a reference level, for example, an increase of at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least a 2-fold, or at least a 3 -fold, or at least a 4-fold, or at least a 5-fold or at least a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.
[0037] As used herein, the terms “tumor antigen,” “tumor-associated antigen” and “cancer antigen” are used interchangeably to refer to antigens that are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells. Cancer antigens are antigens that can potentially stimulate tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those that are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation, and those that are temporally expressed, such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (for example, activated ras oncogene), suppressor genes (for example, mutant p53), and fusion proteins resulting from internal deletions or chromosomal translocations. Still, other cancer antigens can be encoded by viral genes, such as those carried on RNA and DNA tumor viruses. Many tumor antigens have been defined in terms of multiple solid tumors: MAGE 1, 2, & 3, defined by immunity; MART-l / Melan-A, gplOO, carcinoembryonic antigen (CEA), human epidermal growth factor receptor (HER2), mucins (i.e., MUC-1), prostate-specific antigen (PSA), and prostatic acid phosphatase (PAP). In addition, viral proteins such as some encoded by hepatitis B (HBV), Epstein-Barr (EBV), and human papilloma (HPV) have been shown to be important in the development of hepatocellular carcinoma, lymphoma, and cervical cancer, respectively. The tumor-associated antigen herein may be any one of CD19, CD79b,MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOTACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, EGFR, or a combination thereof.
[0038] The term “chimeric” refers to the product of the fusion of portions of at least two or more different polynucleotide molecules. The term “chimeric” includes gene expression elements produced through the manipulation of known elements or other polynucleotide molecules.
[0039] ‘ ‘Activation” can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation, “activation” can also refer to induced cytokine production. “Activation” can also refer to detectable effector functions.
[0040] An “activated T cell” means a proliferative T cell. “Activated CAR T cells” can include CAR T cells modified for improved (i.e., better) performance.
[0041] The terms “specific binding” and “specifically binds” refer to a physical interaction between two molecules, compounds, cells and / or particles wherein the first entity binds to the second target entity with greater specificity and affinity than it binds to a third entity which is a non-target. Specific binding can refer to an affinity of the first entity for the second target entity, which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or more than the affinity for the third non-target entity under the same conditions. A reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized. A non-limiting example includes an antibody, or a ligand, which recognizes and binds with a cognate binding partner (for example, a stimulatory and / or costimulatory molecule present on a T cell) protein.
[0042] The term “engineered” and its grammatical equivalents can refer to one or more human-designed alterations of a nucleic acid, for example, the nucleic acid within an organism's genome. “Engineered” can refer to alterations, additions, and / or deletion of genes. An “engineered cell” can refer to a cell with an added, deleted and / or altered gene.
[0043] The term “cell” or “engineered cell” and their grammatical equivalents can refer to a cell of human or non-human animal origin.
[0044] The term “treating” (or “treat” or “treatment”) refers to restraining, slowing, stopping, or reversing the progression or severity of an existing symptom, condition, or disorder. The term “treatment” or “treat” or variations thereof also refer to reducing, limiting progression,MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOameliorating, or resolving, to any extent, the symptoms or signs related to a condition. A “treatment” may be therapeutic or prophylactic. “Therapeutic” and variations thereof refer to a treatment that ameliorates one or more existing symptoms or clinical signs associated with a condition. “Prophylactic” and variations thereof refer to a treatment that limits, to any extent, the development and / or appearance of a symptom or clinical sign of a condition. Generally, a “therapeutic” treatment is initiated after the condition manifests in a subject, while “prophylactic” treatment is initiated before a condition manifests in a subject.
[0045] Treating a condition can be prophylactic or, alternatively, can be initiated after the subject exhibits one or more symptoms or clinical signs of the condition. Treatment that is prophylactic — for example., initiated before a subject manifests a symptom or clinical sign of the condition such as, for example, while an infection remains subclinical — is referred to herein as treatment of a subject that is “at risk” of having the condition. The term “at risk” refers to a subject that may or may not actually possess the described risk. Thus, for example, a subject “at risk” of a non- infectious condition is a subject possessing one or more risk factors associated with the condition such as, for example, genetic predisposition, ancestry, age, sex, geographical location, lifestyle, or medical history. Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their recurrence.
[0046] Accordingly, a composition can be administered before, during, or after the subject first exhibits a symptom or clinical sign of the condition. Treatment initiated before the subject first exhibits a symptom or clinical sign associated with the condition may result in decreasing the likelihood that the subject experiences clinical evidence of the condition compared to a subject to which the composition is not administered, decreasing the severity of symptoms and / or clinical signs of the condition, and / or completely resolving the condition. Treatment initiated after the subject first exhibits a symptom or clinical sign associated with the condition may result in decreasing the severity of symptoms and / or clinical signs of the condition compared to a subject to which the composition is not administered, and / or completely resolving the condition.
[0047] Thus, the method includes administering an effective amount of the composition to a subject having, or at risk of having, a particular condition. An “effective amount” is an amount effective to reduce, limit progression, ameliorate, or resolve, to any extent, a symptom or clinical sign related to the condition.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0048] The term “polypeptide” refers to a polymer of amino acids. The terms “protein” and “polypeptide” are used interchangeably herein. A peptide may be a relatively short polypeptide, typically between about 2 and 60 amino acids in length. Polypeptides used herein typically contain amino acids, such as the 20 L-amino acids that are most commonly found in proteins. However, other amino acids and / or amino acid analogs known in the art can be used. One or more of the amino acids in a polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a fatty acid group, a linker for conjugation, functionalization, etc. A polypeptide that has a non-polypeptide moiety covalently or noncovalently associated therewith is still considered a “polypeptide.” Some modifications include glycosylation and palmitoylation. Polypeptides can be purified from natural sources, produced using recombinant DNA technology or synthesized through chemical means such as conventional solid-phase peptide synthesis, etc. The term “polypeptide sequence” or “amino acid sequence” can refer to the polypeptide material itself and / or to the sequence information (i.e., the succession of letters or three-letter codes used as abbreviations for amino acid names) that biochemically characterizes a polypeptide. A polypeptide sequence presented herein is presented in an N-terminal to C-terminal direction unless otherwise indicated.
[0049] The term “gene” means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, for example, 5' untranslated (5' UTR) or “leader” sequences and 3' UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons).
[0050] The term “statistically significant” or “significantly” may refer to statistical significance and generally means a two standard deviation (2SD) or greater difference.
[0051] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the embodiments described herein. The scope of the present disclosure is not intended to be limited to the description herein, but rather is as set forth in the appended claims.
[0052] Claims or descriptions that include “or” between two or more members of a group are considered satisfied if one, more than one, or all of the group members are present, unless indicated to the contrary or otherwise evident from the context. The disclosure of a group thatMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOincludes “or” between two or more group members provides embodiments in which exactly one member of the group is present, embodiments in which more than one member of the group is present, and embodiments in which all of the group members are present. For purposes of brevity, those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.
