Recombinant expression systems and radiation useful for the treatment of cancer

The recombinant expression system using AAV-HL12 with an IFN-inducible promoter for IL-12 production in irradiated tumors addresses the limitations of radiation therapy by inducing regression in both treated and untreated tumors, enhancing cancer treatment efficacy.

WO2026131894A1PCT designated stage Publication Date: 2026-06-25FUNDACION PARA LA INVESTIGACION MEDICA APLICADA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/087486
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-16
Filing Date
2025-12-16
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current radiation therapy for cancer induces immunosuppressive factors and vascular damage, limiting its therapeutic benefit, and previous attempts to enhance immune response with IL-12 delivery, such as using AAV vectors, have faced systemic toxicity and insufficient levels.

Method used

A recombinant expression system using an AAV vector (AAV-HL12) with an IFN-inducible promoter that selectively produces IL-12 in irradiated tumors, enhancing immune response and allowing treatment of at least one tumor with radiation and expression system, which surprisingly induces regression in both treated and distant tumors.

Benefits of technology

The combination therapy achieves synergistic tumor regression in treated and untreated tumors, improving treatment efficiency by treating one tumor with the recombinant expression system and radiation, even in cases with multiple tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000083_0001
    Figure IMGF000083_0001
  • Figure IMGF000083_0002
    Figure IMGF000083_0002
  • Figure IMGF000018_0001
    Figure IMGF000018_0001
Patent Text Reader

Abstract

Recombinant expression systems and radiation useful for the treatment of cancer The invention relates to a recombinant expression system comprising a nucleic acid construct, particularly for use in a combined gene and radiation therapy for the treatment of diseases, especially cancer. Said expression system is administered to a tumor that received prior low dose radiation. Additionally, the method comprises that at least one further tumor different from the one treated with expression system is subjected to radiation.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Recombinant expression systems and radiation useful for the treatment of cancer

[0002] FIELD OF THE INVENTION

[0003] The invention relates to a recombinant expression system comprising a nucleic acid construct, particularly for use in a combined gene and radiation therapy for the treatment of diseases, especially cancer. Said expression system is administered to a target tissue or organ that received treatment with radiation.

[0004] BACKGROUND OF THE INVENTION

[0005] Treatment with radiation is the mainstay of first-line treatment in about 50 % of solid cancers (Citrin, 2017). Despite its widespread use, rad io re sista nee and tumor recurrence remain significant clinical challenges (Huang, 2020; Barker, 2015; Qian, 2020). Effective tumor responsesto radiation are critically influenced by the host immune system, particularly T cell responses, with severalstudies highlighting a link between tumor-infiltrating CD8+ T cells and radiation-induced antitumor effects (Lee, 2009; Weichselbaum, 2017; Wang Y. L.-G., 2019). By producing DNA damage and immunogenic cell death of cancer cells, ionizing radiation (IR) increases the release of tumor antigens and the generation of neoantigens, leading to the expansion of the immunopeptidome presented to T cells by antigen-presenting cells (APCs) (Charpentier, 2022; Lussier, 2021; Re its, 2006; Lhuillier, 2021; Tailor, 2022) . Radiation therapy (RT) increases the production of type I IFN through the cGAS / STING pathway and enhances the expression of MHC class I molecules (Deng, 2014; Woo, 2014), thus promoting the exposure of tumor antigens to the immune system.

