Heterobifunctional compounds targeting PARP and brd

Heterobifunctional compounds targeting PARP and BET proteins through a linker overcome PARP inhibitor resistance in ovarian cancer by recruiting BET proteins to PARP2, enhancing treatment efficacy in resistant cancers and HR-deficient tumors.

WO2026117454A1PCT designated stage Publication Date: 2026-06-04THE SCRIPPS RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE SCRIPPS RES INST
Filing Date
2025-11-21
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Existing PARP inhibitors face challenges with primary and acquired resistance in ovarian cancer treatment, limiting their effectiveness in maintaining progression-free survival.

Method used

Development of heterobifunctional compounds, known as PARP-based chemical inducers of proximity (PCIPs), which combine a PARP inhibitor with a BET inhibitor through a plasma-resistant linker, recruiting BET proteins to PARP2 to inhibit DNA repair pathways.

Benefits of technology

PCIPs demonstrate potent anti-proliferative effects in PARP-resistant cancers, including increased sensitivity in PARP1 knockout cells and synthetic lethality with HR-deficient tumors, offering a new therapeutic modality to overcome resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025056542_04062026_PF_FP_ABST
    Figure US2025056542_04062026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are bifunctional compounds of the formula: (I) A— L— B and pharmaceutically acceptable salts thereof, wherein: A is an inhibitor of a poly (ADP-ribose) polymerase (PARP) protein; L is a linker that resists cleavage in plasma; and B is an inhibitor of a bromodomain and extraterminal (BET) protein. Also disclosed are methods of preparing such compounds, compositions comprising them, and methods of their use to treat cancer.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] TSRI 2262.1PC / TSR3173P 18350.049W01

[0002] HETEROBIFUNCTIONAL COMPOUNDS TARGETING PARP AND BRD

[0003] CROSS-REFERENCE TO RELATED APPLICATION

[0004] This application claims priority to U.S. provisional patent application no. 63 / 725,598, filed November 27, 2024 , the entirety of which is incorporated herein by reference.

[0005] GOVERNMENT SUPPORT

[0006] This invention was made with government support under CA280720-01A1 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] 1. BACKGROUND

[0008] Ovarian cancer (OC) is often diagnosed at an advanced stage and is associated with poor prognosis. Until recently, first-line treatment for advanced (International Federation of Gynecology and Obstetrics [FIGO] stage II-IV) OC included debulking surgery combined with platinum -based chemotherapy. Unfortunately, most patients relapse within three years despite treatment. O’Malley, D.M., et al., “PARP Inhibitors in Ovarian Cancer: A Review” Targeted Oncology 2023;18:471-501. The five- year survival rate of advanced OC patients is 35-40 percent. Liu, C., et al., “PARP1-DOT1L transcription axis drives acquired resistance to PARP inhibitor in ovarian cancer” Molecular Cancer 2024;23: 111.

[0009] Poly(ADP-ribose) polymerase (PARP) inhibitors (PARPis) have emerged as important new therapies in OC. Four such inhibitors — olaparib, niraparib, rucaparib, and talazoparib — have been approved for use in the United States for OC maintenance therapy. But while PARPi maintenance therapy significantly extends progression-free survival in ovarian cancer patients, an increasing number of patients develop primary or acquired resistance to PARPi. Id. It has been reported that more than 40% of BRCAm ovarian cancer patients fail to benefit from PARPi therapy. Li, H., et al., “PARP inhibitor resistance: the underlying mechanisms and clinical implications” Molecular Cancer 2020; 19: 107. A need exists for approaches to treating PARPi-resistant cancers.

[0010] 2. SUMMARY

[0011] This invention is directed, in part, to the treatment of PARPi-resistant cancers using chemical inducers of proximity (CIPs). In particular, this invention provides PARP -based CIPs (PCIPs) that are bifiinctional compounds of the formula:

[0012] A— L— B and pharmaceutically acceptable salts thereof, wherein: A is an inhibitor of poly (ADP-ribose) polymerase (PARP); L is a linker that resists cleavage in plasma; and B is an inhibitor of a BET protein.

[0013] In one embodiment of the invention, the moiety A is a residue of a drug that inhibits PARP, such as fuzuloparib, niraparib, olaparib, pamiparib, rucaparib, saruparib, or talazoparib. TSRI 2262.1PC / TSR3173P 18350.049W01

[0014] In one embodiment of the invention, the linker L comprises an aliphatic and / or polyethylene glycol (PEG) chain.

[0015] In one embodiment of the invention, the moiety B is a residue of a BET inhibitor, such as (+)-JQl.

[0016] This invention also encompasses pharmaceutical compositions comprising the bifunctional compounds disclosed herein and methods of their use to treat cancer.

[0017] 3. DESCRIPTION OF THE DRAWINGS

[0018] Certain aspects of the invention may be understood with reference to the accompanying figures.

[0019] FIGS, la-d relate to the discovery of PCIP-1. FIG. la provides chemical structures of certain PARP -based CIPs (PCIPs) comprising a JQ1 residue, a rucaparib residue, and linkers of varying types and lengths. FIG. lb shows BRD4 target engagement measured by competitive displacement of dBET6. Jurkat-BRD4-HiBit cells are treated with test compounds for 2 h and then for 45 min with 500 nM dBET6 (HiBiT luminescence normalized to DMSO control with no dBET6, n = 3, mean ± s.e.m.). FIG. 1c shows PARP1 target engagement measured by competitive displacement of SK-575. Jurkat-PARPl-HiBit cells are treated with test compounds for 2 h and then for 4 h with 250 nM SK-575 (HiBiT luminescence normalized to DMSO control with no SK-575, n = 3, mean ± s.e.m.). FIG. Id shows Jurkat viability after 72 h compound treatment (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.).

[0020] FIGS. 2a-g relate to PCIP-1 ternary complex formation. FIG. 2a shows the chemical structure of ewt-PCIP-1. FIG. 2b shows BRD4 target engagement measured by displacement of dBET6 (DMSO- normalized HiBiT luminescence, n = 3, mean ± s.e.m.). FIG. 2c shows PARP1 target engagement measured by displacement of SK-575 (DMSO-normalized HiBiT luminescence, n = 3, mean ± s.e.m.). FIG. 2d shows Jurkat viability after 72-h compound treatment (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 2e shows compound-induced FRET between 6xHis-BRD4 bromodomain 1 and biotin-PARPl catalytic domain (DMSO-normalized, n = 4, mean ± s.e.m.). FIG. 2f shows inhibition of HTRF signal (normalized by percent activity remaining) induced by 500 nM PCIP-1 (n = 4, mean ± s.e.m.). FIG. 2g shows co-IP of BRD4-2xHA following treatment of Jurkat cells with 1 pM of each indicated compound for 4 h.

[0021] FIGS. 3a-d relate to PCIP-1 inhibition of DNA damage repair. FIG. 3a shows Jurkat viability after 72 h compound treatment with and without 25 pM MMS (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 3b shows immunoblot following 24 h treatment of Jurkat cells. PCIP- I and JQ1 were used at 100 nM and 1 pM. All other compounds were used at 1 pM, with and without 25 pM MMS. FIG. 3c shows cell cycle analysis of Jurkat cells treated with indicated drugs for 24 h, JQ1 and PCIP-1 treated at 100 nM and 1 pM, all other compounds at 1 pM, with and without 25 pM MMS. FIG. 3d shows immunoblot analysis of Jurkat cells treated with PCIP-1 for 24 h, with and without 25 pM MMS.

[0022] FIGS. 4a-g relate to the mediation of PCIP-1 anti-proliferative effects by PARP2. FIG. 4a shows competitive growth assay testing the effect of / '4 / ? / ' / -sgRNA- l on the response of Jurkat-Cas9 cells to TSRI 2262.1PC / TSR3173P 18350.049W01 talazoparib (1 pM), PCIP-1 (1 pM), and ewt-PCIP-1 (1 pM), or JQ1 (250 nM). Proportion ofGFP- positive cells over time was measured by flow cytometry (n = 3, mean ± s.e.m.). FIG. 4b shows viability assay (72 h) in Jurkat-Cas9 cells with and without 25 pM MMS (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 4c shows chemical structures of PARP1 / 2 inhibitors and their corresponding IC50 values for PARP1 / 2 selectivity. FIG. 4d shows viability assay (72 h) in Jurkat-Cas9 cells with and without 25 pM MMS, cell cultures treated with 1 pM PCIP-1 (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 4e shows competitive growth assay testing the effect of ARP2-sgRNA-l on the response of Jurkat-Cas9 cells to 1 pM talazoparib, PCIP-1, ewt-PCIP-1, and JQ1. Proportion of GFP-positive cells over time was measured by flow cytometry (n = 3, mean ± s.e.m.). FIG. 4f shows viability assay (72 h) in Jurkat-Cas9 cells with and without 25 pM MMS (ATPlite luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 4g shows immunoblot analysis of Jurkat-CAS9 cells after 100 nM compound treatment after 24h, with and without 25 pM MMS.

[0023] FIGS. 5a-c relate to the synthetic lethality of PCIP-1 in BRCA mutated cancers. FIG. 5a shows DLD1 viability after 6 day compound treatment (CellTiter-Glo luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 5b shows HCT116 viability after 6 day compound treatment (CellTiter-Glo luminescence normalized to DMSO, n = 3, mean ± s.e.m.). FIG. 5c shows RPEl-hTERT-TP53KOviability after 6 day compound treatment (CellTiter-Glo luminescence normalized to DMSO, n = 3, mean ± s.e.m.).

[0024] 4. DETAILED DESCRIPTION

[0025] Heterobifunctional small molecules enable the rational design of chemical inducers of proximity (CIPs) that control diverse biological processes.1,2Recent examples have shown that heterobifunctional small molecules can control ubiquitination,5,12phosphorylation,13-15acetylation,16,17O-GlcNAcylation,18-20methylation,21endocytosis,22-24RNA hydrolysis,25,26transcription,27,28and subcellular localization,29,30among other effects.31This invention is based, in part, on the discovery that CIPs targeting members of the poly(ADP-ribose) polymerase (PARP) family of DNA repair proteins can be used to dramatically increase the efficacy of known PARP inhibitors.

[0026] PARP 1 / 2 inhibitors are approved to target homologous recombination (HR) -deficient cancers, a paradigmatic example of synthetic lethality caused by the increased sensitivity of these tumors to the inhibition of PARylation and the trapping of PARP1 onto sites of DNA damage.32-35This invention encompasses a series of heterobifunctional small molecules attaching PARP inhibitors such as rucaparib to JQ1, a chemical probe that binds to the bromodomains of the BET family transcriptional co-activators (BRD2 / 3 / 4).36,37Prior research demonstrated that both small molecules can be used to synthesize heterobifunctional compounds.38 4" Since the bromodomains of BET proteins function primarily to mediate protein localization, the research that let to this invention was prompted by the question of whether JQ1 can be used to recruit BRD4 to new locations in the cell while preserving its native proteinprotein interactions (PPIs) and functions.27,28,41,42It was thought that JQ1 could possibly be used to synthesize PARP -based CIPs (PCIPs) that would recruit functioning BET family proteins to PARP 1 / 2, TSRI 2262.1PC / TSR3173P 18350.049W01 potentially altering DNA repair pathways. However, the consequences of inducing spatial proximity between PARP and BET proteins were unknown. Thus, cell viability assays were used as a coarse-grained readout of biological activity, which was tracked alongside measurements of intracellular target engagement to identify compounds that were active at low equilibrium occupancy of their targets.

[0027] Through these studies, several CIPs were identified and at least one, referred to as “PCIP-1”, was shown to exhibit potent anti -proliferative activity despite low fractional engagement of PARP and BET proteins. Unlike conventional PARP inhibitors, which inhibit PARPl / 2-catalyzed PARylation, PCIP-1 inhibits DNA repair by recruiting BET proteins to PARP2, resulting in non-overlapping mechanisms of resistance but preserving synthetic lethality with (HR)-deficiencies. In fact, PARP1 knockout cells, which are resistant to PARP inhibition, show increased sensitivity to PCIP-1, suggesting that PCIPs may represent a new modality to target tumors with acquired resistance to PARP inhibition. Altogether, this invention provides a generalizable framework to expand the scope of proximity pharmacology, demonstrates the ability to rewire DNA repair pathways with CIPs, and establishes a new approach to targeting HR-deficient tumors through synthetic lethality.

[0028] A strategy to identify event-driven CIP activity

[0029] Candidate PCIPs were designed from JQ1 and rucaparib, attaching variable linkers at sites on each molecule informed by previously disclosed PROTACs (FIG. la).39,40To begin understanding the biological effects — if any — that may be provoked by the chemically induced proximity of PARP and BET proteins, we began by profding their effects on cellular viability as a granular readout of diverse biological activities. However, because PARP inhibitors and BET bromodomain inhibitors can elicit antiproliferative effects independently, we sought a strategy to differentiate between proximity-induced effects and occupancy-driven inhibition of either target. We hypothesized that any biological effects resulting from low fractional occupancy might reflect event-driven CIP activity. To test this, we developed a workflow to quantitatively compare the anti-proliferative effects of each PCIP relative to their intracellular target engagement profdes.

[0030] We used competitive PROTAC displacement assays to measure BRD4 and PARP 1 target engagement in living cells43,44In these assays, cells were pretreated with the candidate PCIPs and then exposed to a fixed concentration of a PROTAC, such that target engagement by the PCIP can be measured by the blockade of PROTAC-induced degradation. These measurements were enabled by fusing HiBiT to the carboxy (C)-termini of PARP 1 and BRD4 using CRISPR / Cas9-based endogenous genome editing, allowing for the highly sensitive detection of protein abundance through a luminescence-based protein complementation assay45,46BRD4 and PARP1 HiBiT reporters were potently degraded by the PROTACs, dBET6 and SK-575,47,48respectively, which was blocked by increasing concentrations of JQ1 or rucaparib, altogether validating these assays for making quantitative measurements of intracellular target engagement (FIG. lb,c).

[0031] Next, we profiled all PCIP candidates and their parent inhibitors for BRD4 target engagement, PARP1 target engagement, and cell viability effects in the Jurkat T-cell acute lymphoblastic leukemia (T- TSRI 2262.1PC / TSR3173P 18350.049W01

[0032] ALL) cell line (FIG. Ib-d). In these assays, JQ1 and rucaparib produced anti -proliferative effects at high fractional occupancy of BRIM and PARP1, respectively, consistent with their occupancy-driven mechanisms of action. In contrast, several PCIP candidates showed potent anti-proliferative effects despite weak engagement of BRD4 and PARPL The most profound effect was seen for 2 (PCIP-1), which inhibits cell viability at similar concentrations as JQ1 (IC50: JQ1 = 193 nM, PCIP-1 = 662 nM) but requires much higher concentrations to engage BRD4 in cells (EC50: JQ1 = 97 nM, PCIP-1 = 26 pM) (FIG. lb,d). In fact, PCIP-1 failed to saturate BRD4 even at the highest concentration tested, 50 pM (FIG. lb), altogether ruling out the possibility that its anti-proliferative effects can be explained by occupancy-driven inhibition of BET bromodomain proteins. Likewise, despite failing to show any detectable engagement of PARP1, PCIP-1 inhibited the viability of Jurkat cells more potently than rucaparib (FIG. lc,d), demonstrating that it does not act through an occupancy-driven mechanism of PARP inhibition either.

[0033] Initially, we attributed the weak engagement of BRD4 by several PCIPs to poor cell penetration, as these compounds maintained relatively strong engagement of purified recombinant BRD4 bromodomain 1 (BD1) in vitro. However, the relative rank in target engagement potencies among the candidate PCIPs differed between BRD4 and PARP1, suggesting a more complex explanation. For example, 4 was found to be among the worst at engaging BRD4 but the best at engaging PARP 1. Likewise, while 7 is the most potent engager of BRD4 in cells, it is among the worst for PARP 1. The source of these differences is not immediately clear but might plausibly be related to the ability of ternary complex formation to stabilize ligand binding through cooperativity.

[0034] PCIP-1 mediates ternary complex formation with PARP and BET proteins

[0035] To assess if the activity of PCIP- 1 is potentially mediated by the formation of a ternary complex, we synthesized the enantiomer of PCIP-1, which incorporates a stereochemical inversion within the JQ1 moiety that disrupts binding to BET bromodomains (FIG. 2a).36This control compound, ewt-PCIP-1 (8), is unable to engage BRD4 in cells and in vitro and engages PARP1 to the same degree as PCIP-1 (FIG. 2b, c). It also showed no impact on Jurkat viability (Fig. 2d), indicating that the activity of PCIP-1 is dependent on its ability to co-opt BET proteins. These data suggested that PCIP-1 might be able to induce the formation of a ternary complex at low fractional engagement of PARP and BET proteins, eliciting a loss of cell viability through an event-driven mechanism of action (MoA).

[0036] To assess its potential for ternary complex formation, we developed a homogenous time-resolved (TR)-FRET (HTRF) assay for the catalytic domain of PARP 1 and the first bromodomain of BRD4 (FIG. 2e). PCIP-1 induced a concentration-dependent increase in HTRF signal with a characteristic “hook effect” that is commonly observed in ternary complex equilibria (FIG. 2e).49PCIP-1 -induced FRET was suppressed in a dose-dependent manner by the addition of rucaparib or the BET bromodomain inhibitor, CPI-203, indicating that the HTRF assay reports on an authentic induced proximity effect (FIG. 2f). In contrast to PCIP-1, cw-PCIP- 1 was inactive across all concentrations tested (FIG. 2e), consistent with the inability to bind BRIM. To determine whether a ternary complex is formed in cells, we performed a co- TSRI 2262.1PC / TSR3173P 18350.049W01 immunoprecipitation (co-IP) experiment, which revealed an increased association between BRD4 and PARP1 / 2 in the presence of PCIP-1 but not in the presence of ewt-PCIP-1, rucaparib, or JQ1 (FIG. 2g). Based on these data, we concluded that PCIP- 1 is capable of inducing proximity between BET and PARP proteins, despite its weak equilibrium occupancy of these targets in cells.