[0053] It is to be understood that the disclosure encompasses all variations, combinations, and permutations in which one or more limitation, element, clause, or descriptive term, from one or more of the claims or from one or more relevant portions of the description, is introduced into another claim. For example, a claim that is dependent on another claim can be modified to include one or more of the limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of making or using the composition according to any of the methods of making or using disclosed herein or according to methods known in the art, if any, are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
[0054] Where elements are presented as lists, for example, in Markush group format, it is to be understood that every possible subgroup of the elements is also disclosed, and that any element or subgroup of elements can be removed from the group. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps. It should be understood that, in general, where an embodiment, product, or method is referred to as comprising particular elements, features, or steps, embodiments, products, or methods that consist, or consist essentially of, such elements, features, or steps, are provided as well. For purposes of brevity, those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.
[0055] Where ranges are given, endpoints are included. Where ranges are given with the term “between,” the endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and / or the understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value within the statedMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOranges, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. For purposes of brevity, the values in each range have not been individually spelled out herein, but it will be understood that each of these values is provided herein and may be specifically claimed or disclaimed. It is also to be understood that unless otherwise indicated or otherwise evident from the context and / or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
[0056] The units for the variables described in the present disclosure include moles (M), millimole (mM), micromole (uM or pM), picomole (pmol), milliliter (mL), microliter (pL), degrees centigrade (°C), hour (h).
[0057] In addition, it is to be understood that any particular embodiment of the present disclosure may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and / or methods of the disclosure, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more elements, features, purposes, or aspects is excluded are not set forth explicitly herein.
[0058] As used herein, a nucleic acid sequence that is “substantially identical” to another nucleic acid sequence is a nucleotide sequence that has 70% or more sequence identity to the other nucleic acid sequence. In some embodiments, a nucleic acid sequence that is “substantially identical” to another nucleic acid sequence has 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the other nucleic acid sequence.
[0059] For purposes of percent sequence identity between an RNA sequence and a DNA sequence, uracil bases in the RNA are to be considered identical to thymine bases in the DNA.
[0060] As used herein “sequence identity” refers to the extent to which two optimally aligned nucleic acid sequences are invariant throughout a window of alignment of components, e.g., nucleotides. “Identity” can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford UniversityMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOPress, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G, ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0061] As used herein, the term “percent sequence identity” or “percent identity” refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) nucleic acid (or its complementary strand) as compared to a test (“subject”) nucleic acid (or its complementary strand) when the two sequences are optimally aligned. Percent sequence identity may be determined, when the compared sequences are aligned for maximum correspondence, as measured using a sequence comparison algorithm described below and as known in the art, or by visual inspection.
[0062] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA). Alignment of sequences may be analyzed using a Burrows- Wheeler transform such as BOWTIE open-source software available from https: / / github.com / BenLangmead / bowtie. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0063] Other terms are defined within the description of the various aspects and embodiments of the technology, as set forth herein.CAR T Cells and Apoptosis
[0064] Malignant hematologic cells can evade both the immune system and chemotherapeutic agents through evasion of apoptosis. Like normal cells, tumor cells retain numerous signals that, under normal circumstances, would trigger programmed cell death. However, many tumor cells hijack anti-apoptotic machinery, such as B cell lymphoma 2 (BCL-2) family members, to avoid apoptosis. Chimeric antigen receptor T cell therapy (CAR T cell therapy) has provided a promising treatment option for patients with such hematologic malignancies. However, relapse remains a common problem. Mechanisms of failure include loss of CAR T cell persistence and tumor resistance to apoptosis. It has been discovered that decreased apoptotic priming of CAR T cells can improve the persistence and therapeutic efficacy (for example, cancer-killing efficacy). Knockout of proapoptotic genes, such as BAK1 and BAX, increases resistance to apoptotic stimuli. Loss of expression of a gene may be identified using genetic sequencing, by detecting loss of an mRNA transcript, and / or by detecting loss of a protein product.
[0065] There is described a CAR T cell, wherein the CAR T cell is engineered to include a knockout of at least one proapoptotic gene, such as BAK1, BAX, or both BAK1 and BAX. The T cell may include at least one CRISPR activation protein-gRNA complex that knocks out the BAK1 gene, the BAX gene, or both genes.
[0066] The BAK1 and / or BAX knock-outs can be facilitated by using at least one gene editing complex. Typically, a gene editing complex includes one or more proteins and / or one or more nucleic acids designed to target and effectuate an edit in a gene of interest. Examples of gene editing complexes include TALENs, CRISPR-Cas9 ribonucleoproteins (RNPs), transposons, protein-gRNA complex. In the systems described herein, a gene editing complex may include Cas9, such as S. aureus Cas9 or S. pyogenes Cas9.
[0067] Where a Cas9 editing strategy is used, the gene editing complex may include one or more guide RNAs. Typically, the one or more guide RNAs bind within or near a gene of interest. To generate a BAK1 knockout cell, a gene editing complex may include a gRNA that targets a sequence upstream of BAK1 or within the BAK1 gene, such as in an intron or exon. To generateMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOa BAX knockout cell, a gene editing complex may include a gRNA that targets a sequence upstream of BAX or within the BAX gene, such as in an intron or exon.
[0068] One or more CRISPR protein-gRNA complexes may be used. Two protein-gRNA complexes may be used. One protein-gRNA complex may include a gRNA that targets a sequence upstream of BAK1, while the other protein-gRNA complex may include a gRNA that targets a sequence upstream of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets an exon of BAK1, while the other protein-gRNA complex may include a gRNA that targets an exon of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets a sequence upstream of BAK1, while the other protein-gRNA complex may include a sequence that targets an exon of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets an exon of BAK1, while the other protein-gRNA complex may include a gRNA that targets a sequence upstream of BAX.
[0069] The one or more protein-gRNA complexes can include Cas9. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1. One protein-gRNA complex may include a gRNA that targets exon 2 of BAX. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1, while the other protein-gRNA complex may include a gRNA that targets exon 2 of BAX.
[0070] A method of producing an engineered T cell may include delivering at least one protein-gRNA complex into the T cell; and delivering a polynucleotide encoding a CAR into the T cell.
[0071] In such method, one or more protein-gRNA complexes may be delivered that target one or more genes. Delivering protein-gRNA complexes can include nucleofection.
[0072] Other methods known in the art may be used to deliver protein-gRNA complexes.
[0073] One protein-gRNA complex may target one proapoptotic gene, while another protein-gRNA complex may target a another proapoptotic gene. One protein-gRNA complex may knock out BAK1, while the other protein-gRNA complex may knock out BAX.
[0074] In such method, the protein-gRNA complex may further include a gRNA that targets a sequence upstream of BAK1. Alternatively, the protein-gRNA complex may include a gRNA that targets a sequence upstream of BAX. The protein-gRNA complex may include a gRNA thatMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOtargets an exon of BAK1. Alternatively, the protein-gRNA complex may include a gRNA that targets an exon of BAX.