[0006] However, although treatment with radiation primes the immune system against the tumor, it also induces a wide spectrum of immunosuppressive factors, including TGF , adenosine, and chemokines that attract a variety of immunoinhibitory cell populations such as immunosuppressive macrophages, myeloid-derived suppressor cells (MDSC) and Tregs (Charpentier, 2022; Cytlak, 2022; Jobling, 2006; De Martino, 2021; Schaue, 2021; Allard, 2020; Kalbasi, 2017; Ahn, 2010; Rodriguez-Ruiz, 2020). These elements are notable for their ability to dampen T cell effectorfunctions through various mechanisms, facilitating the tumor escape from the immune system. Furthermore, treatment with radiation induces vascular damage and exacerbates chronic hypoxia, giving rise to new hypoxic areas infiltrated with immunosuppressive and tumor-promoting macrophages (Brown, 2020). Therefore, despite promoting the immunogenicity of the tumors, IR shapes a suppressive milieu that hampers effectorT cell responses and restrains the therapeutic benefit of RT. Hence, there is a great need for therapeutic approaches able to trigger fully effective antitumor immunity and enhance the curative potential of treatment with radiation.

[0007] Using a gene transfer approach, the inventors previously sought to link tumor irradiation with intratumor production of IL-12, an essential cytokine for the activation of both innate and adaptive immune responses (Tugues, 2015; Nguyen, 2020; Kerkar, 2011; Trinchieri, 1995) . IL- 12 plays a key role in the immune system by promoting the differentiation and maturation of naive T cells, which enhances cell-mediated immunity. Importantly, IL-12 stimulates natural killer (NK) cells and CD8+ T cells to produce interferon -gamma (I FNy), boosting the immune response against tumors.

[0008] Multiple therapeutic strategies have been explored to achieve efficient and safe delivery of IL- 12. Despite showing great potential in preclinical studies, previous clinical trials have failed mainly due to systemic toxicity or insufficient levels of active IL- 12 (Atkins, 1997; Lenzi, 2007; Cohen, 1995; Sangro, 2004; Penuelas, 2005; Younes, 2004) .

[0009] To address these challenges; AAV vectors were used. AVV are the benchmark in gene therapy and have been widely used in the clinic due to long-term expression capacity and favourable safety profile (Wang D. T., 2019). Although their use in oncology has been hampered by their limited ability to transduce tumors, it was found that IR reprograms cellular circuits, including epigenetic modifications, that enhances AAV-mediated tumor transduction, representing an attractive opportunity for oncological applications.

[0010] As a result, an AAV vector (AAV-HL12) that enables selective and sustained intratumoral production of IL-12 was devised. To achieve this, transgene expression was restricted to irradiated tumors by using an I FN -ind ucible promoter that responds to type I and type II IFN produced through cGAS / STING activation, following RT and type II IFN derived from adaptive immune responses.

[0011] The inventors have now surprisingly found that it is not required to treat every tumor in a patient with the recombinant expression system. It is sufficient to treat at least one tumor with the expression system and radiation. All further tumors may be treated exclusively with radiation. This provides a simpler therapy for treating cancer, in particular cancers which involve the presence of more than one tumor, such as metastatic cancers.

[0012] SUMMARY OF THE INVENTION

[0013] The inventors surprisingly found that in the presence of more than one tumor (metastatic or primary), the treatment of at least one of the tumors (metastatic or primary) with radiation and the expression system of the present invention leads to tumor regression not only of the tumor(s) receiving the combination therapy (radiotherapy plus the expression system) but also of further distant tumors if those are subjected to radiation therapy. Surprisingly, the combination of the treatment with radiation and with the expression system as described herein has a synergistic effect in tumortreatment (e.g., tumor size reduction) not only in the tumor(s) treated with radiation and the expression system, but also in further distant tumors if those are subjected to radiation therapy. This synergistic effect was neither disclosed nor suggested in the prior art.

[0014] In other words, treatment of at least one tumor (primary or metastatic) with radiotherapy plus the expression system of the present invention induces regression of the treated tumor and also of distant tumors (primary or metastatic) if these are given radiotherapy (but not the expression system).

[0015] This finding greatly improves the efficiency of the treatment, as treatment of one tumour target with the recombinant expression system and radiation is sufficient to elicit a strong and sustainable therapeutic effect in any further tumortreated only with radiation.