[0037] PCIP-1 inhibits the repair of DNA damage

[0038] To gain a preliminary understanding of the biological processes underlying PCIP-1 -induced antiproliferative effects, we sought to determine whether PCIP-1 impacts the function of PARP1 / 2. To begin, we repeated the Jurkat cell viability assays in the presence of the DNA alkylating compound, methyl methanesulfonate (MMS), which is known to sensitize cancer cells to PARP 1 / 2 inhibition.50We found that the activities of PCIP-1 and rucaparib are improved in the presence of MMS, whereas JQ1 activity is unchanged, likely suggesting that PCIP-1 interferes with DNA damage repair (FIG. 3a). Notably, MMS does not change PCIP-1 engagement of BRD4 or PARP1 in cells, indicating that its enhanced activity does not arise from changes in equilibrium occupancy. By immunoblot analysis of the DNA damage marker, yH2AX, we confirmed that PCIP-1 inhibits the repair of MMS-induced DNA damage (FIG. 3b).51,52As expected, this was also observed for rucaparib, but not for JQ1 or ewt-PCIP-1, altogether indicating that PCIP-1 interferes with PARP 1 / 2 -dependent DNA repair pathways through a bifunctional mechanism of action. Cell cycle analysis further supported an impact on DNA repair by demonstrating that PCIP-1 induces a strong S-phase arrest, which is comparable to the effects of rucaparib but not observed for its associated control compounds (FIG. 3c). Additionally, we observed markers of apoptosis, including dose-responsive and time-dependent increases in the levels of cleaved PARP 1 / 2 and cleaved Caspase 3, both of which tracked with the accumulation of yH2AX (FIG. 3d). However, whereas rucaparib potently inhibits PARP -catalyzed PARylation, PCIP-1 showed minimal effects on global PARylation levels (FIG. 3b), differentiating its cellular mechanism of action from conventional PARP inhibitors and further confirming that it does not function through the occupancy -based inhibition of PARP proteins.

[0039] PCIP-1 activity is mediated by the recruitment of BET proteins to PARP2

[0040] These data suggest that PCIP-1 inhibits DNA repair through an event-driven pharmacology. To formally assess the requirement for PARP 1 / 2 engagement in this MoA, we performed competitive growth experiments in which Cas9-expressing cells are transduced with a bicistronic vector encoding an sgRNA (single-guide RNA) for targeted gene disruption and EGFP (enhanced green fluorescent protein) for tracking the competitive fitness of sgRNA-positive cells relative to untransduced cells in the same population.53Conventional PARP inhibitors function through a dominant-negative MoA that involves the trapping of PARP1 onto sites of DNA damage such that PARP1 knockout confers resistance to PARP inhibitors.50As expected, treatment with the PARP inhibitor talazoparib selected for Jurkat cells transduced with each of the 3 distinct sgRNAs targeting PARP1 in our competitive growth assays (FIG. 4a). In contrast, PCIP-1 had the opposite effect, rapidly eliminating cells expressing PA RP1 -targeted TSRI 2262.1PC / TSR3173P 18350.049W01 sgRNAs from the population. This selective pressure was not exerted by JQ1 or ewt-PCIP-1, suggesting that PCIP-1 functions through a mechanism distinct from both PARP inhibitors and BET bromodomain inhibitors.

[0041] To enable dose-response assays, we isolated a population of PARP1 knockout cells by selecting sgRNA-positive cells to homogeneity with talazoparib (1 pM). Loss of PARP1 expression in these cells was validated by immunoblot analysis and by their resistance to multiple distinct PARP inhibitors. Consistent with the previous competitive growth experiments, cell viability assays revealed that PCIP-1 potency is improved by more than 10-fold in these PARP1 loss-of-function cells compared to control cells harboring an sgRNA targeting the AAVS1 safe-harbor locus (FIG. 4b). These data, which revealed that PARP1 knockout cells are more sensitive to PCIP-1 despite being resistant to conventional PARP inhibitors further highlight the differentiated mechanism of action by which PCIP-1 inhibits cell viability.

[0042] Based on the divergent effects of PCIP-1 and conventional PARP inhibitors in response to PARP1 knockout, we hypothesized that PCIP- 1 might function through PARP2 instead of PARP 1. To test this hypothesis, we evaluated whether saturating the PARP2 ligand-binding site with excess talazoparib could block the anti-proliferative effects of PCIP-1 in PARP1 knockout cells. Indeed, co-treating with talazoparib (1 pM) fully blocked the anti -proliferative effects of PCIP-1 in each of the 3 distinct PARP1- deficient Jurkat populations. Four PARP inhibitors — olaparib, talazoparib, rucaparib, and saruparib — were tested for their ability to block the effects of PCIP- 1. These structurally distinct ligands share single- digit-nanomolar potency for PARP1, but their potencies for PARP2 vary dramatically, ranging from 6 nM to 1.4 pM (FIG. 4c).54All four compounds blocked the effects of PCIP-1 in a dose-responsive manner and at concentrations that tracked with their respective PARP2 potencies (FIG. 4c, d), indicating that PCIP-1 functions through PARP2.

[0043] To validate these findings further, we sought to establish PARP1 loss-of-function cells through an alternative experimental procedure, using electroporation to introduce a CRISPR / Cas9 ribonucleoprotein (RNP) complex targeting the PARP1 gene into wild-type Jurkat cells (using the sgRNA- 1 sequence previously used in competitive growth assays). We treated the electroporated cells for 14 days with 1 pM talazoparib to select for insertion-deletion alterations (indels) causing PARP1 loss-of-function, which was confirmed by TIDE (tracking of indels by decomposition) and was functionally validated by resistance to four distinct PARP inhibitors.55Consistent with previous results, these cells were more than 10-fold sensitized to PCIP-1 compared to wild-type Jurkat cells, and the anti -proliferative effects of PCIP-1 can be blocked by co-treatment with 1 pM talazoparib. Once again, we observed that the blockade of PCIP-1- induced cell viability effects by each of the four PARP inhibitors corresponded with their relative PARP2 potencies.

[0044] These data indicate that PCIP-1 functions through the recruitment of BET proteins specifically to PARP2. To test this orthogonally, we performed competitive growth assays evaluating whether PARP2 loss-of-function can confer resistance to PCIP-1. Indeed, PCIP-1 rapidly selected for Jurkat-Cas9 cells transduced with sgRNAs targeting PARP2, which was not observed with JQ1, talazoparib, or ewt-PCIP-1 (FIG. 4e). This experiment was performed with three additional sgRNAs targeting PARP 2, producing the TSRI 2262.1PC / TSR3173P 18350.049W01 same results in each instance. After completion of the competitive growth assay, Jurkat-Cas9 cells that had been transduced with / N / ? / '2-targcting sgRNAs and selected with PCIP- 1 were expanded and confirmed to harbor PARP2 knockout by immunoblot analysis. These were then used for dose-response assays, which demonstrated decreased sensitivity to the anti-proliferative effects of PCIP- 1 (FIG. 4f). Notably, the resistance of PARP2 knockout cells to PCIP-1 tracked with a decrease in the ability of PCIP- 1 to inhibit the repair of DNA damage (FIG. 4g). Finally, we recapitulated these results in Jurkat cells electroporated with CRISPR / Cas9 RNPs targeting the PARP2 gene using an sgRNA distinct from the four used for competitive growth assays.

[0045] Synthetic lethality between PCIP-1 and HR deficiency

[0046] Since PCIP-1 inhibits the repair of DNA damage through a mechanism that is differentiated from conventional PARP inhibitors, we sought to determine if it remained synthetically lethal with genetic alterations that cause HR deficiencies. To test this, we characterized its effects in DLD1, HCT116, and RPE1-TP53KOcell lines with and without knockout of BRCA1 or BRCA2, which are commonly used to test the effects of PARP inhibitors and other agents exploiting synthetic lethality with HR deficiencies.66In DLD1 cells, rucaparib and PCIP-1 show little effect on the viability of parental cells. However, we found that BRCA2KOcells are highly sensitive to PCIP-1, showing more than 100-fold sensitization compared to parental cells (FIG. 5a). These BRCA2KOcells are also highly sensitive to rucaparib, but its effects were less potent than PCIP- 1. The effects of JQ 1 were unaltered by BRCA2 knockout and ent- PCIP-1 did not impact the viability of parental or BRCA2KOcells. We observed similar effects to varying degrees in HCT116 cells and RPE1-TP53KOcells (FIG. 5b, c), further confirming the synthetic lethality between PCIP-1 and HR-deficient tumors. The RPE1 model was previously used to discover a mechanism of resistance to PARP inhibitors involving the restoration of HR through the knockout of 53BPl61 (,iAs expected, 53BP1 knockout successfully reversed rucaparib-induced cytotoxicity, but it only partially reduced the anti -proliferative effects of PCIP-1, further reinforcing that PCIP-1 acts through a differentiated mechanism of action compared to conventional PARP inhibitors. These results suggest PCIPs may provide an opportunity to overcome resistance to PARP inhibition that occurs through the restoration of HR.69,70Combined with our observation that PAR I knockout cells are hypersensitive to PCIP-1, these data suggest that PCIPs may be able to address two of the predominant pathways for acquired resistance to PARPi therapy.

[0047] Discussion

[0048] The modular construction of heterobifunctional small molecules has enabled the rational discovery of CIPs that can rewire cellular interactions.1,2Targeted protein degradation (TPD) remains the most advanced application of proximity pharmacology, but it is now joined by a growing list of other CIPs.5,31While proximity-induced changes in post-translational modifications (PTMs) can be relatively straightforward to measure, at least in principle, other potential outcomes of induced proximity can be comparatively difficult to anticipate. The number of unanticipated pharmacological mechanisms that have TSRI 2262.1PC / TSR3173P 18350.049W01 been revealed by serendipitously discovered CIPs — e.g., steric inhibition of enzyme activity by cyclophilin / immunophilin recruitment,56-59induced degradation by polymerization of BCL6,71,72and destruction of the nuclear pore complex by TRIM21 ligands73-75— highlights the exceptionally diverse cellular effects that can be achieved by induced proximity. It is therefore unsurprising that new classes of CIPs have been relatively difficult to discover, particularly those that do not directly regulate a measurable PTM.

[0049] While PARP proteins have been successfully targeted by PROTAC degraders,40,47DNA repair processes have not, to our knowledge, been rewired through the design of other heterobifunctional CIPs. In demonstrating synthetic lethality with HR deficiencies, PCIP-1 reflects favorably on the potential for this class of CIPs to be explored as a new therapeutic modality. The increased sensitivity of PARP1 knockout cells to PCIP- 1 suggests PCIPs might afford an attractive mechanism to overcome or circumvent a common form of PARPi drug resistance.69,70

[0050] 4.1. DEFINITIONS

[0051] When used herein, the term “alkenyl” is accorded its conventional meaning. Examples of alkenyl moieties include straight-chain and branched C2-20, C2-12 and C2-6 alkenyl such as vinyl, allyl, 1-butenyl, 2- butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3 -methyl- 1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2- butenyl, 1 -hexenyl, 2-hexenyl, 3 -hexenyl, 1 -heptenyl, 2-heptenyl, 3 -heptenyl, 1 -octenyl, 2-octenyl, 3- octenyl, 1-nonenyl, 2-nonenyl, 3-nonenyl, 1 -decenyl, 2-decenyl and 3 -decenyl.

[0052] The term “alkyl” is accorded its conventional meaning. Examples of alkyl moieties include straight-chain and branched C1-20 alkyl, C1-12 alkyl, C1-6 alkyl, C1-4 alkyl, and C1-3 alkyl, such as methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, isobutyl, pentyl, hexyl, isohexyl, heptyl, 4,4-dimethylpentyl, octyl, 2,2,4-trimethylpentyl, nonyl, decyl, undecyl, and dodecyl. Unless otherwise indicated, the term “alkyl” encompasses cycloalkyl.

[0053] The term “alkynyl” is accorded its conventional meaning. Examples of alkynyl moieties include straight-chain and branched C2-20, C2-12 and C2-6 alkynyl, such as ethynyl and 2-propynyl (propargyl).

[0054] The term “aryl” refers to a single all-carbon-backbone aromatic ring or a multiple condensed all- carbon-backbone ring system wherein at least one of the rings is aromatic. Examples include C6-20, Ce-i4, C6-12, and C2-10 rings and multiple condensed carbon ring systems (e.g., ring systems comprising 2, 3 or 4 rings) having 9 to 20 carbon atoms in which at least one ring is aromatic and wherein the other rings may be aromatic or not aromatic. The rings of multiple condensed ring systems may be connected to each other via fused, spiro, or bridged bonds when valency allows. Examples of aryl moieties include anthracenyl, azulenyl, fluorenyl, indanyl, indenyl, naphthyl, phenyl, phenanthrenyl, and 1, 2, 3, 4- tetrahy dronaphthyl .

[0055] The term “include” has the same meaning as “include, but are not limited to,” and the term “includes” has the same meaning as “includes, but is not limited to.” Similarly, the term “such as” has the same meaning as the term “such as, but not limited to.” TSRI 2262.1PC / TSR3173P 18350.049W01

[0056] The term “pharmaceutically acceptable salt” refers to a salt that is generally recognized as safe to administer to a subject. Examples of pharmaceutically acceptable salts include acetate, chloride, diphosphate, hydrochloride, maleate, phosphate, potassium, sodium, and sulfate.

[0057] The terms “subject” and “patient” are used interchangeably. The terms “subject” and “subjects” refer to an animal, such as a non-primate mammal (e.g., cow, pig, horse, cat, dog, rat, and mouse) and a primate (e.g., monkey, a chimpanzee, human). Preferred subjects are human (e.g, adult humans).

[0058] A “therapeutically effective amount” of a compound is an amount sufficient to provide a therapeutic benefit in the treatment or management of a disease or condition, or to delay or minimize one or more symptoms associated with the disease or condition. A “therapeutically effective amount” of a compound means an amount, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of the disease or condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces, or avoids symptoms or causes of a disease or condition, or enhances the therapeutic efficacy of another therapeutic agent.

[0059] The terms “treat,” “treating” and “treatment” contemplate an action that occurs while a patient is suffering from a specified disease or disorder, which reduces the severity of the disease or disorder or retards or slows the progression of the disease or disorder.

[0060] Unless otherwise indicated, an adjective before a string of nouns should be construed to apply to each. For example, the phrase “optionally substituted pyridyl, pyrazyl, or furanyl” means the same as “optionally substituted pyridyl, optionally substituted pyrazyl, or optionally substituted furanyl”.

[0061] A wavy line “ •nnn' ” that intersects a bond in a chemical structure indicates the point of attachment of the bond that the wavy bond intersects in the chemical structure to the remainder of a molecule.

[0062] Compounds disclosed herein may exist as tautomeric isomers. Although only one delocalized resonance structure may be depicted, all such forms are contemplated within the scope of the invention.

[0063] Compounds disclosed herein may exist as zwitterions (e.g., at pharmacological pH). Unless otherwise indicated, it should be understood that a chemical drawing depicting the structure of such a compound encompasses all of its zwitterionic forms.

[0064] Some compounds exist as stereoisomers. When a stereoisomer of compound is defined by its name (e.g. , with the use of R or .S') or is depicted in a drawn structure (e.g. , using a bold, bold-wedge, dashed, or dashed-wedge to depict the relevant chemical bond), the enantiomeric excess (ee) of that compound, unless otherwise indicated, is to be understood to be at least 60, 70, 80, 90, 95, or 99%. A compound or composition enriched with one stereoisomer of a compound has that one stereoisomer in an amount measurably greater than the compound’s other stereoisomer(s). For example, a compound enriched with an R enantiomer will have an enantiomeric excess of that enantiomer vis-a-vis the S enantiomer.

[0065] Unless otherwise indicated, a composition described as comprising one stereoisomer of a compound should be understood as being substantially free of the compound’s other isomer(s). For example, if a composition is defined as comprising the R isomer of a racemic compound, that composition is substantially free of the compound’s S isomer, i.e., the composition does not contain a measurable TSRI 2262.1PC / TSR3173P 18350.049W01 amount of the S isomer or contains the R isomer in an enantiomeric excess of greater than 90 percent (e.g. , greater than 95 or 99 percent) . Similarly, a method that comprises the use (e.g. , administration) of one stereoisomer of a compound is to be understood as a method of using an enantiomeric excess of that stereoisomer.

[0066] With regard to the claims, if a first claim recites a compound, which compound belongs to a generic chemical structure or is a salt thereof, a dependent claim that recites the compound of the first claim should, unless otherwise indicated, be construed as encompassing both the compound and its salt(s).

[0067] 4.2. COMPOUNDS

[0068] This invention is directed to bifunctional compounds of the formula:

[0069] A— L— B and pharmaceutically acceptable salt thereof, wherein: A is an inhibitor of poly (ADP-ribose) polymerase (PARP); L is a linker that resists cleavage in plasma; and B is an inhibitor of a BET protein and / or is a moiety that binds to a bromodomain of a BET protein.

[0070] Compounds of this invention can be prepared from derivatives of known PARP and BET inhibitors that allow their coupling to a linker. The portion of the PARP or BET inhibitor that becomes part of the A — L — B compound is referred to herein as a “residue” of the inhibitor. The residue of an inhibitor preferably retains substantially all of the inhibitory and / or binding activity (vis-a-vis its target) of its parent compound, but needs to retain at least enough of the binding activity of its parent to bring the two targets — the PARP and BET proteins — together. Suitable methods of preparing residue precursors (i.e., a derivative of an inhibitor that can be coupled to a linker) are known in the art38 4" and described below. Methods of coupling those precursors with linkers are also well known in the art.

[0071] 4.2.1. PARP Inhibitors

[0072] This invention utilizes residues of known PARP inhibitors. These moieties may themselves be referred to herein as “PARP inhibitors” since their inhibitory activity is retained when coupled to the reminder of the A — L — B compound.

[0073] PARP inhibitors useful in this invention can inhibit PARP1 and / or PARP2. Particular PARP inhibitors include residues of ACE-86225106, amelparib, AMP-1707, CK-102, HRS-1167, IDX-1197, IMP-1734, mefuparib, NMS-03305293, palacarib, SC-10914, stenoparib, TQB-3823, or VB-15010.

[0074] Preferred PARP inhibitors include residues of fuzuloparib, niraparib, olaparib, pamiparib, rucaparib, saruparib, or talzoparib.