[0075] In such method, one or more CRISPR protein-gRNA complexes may be used. Two protein-gRNA complexes may be used. One protein-gRNA complex may include a gRNA that targets a sequence upstream of BAK1, while the other protein-gRNA complex may include a gRNA that targets a sequence upstream of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets an exon of BAK1, while the other protein-gRNA complex may include a gRNA that targets an exon of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets a sequence upstream of BAK1, while the other protein-gRNA complex may include a sequence that targets an exon of BAX. Alternatively, one protein-gRNA complex may include a gRNA that targets an exon of BAK1, while the other protein-gRNA complex may include a gRNA that targets a sequence upstream of BAX.
[0076] In such method, the one or more protein-gRNA complexes can include Cas9. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1. One protein-gRNA complex may include a gRNA that targets exon 2 of BAX. One protein-gRNA complex may include a gRNA that targets exon 5 of BAK1, while the other protein-gRNA complex may include a gRNA that targets exon 2 of BAX.
[0077] As it is used herein, a “knockout” mutation is a mutation to a gene or to the regions surrounding the gene that results in loss of the gene product. Gene knockout may be confirmed using protein expression analysis methods, such as Western blot and flow cytometry. Gene knockout may alternatively or additionally be confirmed using genetic methods, such as probe hybridization, polymerase chain reaction (PCR), or sequencing, such as next-generation sequencing. Mutations that may result in knockout of a gene include random insertions and deletions (indels), mutations to a splice donor or acceptor, frameshift mutations, and nonsense mutations. While described herein in the context of a complete gene knockout, partial gene knockouts are also contemplated. An engineered T cell may include a mutation to BAK1 gene or the surrounding genomic DNA and / or BAX gene or the surrounding genomic DNA that reduces the level of protein produced by the gene by at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0078] The T cell may include a CAR that specifically binds to CD 19. The T cell may include a CAR that specifically binds to EGFR.
[0079] A T cell may be treated to include a CAR by contacting the T cell with a construct encoding the CAR. For example, a T cell may be contacted with a polynucleotide encoding the CAR. Delivering a polynucleotide encoding a CAR may include transduction. Delivering a polynucleotide encoding a CAR may include delivering a vector that includes the polynucleotide encoding a CAR. The vector may be a viral vector. The viral vector may be a lentiviral vector or an adenoviral vector. An engineered T cell may be treated to include a CAR before or after it is treated to knock out one or more genes, such as BAX and BAK1.
[0080] The T cell may be made to express a CAR by delivery of a polynucleotide that includes a sequence encoding the CAR. For example, the polynucleotide may be included in a vector, such as a viral vector. The viral vector may be a lentiviral vector or an adeno- viral vector.
[0081] Other methods known in the art may be used to deliver a CAR.
[0082] While described herein by their genetic and proteomic characteristics, the engineered T cells of the present disclosure may also be identified by functional characteristics. For example, the engineered T cells of the present disclosure typically exhibit increased persistence and expansion as compared to a non-engineered cell, such as a wild-type T cells or comparative CAR T cells lacking the engineered genetic mutations. As it is used herein, persistence describes the quality of a cell to survive and replicate in stressful conditions, such as long-term co-culture with tumor cells, treatment with cytotoxic anti-cancer drugs and IL-2 cytokine deprivation.. Cells having increased persistence may be resistant to fatigue, even after chronic activation and survive better. In addition, CAR T cells having increased persistence continue to exhibit antitumor effects even after exposure to stressful conditions, such as chronic activation and treatment with apoptosis-inducing agents,
[0083] An engineered T cell of the present disclosure may survive for at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% longer than a comparable non-engineered T cell or CAR T cell lacking the genetic mutations of the engineered cells described herein. An engineered T cell of the present disclosure may exhibit anti-tumor activity after at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 18 days, at least 20 days, at least 25 days, or at least 30MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOdays after initial activation. Initial activation may refer to first contact with a stimulatory target, such as an antigen-containing bead or a cultured tumor cell, or initial administration to a subject.
[0084] In addition, the engineered T cells of the present disclosure may exhibit improved survival under harsh conditions as compared to a non- engineered cell, such as a wild-type T cell or a comparable CAR T cell lacking the engineered genetic mutations. For example, an engineered T cell of the present disclosure may survive at a higher rate than a comparable nonengineered cell when exposed to anti-cancer drugs. An engineered T cell of the present disclosure may survive
[0085] The term “vector” describes a nucleic acid construct designed to be transferred into a cell or between cells. A vector can be viral or non-viral. The term “vector” includes the term plasmid. Under the right conditions, a vector is capable of replication and of inserting its genetic material into the genome of a host cell.
[0086] The term “proapoptotic gene” refers to a gene the activity of which promotes or causes apoptosis in a cell by any pathway.Chimeric Antigen Receptors (CARs)
[0087] The terms “chimeric antigen receptor” or “CAR” refer to engineered T cell receptors, which graft a ligand or antigen specificity onto T cells (for example, naive T cells, central memory T cells, effector memory T cells or combinations thereof). CARs are also known as artificial T cell receptors, chimeric T cell receptors or chimeric immunoreceptors.
[0088] A CAR places a chimeric antigen binding domain that specifically binds a target, for example, a polypeptide, expressed on the surface of a cell to be targeted for a T cell response onto a construct including a transmembrane domain and intracellular domain(s) of a T cell receptor molecule. The chimeric antigen binding domain may include the antigen domain(s) of an antibody reagent that specifically binds an antigen expressed on a cell to be targeted for a T cell response. The chimeric antigen binding domain may include a ligand that specifically binds an antigen expressed on a cell to be targeted for a T cell response.
[0089] “ CAR T cell” or “CAR T” refers to a T cell that expresses a CAR. When expressed in a T cell, CARs have the ability to redirect T cell specificity and reactivity toward a selected target in a non-MHC-restricted manner, exploiting the antigen-binding properties of monoclonal antibodies. The non-MHC-restricted antigen recognition gives T cells expressing CARs theMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOability to recognize an antigen- independent of antigen processing, thus bypassing a major mechanism of tumor escape.
[0090] Any cell-surface moiety can be targeted by a CAR. Often, the target will be a cellsurface polypeptide that may be differentially or preferentially expressed on a cell that one wishes to target for a T cell response. The extracellular target binding domain may bind to any one of CD19, CD37, CD70, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, EGFR, or any combination thereof. The extracellular target binding domain may bind to any pair of CD19 / CD79b, BCMA / TACI, or is a TriPRIL antigen binding domain.Chimeric Antigen Receptor (CAR) Polypeptides
[0091] A CAR polypeptide may refer to a polypeptide including an amino acid sequence encoding a CAR (as described herein). The CAR polypeptide may include from N-terminal to C-terminal an amino acid sequence encoding a CAR.Methods of Treatment
[0092] There are described methods of treating a cancer (as described herein) in a subject, the method including administering a cell (for example, a CAR T cell) that expresses a CAR (as described herein), and that includes a knockout in one or more proapoptotic genes, such as BAK1, BAX, or both. The method may include administering a T-cell engineered to express a CAR and engineered not to express BAK1 or BAX, or not to express both BAK1 and BAX. . The method may include administering to a subject having cancer a CAR T cell that includes a knockout in one or more proapoptotic genes, such as BAK1, BAX, or both BAK1 and BAX. The method may include administering to a subject having a liquid cancer (for example, a hematological cancer or blood cancer) a CAR T cell that includes a knockout in one or more proapoptotic genes, such as BAK1, BAX, or both.