[0016] By way of example, if a subject suffers from cancer and has 6 tumors (primary or metastatic), all six may be treated with radiation and 1, 2, 3, 4, or 5 tumors may be treated with the recombinant expression system and treated with radiation . Regression of the tumor treated with the recombinant expression system and also of distant tumors (not treated with the recombinant expression system) is observed.

[0017] Therefore, the invention provides a recombinant expression system for use in a method of treating a proliferative disease, such as cancer, wherein a. at least one tumor (primary or metastatic) is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor (primary or metastatic) different from the at least one tumor treated in step a. is treated with radiation.

[0018] Radiation may be applied locally to each of the tumors or systemically (to the whole body, i.e., whole-body irradiation). In one embodiment, radiation is applied systemically (only to the tumors). In a preferred embodiment, radiation is applied locally, i.e., in one embodiment, the radiation is not whole-body irradiation.

[0019] Consequently, the cancer to be treated by the recombinant expression system of the present invention is characterized in that it has at least two tumors. The at least one further tumor (b) different from the tumor treated in step a. is not treated with the recombinant expression system. This means that in a patient with multiple tumors (primary or metastatic), more than one tumor is treated with radiation and one or more but not all tumors treated with radiation are treated with the recombinant expression system.

[0020] Hence, the present invention provides methods of treatment of cancer wherein: a. at least one tumor (primary or metastatic) is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor (primary or metastatic) different from the at least one tumor treated in step a. is treated with radiation.

[0021] Radiation may be applied locally to each of the tumors or systemically (to the whole body, i.e., whole-body irradiation). In one embodiment, radiation is applied systemically (only to the tumors). In a preferred embodiment, radiation is applied locally, i.e., in one embodiment, the radiation is not whole-body irradiation.

[0022] The tumors in the cancer can be both primary and metastatic, as further defined below. Not all tumors of a patient have to be treated. In a patient with a variety of tumors ( metastatic or primary), at least two different primary tumors or at least two metastatic tumors or any combination thereof may be treated. Hence, in one embodiment, the cancer comprises more than two tumors, but only two tumors are treated. For instance, one tumor will be treated with the recombinant expression system and both tumors will be treated with radiation, locally or systemically, as described herein. Hence in one embodiment, the cancer comprises two or more tumors, such as X tumors (wherein X is 2 or a number higher than 2). In this case, all of the tumors may be treated with radiation, locally or systemically, as described herein, and X-l tumors (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more tumors) may be treated with the recombinant expression system. In another case, when X is higher than 2, X-l tumors will be treated with radiation, locally or systemically, as described herein, a nd X-2 tumors (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more tumors) may be treated with the recombinant expression system.

[0023] In a further embodiment, the recombinant expression system comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter.

[0024] In a preferred embodiment the immunomodulatory gene or protein is IL- 12, which has the ability to stimulate natural killer (NK) cells and CD8+ T cells to produce interferon-gamma (IFNy), boosting the immune response against tumors. In a further embodiment, the radiation inducible promoter is an interferon (I FN)-inducible promoter.

[0025] In a preferred embodiment, the I FN-ind ucible promoter responds to type I IFN and / or type II IFN. Preferably, the promoter responds to type I and type II IFN produced through cGAS / STING activation following radiation and type II IFN derived from adaptive immune responses.

[0026] In a preferred embodiment, the radiation inducible promoter comprises at least one interferon-stimulated response element (ISRE) and more preferably is selected from the list consisting of: a. a nucleotide sequence comprising one to ten copies, preferably two to seven copies, more preferably three to five copies and particularly preferably 4 copies of a sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with respect to SEQ I D NO: 17 or is or is most preferably identical to SEQ ID NO: 17; optionally wherein the copies are interspaced by up to forty nucleotides, preferably four to thirty-five nucleotides, more preferably ten to thirty nucleotides and particularly preferably fifteen to twenty-five nucleotides; b. a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 18, or is preferably identical to SEQ ID NO.: 18; c. a nucleotide a sequence having at least 75%, at least 80%, at least 85%, at least 90% orat least 95% sequence identity with respectto SEQ ID NO: 19 or is preferably identical to SEQ ID NO.: 19.