[0075] Some particular PARP inhibitor residues include residues of niraparib, olaparib, rucaparib, and saruparib: TSRI 2262.1PC / TSR3173P 18350.049W01 wherein the wiggly line denotes where the residue is bound to the linker.

[0076] 4.2.2. Linkers

[0077] The linker L is resistant to cleavage in plasma and in cells. Its resistance to enzymatic- and environmentally-induced (e.g. , pH) cleavage ensures that the two active moieties, or residues, are kept in close proximity when they enter the cell and interact with their targets.

[0078] Suitable linkers are known in the art, and include alkyl-based linkers, PEG-based linkers, triazole- based linkers, cycloalkane-based linkers, aromatic-based linkers, spiro-based linkers, fused heterocyclebased linkers, macrocyclic-based linkers, photo-caged linkers, and photo-switchable linkers. See, e.g., Dong, Y., et al., “Characteristic roadmap of linker governs the rational design of PROTACs” Acta Pharmaceutica Sinica B 2024;14(10):4266-4295.

[0079] Particular linkers comprise 2-[2-[2- (amino)ethoxy] ethoxy] acetic acid (AEEA), (8-amino-3,6- dioxa-octyl)succinamic acid (EBES), lysine, a cleavage-resistant peptide (i.e., a peptide resistant to cleavage in plasma), polyethylene glycol (PEG), and combinations thereof. Examples of cleavageresistant peptides — which are preferably non-immunogenic — include (GS)n, GSG, GG, and (EK)n, where n is 1-10, and combinations thereof.

[0080] Specific linkers include alkyl- and PEG-based linkers, such as -(CH2)m- and -O(CH2CH2O)n-, wherein m is 2-10 and n is 2-8. Others include spiro- and piperidine-based linkers, such as:

[0081] 4.2.3. BET Inhibitors

[0082] Members of the bromodomain and extraterminal (BET) protein family — BRD2, BRD3, BRD4, and BRDt — share a common architectural domain possessing an ET and two N-terminal bromodomains. See, e.g., Ah, H.A., et al., “A Comprehensive Review of BET Protein Biochemistry, Physiology, and Pathological Roles” Front. Pharmacol. 2022; 13:818891. The bifunctional compounds of this invention bring a BET protein (e.g., BRD4) into close proximity with a PARP protein by comprising a moiety that binds to a BET bromodomain. TSRI 2262.1PC / TSR3173P 18350.049W01

[0083] BET binders (e.g. , inhibitors) that can be used in this invention may bind to either or both bromodomains. Particular inhibitors known to have an affinity for the BD1 domain include GSK778, GSK789, JQ1, a xanthine derivative, olinone, MS436. Inhibitors that have an affinity for the BD2 domain include apabetalone (RVX-208), ABBV-744, GSK620, GSK046, BY27, and I-BET762. Id.

[0084] A particular BET inhibitor is (+)-JQ 1. See, e.g., Filippakopoulos, P., et al., “Selective inhibition of BET bromodomains” Nature 2010; 468(7327): 106701073. A residue of (+)-JQ 1 is shown below:

[0085] 4.3. METHODS OF USE

[0086] This invention encompasses methods of killing cancer cells which comprise contacting a cancer cell (in vitro or in vivo) with a compound of the invention.

[0087] This invention also encompasses a method of treating cancer, which comprises administering to a patient a therapeutically effective amount of a compound of the invention. Examples of cancers include bladder cancer, brain cancer, breast cancer, colorectal cancer, endometrial cancer, gastric cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, and testicular cancer.

[0088] Particular cancers include breast, fallopian tube, ovarian, primary peritoneal, or prostate cancer with germline or somatic BRCA mutations or homologous recombination deficiencies.

[0089] Particular cancers are resistant to PARP inhibitor monotherapy. For example, particular cancers are resistant to fuzuloparib, niraparib, olaparib, pamiparib, rucaparib, saruparib, or talzoparib.

[0090] In some embodiments of the invention, the patient is non-responsive to a PARP inhibitor. In some embodiments, the patient is unable to tolerate adverse effects associated with a PARP inhibitor.

[0091] In some embodiments, the compound is administered in combination with another therapeutic agent. Therapeutic agents include other anti -cancer drugs, anti-emetics, and pain relievers.

[0092] 4.4. PHARMACEUTICAL FORMULATIONS

[0093] Compounds disclosed herein may be systemically administered in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable, edible carrier. They may be in the form of single unit dosage forms (e.g., enclosed in hard or soft shell gelatin capsules or compressed into tablets). For oral therapeutic administration, an active compound may be combined with one or more excipients in the form of ingestible tablets, buccal tablets, capsules, caplets, troches, elixirs, suspensions, syrups, and wafers. TSRI 2262.1PC / TSR3173P 18350.049W01

[0094] Compounds may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of an active compound or its salts may be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0095] Pharmaceutical dosage forms suitable for injection or infusion may include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0096] Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by fdter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-fdtered solutions.

[0097] 4.5. EXPERIMENTAL DETAILS

[0098] 4.5.1. Genetic Modification of Cell Lines

[0099] Table 1 provides a list of nucleotide sequences used in the examples below.

[0100] Table 1 TSRI 2262.1PC / TSR3173P 18350.049W01

[0101] Jurkat-BRD4-HiBit and Jurkat-PARPl-HiBit cell line creation

[0102] All components necessary were ordered from Integrated DNA Technologies. A Neon Transfection System (ThermoFisher) was used to electroporate cells employing the 1 pL tip kit. Briefly, sgRNA complexes are synthesized by mixing equal volumes of crRNA (2 pL, 160 pM in nuclease free water, aatcttttctgagcgcacct (SEQ. ID No. 1) for BRD4-HiBit and taagacctccctgtggtaat (SEQ. ID No. 2) for PARPl-HiBit) and tracrRNA (2 pL, 160 pM) and are incubated at 37 °C for 30 min before Cas9 (2.7 pL, 10 pg / pL, Alt-R™ S.p. Cas9 Nuclease V3, catalog number 1081058) and duplex buffer (1.3 pL, 30 mM HEPES, pH 7.5; 100 mM potassium acetate in nuclease free water) are added. This suspension is incubated at 37 °C for an additional 15 min to form the active RNP complex. The RNP solution (1 pL) is added to ssODN (2 pM in nuclease free water, SEQ. ID No. 3 for BRD4-HiBit and SEQ. ID No. 4 for PARPl-HiBit). The resulting mixture is electroporated (1700 pulse voltage, 20 millisecond, and 1 pulse for Jurkats) containing 200,000 cells in electroporation buffer before the cells are deposited into antibiotic free media. The cells are allowed to rest in a 37 °C incubator for 24 h before additional antibiotic containing media is added. Replicates with the highest overall signal were selected and expanded.

[0103] 22RvlFKBP12F36V-2xHA-BRD4

[0104] BRD4 (CCDS 12328.1 from NCBI) was inserted into the gateway compatible lentiviral destination plasmid pLEX_305-N-dTAG 22Rvl (Addgene #91797) using gateway cloning. The final lentiviral FKBP12F36V-2xHA-BRD4 plasmid was confirmed by whole plasmid sequencing. 22Rvl cells were purchased from ATCC (CRL-2505). Lenti-X 293T (DMEM supplemented with 10% FBS and Gibco Antibiotic -Antimycotic) cells were purchased from Takara for lentivirus production. All cell lines were tested negative for mycoplasma infections regularly. Lentiviral packaging plasmids pMD2.G (a gift from Didier Trono, Addgene plasmid #12259; http: / / n2t.net / addgene: 12259; RRID:Addgene_12259), psPAX2 (a gift from Didier Trono, Addgene plasmid #12260; http: / / n2t.net / addgene: 12260; RRID:Addgene_12260), and the lentiviral expression plasmid were co-transfected to Lenti-X 293T cells to produce corresponding lentivirus. Supernatants with viral particles were harvested at 48 and 72 hours after transfection, filtered with 0.44 pm membrane and concentrated by 50-fold with Lenti-X Concentrator (Takara, #631232). All cells were transduced by spinoculation at 800 g for 1 hour at room TSRI 2262.1PC / TSR3173P 18350.049W01 temperature supplemented with 8 pg / mL polybrene. After at least 72 hours post transduction, cells were selected with 2 pg / mL puromycin for at least 1 week, and expression was confirmed by immunoblot.

[0105] Jurkat-PARP1KOand PARP2KOvia Transfection and TIDE Analysis

[0106] PARP1KOcells and PARP2K0cells were generated via electroporation using the Neon

[0107] Electroporation System protocol described in “Jurkat-BRD4-HiBit and Jurkat-PARPl-HiBit Cell Line Creation” by omitting the procedural step of mixing RNP and ssODN. Instead, RNP is directly mixed into cells suspended in electroporation buffer before electroporation. The sgRNA sequences used were as follows: PARP1 (cgatgcctattactgcactg; SEQ. ID No. 5) and PARP2 (catgcaatgaattctacacc; SEQ. ID No. 5A). PARP1KOcells were selected via continual treatment of 1 pM talazoparib over 14 days, beginning 7 days after transfection. PARP2K0cells were selected via continual treatment of 500 nM PCIP-1 (compound 2) for 10 days, beginning 7 days after transfection. Following selection, gDNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Cat # 69504). Amplicons were generated for sequencing using CloneAmp HiFi PCR (Takara, Cat. # 639298) and custom DNA oligos were designed for PARP1 (IDT, 5’ -cttgctctagagtgccagg-3 ’ (SEQ. ID No. 6), 5’ -ggaggtattttgcgttgagaat-3 ’ (SEQ. ID No. 7) and PARP2 (IDT, 5’ -gccccacttggtaggacttc-3 ’ (SEQ. ID No. 8), 5’ -tttctaggtcacggggctct-3 ’ (SEQ. ID No. 9)). PCR purification was done using the QIAquick PCR Purification Kit (Qiagen, Cat # 28104). Purified product was then sent for Sanger sequencing via GeneWiz. Knockout percentage was measured by tracking of indels by decomposition (TIDE) sequencing and visualized online (https: / / tide.nki.nl / .).

[0108] Jurkat-Cas9

[0109] Lenti X cells were co-transfected with BFP Cas9 plasmid pFUGW Cas9-BFP (Addgene #127396) and packaging plasmids psPAX2 and pMD2.G. Lentivirus was collected and concentrated with Lenti X concentrator (Takara). Jurkat cells at passage number 13 were transduced with IX BFP Cas9 Lentivirus. Cells were sorted into three BFP expression level populations. The highest BFP expression level population was expanded for transduction with Brunello guide sgRNA lentivirus for future gene knockout studies.

[0110] Jurkat-Cas9-PARP1KO

[0111] Jurkat-Ca9 cells were transduced with PARP1 targeting sgRNAs-1-3: cgatgcctattactgcactg (SEQ. ID No. 10), taccgatcaccgtacccaca (SEQ. ID No. 11), and agctaggcatgattgaccgc (SEQ. ID No. 12) that were cloned into an LRG lentiviral vector with EGFP tags. Lenti X cells were co-transfected with PARP1 sgRNA plasmids and packaging plasmids psPAX2 and pMD2.G. Lentivirus was collected and concentrated with Lenti X concentrator (Takara).

[0112] Jurkat-Cas9-PARP2KO

[0113] Jurkat-Ca9 cells were transduced with PARP2 targeting sgRNAs-1-4: catgcaatgaattctacacc (SEQ. ID No. 13), aataccaagaaagccccact (SEQ. ID No. 14), gggggcgcaaggcacaatgt (SEQ. ID No. 15), and ttgttcaggcaatctcaaca (SEQ. ID No. 16) that were cloned into an LRG lentiviral vector with EGFP tags. TSRI 2262.1PC / TSR3173P 18350.049W01

[0114] Lenti X cells were co-transfected with PARP1 sgRNA plasmids and packaging plasmids psPAX2 and pMD2.G. Lentivims was collected and concentrated with Lenti X concentrator (Takara).

[0115] 4.5.2. Cellular and Biochemical Assays

[0116] Graphing and ECso and ICso calculations

[0117] All assay graphs were plotted using Graphpad Prism 10 and fitted using Log(inhibitor) vs. response (three parameters) which automatically calculated EC50 and ICso value. For datasets where drug treatments did not result in a complete response magnitude the graphs were modelled using Log(inhibitor) vs. response Variable slope (4 parameters), where the data was constrained to the lowest and highest values found in the dataset, to ensure accurate calculation of ECso and ICso values.

[0118] BRD4 target engagement assay

[0119] Cells were brought to 1,000,000 cells / mL, and 18,000 cells (18 pL) were seeded into white 384- well polystyrene microplates (Greiner Bio-One) that had been seeded with indicated drugs by transferring from a source plate using an 655 Echo Acoustic Liquid Handler Instrument (Beckman). A 0.5 pM working solution of dBET6 was prepared by diluting 4 pL of a 10 mM DMSO stock into 8 mL of RPMI- 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 5% Antibiotic- Antimycotic (Thermo Fisher, #15240062). A corresponding DMSO-only solution in supplemented media was prepared in parallel. After 2 hours of compound incubation, 2 pL of the 0.5 pM dBET6 solution was added to wells that were pre-seeded with compound, while 2 pL of DMSO-only media was added to wells pre-seeded with DMSO. After a further 45-minute incubation at 37 °C, 20 pL of Nano-Gio® HiBiT Lytic Detection Reagent (Promega, N3050) was added to each well. Plates were centrifuged at 200 x g for 1 minute, incubated for 5 minutes at room temperature, and luminescence was measured using a Clariostar Plus microplate reader (BMG Labtech). Luminescence values from dBET6-treated wells were normalized to DMSO-only controls to visualize the rescue of the degradation effect. The assay was performed with three technical replicates per condition. Data points are presented as the mean of these replicates, and error bars represent the standard error of the mean (s.e.m.).

[0120] PARP1 target engagement assay

[0121] Cells were brought to 1,000,000 cells / mL, and 18,000 cells (18 pL) were seeded into white 384- well polystyrene microplates (Greiner Bio-One) that had been seeded with indicated drugs by transferring from a source plate using a 655 Echo Acoustic Liquid Handler Instrument (Beckman). A 0.23 pM working solution of SK-575 was prepared by diluting 2 pL of a 10 mM DMSO stock into 8 mL of RPMI- 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 5% Antibiotic- Antimycotic (Thermo Fisher, #15240062). A corresponding DMSO-only solution in supplemented media was prepared in parallel. After 2 hours of compound incubation, 2 pL of the 0.5 pM SK-575 solution was added to wells that were pre-seeded with compound, while 2 pL of DMSO-only media was added to wells pre-seeded with DMSO. After a further 4 hours incubation at 37 °C, 20 pL of Nano-Gio® HiBiT Lytic TSRI 2262.1PC / TSR3173P 18350.049W01

[0122] Detection Reagent (Promega, N3050) was added to each well. Plates were centrifuged at 200 x g for 1 minute, incubated for 5 minutes at room temperature, and luminescence was measured using a Clariostar Plus microplate reader (BMG Labtech). Luminescence values from SK-575 -treated wells were normalized to DMSO-only controls to visualize the rescue of the degradation effect. The assay was performed with three technical replicates per condition. Data points are presented as the mean of these replicates, and error bars represent the standard error of the mean (s.e.m.).

[0123] Viability assay for Jurkat, Jurkat-PARP1KOand Jurkat-PARP2KOcells

[0124] Cells were diluted to a concentration of 20,000 cells / mL, and 1,000 cells (50 pL) were seeded into white 384-well polystyrene microplates (Greiner Bio-One). Compounds were pre-deposited into the plates using an 655 Echo acoustic liquid handler (Beckman) to transfer from a source plate. Viability studies involving methyl methane sulfonate (MMS) were performed by pretreating cells with MMS from a 25 mM stock solution prepared in RPMI-1640 supplemented media. Cells in 50 pL of culture media at 20,000 cells / mL were seeded into the compound-containing plates and incubated for 72 hours at 37 °C. Cell viability was assessed using ATPlite luminescence detection reagent (Revvity), which was diluted 1:4 using MilliQ water. Following incubation, 25 pL of ATPlite reagent, diluted 1:4 with MilliQ water, was added to wells. Plates were centrifuged at 200 x g for 1 minute, incubated at room temperature for 5 minutes, and luminescence was measured using a Clariostar Plus microplate reader (BMG Labtech). In all cases, the mean of technical replicates was plotted, with error bars representing the standard error of the mean (s.e.m.). Values were determined by normalizing treated wells to DMSO wells.

[0125] Jurkat-Cas9 PARP1 and PARP2 Knockout Competitive Growth Assays

[0126] Jurkat cells expressing Cas9 with a BFP reporter tag were sorted and high expression level populations were collected. Three Brune llo sgRNA guides targeting PARP1 and four sgRNA guides targeting PARP2 were cloned into lentiviral expression vectors and Lentivirus was prepared and collected as previously described (Takara). JURKAT Cas9 cells were transduced with a titration of virus containing PARP1 or PARP2 guides, with AAVS1 sgRNA as a negative control, and RPS19 sgRNA as a positive control to verify Cas9 activity. On day 3 post transduction, GFP expression was quantified via flow cytometry (NovoCyte / ACEA Biosciences / Analyzer, NovoCyte 3000 with NovoSampler Pro) and populations with approximately 50% GFP expression were expanded and selected using 250 nM JQ1, 1 pM PCIP-1, 1 pM ewt-PCIP-1, or 1 pM talazoparib for PARP1KOor 1 pM JQ1, PCIP-1, ewt-PCIP-1, or talazoparib for PARP2K0. These doses were selected from approximate IC50 values in Jurkat cells treated for 72 h via viability assays. Cells were collected for GFP analysis in triplicate and sub-cultured every 3-5 days for up to 21 days post transduction. Relative % GFP from averages of triplicates are plotted over time with error bars showing standard error the mean (s.e.m.). Conditions with fewer than 5% viable cells were excluded from the plots. After 21 days, triplicate wells of 1 pM talazoparib selected PARP1KOJURKAT cells were combined and expanded in the presence of 1 pM talazoparib to maintain selective pressure. As a control, AAVSl’s triplicates were pooled and expanded. After 14 days of selection with TSRI 2262.1PC / TSR3173P 18350.049W01

[0127] PCIP-1, PARP2KOcells were cultured in the absence of PCIP-1 for 14 days and expanded for antiproliferation assays.