[0093] The CAR may express an antigen-binding domain that is capable of binding an antigen of a cell of the cancer (for example, a tumor- specific antigen on the surface of the cancer cell). The CAR may express an antigen binding domain that binds to an antigen of a cell of the cancer (for example, a tumor-specific antigen on the surface of the cancer cell). Accordingly, the CAR T cell may bind to a cancer antigen of the cancer.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0094] The methods disclosed herein can include treating a subject having a cancer that express CD19 or CD37. The methods disclosed herein can include liquid cancers, such as cancers that include liquid tumors. The methods disclosed herein can include a liquid cancer that is a B cell malignancy or a T cell malignancy. The cancer may be a hematological cancer. The cancer may be lymphoma or leukemia. The cancer may be B-cell Non-Hodgkin Lymphoma (NHL), mantle cell lymphoma, Burkitt’s lymphoma, B-cell lymphoblastic lymphoma, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), marginal zone lymphoma, or T-cell lymphoma. The cancer may be acute myeloid leukemia (AML), small lymphocytic lymphoma (SLL), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), B-cell lymphoblastic leukemia, chronic lymphocytic leukemia (CLL), or T-cell leukemia. The method may include administering to a subject having a CD19 expressing liquid cancer (for example, lymphoma or leukemia) a CAR T cell that does not express one or more proapoptotic genes, such as BAK1, BAX, or both BAK1 and BAX.
[0095] The CD 19 expressing leukemia may be acute myeloid leukemia (AML), small lymphocytic lymphoma (SLL), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), B-cell lymphoblastic leukemia, chronic lymphocytic leukemia (CLL), or T cell leukemia. The CD 19 expressing lymphoma may be B-cell Non-Hodgkin Lymphoma (NHL), mantle cell lymphoma, Burkitt’s lymphoma, B-cell lymphoblastic lymphoma, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), marginal zone lymphoma, or T-cell lymphoma. The CD 19 expressing cancer may be a B-cell malignancy. The CD 19 expressing cancer may be a T-cell malignancy.
[0096] The method can include administering to a subject having a CD37 expressing liquid cancer for example, lymphoma or leukemia) a CAR T cell that does not express one or more proapoptotic genes, such as BAK1, BAX, or both BAK1 and BAX. The CD37 expressing leukemia may be acute myeloid leukemia (AML), small lymphocytic lymphoma (SLL), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), B-cell lymphoblastic leukemia, chronic lymphocytic leukemia (CLL), or T cell leukemia. The CD37 expressing lymphoma may be B-cell Non-Hodgkin Lymphoma (NHL), mantle cell lymphoma, Burkitt’s lymphoma, B-cell lymphoblastic lymphoma, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL),MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOmarginal zone lymphoma, or T-cell lymphoma. The CD37 expressing cancer may be a B-cell malignancy. The CD37 expressing cancer may be a T-cell malignancy.
[0097] A method of treating can include treating a subject having a cancer that expresses EGFR. Cancers that express EGFR include lung cancer, such as non-small cell lung cancer, breast cancer, ovarian cancer, prostate cancer, thyroid cancer, liver cancer, and renal cancer. Typically, cancers that express EGFR include solid tumors. Thus, a method of treating can include treating a subject having a cancer that includes solid tumors.
[0098] A method of treating may include administering to a subject a T cell engineered to express a CAR and to have no or reduced expression of BAX and / or BAK1. A method may additionally include administering to the subject one or more anti-cancer drugs. As is described in Example 4 and Example 5 of the present application, the engineered CAR T cells of the present disclosure exhibit improved resistance to anti-cancer drugs, such as etoposide, doxorubicin, panobinostat, and dinaciclib. A method of treating may include administering an engineered T cell of the present disclosure with one or more anti-cancer drugs, including etoposide, doxorubicin, panobinostat, and / or dinaciclib.Cancer
[0099] In one aspect, the subject has been diagnosed with cancer. “Cancer” can refer to a hyperproliferation of cells whose trait, loss of normal cellular control, results in unregulated growth, lack of differentiation, local tissue invasion, and metastasis. Cancers may include, but are not limited to, liquid cancers (as referred to as liquid tumors), and solid tumors. Cancer may include a solid tumor. A “liquid cancer” or “liquid tumor” may refer to a leukemia, lymphoma, and myeloma cancer. Nonlimiting examples of leukemia include acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), and chronic lymphocytic leukemia (CLL). The cancer may be ALL or CLL. Non-limiting examples of lymphoma include diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphomas, Burkitt's lymphoma, hairy cell leukemia (HCL), and T cell lymphoma (for example, peripheral T cell lymphoma (PTCL), including cutaneous T cell lymphoma (CTCL) and anaplastic large cell lymphoma (ALCL)). The cancer can be DLBCL or follicular lymphoma. The myeloma can be multiple myeloma. The multiple myeloma can be smoldering and active multiple myeloma.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0100] Non-limiting examples of solid tumors include adrenocortical tumor, alveolar soft part sarcoma, carcinoma, chondrosarcoma, colorectal carcinoma, desmoid tumors, desmoplastic small round cell tumor, endocrine tumors, endodermal sinus tumor, epithelioid hemangioendothelioma, Ewing sarcoma, glioblastoma, prostate cancer, glioma, lung cancer, pancreatic cancer, germ cell tumors (solid tumor), giant cell tumor of bone and soft tissue, hepatoblastoma, hepatocellular carcinoma, melanoma, nephroma, neuroblastoma, nonrhabdomyosarcoma soft tissue sarcoma (NRSTS), osteosarcoma, paraspinal sarcoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, synovial sarcoma, and Wilms tumor. The solid tumor may be selected from the group consisting of breast cancer, glioblastoma, gastroesophageal, bladder, neuroblastoma, prostate, pancreatic, ovarian and mesothelioma. The cancer may express mesothelin. The cancer may be uterine cancer. Solid tumors can be found in bones, muscles, or organs, and can be sarcomas or carcinomas. It is contemplated that any aspect of the technology described herein can be used to treat all types of cancers, including cancers not listed in the instant application. The term “tumor” refers to an abnormal growth of cells or tissues, for example, of malignant type or benign type.Subject
[0101] A “subject” means a human or animal. Usually, the animal is a vertebrate such as a primate, rodent, domestic animal, or game animal. The subject may be a mammal, for example, a primate, for example, a human. The terms “individual,” “patient,” and “subject” are used interchangeably herein. Preferably, the subject is a mammal. The mammal can be a human, nonhuman primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples.Mammals other than humans can be advantageously used as subjects that represent animal models of disease, for example, cancer. A subject can be male or female.
[0102] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (for example, diagnosed with cancer) or one or more complications related to such a condition, and optionally, has already undergone treatment for the condition or the one or more complications related to the condition.
[0103] Alternatively, a subject can also be one who has not been previously diagnosed as having such condition or related complications. For example, a subject can be one who exhibitsMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOone or more risk factors for the condition or one or more complications related to the condition or a subject who does not exhibit risk factors.