[0027] In a furtherembodiment, the at least one immunomodulatory gene or protein is selected from the group consisting of interleukin-1, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-7, interleukin-8, interleukin-9, interleukin-11, single-chain interleukin-12, interleukin-12, interleukin-13, interleukin-14, interleukin-15, interleukin-15-sushi, interleukin- 16, interleukin-17, interleukin-18, interleukin-19, interleukin-20, interleukin-21, interleukin- 22, interleu kin -23, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10 (I P10), CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, CX3CL1, granulocyte-macrophage colony-stimulating factor, type I interferons, IFN-y, TNF-a, FLT3-ligand, a blocking peptide targeting TG F-B, a blocking peptide targeting IL-10, a blocking peptide targeting FoxP3, a monoclonal antibody or single -chain variable fragment (scFv) or nanobody neutralizing PD1, PDL1, CTLA4, CD137, TIM3, LAG3, and a fragment or variant thereof; or a shRNA targeting TGF-B, a shRNA targeting IL-10, or a shRNA targeting FoxP3.

[0028] In a preferred embodiment, the at least one immunomodulatory protein is:

[0029] (i) encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ ID NO: 1 or 3, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: l or 3, or

[0030] (ii) selected from the group consisting of: a. the alpha subunit of IL- 12; b. the B-subunit of IL-12; c. single chain IL- 12 comprising the a- and B-subunit of IL- 12; d. a single chain IL- 12 comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 4; e. a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 2 or 4, wherein the polypeptide has the biological activity of interleukin-12.

[0031] In a further embodiment, the nucleic acid construct further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the proteins,

[0032] In a further embodiment, the tissue is liver tissue, spleen, kidney or tissue of the reproductive organs.

[0033] In a furtherembodiment, the sequence motif is a target sequence of a microRNA that is highly abundant in the liver.

[0034] In a further embodiment, the target sequence is selected from the group consisting of miR- 122 target sequence, miR-192 target sequence, miR-199a target sequence, miR-101 target sequence, miR-99a target sequence, Iet7a target sequence, Iet7b target sequence, Iet7ctarget sequence, Iet7f target sequence .

[0035] In a preferred embodimentof the invention, the targetsequence is a miR-122 target sequence selected from: a. a miR-122 target sequence having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 10 or having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 11 or is identical to SEQ ID NO: 11; optionally wherein the nucleotide sequence comprises 1 to 12, preferably 3 to 10, more preferably 4 to 8 and particularly preferably 5 copies of the miR-122 target sequence; optionally wherein the copies are interspaced by one to forty nucleotides, preferably one to thirty nucleotides, more preferably two to twenty nucleotides and particularly preferably two to eight nucleotides; and b. a nucleotide sequence comprising 5 copies of the miR-122 target sequence as depicted in SEQ ID NO: 11.

[0036] In a further embodiment, the recombinant expression system is an expression vector.

[0037] In a furtherembodiment, the expression vector is a viral vector, more preferably a viral vector selected from the list consisting of adeno-associated virus (AAV) vector, adenoviral vector, lentiviral vector, vaccine virus vector, or herpessimplex virus vector, even more preferab ly an adeno-associated virus vector having one or more of the following characteristics: a. the nucleic acid construct sequence further comprises a 5'ITR and a 3'ITR sequence, being preferably AAV 2 ITRs having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NOs: 13 and 14; most preferably comprising a 5'ITR and a 3'ITR sequence identical to SEQ ID NOs: 13 and 14, b. the AAV vector has preferably the serotype AAV8, AAV1, AAV3, AAV6, AAV9, AAV2, AAV5, AAVrh.10, or anygain-of-function mutant of AAVrh.10, more preferably the AAV vector has the serotype AAV8.