[0128] Viability assay for Jurkat-Cas9-PARP1KOand Jurkat-Cas9-PARP2KOcells

[0129] JURKAT-Cas9 cells selected for PARP1KOwith 1 pM talazoparib were cultured in absence of talazoparib for 72 hours prior to seeding cells for the anti-proliferation assays. JURKAT-Cas9 cells selected for PARP2K0with 1 pM PCIP-1 were cultured in absence of PCIP-1 for 2 weeks prior to seeding cells for the anti-proliferation assays, in order to recover the viability of the populations. 30 nL of serial half-log diluted compounds were printed into white 384 well plates (Coming REF 353988) using an 655 Echo Acoustic Liquid Handler (Beckman). 3,400 cells in 30 pL of media were plated in triplicate. 15 pL of ATPLite reagent diluted 1:4 with MilliQ water was added to wells after 72 hours of growth and plates were incubated for 10 minutes in the dark at room temperature while shaking. Fluorescence values were measured using the Clariostar Plus microplate reader (BMG Labtech). The average of triplicate values are plotted with error bars representing standard error of mean (s.e.m.).

[0130] PARP2 target engagement assay

[0131] This assay was carried out by Reaction Biology using the following protocol “HEK293 cells transiently expressing PARP2-NanoLuc Fusion Vector were seeded into the wells of 384-well plates. The cells were pre-treated with PARP Tracer-01 and then treated with reference compound olaparib for 1 hour. The BRET signal was measured on an Envision 2104 Multilabel Reader.” (https : / / www .reactionbiology .com / datasheet / parp2 -nano / )

[0132] Homogenous time-resolved FRET (HTRF) assay

[0133] HTRF assays were performed in assay buffer (25 mM HEPES pH 7, 20 mM NaCl, 0.2% Pluronic F-127, and 0.05% BSA). Assays consisted of 1 nM LanthaScreen Eu-anti-His Tag antibody (ThermoFisher, Cat. No, PV5597), and 8.9 nM SureLight allophycocyanin-streptavidin (PerkinElmer, APC-SA, Cat. No. CR130-100). 5 pL was dispensed per well into black 1536-well plates (Coming, Cat. # 9007BC) via Multidrop Combi reagent dispenser (Thermo). Compound addition was performed with the 655 Echo Acoustic Liquid Handler (Beckman). Plates were incubated for 2 hours in the dark after compound administration before measurement via PHERAstar plate reader (BMG Labtech; simultaneous dual emission; excitation = 337 nm, emission 1 = 620 nm, emission 2 = 665 nm).

[0134] For the BRD4 BD1-H4 tetra-acetylated peptide HTRF consisted of 10 nM BRD4 BD1 (BPS Bioscience, Cat. # 31042) and 13.3 nM tetra-acetylated H4 (BioVision Cat. No. 7144-01). HTRF signals (ration of emission 2 to emission 1) from DMSO-treated wells (maximum signal control) and no-peptide control wells (minimum signal control) were used for percent inhibition calculations. For the ternary complex HTRF, 50 nM PARPI Cat and 25 nM BRD4 BD1 were added simultaneously. HTRF signals were compared to DMSO-treated wells (minimum signal control). TSRI 2262.1PC / TSR3173P 18350.049W01

[0135] Viability assays for homologous recombination deficient cell lines

[0136] Cell viability was assessed using the CellTiter-Glo luminescent cell viability reagent (Promega) in 96-well opaque white polystyrene microplates (Costar 3917, non-clear bottom). Peripheral wells were filled with media only and excluded from analysis to buffer against edge effects due to evaporation. Each experimental well contained 100 pL of media and cells seeded at the following densities:

[0137] • DLD1 and BRCA2kocells: 1,400 cells / well

[0138] • HCT116 and BRCA2kocells: 900 cells / well

[0139] • RPEl-hTERT-Flag-Cas9-TP53koand derived lines (BRCAlko, BRCAl / 53BPko): 800 cells / well

[0140] Cells were allowed to adhere and recover before drug treatment. For compound dosing, the media in each well was first aspirated and replaced with 100 pL of fresh culture media. Drug-containing media were prepared at 2X concentration and added at 100 pL per well, resulting in a final volume of 200 pL and a IX final drug concentration. Eight-point, 4-fold serial dilutions were prepared, with final compound concentrations ranging from 10 pM down to 0.152 nM, plus a vehicle-only (0 pM) control. Cells were treated with compounds for 6 days. At endpoint, media were aspirated from all wells and replaced with 100 pL of fresh media. An additional 100 pL of fresh media was added to four wells containing no cells to serve as blank controls. Subsequently, 100 pL of CellTiter-Glo reagent was added to each well, followed by a brief incubation according to the manufacturer’s instructions.

[0141] Luminescence was measured using a BioTek Synergy Neo plate reader (Gen 5.2.09). Three technical replicates per treatment condition. The mean of technical replicates was plotted, with error bars representing the standard error of the mean (s.e.m.).

[0142] Cell Cultures

[0143] The following cell lines were used in this work: Jurkat, Jurkat-BRD4-HiBit, Jurkat-PARPl-HiBit, 22Rvl-FKBP12F36V-2XHA-BRD4, Jurkat-PARP1KO, Jurkat-PARP2K0, Jurkat-Cas9, Jurkat-Cas9- PARP1KO(sgRNAl-3), Jurkat-Cas9-PARP2KO(sgRNA 1-4), RPEl-hTERT TP53-KO Flag-Cas9 (RPE1- P53KO), RPE1-P53KO-BRCA1KO, RPE1-P53KO-BRCA1KO-53BP1KO, DLD1, DLD1-BRCA2KO, HCT116, and HCT116-BRCA2KO.

[0144] All Jurkat isogenic cell lines were cultured in RPMI1640 media containing 10% heat-inactivated fetal bovine serum (FBS) and 5% Antibiotic -Antimycotic (Thermofisher, #15240062) and stored at 37°C at 5% CO2. The parental line was a gift from the lab of Professor Michael Bollong’s lab at Scripps Research.

[0145] 22Rvl-FKBP12F36V-2XHA-BRD4 cells were cultured in RPMI1640 media containing 10% heat- inactivated fetal bovine serum (FBS) and were supplemented with 5% Antibiotic-Antimycotic (Thermofisher, #15240062) and stored at 37°C at 5% CO2.

[0146] All RPEl-hTERT TP53KOisogenic cell lines were cultured in DMEM +1% penicillin / streptomycin and 2 pg / mL blasticidin and stored at 37°C at 5% CO2. The parental cell line RPEl-hTERT was purchased from ATCC and the ensuing genetic alterations are described in.1 TSRI 2262.1PC / TSR3173P 18350.049W01

[0147] All DLD1 isogenic cell lines were cultured in RPMI-1640 +1% penicillin / streptomycin +10% FBS and stored 37°C at 5% CO2, DLD1-BRCA2KOstorage was supplemented with 3% O2. These isogenic cell lines were purchased from Horizon.

[0148] All HCT116 wild type and genetically modified lines were cultured in ATCC-formulated McCoy’s 5a medium +1% penicillin / streptomycin +10% FBS and stored 37°C at 5% CO2, HCT116- BRCA2KOstorage was supplemented with 3% O2. HCT116 cells were purchased from ATCC and the BRCA2KOwas originally purchased from Ximbio.

[0149] Immunoblot analysis

[0150] At time of cell harvest, 3-6 million cells per condition were isolated. The cells were spun down (500 g x 5 min) and then given washed with 1 mb of PBS before being spun down again. Cells were flash frozen in liquid nitrogen before protein isolation. Protein was isolated by 30-minute treatment on ice of 100 pL RIPA lysis buffer (ThermoFisher, Cat # 89900) with lx Halt protease inhibitor (ThermoFisher, Cat # 78429) and 1: 1000 benzonase nuclease (Sigma- Aldrich, Cat # 70746-4). Cleared protein lysates were isolated from cell debris through centrifugation (16000 g x 10 min @ 4°C). Protein concentrations were obtained through BCA assay (ThermoFisher, Cat # 23225). 4x SDS sample buffer and 10% 2- mercaptoethanol were added to each sample and then protein was denatured at 95°C for 10 minutes. 16 pg of each sample was loaded into a well of a 4-12% Bis-Tris gel (ThermoFisher, Cat # NW04127). Protein ladders (BioRad, Cat # 1610375) were added on both sides of the samples. Protein gels were run at 90 volts for 10 minutes and then 134 volts for 42 minutes in MES buffer (Invitrogen, Cat # B000202). Proteins were transferred to nitrocellulose membranes and then blocked in 5% nonfat milk in TBS-T for 1 hour at RT. Primary antibodies were incubated over the membranes overnight at 4°C with light shaking. Following TBS-T washes, secondary infrared antibodies (1:7000 IRDye® 680RD Goat anti-Mouse IgG Secondary Antibody 926-68070 and 1:7000 IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody 926-32211) were incubated with light shaking for 1 hour at room temperature. Following final washes, blots were imaged on the Odyssey CLx Images (LI-COR). The following primary antibodies were used 1: 1000, unless otherwise stated, for overnight blotting: (1:5000 for Jurkat-Cas9 cells and 1:2500 for Jurkat wild type cells) anti-GAPDH (Sigma- Aldrich, Cat # G8795), anti-PARPl (CST, Cat # 9542), anti-PARP2 (CST, Cat # 20009S), anti-PAR (CST, Cat # 89190), anti-yH2A.X (CST, Cat # 2595S), and anti-cleaved caspase 3 (CST, Cat # 9661).

[0151] Co-immunoprecipitation

[0152] 22RV1FKBP12F36V-2XHA-BRD4 cells expressing BRD4_HA_dTAG were treated with compound for 4 hours. Cells were washed with cold PBS and scraped to detach cells from the dish. Following a PBS wash and centrifugation (500 g x 5 min at 4°C), cells were lysed with a buffer containing Cell Lytic M (Sigma-Aldrich, Cat # C2978) with lx Halt protease inhibitor (ThermoFisher, Cat # 78429) and 1: 1000 benzonase nuclease (Sigma- Aldrich, Cat # 70746-4). Pellets were sonicated and placed to rotate at 4°C for 1 hour. Cleared protein lysates were isolated from cell debris through TSRI 2262.1PC / TSR3173P 18350.049W01 centrifugation (16000 g x 10 min at 4°C). Protein concentrations were obtained through BCA assay (ThermoFisher, Cat # 23225). Input samples were prepared at 4 mg / mL with 50 pL aliquots removed for Western blotting. Anti-HA magnetic beads (Sigma- Aldrich, Cat # 88836) were washed with Cell Lytic M and 25 pL beads per 1 mL of protein was added to each sample. Beads and protein inputs were incubated with rotation overnight at 4°C. Beads were then collected through magnetization and washed 3 times with TBS-T. Protein was eluted by adding 40 pL IX loading buffer (IX SDS loading buffer + 2.5% 2- mercaptoethanol) and heated at 95°C for 10 minutes. Input samples were diluted to 2 mg / mL. 4x SDS sample buffer and 10% 2 -mercaptoethanol was then added to input samples and heated at 95°C for 10 minutes. 18 pL of each sample and input was loaded into a well of a 4-12% Bis-Tris gel (ThermoFisher, Cat # NW04127). Protein gels were run at 90 volts for 10 minutes and then 150 volts for 50 minutes in MES buffer (Invitrogen, Cat # B000202). Proteins were transferred to nitrocellulose membranes and then blocked in 5% nonfat milk in TBS-T for 1 hour at RT. Primary antibodies were incubated over the membranes overnight at 4°C with light shaking. Following TBS-T washes, secondary infrared antibodies (1:7000 IRDye® 680RD Goat anti-Mouse IgG Secondary Antibody 926-68070 and 1:7000 IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody 926-32211) were incubated with light shaking for 1 hour at RT. Following final washes, blots were imaged on the Odyssey CLx Images (LI-COR). The following primary antibodies were used 1 : 1000, unless otherwise stated, for overnight blotting: (1 :2500) anti-GAPDH (Sigma-Aldrich, Cat # G8795), anti-PARPl (CST, Cat # 9542), anti-PARP2 (CST, Cat # 20009S), anti-BRD4 (Bethyl, Cat # BL-151-6F11), and anti-HA (CST, Cat # 3724).

[0153] Cell cycle analysis

[0154] 100,000 cells were seeded per well in a 96-well plate and treated with compounds as a 1: 1000 dilution of DMSO stocks. Following incubation, plates were spun at 500 g for 5 minutes. Following two wash steps with PBS, cells were fixed overnight with cold 70% ethanol at 4°C overnight. Cells were then centrifuged at 1000 g for 5 minutes and washed twice with PBS. Cells were stained in the dark at room temperature in 100 pL PBS with 0.5 pg / mL RNAse A (Thermo, Cat. # EN0531) and 50 pg / mL propidium iodide (VWR, Cat. # 102876-812). Propidium iodide quantification was performed via flow cytometry on aNovoCyte Quanteon / Agilent / Analyzer (Quanteon 4025 with NovoSampler Q).

[0155] Protein production

[0156] The catalytic domain of PARP1 (amino acids 661-1014) was recombinantly expressed and purified in BL21 (DE3) cells (New England Biolabs). The protein was cloned into a pET28(a)+ expression vector with an N-terminal 6xHis tag and a C-terminal AviTag. BL21 (DE3) cells were cotransformed with the AviTag-containing construct and a biotin ligase expression vector, pBirAcm (Avidity). Bacteria was induced at an OD600 of 0.6 at 16°C by 1 mM isopropyl-P-D- thiogalactopyranoside (IPTG) (Fisher Scientific, Cat. # 50-213-380). Following a 20-hour incubation, the culture was harvested via centrifugation. The cell pellet was resuspended in lysis buffer (50mM sodium phosphate (pH 7.4), 500 mM NaCl, lOmM imidazole, lx Halt Protease Inhibitor Cocktail (Thermo TSRI 2262.1PC / TSR3173P 18350.049W01

[0157] Scientific, Cat. # 78429) and passed three times through a microfluidizer (Microfluidics). Following centrifugation at 16,000 g for 20 minutes at 4°C, the supernatant was incubated with TALON metal affinity resin (Fisher Scientific, Cat. # NC9306569) for 1 hour at 4°C. The resin was then placed over an elution column where it was washed 2x with lysis buffer before elution via ImL fractions of elution buffer (50 mM sodium phosphate (pH 7.4), 500 mM NaCl, 300 mM imidazole, lx Halt Protease Inhibitor Cocktail. Fractions containing protein underwent buffer exchange to size exclusion buffer (20mM Tris- HC1 (pH 7.5) in a 10K desalting column (Amnicon Ultracel). Purified protein was then further purified through a HiLoad Superdex column on an AKTA pure size exclusion system (Cytiva).

[0158] 4.5.3. Synthetic Analytical Information

[0159] Analytical data. ’H,13C, and19F spectra were recorded on the following NMR spectrometers: Bruker AV NEO 400 MHz equipped with a 5 mm BBFO probe, Bruker AVIII HD 600 MHz equipped with a 5 mm CPQCI and 1.7 mm CPTCI CryoProbe, Bruker AVIII HD 600 MHz MNR equipped with a 5 mm CPDCH cryoprobe, or JEOL JNM-ECZ400R 400 MHz equipped with a 5 mm H / F / X royal probe. The spectrometers were automatically tuned and matched to the correct operating frequencies. Proton (’H), carbon (13C), and fluorine (19F) chemical shifts are reported in parts per million (8) with respect to tetramethylsilane (TMS, 8 = 0) and referenced internally with respect to the protio solvent impurity or hexafluorobenzene (HFB) for19F spectra (HFB, 8 = -164.9). Multiplicities are abbreviated: singlet, s; doublet, d; triplet, t; quartet, q; doublet of doublet, dd; doublet of doublet of doublets, ddd; multiplet, m. Deuterated NMR solvents were obtained from Cambridge Isotope Laboratories, Inc., Andover, MA, and used without purification. Spectra were digitally processed (phase and baseline corrections, integration, peak analysis) using MestreNova. Unless otherwise noted all spectra were obtained at 298 K.

[0160] Ultra performance liquid chromatography. Ultra performance liquid chromatography (UPLC) data was collected using a Waters I-Class LC with diode array and QDa mass spectrometer.

[0161] High-resolution mass spectrometry. HRMS (ESI-TOF) was run as direct injection and analyzed on an Agilent 6230 TOF LC / MS System.

[0162] Purification chromatography. Normal and reverse phase chromatography were run using Teledyne ISCO Combiflash NextGen 300+ auto columns. Column size and conditions are compound specific and are listed as such. Unless otherwise explicitly stated, compounds purified via reverse phase chromatography are isolated as the TFA salt.

[0163] Reagents and solvents. Reagents and solvents were purchased from commercial sources and used as received. All solvents were purchased as anhydrous Sure / Seal™.

[0164] Reactions. Reactions were performed as written and monitored by ultra-performance liquid chromatography (UPLC). TSRI 2262.1PC / TSR3173P 18350.049W01

[0165] 4.5.4. Synthesis of Inhibitor Residues

[0166] Bifunctional molecules were synthesized by tethering two protein ligands together via linkers of varying sizes and chemical compositions. The ligands were derivatives of known inhibitors, conjugated to the linker in a way that does not materially affect their interaction with their targets. A representative approach to preparing some residues is shown below.