[0104] A “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.Pharmaceutical Compositions
[0105] The term “pharmaceutical composition” refers to the active agent (for example, a CAR T described herein in combination with a pharmaceutically acceptable carrier for example a carrier commonly used in the pharmaceutical industry.
[0106] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. A pharmaceutically acceptable carrier can be a carrier other than water. A pharmaceutically acceptable carrier can be an artificial or engineered carrier, for example, a carrier in which the active ingredient would not be found to occur in nature.
[0107] In one aspect of the technology, the technology described herein relates to a pharmaceutical composition including activated CAR T cells as described herein, and optionally a pharmaceutically acceptable carrier. The active ingredients of the pharmaceutical composition at a minimum include activated CAR T cells as described herein. The active ingredients of the pharmaceutical composition may consist essentially of activated CAR T cells as described herein. The active ingredients of the pharmaceutical composition may consist of activated CAR T cells as described herein. Pharmaceutically acceptable carriers for cell-based therapeutic formulation include, but are not limited to, saline and aqueous buffer solutions, Ringer’s solution, and serum components, such as serum albumin, HDL. and LDL. The terms such as “excipient,” “carrier,” “pharmaceutically acceptable carrier,” “pharmaceutically acceptable excipient” or the like are used interchangeably herein.
[0108] The pharmaceutical composition including activated CAR T cells as described herein can be a parenteral dose form. Since administration of parenteral dosage forms typically bypasses the patient’s natural defenses against contaminants, the components apart from theMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOCAR T cells themselves are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. Any of these can be added to the activated CAR T cells preparation prior to administration. Suitable vehicles that can be used to provide parenteral dosage forms of activated CAR T cells as disclosed within are well known to those skilled in the art. Examples include, without limitation: saline solution; glucose solution; aqueous vehicles including but not limited to, sodium chloride injection, Ringer’s injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer’s injection; water- miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.Administration
[0109] The phrase “administering” (or “administer” or “administration”) refers to the act of the attending physician or caregiver, prescribing the agent for administration and thereby causing the application of an agent to a subject, through ingestion, infusion, injection, or any other means, whether self-administered or administered by a clinician or other qualified care giver.
[0110] The methods described herein may relate to treating a subject having or diagnosed as having cancer, a plasma cell disease or disorder, or an autoimmune disease or disorder with a mammalian CAR T cell (and optional antibody reagents or cytokines) described herein. The CAR T cells described herein include mammalian cells expressing a CAR described herein and not expressing one or more proapoptotic genes, such as BAK1, BAX, or both BAK1 and BAX. Subjects having a condition can be identified by a physician using current methods of diagnosing the condition. Symptoms and / or complications of the condition, which characterize these conditions and aid in diagnosis are well known in the art and include, but are not limited to, fatigue, persistent infections, and persistent bleeding. Tests that may aid in a diagnosis of, for example, the condition include but are not limited to, blood screening and bone marrow testing, and are known in the art for a given condition. A family history for a condition, or exposure toMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOrisk factors for a condition can also aid in determining if a subject is likely to have the condition or in making a diagnosis of the condition.
[0111] The methods described herein may include administering an effective amount of activated CAR T cells described herein to a subject in order to alleviate a symptom of the condition. “Alleviating a symptom of the condition” is ameliorating any condition or symptom associated with the condition. As compared with an equivalent untreated control, such reduction is 5% or greater, 10% or greater, 20% or greater, 40% or greater, 50% or greater, 60% or greater, 80% or greater, 90% or greater, 95% or greater, 99% or greater as measured by any standard technique. A variety of means for administering the compositions described herein to subjects are known to those of skill in the art. The compositions described herein may be administered systemically or locally. The compositions described herein may be administered intravenously. The compositions described herein may be administered at the site of a tumor.
[0112] The term “effective amount” refers to the amount of activated CAR T cells described herein needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of the cell preparation or composition to provide the desired effect. The term “therapeutically effective amount” therefore refers to an amount of activated CAR T cells described herein that is sufficient to provide a particular anti-condition effect when administered to a typical subject. An effective amount, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a condition), or reverse a symptom of the condition. Thus, it is not generally practicable to specify an exact “effective amount.” However, for any given case, an appropriate “effective amount” can be determined by one of ordinary skill in the art using only routine experimentation.
[0113] Effective amounts, toxicity, and therapeutic efficacy can be evaluated by standard pharmaceutical procedures in cell cultures or experimental animals. The dosage can vary depending upon the dosage form employed and the route of administration utilized. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Compositions and methods that exhibit large therapeutic indices are preferred. A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range thatMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOincludes the IC50 (i.e., the concentration of activated CART cells described herein, which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model. Levels in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay, for example, an assay for bone marrow testing, among others. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.Modes of Administration
[0114] Modes of administration (for example, of the CAR T cells and / or pharmaceutical compositions described herein) can include, but are not limited to, intravenous (IV) injection or infusion. The CAR T cells and / or compositions can be administered to a patient transarterially, intratumorally, intranodally, intraperitoneally, intrathecally, or intramedullary. They can be injected directly into a tumor, lymph node, or site of infection. They can be administered into a body cavity or body fluid (for example, ascites, pleural fluid, peritoneal fluid, or cerebrospinal fluid).
[0115] Subjects may undergo leukapheresis, wherein leukocytes are collected, enriched, or depleted ex vivo to select and / or isolate the cells of interest, for example, T cells. These T cell isolates can be expanded by contact with an artificial APC, for example, an artificial APC expressing anti-CD28 and anti-CD3 CDRs, and treated such that one or more CAR constructs of the technology may be introduced, thereby creating a CAR T cell.
[0116] Subjects in need thereof can subsequently undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. Following or concurrent with the transplant, subjects can receive an infusion of the expanded CAR T cells. Expanded cells may be administered before or following surgery. Lymphodepletion may be performed on a subject prior to administering one or more CAR T cells as described herein. The lymphodepletion can include administering one or more of melphalan, survivin, cyclophosphamide, and fludarabine. The dosage of the treatments described herein to be administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. The scaling of dosages for human administration can be performed according to art-accepted practices.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0117] A single treatment regimen may be beneficial. Alternatively, administration of one or more subsequent doses or treatment regimens can be performed. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year or longer. Alternatively, no additional treatments may be administered following the initial treatment.