[0038] In a further embodiment, the nucleic acid construct sequence comprises an alternative 5'ITR having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NOs: 27 or is identical to SEQ ID NOs: 27.

[0039] In a further embodiment, the recombinant expression system is contained in a viral particle, preferably wherein the viral particle is an AAV viral particle or an adenoviral particle; more preferably an AAV viral particle; even more preferably an AAV8 viral particle .

[0040] In a further embodiment, the cancer is a solid cancer. The cancer is characterized by the presence of at least two different tumors. For instance, the cancer is characterized by the presence of two different tumors in the patientsufferingfrom cancer. For instance, the cancer is characterized by the presence of more than two different tumors, such as three, four, five, six, seven, eight, nine, ten, or more different tumors. The different tumors may be primary tumors or secondary (metastatic) tumors. A primary tumor is the tumor which first appears in the body. Cancer cells from a primary tumor may spread to other parts of the body and form new, or secondary, tumors (metastasis or metastatic tumors). These secondary tumors are the same type of cancer as the primary tumor. The at least two differenttumors may also be a combination of primary and secondary (metastatic) tumors.

[0041] In a further preferred embodiment of the invention, the solid cancer is selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cancer of the thymus, cervical cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head & neck cancers, Hodgkin's lymphoma, primary liver cancer, metastatic liver cancer, gallbladder cancer, lung cancer, melanoma cancers, mesothelioma, multiple myeloma, Merkel cell carcinoma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, urothelial cancer, renal cancer, sarcoma, skin cancer, testicular cancer, thyroid cancer, uterine cancer, plasma cell tumors, neuroendocrine tumors, cholangiocarcinoma, or carcinoid tumors.

[0042] In a further embodiment, the cancer is a metastatic cancer.

[0043] In a further embodiment, the at least one tumor (a) treated with the recombinant expression system and with radiation is treated with the recombinant expression system by intratumoral administration of the recombinant expression system. Hence, in one embodiment, the recombinant expression system is administered intratumorally.

[0044] In a further embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system prior or concurrently or after the treatment with radiation.

[0045] In a further preferred embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after treatment with radiation.

[0046] In a preferred embodiment, the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours. In a further embodiment, the at least one further tumor (b) is treated with radiation prior or concurrently or after the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system.

[0047] In a further preferred embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one further tumor (b) is treated with radiation.

[0048] Preferably, the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours.

[0049] In a further embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after the at least one tumor (a) and the at least one further tumor (b) are treated with radiation.

[0050] In a further embodiment, the at least two tumors are treated with radiation and only one of the tumors treated with radiation is treated with the recombinant expression system.

[0051] In a further embodiment, the radiation is ionizing radiation, preferably wherein the ionizing radiation is based on photon rays, preferably wherein the photon ray is selected from the group consisting of X-rays or gamma-rays, or particle rays, preferably wherein the particle of the particle ray is selected from the group consisting of beta particle, alpha particle, neutron, muon, pion, proton or other heavier positive ions.

[0052] In a further embodiment, the radiation has a total dose of radiation of 100 Gy or less, preferably 40 Gy or less and more preferably of 8 Gy and less.

[0053] In a further embodiment, the radiation is administered using stereotactic radiosurgery (SRS), intraoperative radiation therapy (IORT), stereotactic body radiotherapy (SBRT), single dose radiotherapy (SDRT), intensity-modulated radiation therapy (IM RT), Image-Guided Radiation Therapy (IGRT), stereotactic ablative radiotherapy (SABR) or a form of hypofractionated radiation therapy preferably performed by linear accelerator (LINAC) machines, gamma Knife machines or proton beam therapy.

[0054] In a further embodiment, the radiation is administered in combination with any chemotherapy or standard of care known to the skilled person, before, after, concomitant or sequential accordingly with the standard care for each cancer. In a particularly preferred embodiment, any of the described treatments with radiotherapy and / or the expression system occur after previous treatment with chemotherapy.