[0167] Scheme 1

[0168] Synthesis of 5-bromo-8-fluoro-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (2) A 250 mb round-bottom flask was equipped with a magnetic stir bar and charged with 8-fluoro-

[0169] 2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (1) (1.0 g, 4.90 mmol). The starting material was then dissolved in a 1: 1 mixture of dichloromethane and tetrahydrofuran (32 mL). The solution was stirred vigorously and brought to 0 °C using an ice bath. The solution was stirred until the starting material was evenly dispersed throughout the solution for about twenty minutes. Following this, 5-bromo-8-fluoro- 2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (1.64 g, 5.14 mmol) was slowly added to the solution portion-wise; rapid addition of this compound results in poor reaction outcomes. The solution was allowed to warm to room temperature, and after four hours, the reaction had reached completion. The solution was transferred to a 1.0 L separatory funnel and diluted with 800 mL of ethyl acetate. The organic layer was then washed with water (3 x 5 mL), saturated aqueous bicarbonate solution (3 x 5 mL), TSRI 2262.1PC / TSR3173P 18350.049W01 and brine (3 x 5 mL) before being dried over magnesium sulfate. The solvents were removed using reduced pressure and the crude material was recrystallized using a mixture of water and methanol. The resulting heterogeneous solution was filtered, yielding a yellow powder (1.2 g, 87%) that was used without further purification. Note: The reaction can be run for 24 hours without any noticeable changes in product purity or yield. Additionally, once the reaction has reached completion the crude material can be recrystallized to yield pure product in comparable yield to the above -de scribed procedure. ’H NMR (600 MHz, DMSO) 5 12.13 (s, 1H), 8.26 (t, J= 5.8 Hz, 1H), 7.44 (dt, J= 12.0, 2.4 Hz, 1H), 7.30 (dt, J= 12.0, 2.4 Hz, 1H), 3.43 (br, 2H), 2.80 (br, 2H).

[0170] Synthesis of tert-butyl (4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)carbamate (4)

[0171] A 20 mL dram vial was equipped with a magnetic stir bar and charged with 5-bromo-8-fluoro- 2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (2) (1.0 g, 4.0 mmol), (4-((tert- butoxycarbonyl)amino)phenyl)boronic acid (1.2 g, 4.0 mmol), and sodium carbonate (700 mg, 7.0 mmol). The solid was suspended in two mL of dioxane and 500 pL of water which was subsequently degassed using a ballon of nitrogen and vent needle over the course of twenty minutes. Ten minutes into the degassing procedure l,l'-bis(diphenylphosphino)ferrocene] dichloropalladium (II) (100 mg, 0.2 mmol) was added portion wise. After degassing for an additional twenty minutes the needles were removed from the dram vial septum and the reaction was heated using an aluminum hot black to 80 °C and heated for 48 h. Once the reaction had reached completion the mixture was allowed to cool to room temperature before being diluted with 600 mL of ethyl acetate and transferred to a 1 L separatory funnel. The organic layer was washed with water (3 x 5 mL) and saturated aqueous sodium bicarbonate (3 x 5 mL) before being dried by washing with brine (3 x 5 mL) and then finally dried over magnesium sulfate. The dried organic solution was flushed through a basic alumina plug and the volatiles were removed using rotary evaporation. This residue was dissolved in N,N-dimethylformamide (1.0 mL) and loaded directly onto a 42-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 0- 100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25 -minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a beige powder (532 mg, 40%). Note: Recrystallization of the crude material using a mixture of water and MeOH after filter the organic layer through basic alumina provided analytically pure product in the same quantity as using reverse phase technologies. ’H NMR (600 MHz, DMSO) 5 11.58 (s, 1H), 9.53 (s, 1H), TSRI 2262.1PC / TSR3173P 18350.049W01

[0172] 8.23 (t, J = 5.8 Hz, 1H), 7.61 (d, J = 8.3 Hz, 2H), 7.53 (d, J = 8.5 Hz, 2H), 7.41 (dd, J = 11.1, 2.4 Hz, 1H), 7.29 (dd, J = 9.1, 2.4 Hz, 1H), 3.38 (s, 2H), 3.06 - 2.97 (m, 2H), 1.50 (s, 9H).

[0173] Synthesis of 5-(4-aminophenyl)-8-fluoro-2,3,4,6-tetrahydro-lH-azepino [5,4,3-cd] indol-l-one

[0174] (5)

[0175] A 20 mL dram vial was equipped with a magnetic stir bar and charged with tert-butyl (4-(8- fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)carbamate (4) (500 mg, 1.3 mmol) and was then dissolved in trifluoroacetic acid (3 mL), before being stirred at room temperature. The reaction was monitored using UPLC and following completion after two hours the trifluoroacetic acid was removed using reduced pressure. This residue was dissolved in N,N-dimethylformamide (0.5 mL) and loaded directly onto a 42 -gram RediSep Cl 8 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 0-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a neon yellow powder (350 mg, 94%).

[0176] Note: After removing trifluoroacetic acid using rotary evaporative technologies, the crude residue can be diluted with tetrahydrofuran and stirred with Biotage® MP-Carbonate beads and subsequently filtered through a two sequential 2 cm tall pads of basic alumina and magnesium sulfate inside of a 12 mL plastic syringe equipped with a EZflow filter 0.2 pM. After removing the volatiles this technique produced product 5 in equivalent yields as the initial procedure. ’H NMR (400 MHz, DMSO) 5 11.46 (s, 1H), 8.20 (t, J= 5.8 Hz, 1H), 7.45 - 7.35 (m, 3H), 7.26 (dd, J= 9.2, 2.4 Hz, 1H), 6.86 (d, J= 8.1 Hz, 2H), 3.44 > 3.34 (m, 2H), 3.04 - 2.95 (m, 2H).

[0177] Synthesis of tert-butyl 4-(2-fluoro-5-((4-oxo-3,4-dihydrophthalazin-l-yl)methyl)benzoyl)- piperazine-l-carboxylate (8) TSRI 2262.1PC / TSR3173P 18350.049W01

[0178] A 20 mL dram vial equipped with a stir bar was charged with 2-fluoro-5-((4-oxo-3,4- dihydrophthalazin-l-yl)methyl)benzoic acid (6) (1.0 g, 0.14 mmol), HATU (1.53 g, 4.02 mmol), acetonitrile (5.0 mL), and N,N-diisopropylethylamine (1.17 mL, 6.71 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of tert-butyl piperazine- 1 -carboxylate (7) (624 mg, 3.35 mmol). Stirring at room temperature continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 10 minutes and was allowed to stir for an additional 20 minutes. The reaction mixture was diluted with 200 mL of ethyl acetate and the organic layer was washed with water (3 x 5 mL), saturated ammonium chloride (1 x 5 mL) and brine (3 x 5 mL), before being dried over magnesium sulfate. The organic layer was then separated from the drying agent by filtration before being removed using rotary evaporation. The crude material was dissolved in N,N-dimethylformamide (1.5 mL) and then was directly loaded onto a 40-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 0-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (750 mg, 48%).

[0179] Note: After completion of the reaction the crude mixture can be diluted with water (2 mL) and diluted with ethyl acetate (500 mL). After the layers separate in a IL separatory funnel, the organic is washed with water (3 x 5 mL) and brine (3 x 5 mL) before being dried over sodium sulfate. Once the organics are removed a white powder is produced in higher yields than the procedure when ran at a 0.07 mmol scale (500 mg, 66%). This method produces a compound of slightly lower analytical purity, but pure enough to be used without consequence in the following step. ’H NMR (600 MHz, DMSO) 5 12.59 (s, 1H), 8.26 (dd, J= 7.9, 1.5 Hz, 1H), 7.96 (d, J= 8.0 Hz, 1H), 7.91 - 7.86 (m, 1H), 7.83 (t, J= 7.5 Hz, 1H), 7.44 (ddd, J= 8.1, 5.1, 2.3 Hz, 1H), 7.35 (dd, J= 6.5, 2.3 Hz, 1H), 7.23 (t, J= 9.0 Hz, 1H), 4.33 (s, 2H), 3.59 (s, 2H), 3.38 (s, 2H), 3.26 - 3.17 (m, 2H), 3.14 (d, J= 5.8 Hz, 2H), 1.40 (s, 9H).

[0180] Synthesis of 4-(4-fluoro-3-(piperazine-l-carbonyl)benzyl)phthalazin-l(2H)-one (9)

[0181] A 20 mL dram vial was equipped with a magnetic stir bar and charged with tert-butyl 4-(2-fluoro- 5 -((4-oxo-3,4-dihydrophthalazin-l-yl)methyl)benzoyl)piperazine-l -carboxylate (5) (500 mg, 1.1 mmol) and was then dissolved in trifluoroacetic acid (3 mL), before being stirred at room temperature. The reaction was monitored using UPLC and following completion after two hours the trifluoroacetic acid was removed using reduced pressure. This residue was dissolved in N,N -dimethylformamide (0.5 mL) and TSRI 2262.1PC / TSR3173P 18350.049W01 loaded directly onto a 42-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 0-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (390 mg, 99%).

[0182] Note: After removing trifluoroacetic acid using rotary evaporative technologies, the crude residue can be diluted with tetrahydrofuran and stirred with Biotage® MP-Carbonate beads and subsequently filtered through a two sequential 2 cm tall pads of basic alumina and magnesium sulfate inside of a 12 mb plastic syringe equipped with a EZflow filter 0.2 pM. After removing the volatiles this technique produced product 9 in equivalent yields as the initial procedure. ’H NMR (600 MHz, DMSO) 5 12.60 (s, 1H), 8.89 (s, 2H), 8.27 (d, J= 7.7 Hz, 1H), 7.95 (d, J= 8.0 Hz, 1H), 7.89 (t, J= 7.6 Hz, 1H), 7.84 (t, J = 7.5 Hz, 1H), 7.49 (ddd, J= 8.1, 5.2, 2.3 Hz, 1H), 7.39 (dd, J= 6.5, 2.3 Hz, 1H), 7.26 (t, J= 9.0 Hz, 1H), 4.34 (s, 2H), 3.80 (s, 2H), 3.38 (t, J= 5.4 Hz, 3H), 3.19 (s, 2H), 3.06 - 2.97 (m, 2H).

[0183] 4.5.5. Synthesis of 4 (R)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f| [l,2,4]triazolo[4,3-a] [l,4]diazepin-6-yl)acetic acid (11 (R))

[0184] The procedure and outcomes were identical to those in the synthesis of 11 (S).

[0185] 4.5.6. Synthesis of 5-(4-aminophenyl)-8-fluoro-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-l-one (S3)

[0186] A 25 mb round bottom flask was equipped with a magnetic stir bar and charged with 5-bromo-8- fluoro-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (SI) (500 mg, 1.7 mmol), 4-(4,4,5,5- tetramethyl-l,3,2-dioxaborolan-2-yl)aniline (S2) (464 mg, 2.1 mmol), and sodium carbonate (350 mg, 3.5 mmol) before the flask was sealed with a rubber septum. The solid was suspended in 8 mb of dioxane and 500 pL of water which was subsequently degassed using a ballon of nitrogen and vent needle over the course of twenty minutes. Ten minutes into the degassing procedure l,l'-bis(diphenylphosphino)- ferrocene]dichloropalladium(II) (65 mg, 0.08 mmol) was added portion wise. After degassing for an additional twenty minutes the needles were removed from the flask septum and the reaction was heated using an oil bath to 80 °C and heated for 16 h. Once the reaction had reached completion the mixture was allowed to cool to room temperature before being transferred to a 1 L beaker by washing and diluting 800 mb of ethyl acetate. The organic layer was sequentially washed in a 1 L separatory funnel with water (3 x TSRI 2262.1PC / TSR3173P 18350.049W01

[0187] 5 mL) and saturated aqueous sodium bicarbonate (3 x 5 mL), followed by a brine wash (3 x 5 mL), and then dried over magnesium sulfate. The dried organic solution was flushed through a basic alumina plug and the volatiles were removed using rotary evaporation. This residue was dissolved in N,N- dimethylformamide (1.0 mL) and dry loaded onto celite before being packed into a plastic cartridge which was directly loaded onto a 42-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a beige powder (210 mg, 40%). Spectra is consistent with primary literature.2’H NMR (400 MHz, DMSO-tL) 5 11.46 (s, 1H), 8.20 (t, J= 5.8 Hz, 1H), 7.45 - 7.35 (m, 3H), 7.26 (dd, J= 9.2, 2.4 Hz, 1H), 6.86 (d, J= 8.1 Hz, 2H), 3.44 - 3.34 (m, 2H), 3.04 - 2.95 (m, 2H).

[0188] 4.5.7. Synthesis of 4 (iS)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f| [l,2,4]triazolo[4,3-a] [l,4]diazepin-6-yl)acetic acid ((A)-S6)

[0189] A 20 mL dram vial was equipped with a magnetic stir bar and charged with tert-butyl tert-butyl (S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepin-6-yl)acetate ((A)-S4): (500 mg, 1.1 mmol) and was then dissolved in trifluoroacetic acid (3 mL), before being stirred at room temperature. The reaction was monitored using UPLC and following completion after two hours the trifluoroacetic acid was removed using reduced pressure. This residue was dissolved in N,N- dimethylformamide (0.5 mL) and loaded directly onto a 42-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a yellow powder (401 mg, 91%). ’H NMR (600 MHz, DMSO-d6) 5 7.56 - 7.52 (m, 2H), 7.48 (d, J= 8.2 Hz, 2H), 4.50 (t, J= 7.0 Hz, 1H), 3.50 - 3.43 (m, 1H), 3.40 - 3.33 (m, 1H), 2.65 (d, J= 1.3 Hz, 3H), 2.54 (p, J= 1.8 Hz, 2H), 2.45 (s, 3H), 2.12 (d, J= 1.3 Hz, 1H), 1.67 (s, 3H). TSRI 2262.1PC / TSR3173P 18350.049W01

[0190] 4.5.8. Synthesis of 4 (7?)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f|[l,2,4]triazolo[4,3-a][l,4]diazepin-6-yl)acetic acid (( ?)-S7)

[0191] The synthesis of this compound was achieved using procedures analogous to the synthesis of ((A)-

[0192] S6).

[0193] 4.5.9. General Approach to Rucaparib-JQl Based Molecules

[0194] Representative synthetic routes to obtain rucaparib-JQ 1 based heterobifunctional molecules are shown below.

[0195] Scheme SI TSRI 2262.1PC / TSR3173P 18350.049W01

[0196] 4.5.10. Synthesis of tert-butyl (5-((4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)amino)-5-oxopentyl)carbamate (S10)

[0197] A 3.0 mL dram vial equipped with a stir bar was charged with 5-((tert-butoxycarbonyl)amino)- pentanoic acid (S8) (122 mg, 0.51 mmol), HATU (232 mg, 0.61 mmol), N,N -dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (177 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-l-one (S3) (150 mg, 0.51 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after five and a half hours of stirring at room temperature. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0. 1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (l l l mg, 44%). ’H NMR (600 MHz, DMSO-t / 6) 5 11.63 (s, 1H), 10.05 (s, 1H), 8.25 (t, J= 5.9 Hz, 1H), 7.75 (d, J= 8.3 Hz, 2H), 7.57 (d, J= 8.3 Hz, 2H), 7.41 (dd, J= 11.0, 2.5 Hz, 1H), 7.30 (dd, J = 9.1, 2.5 Hz, 1H), 6.83 (t, J= 5.7 Hz, 1H), 3.39 (s, 2H), 3.03 (t, J= 4.9 Hz, 2H), 2.94 (q, J= 6.6 Hz, 2H), 2.34 (t, J= 7.4 Hz, 2H), 1.58 (p, J= 7.6 Hz, 2H), 1.42 (q, J= 7.6 Hz, 2H), 1.38 (s, 9H).13C NMR (151 MHz, DMSO-d6) 5 170.74, 167.86, 158.44, 156.89, 154.99, 150.55, 138.31, 136.01, 134.74, 127.66, 125.61, 125.02, 122.69, 118.45, 110.52, 108.71, 99.96, 76.75, 41.26, 35.50, 28.56, 28.17, 27.67, 21.86.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.91. HRMS (ESI-TOF) m / z: [M+H]+calculated for C27H32FN4O4: 495.2403, found: 495.2409. UPLC-MS, ESI+, m / z 495.31 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0198] 4.5.11. Synthesis of tert-butyl (9-((4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)amino)-9-oxononyl)carbamate (Sil)

[0199] A 3.0 mL dram vial equipped with a stir bar was charged with 9-((tert-butoxycarbonyl)amino)- nonanoic acid (S9) (110 mg, 0.51 mmol), HATU (232 mg, 0.61 mmol), N,N -dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (177 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-l-one (S3) (150 mg, 0.51 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after five and a half hours of stirring at room temperature. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0. 1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (154 mg, 55%). 'HNMR (400 MHz, DMSO-tL) 5 11.63 (s, IH), 10.05 (s, IH), 8.26 (t, J= 5.7 Hz, IH), 7.75 (d, J= 8.4 Hz, 2H), 7.57 (d, J= 8.5 Hz, 2H), 7.41 (dd, J= 11.0, 2.5 Hz, IH), 7.31 (dd, J = 9.1, 2.5 Hz, IH), 6.78 (s, IH), 3.39 (s, 2H), 3.03 (s, 2H), 2.89 (q, J= 6.6 Hz, 2H), 2.33 (t, J= 7.4 Hz, 2H), 1.60 (s, 2H), 1.37 (s, 9H), 1.27 (br, 9H).13C NMR (151 MHz, DMSO-tLi 5 172.06, 169.77, 159.64, 158.08, 156.12, 138.98, 136.89, 135.58, 128.38, 126.82, 125.34, 123.63, 119.54, 111.17, 110.16, 109.99, 101.00, 100.83, 42.58, 42.44, 37.16, 37.11, 29.96, 29.32, 29.20, 29.13, 28.63, 26.78, 25.60.19F NMR (376 MHz, DMSO- e, referenced to CeFe): 5 -123.9. HRMS (ESI-TOF) m / z: [M+H]+calculated for C31H40FN4O4: 551.3029, found: 551.3028. UPLC-MS, ESI+, m / z 551.47 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0200] 4.5.12. Synthesis of 5-amino-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)pentanamide (S12)

[0201] A 3.0 mL dram vial equipped with a stir bar was charged with tert-butyl (5-((4-(8-fluoro-l-oxo- 2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)amino)-5-oxopentyl)carbamate (S10) (45 mg, 91 pmol) and trifluoracetic acid (2.0 mL). The solution was allowed to stir at room temperature for 15.5 h, reaction completion was determined using UPLC, and before the solvent was removed using reduced pressure. The crude reaction solution was dissolved in N,N-dimethylformamide (1.0 mL) and directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (25 mg, 70%). ’H NMR (600 MHz, DMSO-tL) 5 11.66 (s, 1H), 10. 15 (s, 1H), 8.26 (t, J= 5.8 Hz, 1H), 7.76 (d, J= 8.7 Hz, 2H), 7.58 (d, J= 8.5 Hz, 2H), 7.42 (dd, J= 11.0, 2.5 Hz, 1H), 7.32 (dd, J= 9.0, 2.5 Hz, 1H), 3.40 (s, 2H), 3.03 (br, 2H), 2.83 (br, 2H), 2.39 (t, J= 7.1 Hz, 2H), 1.74 - 1.54 (m, 4H).13C NMR (151 MHz, DMSO-6) 5 171.51, 168.95, 159.53, 157.97, 139.30, 137.18, 135.77, 128.76, 126.79, 123.75, 119.54, 111.62, 109.97, 101.06, 42.33, 39.17, 36.17, 29.26, 27.09, 22.41.19F NMR (376 MHz, DMSO-tL. referenced to C6F6): 5 -123.83. HRMS (ESI-TOF) m / z: [M+H]+calculated for C22H24FN4O2: 395.1878, found: 395.1890. UPLC-MS, ESI+, m / z 395.31 [M+H]+.