[0118] The dosage of CAR T cells as described herein can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment. With respect to duration and frequency of treatment, it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to administer further cells, discontinue treatment, resume treatment, or make other alterations to the treatment regimen. The dosage should not be so large as to cause adverse side effects, such as cytokine release syndrome. Generally, the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art. The dosage can also be adjusted by the individual physician in the event of any complication.EXAMPLESExample 1 : BAX knockout in CAR T cellsMethods
[0119] Ribonucleoproteins (RNPs) consisting of a Cas9 protein and a gRNA that targets the BCL2 antagonist / killer 1 gene (BAK1), as well as RNPs consisting of a Cas9 protein and a gRNA that targets the BCL2 associated X gene (BAX), were transfected into T cells. The spacer of the gRNA that was used to target exon 2 of BAX was: UGAGCAGAUCAUGAAGACAG (SEQ ID NO:1) and contains a tracrRNA complement sequence of GUUUUAGAGCUAUGCU (SEQ ID NO:2) and was purchased from IDT. The spacer of the gRNA that was used to target exon 5 of BAK1 was: UCGGAAAAAGACCUCUCGGG (SEQ ID NO: 3). Each gRNA also included a tracr sequence of GUUUUAGAGCUAUGCU (SEQ ID NO:2) and was purchased from INTEGRATED DNA TECHNOLOGIES (IDT). T cells were isolated using magnetic bead negative selection and activated for 48 hours with anti-CD3 and anti-CD28 antibodies and 20 International Units (IU) of recombinant human IL-2 (FIG. 1). On day two, T cells were resuspended in AMAXA nucleofection buffer at a density of 50xl06 / mL (1 xlO6per 20 pL.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WORNPs targeting BAX or BAK1 were assembled by combining CRISPR RNA (crRNA), which included each spacer sequence, and tracrRNA in equal molar quantities, heating to 95 °C for five minutes, and allowing to cool to room temperature. A stock of each individual annealed gRNA was kept and a pooled stock including both BAX and BAK1 gRNA was prepared. Next, the RNPs were assembled by mixing the BAX and / or BAK1 gRNAs with Cas9 protein in a 3: 1 ratio (150 picomoles (pmol) Cas9:450 pmol gRNA or pooled gRNA) for 15 minutes at room temperature 20 pL ) of T cell suspension (50 106 / mL) was mixed with the BAK1 / BAX RNP mixture (150 pmol Cas9+450 pmol gRNA) and added directly into 16- well nucleocuvette. The nucleocuvette was placed into a nucleofector and RNPs were nucleofected into the T cells using a standard nucleofection program. Nucleofected T cells were immediately transferred to fresh media at a density of 1 * 106cells / mL in a 24-well plate. T cells were incubated for 30 mins at 37 °C. Anti-CD3 and anti-CD28 DYNABEADS were added in a 1:1 ratio with 20 IU of IL-2. Following a two-hour incubation, T cells were transduced with CD19-CAR lentivirus and incubated for 48 hours at 37 °C. Media and IL-2 were refreshed every two days. On day six, DYNABEADS were removed and BAX and BAK1 knockout efficiency and CD19-CAR transduction efficiency were assessed by Western blot and flow cytometry (FIG.2) . Single knock-out (SKO) and DKO-CAR T cells were frozen down on day ten in fetal bovine serum (FBS) and 20% DMSO and stored at -80 °C for 24 hours and transferred to liquid nitrogen for long-term storage. Functional analysis of the resulting CD 19 CAR T cells was then conducted to assess the functional outcomes of this knockout on the persistence of the cells.Results
[0120] CAR constructs were successfully transduced into the T cells (FIG.2C). A knockout of BAX, but not of BAK1, was observed (FIG.2). The BAX knockout CAR T cells had a CD4 / CD8 ratio closer to 1:1, indicating a greater central memory T cell population, and reduced PD1 expression (FIG.3). BAX knockout did not improve cytotoxicity in vitro in CAR T cells (FIG. 4A). However, BAX knockout CAR T cells had reduced cytokine production, indicating of improved persistence of the BAX knockout CAR T cells (FIG.4B).Example 2: BAK1 / BAX double knockout in T cellsMethodsMRGRef: 0680.003583W001DFCI Ref: 3583.W01WO
[0121] RNPs including a Cas9 protein and a gRNA having a spacer targeting BAK1 (SEQ ID NO:4, GCCCUACACGUCUACCAGCA) or a gRNA having a spacer targeting BAX (SEQ ID NO:1, UGAGCAGAUCAUGAAGACAG) and a tracrRNA (SEQ ID NO:2, GUUUUAGAGCUAUGCU) and aCas9 protein were formed and transfected into T cells using nucleofection. gRNAs were purchased from IDT. T cells were isolated using magnetic bead negative selection and activated for 48 hours with anti-CD3 and anti-CD28 antibodies and 20 IU of recombinant human IL-2. On day two, T cells were resuspended in AMAXA nucleofection buffer at a density of 50 106 / ml (1 x 106per 20 pL ). BAX and BAK1 gRNAs were annealed as described in Example 1. RNPs were assembled by mixing the BAX and / or BAK1 gRNAs with Cas9 protein in a 3:1 ratio for 15 mins at room temperature (for SKO: 75 pmol Cas9 + 225 pmol gRNA; and for DKO: 150 pmol Cas9 + 450 pmol pooled gRNAs). 20 pL of T cell suspension (50x 106 / mL was mixed with BAX RNPs, BAK1 RNPs and BAK1 / BAK1 RNPs and added directly into a 16-well nucleocuvette. The nucleocuvette was placed into a nucleofector and RNPs were nucleofected into the T cells using a standard nucleofection program. Nucleofected T cells were immediately transferred to fresh media at a density of 1 x 106cells / ml in a 24- well plate.
[0122] T cells were incubated for 30 minutes at 37 °C. Media and IL-2 were refreshed every two days. On day six, DYNABEADS were removed and BAX and BAK1 knockout efficiency were assessed by Western blot and flow cytometry. SKO and DKO-CAR T cells were frozen down on day 10 in FBS and 20% DMSO, stored at -80 °C for 24 hours and transferred to liquid nitrogen for long-term storage. Functional analysis of the resulting CD 19- CAR T cells was then conducted to assess the functional outcomes of this knockout on the persistence of the cells. Flow cytometry-based BH3 profiling was conducted to assess the sensitivity of SKO and DKO T cells to mitochondrial apoptotic cell death. Cells were counted using trypan blue (to exclude dead cells) and an automated cell counter. Cells were resuspended in MEB buffer (150 mM mannitol, 10 mM HEPES-KOH pH 7.5, 150 mMKCl, 1 mMEGTA, 1 mMEDTA, 0.1% BSA , and 5 mM succinate) at a cell density of 1 xio6 / ml and 10 pL of cell suspension was seeded per well into a low binding 384- well black plate. Ten microliters (10 pL) of BIM peptide solution (containing MEB buffer and 0.004% digitonin) was added to each well at increasing BIM concentrations (0.0001 pM-1 pM) and incubated for one hour at 25 °C. Cells were then fixedMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOwith 5 L of 10% formalin for 15 minutes followed by neutralization with 5 pL of N2 buffer (1.7 M tris, 1.25 M glycine, pH 9.1) for five minutes at room temperature. 10 pL of cytochrome c antibody staining solution was added to each well and incubated overnight at 4 °C (antibody staining solution: 1 BD perm / wash solution (BD Biosciences cat#51-209-lKZ) and ALEXAFLUOR-647-cytochrome c antibody (BIOLEGEND cat#612310) diluted 1 in 1000 with an overall final dilution of 1 :4000 in the well). Cells were analyzed using flow cytometry the next day and data was analyzed to determine the number of cells that lost cytochrome c following the one-hour exposure to BIM peptide, which is indicative of sensitivity to mitochondrial apoptosis.Results
[0123] Protein expression of BAX and BAK1 was assessed using western blot analysis to assess the efficiency of BAX and BAK1 single knockout (SKO) and double knockout (DKO) in T cells. In the BAX SKO T cells, a 100% knockout of BAX was observed (FIG.6A-B) and a 94% knockout of BAK1 was observed in BAK1 SKO T cells (FIG. 6A and FIG.6C). In the BAX / BAK1 DKO T cells, a 100% knockout of BAX and 61% knockout of BAK1 was observed (FIG. 6A-C). Flow cytometry-based BH3 profiling was utilized to assess the ability of knocking out BAX and BAK1 in T cells to decrease the sensitivity of T cells to mitochondrial apoptotic cell death. The BAK1 SKO and BAX / BAK1 DKO knockout T cells were significantly less sensitive to mitochondrial apoptotic cell death compared to WT T cells, whereas there was no difference in sensitivity to mitochondrial apoptotic cell death in the BAX SKO T cells compared to the WT (FIG. 7A and Fig. 7B). To further explore the sensitivity of SKO and DKO T cells to mitochondrial apoptotic cell death, T cells were treated for 24 hours with single agent and dual agent BH3 mimetics that directly inhibit the anti-apoptotic effects of BCL-2 family members to specifically induce mitochondrial apoptosis. The SKO and DKO T cells were equally sensitive to ABT-263 (a BCL-2, xl, w mimetic) compared to the WT (FIG. 7C). Only BAK1 SKO and BAX / BAK1 DKO T cells were significantly less sensitive to AZD5991 compared to the WT, while the BAX SKO T cells had a comparable sensitivity to the WT (FIG. 7D). Compared to the WT, the BAX / BAK1 DKO T cells were significantly less sensitive to dual BH3 mimetic treatment (AZD5991, an MCL-1 mimetic and ABT263, a BCL-2, BCL-xl, BCL-w mimetic) whereas the SKO BAX and SKO BAK1 T cells had comparable sensitivity to the WT T cellsMRGRef: 0680.003583W001DFCI Ref: 3583.W01WO(FIG. 7E). These findings indicate that the BAX / BAK1 DKO T cells were less sensitive to mitochondrial apoptotic cell death, equipping them with a superior survival advantage indicative of improved persistence.Example 3: BAK1 / BAX double knockout CAR T cell characterization
[0124] BAX / BAK1 DKO-CAR19 T cells were generated using RNP nucleofection with gRNAs including the spacer sequences of SEQ ID NO: 1 and SEQ ID NO:2. A schematic representation of BAX / BAK1 DKO-CAR19 T cell generation is show in in FIG. 8. Western blot analysis and flow cytometry analysis showed that BAX and BAK protein expression was depleted in DKO-CAR19 T cells compared to NT CAR19 T cells (FIG.9). Flow-cytometry based BH3 profiling was performed to show that BAX and BAK1 double knockout CAR19 T cells were resistant to mitochondrial apoptosis as indicated by a substantial reduction in cytochrome c loss in DKO-CAR19 T cells upon Bim peptide exposure compared to the NT-CAR19 T cells (FIG. 10A, FIG. 10B). To further confirm that DKO-CAR19 T cells were resistant to mitochondrial apoptosis, NT and DKO-C ARI 9 T cells were treated with BH3 mimetics, which specifically induce mitochondrial apoptosis. Cells were treated with ABT-263, AZD5991, or combination ABT-263 and AZD5991 for 24 hours, after which T cell viability was assessed using a CELLTITER-GLO assay. DKO-CAR19 T cells were found to be resistant to single or combination BH3 mimetic treatment indicated by no reduction in viability following BH3 mimetic treatment compared to NT CAR19 T cells (FIG. 10C, FIG. 10D, FIG. 10E). Additionally, cells were treated with BH3 mimetics for up to 2.5 hours, after which caspase-3 / 7, downstream activators of mitochondrial apoptosis, were quantified using a Caspase-Gio activity assay. Single and dual BH3 mimetic treatment did not induce caspase-3 / 7 activation in DKO-CAR19 T cells, whereas substantial caspase 3 / 7 activation was observed in NT CAR19 T cells (FIG. 11A) To further test whether DKO-CAR19 T cells were resistant to mitochondrial apoptosis and retain their functional abilities to kill target tumor cells, NT and DKO-CAR19 T cells were pre-treated with dual BH3 mimetics (1 pM ABT-263 and 1 pM AZD5991) for three days. After this pretreatment, the cells were washed and co-cultured with NALM6-luc B-ALL cells for an additional 24 hours. Cells that had not been pretreated with the dual BH3 mimetics were also cocultured with NALM6-luc-B-ALL cells as a control. It was observed that the BH3 mimetic pre- treated DKO-C ARI 9 T cells retained a comparable cytotoxicity profile compared toMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOuntreated DK0-CAR19 T cells. However, pre-treating NT-CAR19 T cells with dual BH3 mimetics completely abolished their cytotoxic capabilities compared to untreated NT-CAR19 T cells (FIG. 11B)
[0125] Collectively, this data demonstrates successful generation of a BAX / BAK1 DKO-CAR19 T cell and that these DKO cells were resistant to mitochondrial apoptosis.Example 4: DKO-CAR19 T cells exhibit superior expansion, persistence and tumor control
[0126] To determine if DKO-CAR19 T cells possess enhanced expansion and persistence in vitro, NT and DKO-CAR19 T cells were transiently restimulated with anti-CD3 / 28 beads for 3 days, after which the beads were removed and the cells were cultured for up to 2 weeks in vitro. NT and DKO-CAR19 expansion was monitored by counting the number of viable cells using trypan blue and an automatic cell counter. In one donor, it was observed that DKO-CAR19 T cells exhibited superior expansion and persistence over a 2-week period, indicated by a two-fold increase in the number of DKO-CAR19 T cells compared to NT-CAR19 T cells (FIG. 12A).
[0127] To determine whether DKO-CAR19 T cells have superior expansion and persistence, NT and DKO-CAR19 T cells were co-cultured with Nalm6 B-ALL cells for up to 2 weeks. Additional tumor cells were added every 2-3 days to simulate constant antigen stimulation analogous to the tumor microenvironment. The number of viable NT and DKO-CAR19 T cells was counted using flow cytometry using counting beads every 2-3 days (FIG. 12B). In each of three independent donors, it was observed that DKO-C ARI 9 T cells expanded 2-fold more compared to the NT-CAR19 T cells (FIG. 13A).
[0128] To further investigate if the DKO-CAR19 T cells have superior expansion and persistence in vitro, NT and DKO-C ARI 9 T cells were chronically restimulated with anti-CD3 / 28 beads continuously for 31 days, replenishing the beads on day 21. Every 2 days, the number of viable cells was counted using trypan blue and an automated cell counter. In one donor, it was observed that DKO-CAR19 T cells exhibited superior expansion and persistence following a 31 -day culture indicated by 47-fold increase in the number of DKO-CAR19 T cells compared to NT-CAR19 T cells (FIG. 14).