[0202] 4.5.13. Synthesis of 9-amino-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)nonanamide (S13) TSRI 2262.1PC / TSR3173P 18350.049W01

[0203] A 3.0 mL dram vial equipped with a stir bar was charged with tert-butyl (5-((4-(8-fluoro-l-oxo- 2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)amino)-5-oxopentyl)carbamate (Sil) (134 mg, 243 pmol) and trifluoracetic acid (2.0 mL). The solution was allowed to stir at room temperature for 15.5 h, reaction completion was determined using UPLC, and before the solvent was removed using reduced pressure. The crude reaction solution was dissolved in N,N-dimethylformamide (1.0 mL) and directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (79 mg, 72%). ’H NMR (600 MHz, DMSO-tL) 5 11.65 (s, 1H), 10. 11 (s, 1H), 8.19 (t, J= 5.8 Hz, 1H), 7.70 (d, J= 8.7 Hz, 2H), 7.50 (d, J= 8.7 Hz, 2H), 7.34 (dd, J= 11.0, 2.5 Hz, 1H), 7.25 (dd, J= 9.1, 2.5 Hz, 1H), 3.32 (s, 2H), 2.96 (s, 2H), 2.64 (t, J= 7.5 Hz, 2H), 2.28 (t, J= 7.4 Hz, 2H), 1.54 (t, J= 7.2 Hz, 2H), 1.44 (t, J= 7.5 Hz, 2H), 1.23 (s, 10H).13C NMR (151 MHz, DMSO-tL) 5 171.98, 168.97, 159.49, 157.94, 139.46, 137.20, 135.84, 128.71, 126.64, 126.00, 123.76, 119.52, 111.53, 109.92, 100.89, 42.34, 36.89, 29.26, 29.14, 29.05, 28.98, 28.60, 26.38, 25.55.19F NMR (376 MHz, DMSO- e, referenced to CeFe): 5 -123.96. HRMS (ESI-TOF) m / z: [M+H]+calculated for C26H32FN4O2: 451.2504, found: 451.2509. UPLC-MS, ESI+, m / z 451.37 [M+H]+.

[0204] 4.5.14. Synthesis of (A)-5-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2, 3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)pentanamide (S14, compound 1)

[0205] A 3.0 mL dram vial equipped with a stir bar was charged with (.S)-4-(4-chlorophcnyl)-2.3.9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (19 mg, 0.05 mmol), HATU (22 mg, 0.06 mmol), N,N-dimethylformamide (0.5 mL), and N,N-diisopropylethylamine (27 pL, 0.15 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-amino- N-(4-(8-fhioro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)pentanamide (S12) (19 mg, 0.05 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 10 minutes of stirring at room temperature and was allowed to continue stirring for an additional 20 minutes. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after TSRI 2262.1PC / TSR3173P 18350.049W01 the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a yellow powder (8 mg, 20%). ’H NMR (600 MHz, DMSO-t / e) 5 11.63 (s, 1H), 10.08 (s, 1H), 8.25 (q, J= 5.7 Hz, 2H), 7.76 (d, J= 8.9 Hz, 2H), 7.56 (d, J= 8.9 Hz, 2H), 7.48 (d, J= 8.9 Hz, 2H), 7.42 (s, 3H), 7.31 (dd, J= 9.1, 2.4 Hz, 1H), 4.52 (dd, J= 8.6, 5.7 Hz, 1H), 3.39 (s, 2H), 3.31 - 3.15 (m, 4H), 3.13 - 3.08 (m, 1H), 3.03 (s, 2H), 2.60 (s, 3H), 2.43 - 2.36 (m, 5H), 1.66 (td, 2H), 1.61 (s, 3H), 1.52 (p, J = 7.2 Hz, 2H).13C NMR (151 MHz, DMSO-t / 6) 5 170.69, 168.75, 167.84, 162.50, 158.41, 156.86, 154.44, 149.30, 138.29, 136.04, 134.63, 131.60, 130.17, 129.51, 129.22, 128.95, 127.85, 127.62, 125.59, 124.93, 122.67, 118.41, 115.76, 113.83, 110.49, 108.86, 99.94, 53.23, 41.23, 37.65, 36.98, 35.49, 28.25, 28.16, 21.93, 13.42, 12.04, 10.68.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.87. HRMS (ESI-TOF) m / z: [M+H]+calculated for C^HssClFNsOsS: 777.2533, found: 777.2533. UPLC-MS, ESI+, m / z 111A9 [M]+.

[0206] 4.5.15. Synthesis of (S or 7?)-9-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2, 3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)nonanamide (S15, PCIP-1)

[0207] A 3.0 mL dram vial equipped with a stir bar was charged with (S)-4-(4-chlorophenyl)-2,3,9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6 or S7) (8.6 mg, 0.02 mmol), HATU (10 mg, 0.03 mmol), N,N-dimethylformamide (0.5 mL), and N,N-diisopropylethylamine (12 pL, 0.07 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 9- amino-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)nonanamide (S13) (10 mg, 0.02 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 10 minutes of stirring at room temperature and was allowed to continue stirring for an additional 20 minutes. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield an orange powder (16 mg, 86%, when using S6). The synthesis of compound 8 (ent- PCIP-1) was carried out under conditions identical to those used for PCIP-1, yielding the same outcomes. ’H NMR (600 MHz, DMSO-t / 6) 5 11.61 (s, 1H), 10.03 (s, 1H), 8.23 (t, J= 5.7 Hz, 1H), 8.17 (t, J = 5.7 Hz, 1H), 7.75 (d, J= 8.7 Hz, 2H), 7.56 (d, J= 8.6 Hz, 2H), 7.48 (d, J= 8.7 Hz, 2H), 7.42 (m, 3H), 7.30 (d, J= 9.1 Hz, 1H), 4.53 (t, J= 6.6 Hz, 1H), 3.38 (s, 2H), 3.25 (dd, J = 15.0, 8.3 Hz, 1H), 3.12 (m, 3H), TSRI 2262.1PC / TSR3173P 18350.049W01

[0208] 3.02 (t, J = 4.9 Hz, 2H), 2.60 (s, 3H), 2.40 (s, 3H), 2.32 (t, J= 1A Hz, 2H), 1.62 (s, 5H), 1.44 (s, 2H), 1.29 (s, 10H).13C NMR (151 MHZ, DMSO-6) 5 171.92, 169.75, 168.94, 163.55, 157.96, 155.56, 150.38, 139.42, 137.10, 135.77, 132.69, 131.30, 130.63, 130.30, 130.06, 128.92, 128.73, 126.65, 126.04, 123.77, 119.51, 116.85, 114.92, 111.59, 101.04, 54.34, 42.33, 38.92, 38.06, 36.94, 29.72, 29.30, 29.24, 29.16, 29.14, 26.85, 25.58, 14.52, 13.14, 11.76.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.91. HRMS (ESI-TOF) m / z: [M+H]+calculated for C45H47C1FN8O3S: 833.3159, found: 833.3157. UPLC-MS, ESC, m / z 833.57 [M]+.

[0209] 4.5.16. Synthesis of tert-butyl (5)-3-(2-(2-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H- thieno[3,2-f| [l,2,4]triazolo[4,3-a] [l,4]diazepin-6 yl)acetamido)ethoxy)- ethoxy)propanoate (S18)

[0210] A 3.0 mL dram vial equipped with a stir bar was charged with (.S)-4-(4-chlorophcnyl)-2.3.9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (200 mg, 0.5 mmol), HATU (228 mg, 0.06 mmol), N,N-dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (174 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of tertbutyl 3-(2-(2-aminoethoxy)ethoxy)propanoate (S16) (140 mg, 0.05 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after one hour of stirring at room temperature. The crude reaction solution was directly loaded onto a 12- gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10- 100% water / acetonitrile. The gradient began during the first fraction and concluded after the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a colorless oil (35 mg, 81%). ’H NMR (600 MHz, DMSO-tL) 5 8.29 (s, 1H), 7.49 (d, J= 8.9 Hz, 2H), 7.43 (d, J= 8.9 Hz, 2H), 4.54 - 4.47 (m, 1H), 3.60 (s, 3H), 3.25 (s, 5H), 2.60 (s, 3H), 2.42 (s, 5H), 1.63 (s, 3H), 1.39 (s, 9H).13C NMR (151 MHZ, DMSO-6) 5 170.89, 170.13, 163.49, 155.57, 150.31, 137.21, 135.69, 132.74, 131.19, 130.64, 130.29, 130.02, 128.93, 80.20, 70.08, 69.99, 69.65, 66.70, 54.29, 39.07, 37.95, 36.29, 28.22, 14.54, 13.16, 11.78. HRMS (ESI-TOF) m / z: [M+H]+calculated for C30H39CIN5O5S: 616.2355, found 616.2358. UPLC-MS, ESI+, m / z 616.45 [M]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0211] 4.5.17. Synthesis of tert-butyl (5)-l-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)-2-oxo-6,9,12,15-tetraoxa-3-azaoctadecan- 18-oate (SI).

[0212] A 3.0 mL dram vial equipped with a stir bar was charged with (.S)-4-(4-chlorophcnyl)-2.3.9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (200 mg, 0.5 mmol), HATU (228 mg, 0.06 mmol), N,N-dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (174 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of tertbutyl l-amino-3,6,9,12-tetraoxapentadecan-15-oate (S17) (160 mg, 0.05 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after one hour of stirring at room temperature. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a colorless oil (122 mg, 35%). 'H NMR (400 MHz, CDCL) 5 7.40 (d, J= 8.5 Hz, 2H), 7.32 (d, J= 8.5 Hz, 2H), 7.20 (s, 1H), 4.66 (t, J= 7.1 Hz, 1H), 3.66 - 3.50 (m, 16H), 3.36 (dd, J= 14.7, 7.0 Hz, 1H), 2.65 (s, 3H), 2.48 (t, J= 6.4 Hz, 2H), 2.39 (s, 3H), 1.67 (s, 3H), 1.42 (s, 9H).13C NMR (151 MHz, CDCh) 5 171.00, 170.65, 163.81, 155.70, 149.81, 136.72, 136.67, 132.16, 130.93, 130.74, 130.50, 129.88, 128.69, 80.53, 70.54, 70.51, 70.44, 70.40, 70.30, 69.90, 66.87, 54.39, 39.40, 39.02, 36.19, 28.09, 14.43, 13.11, 11.86. HRMS (ESI-TOF) m / z: [M+H]+calculated for HRMS (ESI-TOF) m / z: [M+H]+calculated for C34H47CIN5O7S: 704.2880, found 704.2883. UPLC-MS, ESI+, m / z 704.52 [M]+.

[0213] TSRI 2262.1PC / TSR3173P 18350.049W01

[0214] 4.5.18. Synthesis of (5)-3-(2-(2-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [l,4]diazepin-6-yl)acetamido)ethoxy)ethoxy)propanoic acid (S20)

[0215] A 3.0 mL dram vial equipped with a stir bar was charged tert-butyl 3-(2-(2-(2-((6.S)-4-(4- chlorophenyl)-2,3,9-trimethyl-3a,10a-dihydro-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepin-6- yl)acetamido)ethoxy)ethoxy)-propanoate (S18) (95 mg, 0.15 mmol) and trifluoracetic acid (2.0 mL). The solution was allowed to stir at room temperature for 4h, reaction completion was determined using UPLC, before removing the solvent using reduced pressure. The crude reaction solution was dissolved in N,N- dimethylformamide (1.0 mL) and directly loaded onto a 12-gram RediSep Cl 8 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a colorless oil (79 mg, 92%). ’H NMR (600 MHz, DMSO-d6) 5 8.29 (t, J= 5.8 Hz, 1H), 7.49 (d, J= 8.6 Hz, 2H), 7.43 (d, J= 8.5 Hz, 2H), 4.52 (dd, J = 8.3, 5.9 Hz, 1H), 3.61 (t, J= 6.4 Hz, 2H), 3.45 (t, J= 5.9 Hz, 2H), 3.33 - 3.19 (m, 4H), 2.61 (s, 3H), 2.45 (t, J= 6.4 Hz, 2H), 2.42 (s, 3H), 1.63 (s, 3H).13C NMR (151 MHz, DMSO-tL) 5 172.06, 169.01, 162.52, 154.46, 149.35, 136.05, 134.69, 131.62, 130.24, 129.61, 129.27, 129.00, 127.87, 68.98, 68.92, 68.60, 65.64, 53.17, 38.01, 36.80, 34.13, 13.47, 12.10, 10.70. HRMS (ESI-TOF) m / z: [M+H]+calculated for C26H31CIN5O5S: 616.2355, found 616.2358. UPLC-MS, ESI+, m / z 560.35 [M]+.

[0216] 4.5.19. Synthesis of (5)-l-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)-2-oxo-6,9,12,15-tetraoxa-3-azaoctadecan- 18-oic acid (S21) TSRI 2262.1PC / TSR3173P 18350.049W01

[0217] A 3.0 mL dram vial equipped with a stir bar was charged tert-butyl 3-(2-(2-(2-((6.S)-4-(4- chlorophenyl)-2,3,9-trimethyl-3a,10a-dihydro-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepin-6- yl)acetamido)ethoxy)ethoxy)-propanoate (S19) (113 mg, 0.16 mmol) and trifluoracetic acid (2.0 mL). The solution was allowed to stir at room temperature for 4h, reaction completion was determined using UPLC, before removing the solvent using reduced pressure. The crude reaction solution was dissolved in N,N- dimethylformamide (1.0 mL) and directly loaded onto a 12-gram RediSep Cl 8 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a colorless oil (79 mg, 92%). ’H NMR (600 MHz, DMSO-d6) 5 8.23 (t, J= 5.7 Hz, 1H), 7.42 (d, J= 8.7 Hz, 2H), 7.36 (d, J= 8.6 Hz, 2H), 4.44 (dd, J = 8.2, 5.9 Hz, 1H), 3.52 (t, J= 6.4 Hz, 2H), 3.49 - 3.35 (m, 16H), 3.24 - 3.12 (m, 4H), 2.53 (s, 3H), 2.38 - 2.33 (m, 5H), 1.56 (s, 3H).13C NMR (151 MHz, DMSO-tL) 5 173.11, 170.11, 163.53, 155.55, 150.35, 137.18, 135.72, 132.73, 131.24, 130.65, 130.31, 130.04, 128.94, 70.25, 70.21, 70.16, 70.09, 69.69, 66.69, 54.27, 39.09, 37.92, 35.19, 14.54, 13.16, 11.78. HRMS (ESI-TOF) m / z: [M+H]+calculated for C30H39CIN5O7S: 648.2254, found 648.2246. UPLC-MS, ESI+, m / z 648.42 [M]+.

[0218] 4.5.20. Synthesis of (5)-l-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-3,6,9,12-tetraoxapentadecan-15- amide (S22, compound 3)

[0219] A 3.0 mL dram vial equipped with a stir bar was charged with 3-(2-(2-((6.S')-4-(4-chlorophcnyl)- 2,3,9-trimethyl-3a,5,6,10a-tetrahydro-4H-thieno[3,2-f][l,2,4]triazolo[4,3-a]azepine-6- carboxamido)ethoxy)ethoxy)propanoic acid (S20) (51 mg, 0.10 mmol), HATU (42 mg, 0.12 mmol), N,N- dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (52 pL, 0.30 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (S3) (27 mg, 0.10 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after three and a half hours of stirring at room temperature. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after TSRI 2262.1PC / TSR3173P 18350.049W01 the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a yellow powder (25 mg, 32%). ’H NMR (600 MHz, DMSO-tL) 5 11.62 (s, 1H), 10.13 (s, 1H), 8.28 (t, J= 5.7 Hz, 1H), 8.24 (t, J= 5.8 Hz, 1H), 7.75 (d, J= 8.6 Hz, 2H), 7.56 (d, J= 8.7 Hz, 2H), 7.49 - 7.45 (m, 2H), 7.44 - 7.39 (m, 3H), 7.30 (dd, J= 9.1, 2.4 Hz, 1H), 4.50 (dd, J= 8.1, 6.1 Hz, 1H), 3.73 (d, J= 6.2 Hz, 2H), 3.55 (t, J= 2.5 Hz, 4H), 3.45 (t, J= 5.9 Hz, 2H), 3.37 (t, 2H), 3.29 - 3.20 (m, 4H), 3.01 (s, 2H), 2.64 - 2.56 (m, 5H), 2.39 (s, 3H), 1.60 (s, 3H).13C NMR (151 MHz, DMSO- d6) 5 169.06, 168.83, 167.84, 162.41, 154.47, 149.23, 138.16, 136.11, 134.61, 131.65, 130.09, 129.20, 128.92, 127.84, 127.68, 125.73, 124.97, 122.68, 120.54, 118.46, 116.72, 114.78, 110.55, 108.70, 99.95, 69.04, 68.92, 68.60, 66.00, 53.20, 41.24, 38.00, 36.86, 36.62, 28.15, 13.43, 12.06, 10.69.19F NMR (376 MHz, DMSO- e, referenced to CeFe): 5 -122.06. HRMS (ESI-TOF) m / z: [M+H]+calculated for C43H43CIFN8O5S: 837.2735, found: 837.2738. UPLC-MS, ESI+, m / z 837.54 [M]+.