[0129] To determine whether the observed enhanced persistence and expansion of the DKO-CAR19 T cells would translate to an increase in tumor control, a similar set of experiments as outlined in FIG. 12B. Tumor cell growth was monitored by counting the number of viable tumorMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOcells every 2-3 days (CD3-CD22+). It was observed that DK0-CAR19 T cells controlled tumor growth better than NT-CAR19 T cells in two independent donors (FIG. 13B).
[0130] Collectively, this data demonstrated that DKO-CAR19 T cells had superior expansion, persistence and tumor control in vitro.Example 5: DKO-CAR19 T cells possess a survival advantage against chemotherapy treatment and cytokine deprivation
[0131] NT- and DKO-CAR19 T cells were treated with a range of different anti-cancer drugs with distinct mechanisms of action to determine whether DKO-CAR19 T cells had a survival advantage against anti-cancer drugs generally. It was observed that DKO-CAR19 T cells were substantially less sensitive to multiple anti-cancer agents including etoposide (a topoisomerase II inhibitor), doxorubicin (a DNA inter calator), panobinostat (an epigenetic modulator) and dinaciclib (a cell cycle inhibitor) compared with NT-CAR19 T cells (FIG. 15A-D). Furthermore, cytokine deprivation in vivo is a substantial limiting factor for the expansion and survival of CAR T cells. The hostile tumor microenvironment is often depleted in the essential cytokine interleukin-2 (IL-2), which is critical for the survival, expansion and persistence of T cells. To determine whether DKO-CAR19 T cells had a survival advantage under IL-2 deprivation, NT and DKO-CAR19 T cells were cultured in IL-2 for 24 hours, after which IL-2 was removed. The growth and survival of the cells was monitored by counting the number of viable cells every 1-2 days. It was observed that DKO-CAR19 T cells survived better than NT-CAR19 T cells upon IL-2 cytokine deprivation (FIG. 15E).Example 6: DKO EGFR-CAR T cells are resistant to mitochondrial apoptosis
[0132] BAX BAK1 DKO EGFR-CAR T cells were generated as described in Example 3, but substituting an EGFR CAR construct for the CD 19 CAR construct used in Example 3. HCT116 cells, a solid epithelial tumor cell line derived from colorectal cancer, were used as tumor cell model because they homogenously express EGFR. NT and DKO EGFR-CAR T cells were cocultured with HCT116 cells and dual BH3 mimetics (ABT-263 and AZD5991 0.8 pM each) for 24 hours. Tumor cell viability was assessed after the 24-hour incubation using a luciferase assay.
[0133] As is shown in FIG. 16, HCT116 cells co-cultured with the BAX B AK1 DKO EGFR-CAR T cells and BH3 dual mimetics were less viable than cells treated with NT CAR-EGFRMRGRef: 0680.003583W001DFCI Ref: 3583.W01WOcells and the dual BH3 mimetics. This indicates that BAX BAK1 DKO EGFR-CAR T cells were resistant to mitochondrial apoptosis and capable of killing HCT116 cells following treatment with a dual BH3 mimetics.
[0134] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOSequence Listing Free TextSEQ ID NO: 1- BAX exon 2 spacerUGAGCAGAUC AUGAAGACAGSEQ ID NO: 2- tracrRNAGUUUUAGAGC UAUGCUSEQ ID NO: 3- BAK1 exon 5 spacer VIUCGGAAAAAG ACCUCUCGGGSEQ ID NO:4- BAK1 exon 5 spacer V2GCCCUACACG UCUACCAGCA
Claims
MRGRef: 0680.003583W001DFCI Ref: 3583.W01WOCLAIMS1. A genetically engineered T cell comprising:a chimeric antigen receptor (CAR); anda knockout of the BCL2 antagonist / killer 1 gene (BAK1), a knockout of the BCL2 associated X gene (BAX), or a combination thereof.
2. The T cell of claim 1 , wherein the CAR specifically binds to CD 19.
3. A method of producing an engineered T cell, the method comprising:contacting a first gene editing complex and a second gene editing complex with a T cell, wherein the first gene editing complex is configured to knock out the BAK1 gene and the second gene editing complex is configured to knock out the BAX gene; andcontacting the T cell with a polynucleotide encoding a CAR, thereby producing the engineered T cell.
4. The method of claim 3, wherein the first gene editing complex and / or the second gene editing complex comprises a CRISPR / Cas9 ribonucleoprotein (RNP) comprising a Cas9 protein and a guide RNA (gRNA).
5. The method of claim 4, wherein the gRNA of the first gene editing complex binds to exon 5 of BAK 1.
6. The method of claim 4, wherein the gRNA of the second gene editing complex binds to exon 2 of BAX.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO7. The method of any preceding claim, wherein the first gene editing complex comprises a guide RNA (gRNA) comprising a spacer sequence, wherein the spacer sequence comprises at least 95% identity to SEQ ID NO: 1 or SEQ ID NO:4.
8. The method of claim 3, wherein the CAR specifically binds to CD19 or EGFR.
9. The method of claim 3, wherein contacting a polynucleotide encoding a CAR with the T cell comprises contacting the T cell with a viral vector encoding a CAR.
10. A pharmaceutical composition comprising:a T cell comprising:a chimeric antigen receptor (CAR); anda knockout of the BAK1 gene, a knockout of the BAX gene, or a combination thereof; anda pharmaceutically acceptable carrier.
11. The pharmaceutical composition of claim 10, wherein the CAR specifically binds to CD 19 or EGFR.
12. The pharmaceutical composition of claim 10 or 11, further comprising one or more anticancer drugs such as AZD5991, ABT-263, etoposide, doxorubicin, panobinostat, and / or dinaciclib.
13. A method of treating cancer in a subject, the method comprising administering to the subject the pharmaceutical composition of any preceding claim.MRGRef: 0680.003583W001DFCI Ref: 3583.W01WO14. The method of claim 13, wherein the cancer comprises a solid tumor or a liquid tumor.
15. The method of claim 13 or 14, wherein the cancer is a blood cancer.
16. The method of claim 15, wherein the blood cancer is multiple myeloma or a B cell malignancy.
17. The method of any of claims 13-16, wherein further comprising administering to the subject one or more anti-cancer drugs such as AZD5991, ABT-263, etoposide, doxorubicin, panobinostat, and / or dinaciclib.
18. The genetically engineered T cell of any preceding claim, wherein the genetically engineered T cell exhibits improved resistance to cytokine deprivation relative to a nonengineered T cell.
19. The genetically engineered T cell of any preceding claim, wherein the genetically engineered T cell exhibits improved persistence and expansion relative to a non- engineered T cell.
20. The genetically engineered T cell of any preceding claim, wherein the genetically engineered T cell exhibits improved survival relative to a non- engineered T cell when treated with an anti- cancer drug.
Citation Information
Patent Citations
Activation of APC in Immunotherapy
US20200347367A1
Stably enginereed proteasome inhibitor resistant immune cells for immunotherapy
WO2018115189A1
Chimeric antigen receptors targeting tim-1
WO2018132695A1
Cellular based therapies targeting disease-associated molecular mediators of fibrotic, inflammatory and autoimmune conditions
WO2019036724A2
Signaling platforms for chimeric antigen receptor t cells
WO2020160419A1