[0220] 4.5.21. Synthesis of (5)-l-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-3,6,9,12-tetraoxapentadecan-15- amide (S23, compound 4)

[0221] A 3.0 mL dram vial equipped with a stir bar was charged with 3-(2-(2-((6.S')-4-(4-chlorophcnyl)- 2,3,9-trimethyl-3a,5,6,10a-tetrahydro-4H-thieno[3,2-f][l,2,4]triazolo[4,3-a]azepine-6- carboxamido)ethoxy)ethoxy)propanoic acid (S21) (66 mg, 0.10 mmol), HATU (46 mg, 0.12 mmol), N,N- dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (57 pL, 0.33 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (S3) (30 mg, 0.10 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after three and a half hours of stirring at room temperature. The crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 35-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a yellow powder (25 mg, 32%). ’H NMR (600 MHz, DMSO-tL) 5 11.63 (s, 1H), 10.12 (s, 1H), 8.30 (t, J= 5.7 Hz, 1H), 8.24 (t, J= 5.8 Hz, 1H), 7.75 (d, J= 8.5 Hz, 2H), 7.56 (d, J= 8.5 Hz, 2H), 7.48 (d, J= 8.6 Hz, 2H), 7.44 - 7.39 (m, 3H), 7.30 (dd, J= 9.1, 2.5 Hz, 1H), 4.51 (dd, J= 8.1, TSRI 2262.1PC / TSR3173P 18350.049W01

[0222] 6.0 Hz, 1H), 3.71 (t, J= 6.2 Hz, 2H), 3.62 (dt, J= 10.9, 6.7 Hz, 1H), 3.55 - 3.49 (m, 10H), 3.44 (t, J= 5.9 Hz, 2H), 3.38 (s, 2H), 3.29 - 3.19 (m, 4H), 3.02 (s, 2H), 2.64 - 2.56 (m, 5H), 2.40 (s, 3H), 1.61 (s, 3H).13C NMR (151 MHZ, DMSO-6) 5 169.02, 168.78, 167.82, 162.43, 158.41, 156.86, 154.43, 149.25, 138.16, 136.06, 134.61, 131.61, 130.12, 129.54, 129.19, 128.91, 127.83, 127.64, 125.70, 124.94, 122.65, 118.41, 115.95, 114.01, 110.52, 108.68, 99.93, 69.14, 69.10, 69.05, 68.97, 68.55, 65.97, 53.15, 41.22, 37.98, 36.80, 36.58, 28.14, 20.34, 19.55, 13.41, 12.03, 10.66.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.87. HRMS (ESI-TOF) m / z: [M+H]+calculated for C47H5IC1FN8O7S: 925.3269, found: 925.3271. UPLC-MS, ESI+, m / z 925.64 [M]+.

[0223] 4.5.22. Synthesis of tert-butyl 2-((4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)carbamoyl)-7-azaspiro[3.5]nonane-7-carboxylate (S25)

[0224] S6

[0225] A 3.0 mL dram vial equipped with a stir bar was charged with 7-(tert-butoxycarbonyl)-7- azaspiro[3.5]nonane-2 -carboxylic acid (S24) (55 mg, 0.2 mmol), HATU (93 mg, 0.24 mmol), N,N- dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (71 pL, 0.41 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (S3) (60 mg, 0.2 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 20 minutes of stirring at room temperature. The reaction solution was extracted with ethyl acetate (3 x 10 mL), the organic layer was then washed with brine (3 x 1.0 mL) and dried over sodium sulfate. The organic layer was then iteratively removed in a 20 mL dram vial using reduced pressure to yield a brown oil which was used without further purification. UPLC-MS, ESI+, m / z 547.36 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0226] 4.5.23. Synthesis of N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)-7-azaspiro[3.5]nonane-2-carboxamide (S26)

[0227] Trifluoroacetic acid (2 mL) and a stir bar was added to the dram vial containing the crude material S25. The reaction progression was monitored using UPLC. After one hour the starting material had been completely converted to the corresponding product and the volatiles were removed using reduced pressure to yield a brown oil. UPLC-MS, ESI+, m / z 447.30 [M+H]+.

[0228] 4.5.24. Synthesis of (5)-7-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-7-azaspiro[3.5]nonane-2- carboxamide (S27, compound 5)

[0229] A 3.0 mL dram vial equipped with a stir bar was charged with (.S)-4-(4-chlorophcnyl)-2.3.9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (80 mg, 0.2 mmol), HATU (90 mg, 0.24 mmol), N,N-dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (200 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before being syringed into the dram vial containing the crude material containing S26. Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction stalled at 50% conversion after one hour until addition of more N,N-diisopropylethylamine (200 pL, 1.0 mmol), after stirring for five additional minutes the starting material was completely consumed, as determined by UPLC analysis. Promptly, the crude reaction solution was directly loaded onto a 12-gram RediSep Cl 8 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25 -minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (10 mg, 6%). ’H NMR (600 MHz, DMSO-d6) 5 11.64 (s, 1H), 9.99 (s, 1H), 8.25 (t, J= 5.9 Hz, 1H), 7.78 (d, J= 6.4 Hz, 2H), 7.57 (d, J= 7.1 Hz, 2H), 7.50 (d, J= 6.6 Hz, 2H), 7.45 - 7.40 (m, 3H), 7.31 (dd, J= 9.1, 2.5 Hz, 1H), 4.64 - 4.55 (m, 1H), 3.62 (d, J= 7.0 Hz, 2H), 3.56 - 3.50 (m, 1H), 3.49 - 3.45 (m, 1H), 3.42 - 3.35 (m, 4H), 3.27 (s, 1H), 3.03 (s, 2H), 2.61 (s, 3H), 2.42 (s, 3H), 2.14 - 1.91 (m, 5H), 1.79 - 1.70 (m, 1H), 1.63 (s, 4H), 1.58 - 1.55 (m, 1H), 1.50 - 1.45 (m, 1H).13C NMR (151 MHz, DMSO-6) 5 172.84, 167.87, 167.25, 162.33, 158.44, 156.89, 154.68, 149.23, 138.41, 136.11, 134.63, 131.56, 130.18, 129.59, 129.31, 127.89, 127.67, 125.61, 124.97, 122.70, 118.52, 115.95, 114.03, 110.53, 108.88, 99.96, 53.60, 41.66, 41.26, 40.85, 37.77, 37.57, 37.14, 36.03, 35.42, 34.09, 33.55, 33.38, 32.75, 28.18, 13.43, 12.10, 10.68.19F NMR (376 MHz, DMSO- de, referenced to CeLe): 5 -123.90. HRMS (ESI-TOF) m / z: [M+H]+calculated for C45H43CIFN8O3S: 829.2846, found: 829.2844. UPLC-MS, ESI+, m / z 829.46 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0230] 4.5.25. Synthesis of tert-butyl 9-((4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)carbamoyl)-3-azaspiro[5.5]undecane-3-carboxylate (S29)

[0231] A 3.0 mL dram vial equipped with a stir bar was charged with 3-(tert-butoxycarbonyl)-3- azaspiro[5.5]undecane-9-carboxylic acid (S28) (60 mg, 0.2 mmol), HATU (93 mg, 0.24 mmol), N,N- dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (71 pL, 0.41 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (S3) (60 mg, 0.2 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 20 minutes of stirring at room temperature. The reaction solution was extracted with ethyl acetate (3 x 10 mL), the organic layer was then washed with brine (3 x 1.0 mL) and dried over sodium sulfate. The organic layer was then iteratively removed in a 20 mL dram vial using reduced pressure to yield a brown oil which was used without further purification. UPLC-MS, ESI+, m / z 575.43 [M]+.

[0232] 4.5.26. Synthesis of N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)-3-azaspiro[5.5]undecane-9-carboxamide (30)

[0233] Trifluoroacetic acid (2 mL) and a stir bar was added to the dram vial containing the crude material S29. The reaction progression was monitored using UPLC. After one hour the starting material had been completely converted to the corresponding product and the volatiles were removed using reduced pressure to yield a brown oil. UPLC-MS, ESI+, m / z 475.37 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0234] 4.5.27. Synthesis of (5)-3-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-3-azaspiro[5.5]undecane-9- carboxamide (S31, compound 6)

[0235] A 3.0 mL dram vial equipped with a stir bar was charged with (.S)-4-(4-chlorophcnyl)-2.3.9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (80 mg, 0.2 mmol), HATU (90 mg, 0.24 mmol), N,N-dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (200 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before being syringed into the dram vial containing the crude material S30. Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction stalled at 50% conversion after one hour until addition of more N,N-diisopropylethylamine (200 pL, 1.0 mmol), after stirring for five additional minutes the starting material was completely consumed, as determined by UPLC analysis. Promptly, the crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (19 mg, 10%). ’H NMR (600 MHz, DMSO-d6) 5 11.63 (d, J= 2.1 Hz, 1H), 10.02 (d, J= 5.4 Hz, 1H), 8.25 (t, J= 5.7 Hz, 1H), 7.77 (dd, J= 8.7, 3.5 Hz, 2H), 7.57 (dd, J= 8.8, 2.6 Hz, 2H), 7.50 (d, J= 8.9 Hz, 2H), 7.45 (dd, J= 8.7, 3.4 Hz, 2H), 7.41 (dd, J= 11.0, 3.1 Hz, 1H), 7.30 (dd, J= 8.6, 3.0 Hz, 1H), 4.60 (t, J= 6.7 Hz, 1H), 3.66 - 3.58 (m, 3H), 3.50 - 3.36 (m, 5H), 3.03 (s, 2H), 2.61 (s, 3H), 2.42 (s, 3H), 2.40 - 2.33 (m, 1H), 1.82 (d, J= 12.3 Hz, 2H), 1.71 - 1.60 (m, 8H), 1.51 - 1.40 (m, 2H), 1.28 (t, J= 5.5 Hz, 1H), 1.22 - 1.15 (m, 2H).13C NMR (151 MHz, DMSO-d6) 5 173.79, 167.86, 167.13, 162.32, 158.44, 156.89, 154.69, 149.26, 138.46, 136.10, 134.64, 131.56, 130.20, 129.61, 129.31, 127.89, 127.64, 125.58, 125.02, 122.69, 118.53, 115.83, 113.90, 110.52, 108.88, 99.96, 53.56, 44.55, 41.26, 40.46, 40.33, 36.62, 36.48, 34.16, 34.11, 34.06, 33.90, 31.09, 30.45, 30.06, 28.18, 23.45, 13.43, 12.10, 10.68.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.94. HRMS (ESI-TOF) m / z: [M+H]+calculated for C47H47C1FN8O3S: 857.3159, found: 857.3157. UPLC-MS, ESI+, m / z 857.53 [M+H]+.

[0236] TSRI 2262.1PC / TSR3173P 18350.049W01

[0237] 4.5.28. Synthesis of tert-butyl 9-((4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3- cd]indol-5-yl)phenyl)carbamoyl)-3-azaspiro[5.5]undecane-3-carboxylate (S33)

[0238] A 3.0 mL dram vial equipped with a stir bar was charged with l'-(tert-butoxycarbonyl)-[l,4'- bipiperidine] -4-carboxylic acid (S32) (63 mg, 0.2 mmol), HATU (93 mg, 0.24 mmol), N,N- dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (71 pL, 0.41 mmol). The solution was allowed to stir for 10 minutes before the portion wise addition of 5-(4-aminophenyl)-8-fluoro-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-l-one (S3) (60 mg, 0.2 mmol). Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction reached completion after 20 minutes of stirring at room temperature. The reaction solution was extracted with ethyl acetate (3 x 10 mL), the organic layer was then washed with brine (3 x 1.0 mL) and dried over sodium sulfate. The organic layer was then iteratively removed in a 20 mL dram vial using reduced pressure to yield a brown oil which was used without further purification. UPLC-MS, ESI+, m / z 595.45 [M+H]+.

[0239] 4.5.29. Synthesis of N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)-[l,4'-bipiperidine]-4-carboxamide (S34)

[0240] Trifluoroacetic acid (2 mL) and a stir bar was added to the dram vial containing the crude product S33. The reaction progression was monitored using UPLC. After one hour the starting material had been completely converted to the corresponding product and the volatiles were removed using reduced pressure to yield a brown oil. UPLC-MS, ESI+, m / z 490.35 [M+H]+. TSRI 2262.1PC / TSR3173P 18350.049W01

[0241] 4.5.30. Synthesis of ((5)-l'-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2- f] [l,2,4]triazolo[4,3-a] [1,4] diazepin-6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6- tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-[l,4'-bipiperidine]-4- carboxamide (S35, compound 7)

[0242] A 3.0 mL dram vial equipped with a stir bar was charged with (S)-4-(4-chlorophenyl)-2,3,9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepine-6-carboxylic acid (S6) (80 mg, 0.2 mmol), HATU (90 mg, 0.24 mmol), N,N-dimethylformamide (1.0 mL), and N,N-diisopropylethylamine (200 pL, 1.0 mmol). The solution was allowed to stir for 10 minutes before being syringed into the dram vial containing the crude material S34. Stirring continued until UPLC analysis demonstrated complete consumption of the starting materials. The reaction stalled at 50% conversion after one hour until addition of more N,N-diisopropylethylamine (200 pL, 1.0 mmol), after stirring for five additional minutes the starting material was completely consumed, as determined by UPLC analysis. Promptly, the crude reaction solution was directly loaded onto a 12-gram RediSep C18 reversed phase column equipped to a Combiflash NextGen 300+ auto column. The crude reaction mixture was purified using an acidic gradient (0.1% trifluoracetic acid) ranging from 10-100% water / acetonitrile. The gradient began during the first fraction and concluded after the 25-minute run. Clean fractions were determined using UPLC technologies and subsequently lyophilized to yield a white powder (10 mg, 6%). ’H NMR (600 MHz, DMSO-d6) 5 11.65 (s, 1H), 10.26 (s, 1H), 9.24 (s, 1H), 8.26 (t, J= 5.7 Hz, 1H), 7.77 (d, J= 8.4 Hz, 2H), 7.59 (d, J= 8.4 Hz, 2H), 7.54 - 7.48 (m, 3H), 7.48 - 7.39 (m, 4H), 7.31 (dd, J= 9.1, 2.4 Hz, 1H), 4.59 (q, J= 6.2 Hz, 1H), 4.54 (d, J= 12.9 Hz, 1H), 4.45 (t, J= 7.1 Hz, 1H), 4.37 (t, J= 15.0 Hz, 1H), 3.47 - 3.36 (m, 5H), 3.32 (dd, J= 16.7, 7.4 Hz, 1H), 3.17 (t, J= 12.6 Hz, 1H), 3.05 (br, 4H), 2.62 - 2.60 (m, 4H), 2.42 (d, J= 6.2 Hz, 4H), 2.15 (m, 5H), 1.94 (m, 3H), 1.63 (d, J= 4.4 Hz, 4H).13C NMR (151 MHz, DMSO-d6) 5 171.26, 167.83, 162.51, 158.44, 156.89, 154.60, 154.20, 149.20, 137.93, 136.11, 134.63, 131.59, 130.14, 129.53, 128.99, 127.88, 127.65, 126.00, 125.04, 122.62, 118.68, 116.71, 114.75, 110.61, 108.91, 99.78, 62.09, 52.93, 51.98, 47.57, 43.00, 42.75, 41.20, 35.88, 34.17, 33.95, 28.15, 25.21, 13.43, 12.06, 10.65.19F NMR (376 MHz, DMSO-tA referenced to C6F6): 5 -123.78. HRMS (ESI-TOF) m / z: [M+H]+calculated for C47H48C1FN9O3S: 872.3268, found: 872.3266. UPLC-MS, ESI+, m / z 872.52 [M+H]+.

[0243] 4.6. REFERENCES

[0244] 1. Stanton, B. Z., Chory, E. J. & Crabtree, G. R. Chemically induced proximity in biology and medicine. Science 359, (2018).

[0245] 2. Gerry, C. J. & Schreiber, S. L. Unifying principles of bifunctional, proximity-inducing small molecules. Nat. Chem. Biol. 16, 369-378 (2020).

[0246] 3. Bondeson, D. P. et al. Catalytic in vivo protein knockdown by small-molecule PROTACs. Nat. Chem. Biol. 11, 611-617 (2015).

[0247] 4. Lai, A. C. & Crews, C. M. Induced protein degradation: an emerging drug discovery paradigm. Nat. Rev. Drug Discov. 16, 101-114 (2016). TSRI 2262.1PC / TSR3173P 18350.049W01

[0248] 5. Li, K. & Crews, C. M. PROTACs: past, present and future. Chem. Soc. Rev. 51, 5214-5236

[0249] (2022).

[0250] 6. Spencer, D. M., Wandless, T. J., Schreiber, S. L. & Crabtree, G. R. Controlling signal transduction with synthetic ligands. Science 262, 1019-1024 (1993).

[0251] 7. Belshaw, P. J., Ho, S. N., Crabtree, G. R. & Schreiber, S. L. Controlling protein association and subcellular localization with a synthetic ligand that induces heterodimerization of proteins. Proc. Natl. Acad. Sci. U. S. A. 93, 4604-4607 (1996).

[0252] 8. Ho, S. N., Biggar, S. R., Spencer, D. M., Schreiber, S. L. & Crabtree, G. R. Dimeric ligands define a role for transcriptional activation domains in reinitiation. Nature 382, 822-826 (1996).

[0253] 9. Rivera, V. M. et al. A humanized system for pharmacologic control of gene expression. Nat. Med. 2, 1028-1032 (1996).

[0254] 10. Amara, J. F. et al. A versatile synthetic dimerizer for the regulation of protein-protein interactions. Proc. Natl. Acad. Sci. U. S. A. 94, 10618-10623 (1997).

[0255] 11. Clackson, T. et al. Redesigning an FKBP-ligand interface to generate chemical dimerizers with novel specificity. Proc. Natl. Acad. Sci. U. S. A. 95, 10437-10442 (1998).

[0256] 12. Henning, N. J. et al. Deubiquitinase-targeting chimeras for targeted protein stabilization. Nat. Chem. Biol. 18, 412-421 (2022).

[0257] 13. Yamazoe, S. et al. Heterobifimctional molecules induce dephosphorylation of kinases-A proof of concept study. J. Med. Chem. 63, 2807-2813 (2020).

[0258] 14. Siriwardena, S. U. et al. Phosphorylation-inducing chimeric small molecules. J. Am. Chem. Soc. 142, 14052-14057 (2020).

[0259] 15. Chen, P.-H. et al. Modulation of phosphoprotein activity by phosphorylation targeting chimeras (PhosTACs). ACS Chem. Biol. 16, 2808-2815 (2021).

[0260] 16. Wang, W. W. et al. Targeted protein acetylation in cells using heterobifimctional molecules. J. Am. Chem. Soc. 143, 16700-16708 (2021).

[0261] 17. Kabir, M. et al. Acetylation Targeting Chimera enables acetylation of the tumor suppressor p53. J. Am. Chem. Soc. 145, 14932-14944 (2023).

[0262] 18. Ramirez, D. H. et al. Engineering a proximity-directed O-GlcNAc transferase for selective protein O-GlcNAcylation in cells. ACS Chem. Biol. 15, 1059-1066 (2020).

[0263] 19. Ge, Y. et al. Target protein deglycosylation in living cells by a nanobody-fused split O- GlcNAcase. Nat. Chem. Biol. 17, 593-600 (2021).

[0264] 20. Ma, B. et al. Targeted protein O-GlcNAcylation using bifimctional small molecules. J. Am. Chem. Soc. 146, 9779-9789 (2024).

[0265] 21. Seabrook, L. J. et al. Methylarginine targeting chimeras for lysosomal degradation of intracellular proteins. Nat. Chem. Biol. 20, 1566-1576 (2024).

[0266] 22. Banik, S. M. et al. Lysosome-targeting chimaeras for degradation of extracellular proteins. Nature 584, 291-297 (2020). TSRI 2262.1PC / TSR3173P 18350.049W01

[0267] 23. Huang, B. et al. Designed endocytosis-inducing proteins degrade targets and amplify signals. Nature 638, 796-804 (2025).

[0268] 24. Zhang, D. et al. Transferrin receptor targeting chimeras for membrane protein degradation. Nature 638, 787-795 (2025).

[0269] 25. Tong, Y. et al. Programming inactive RNA-binding small molecules into bioactive degraders. Nature 618, 169-179 (2023).

[0270] 26. Costales, M. G., Matsumoto, Y ., Velagapudi, S. P. & Disney, M. D. Small molecule targeted recruitment of a nuclease to RNA. J. Am. Chem. Soc. 140, 6741-6744 (2018).

[0271] 27. Erwin, G. S. et al. Synthetic transcription elongation factors license transcription across repressive chromatin. Science 358, 1617-1622 (2017).

[0272] 28. Gourisankar, S. et al. Rewiring cancer drivers to activate apoptosis. Nature 620, 417-425 (2023).

[0273] 29. Gibson, W. J. et al. Bifunctional small molecules that induce nuclear localization and targeted transcriptional regulation. J. Am. Chem. Soc. 145, 26028-26037 (2023).

[0274] 30. Ng, C. S. C., Liu, A., Cui, B. & Banik, S. M. Targeted protein relocalization via protein transport coupling. Nature 633, 941-951 (2024).

[0275] 31. Nalawansha, D. A., Mangano, K., den Besten, W. & Potts, P. R. TAC-tics for leveraging proximity biology in drug discovery. Chemhiochem 25, e202300712 (2024).

[0276] 32. Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).

[0277] 33. Bryant, H. E. et al. Specific killing of BRCA2 -deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913-917 (2005).

[0278] 34. Ray Chaudhuri, A. & Nussenzweig, A. The multifaceted roles of PARP1 in DNA repair and chromatin remodelling. Ata. Rev. Mol. Cell Biol. 18, 610-621 (2017).

[0279] 35. Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).

[0280] 36. Filippakopoulos, P. et al. Selective inhibition of BET bromodomains. Nature 468, 1067-1073 (2010).

[0281] 37. Canan Koch, S. S. et al. Novel tricyclic poly(ADP-ribose) polymerase- 1 inhibitors with potent anticancer chemopotentiating activity: design, synthesis, and X-ray cocrystal structure. J. Med. Chem. 45, 4961-4974 (2002).

[0282] 38. Anders, L. et al. Genome-wide localization of small molecules. Nat. Biotechnol. 32, 92-96 (2014).

[0283] 39. Winter, G. E. et al. Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 348, 1376-1381 (2015).

[0284] 40. Wang, S. et al. Uncoupling of PARP1 trapping and inhibition using selective PARP1 degradation. Nat. Chem. Biol. 15, 1223-1231 (2019). TSRI 2262.1PC / TSR3173P 18350.049W01

[0285] 41. Liszczak, G. P. et al. Genomic targeting of epigenetic probes using a chemically tailored Cas9 system. Proc. Natl. Acad. Sci. U. S. A. 114, 681-686 (2017).

[0286] 42. Chiarella, A. M. et al. Dose-dependent activation of gene expression is achieved using CRISPR and small molecules that recruit endogenous chromatin machinery. Nat. Biotechnol. 38, 50-55 (2020).

[0287] 43. Donovan, K. A. et al. Mapping the degradable kinome provides a resource for expedited degrader development. Cell 183, 1714-1731. elO (2020).

[0288] 44. Gechijian, L. N. et al. Functional TRIM24 degrader via conjugation of ineffectual bromodomain and VHL ligands. Nat. Chem. Biol. 14, 405-412 (2018).

[0289] 45. Riching, K. M. et al. Quantitative Live-Cell Kinetic Degradation and Mechanistic Profiling of PROTAC Mode of Action. ACS Chem. Biol. 13, 2758-2770 (2018).

[0290] 46. Schwinn, M. K. et al. CRISPR-mediated tagging of endogenous proteins with a luminescent peptide. ACS Chem. Biol. 13, 467-474 (2018).

[0291] 47. Cao, C. et al. Discovery of SK-575 as a Highly Potent and Efficacious Proteolysis-Targeting Chimera Degrader of PARP 1 for Treating Cancers. J. Med. Chem. 63, 11012-11033 (2020).

[0292] 48. Winter, G. E. et al. BET bromodomain proteins function as master transcription elongation factors independent of CDK9 recruitment. Mol. Cell 67, 5-18.e 19 (2017).

[0293] 49. Douglass, E. F., Jr, Miller, C. J., Sparer, G., Shapiro, H. & Spiegel, D. A. A comprehensive mathematical model for three -body binding equilibria. J. Am. Chem. Soc. 135, 6092-6099 (2013).

[0294] 50. Murai, J. et al. Trapping of PARP 1 and PARP2 by Clinical PARP Inhibitors. Cancer Res. 'll, 5588-5599 (2012).

[0295] 51. Mah, L.-J., El-Osta, A. & Karagiannis, T. C. yH2AX: a sensitive molecular marker of DNA damage and repair. Leukemia 24, 679-686 (2010).

[0296] 52. Murai, J. et al. Stereospecific PARP trapping by BMN 673 and comparison with olaparib and rucaparib. Mol. Cancer Ther. 13, 433-443 (2014).

[0297] 53. Shi, J. et al. Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat. Biotechnol. 33, 661-667 (2015).

[0298] 54. Johannes, J. W. et al. Discovery of 5-{4-[(7-Ethyl-6-oxo-5,6-dihydro-l,5-naphthyridin-3- yl)methyl] piperazin- l-yl}-N-methylpyridine -2 -carboxamide (AZD5305): A PARP1-DNA Trapper with High Selectivity for PARP1 over PARP2 and Other PARPs. J. Med. Chem. 64, 14498-14512 (2021).

[0299] 55. Brinkman, E. K., Chen, T., Amendola, M. & van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, el68 (2014).

[0300] 56. Schreiber, S. L. & Crabtree, G. R. The mechanism of action of cyclosporin A and FK506. Immunol. Today 13, 136-142 (1992).

[0301] 57. Yang, H. et al. mTOR kinase structure, mechanism and regulation. Nature 497, 217-223

[0302] (2013). TSRI 2262.1PC / TSR3173P 18350.049W01

[0303] 58. Sabatini, D. M., Erdjument-Bromage, H., Lui, M., Tempst, P. & Snyder, S. H. RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78, 35-43 (1994).

[0304] 59. Sabers, C. J. et al. Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J. Biol. Chem. 270, 815-822 (1995).

[0305] 60. Schulze, C. J. et al. Chemical remodeling of a cellular chaperone to target the active state of mutant KRAS. Science 381, 794-799 (2023).

[0306] 61. Noordermeer, S. M. et al. The shieldin complex mediates 53BPl-dependent DNA repair. Nature 560, 117-121 (2018).

[0307] 62. Zimmermann, M. et al. CRISPR screens identify genomic ribonucleotides as a source of PARP -trapping lesions. Nature 559, 285-289 (2018).

[0308] 63. Hewitt, G. et al. Defective ALC 1 nucleosome remodeling confers PARPi sensitization and synthetic lethality with HRD. Mol. Cell 81, 767-783. el 1 (2021).

[0309] 64. Zatreanu, D. et al. PolO inhibitors elicit BRCA-gene synthetic lethality and target PARP inhibitor resistance. Ata. Commun. 12, 3636 (2021).

[0310] 65. Illuzzi, G. et al. Preclinical characterization of AZD5305, A next-generation, highly selective PARPI inhibitor and trapper. Clin. Cancer Res. 28, 4724-4736 (2022).

[0311] 66. Fried, W. et al. Discovery of a small-molecule inhibitor that traps PolO on DNA and synergizes with PARP inhibitors. Nat. Commun. 15, 2862 (2024).

[0312] 67. Bouwman, P. et al. 53BP1 loss rescues BRCA1 deficiency and is associated with triplenegative and BRCA-mutated breast cancers. Nature structural & molecular biology vol. 17 688-695 (2010).

[0313] 68. Bunting, S. F. et al. 53BP1 inhibits homologous recombination in Brcal -deficient cells by blocking resection of DNA breaks. Cell vol. 141 243-254 (2010).

[0314] 69. Gogola, E., Rottenberg, S. & Jonkers, J. Resistance to PARP inhibitors: Lessons from preclinical models of BRCA-associated cancer. Annu. Rev. Cancer Biol. 3, 235-254 (2019).

[0315] 70. Noordermeer, S. M. & van Attikum, H. PARP inhibitor resistance: A tug-of-war in BRCA- mutated cells. Trends Cell Biol. 29, 820-834 (2019).

[0316] 71. Kerres, N. et al. Chemically induced degradation of the oncogenic transcription factor BCL6. Cell Rep. 20, 2860-2875 (2017).

[0317] 72. Slabicki, M. et al. Small-molecule-induced polymerization triggers degradation of BCL6. Nature 588, 164-168 (2020).

[0318] 73. Lu, P. et al. Selective degradation of multimeric proteins by TRIM21 -based molecular glue and PROTAC degraders. Cell 187, 7126-7142.e20 (2024).

[0319] 74. Li, X. et al. Chemically induced Nuclear Pore Complex Protein degradation via TRIM21. ACS Chem. Biol. 20, 1020-1028 (2025).

[0320] 75. Cheng, Y. et al. TRIM21-NUP98 interface accommodates structurally diverse molecular glue degraders. ACS Chem. Biol. 20, 953-959 (2025). TSRI 2262.1PC / TSR3173P 18350.049W01

[0321] 76. Blessing, C. et al. The oncogenic helicase ALC1 regulates PARP inhibitor potency by trapping PARP2 at DNA breaks. Mol. Cell 80, 862-875. e6 (2020).

[0322] 77. Shaum, J. B. et al. High-throughput diversification of protein-ligand surfaces to discover chemical inducers of proximity. bioRxiv 2024.09.30.615685 (2024) doi: 10.1101 / 2024.09.30.615685.

[0323] 78. Chan, E. M. et al. WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551-556 (2019).

[0324] 79. Kategaya, L., Perumal, S. K., Hager, J. H. & Belmont, L. D. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. iScience 13, 488-497 (2019).

[0325] 80. van Wietmarschen, N. et al. Repeat expansions confer WRN dependence in microsatellite- unstable cancers. Nature 586, 292-298 (2020).

[0326] 81. Ferretti, S. et al. Discovery ofWRN inhibitor HRO761 with synthetic lethality in MSI cancers. Nature 629, 443-449 (2024).

[0327] 82. Rodriguez Perez, F. et al. WRN inhibition leads to its chromatin-associated degradation via the PIAS4-RNF4-p97 / VCP axis. Nat. Commun. 15, 6059 (2024).

[0328] 83. Baltgalvis, K. A. et al. Chemoproteomic discovery of a covalent allosteric inhibitor ofWRN helicase. Nature 629, 435-442 (2024).

[0329] 84. Ito, F. et al. Structural basis for a PolO helicase small-molecule inhibitor revealed by cryo- EM. Nat. Commun. 15, 7003 (2024).

[0330] 85. Mateos-Gomez, P. A. et al. Mammalian polymerase 0 promotes alternative NHEJ and suppresses recombination. Nature 518, 254-257 (2015).

[0331] 86. Ceccaldi, R. et al. Homologous-recombination-deficient tumours are dependent on Pol0- mediated repair. Nature 518, 258-262 (2015).

[0332] 87. Bubenik, M. et al. Identification of RP-6685, an orally bioavailable compound that inhibits the DNA polymerase activity of PolO. J. Med. Chem. 65, 13198-13215 (2022).

[0333] All publications (e.g., patents and patent applications) cited herein are incorporated herein by reference in their entireties.

Claims

1. TSRI 2262.1PC / TSR3173P 18350.049W01CLAIMSWhat is claimed is:

1. A compound, which compound is of the formula:A— L— B or a pharmaceutically acceptable salt thereof, wherein:A is an inhibitor of poly (ADP-ribose) polymerase (PARP);L is a linker that resists cleavage in plasma; andB is an inhibitor of a BET protein.

2. The compound of claim 1, wherein A is a residue of a drug that inhibits PARP (e.g., PARP1 or PARP2).

3. The compound of claim 2, wherein A is a residue of ACE-86225106, amelparib, AMP- 1707, CK-102, HRS-1167, IDX-1197, IMP-1734, mefoparib, NMS-03305293, palacarib, SC-10914, stenoparib, TQB-3823, or VB-15010.

4. The compound of claim 2, wherein A is a residue of fuzuloparib, niraparib, olaparib, pamiparib, rucaparib, saruparib, or talzoparib.

5. The compound of claim 4, wherein A is of the formula:

6. The compound of any of claims 1-5, wherein L comprises (2-[2-[2- (amino)ethoxy] ethoxy] acetic acid) (AEEA, AeeA), (8-amino-3,6-dioxa-octyl)succinamic acid, lysine, a cleavage-resistant peptide, an aliphatic chain, or polyethylene glycol (PEG).

7. The compound of any of claims 1-5, wherein L comprises an aliphatic and / or polyethylene glycol (PEG) chain.

8. The compound of claim 7, wherein L is -(CH2)m- or -( CEECEEC n-, m is 2-10, and n is 2-8.TSRI 2262.1PC / TSR3173P 18350.049W019. The compound of any of claims 1-8, wherein B is a residue of a BET inhibitor that binds to a BD1 domain (e.g., GSK778, GSK789, JQ1, a xanthine derivative, olinone, MS436).

10. The compound of any of claims 1-8, wherein B is a residue of a BET inhibitor that binds to a BD2 domain (e.g., apabetalone (RVX-208), ABBV-744, GSK620, GSK046, BY27, 1-BET762).

11. The compound of claim 9, wherein B is a residue of (+)- JQ 1 of the formula:

12. The compound of claim 1, which is:(.S') - 5 -(2-(4-(4-chlorophenyl)-2,3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [ 1 ,4]diazepin- 6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)pentanamide ;9-(2-(4-(4-chlorophenyl)-2,3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [1,4] diazepin-6- yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5- yl)phenyl)nonanamide ;(.S')- 1 -(2-(4-(4-chlorophenyl)-2,3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [ 1 ,4]diazepin- 6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)- 3,6,9, 12-tetraoxapentadecan- 15 -amide;(.S')- 1 -(2-(4-(4-chlorophenyl)-2,3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [ 1 ,4]diazepin- 6-yl)acetamido)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)- 3,6,9, 12-tetraoxapentadecan- 15 -amide;(.S')-7-(2-(4-(4-chlorophcny I )-2.3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [ 1 ,4]diazepin- 6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-7- azaspiro [3.5] nonane-2 -carboxamide ;(.S') - 3 -(2-(4-(4-chlorophenyl)-2,3 ,9-trimethyl-6H-thieno [3 ,2-f] [ 1 ,2,4]triazolo [4,3 -a] [ 1 ,4]diazepin- 6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-3- azaspiro [5.5] undecane -9-carboxamide ;((S)-T-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepin- 6-yl)acetyl)-N-(4-(8-fluoro-l-oxo-2,3,4,6-tetrahydro-lH-azepino[5,4,3-cd]indol-5-yl)phenyl)-[l,4'- bipiperidine]-4-carboxamide; or a pharmaceutically acceptable salt thereof.TSRI 2262.1PC / TSR3173P 18350.049W0113. A pharmaceutical composition comprising a compound of any of claims 1-12 and a pharmaceutically acceptable excipient.

14. A method of treating cancer in a patient, which comprises administering a compound of any of claims 1-12 or a pharmaceutical composition of claim 13 to a patient in need thereof.

15. The method of claim 14, wherein the cancer is bladder cancer, brain cancer, breast cancer, colorectal cancer, endometrial cancer, gastric cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, and testicular cancer.

16. The method of claim 14, wherein the cancer is breast, fallopian tube, ovarian, primary peritoneal, or prostate cancer with germline or somatic BRCA mutations or homologous recombination deficiencies.

17. The method of any of claims 14-16, wherein the cancer is resistant to PARP inhibitor monotherapy.

18. The method of claim 17, wherein the cancer is resistant to fuzuloparib, niraparib, olaparib, pamiparib, rucaparib, saruparib, or talzoparib.

19. The method of any of claims 14-18, wherein the patient is non-responsive to a PARP inhibitor or is unable to tolerate adverse effects associated with a PARP inhibitor.