[0055] In a further embodiment, the method is a combination therapy further comprising at least one furthertherapy selected from the group consisting of: a. a therapy comprising at least one checkpoint inhibitor, preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, CTLA-4, LAG3, BTLA, B7H3, B7H4, TIM3, KIR, or A2aR, more preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, or CTLA-4; and / or b. a therapy comprising at least one adoptive cell therapy, preferably selected from adoptive NK cell therapy, adoptive dendritic cell therapy, or adoptive T-cell therapy, wherein the adoptive T-cell therapy preferably is a CAR-T-cell therapy, TCR-T-cell therapy ora therapy using TIL; and / or c. a therapy comprising at least one cancer vaccine; and / or d. a therapy comprising at least one exogenous cytokine.

[0056] In a particularly preferred embodiment of the invention, the recombinant expression system comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter and at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the proteins, and: a. the radiation inducible promoter comprises a nucleotide sequence according to SEQ ID NO: 18, b. the at least one immunomodulatory protein is encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ ID NO: 1 or 3, c. the sequence motif that inhibits transgenic expression of the immunomodulatory protein is a nucleotide sequence comprising 5 copies of the miR-122 target sequence as depicted in SEQ ID NO: 11, d. the at least one tumor treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor and the at least one further tumor is treated with radiation.

[0057] In further preferred embodiments, the recombinant expression construct comprises these components and the sequences for the radiation inducible promoter, immunomodulatory protein and motif that inhibits transgenic expression each have a sequence identity of 70%, 80% or preferably 90% to SEQ ID Nos.: 18, 1 or 3 and 11, respectively. ITEMS

[0058] The invention is summarised in the following items:

[0059] Item 1: A recombinant expression system for use in a method of treating cancer, wherein a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor different from the at least one tumor treated in step a. is treated with radiation.

[0060] Item 2: The recombinant expression system for use according to item 1, wherein the recombinant expression system comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter.

[0061] Item 3: The recombinant expression system for use according to any one of items 1 or 2, wherein the radiation inducible promoter is an interferon (I FN) -inducible promoter, preferably wherein the I FN -inducible promoterrespondsto type I IFN and / or type II IFN, more preferably wherein the promoter responds to type I and type II IFN produced th rough cGAS / STING activation following radiation and type II IFN derived from adaptive immune responses.

[0062] Item 4: The recombinant expression system for use according to any one of items 2-3, wherein the radiation inducible promoter comprises at least one interferon-stimulated response element (ISRE) and more preferably is selected from the list consisting of: a. a nucleotide sequence comprising one to ten copies, preferably two to seven copies, more preferably three to five copies and particularly preferably 4 copies of a sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 17 or is or is most preferably identical to SEQ ID NO: 17; optionally wherein the copies are interspaced by up to forty nucleotides, preferably four to thirty-five nucleotides, more preferably ten to thirty nucleotides and particularly preferably fifteen to twenty-five nucleotides; b. a nucleotide sequence according to SEQ ID NO: 18; c. a nucleotide sequence according to SEQ ID NO: 19. Item 5: The recombinant expression system for use according to any one of items 2-4, wherein the at least one immunomodulatory gene or protein is selected from the group consisting of interleukin-1, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-7, interleukin-8, interleukin-9, interleukin-11, single-chain interleukin-12, interleukin-12, interleukin-13, interleukin-14, interleukin-15, interleukin-15-sushi, interleukin-16, interleukin- 17, interleukin-18, interleukin-19, interleukin-20, interleukin-21, interleukin-22, interleukin- 23, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10 (I PIO), CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, CX3CL1, granulocyte - macrophage colony-stimulating factor, type I interferons, I FN -y, TNF-a, FLT3-ligand (FLT3L), a blocking peptide targeting TG F-B, a blocking peptide targeting I L- 10, a blocking peptide targeting FoxP3, a monoclonal antibody or single -chain variable fragment (scFv) or nanobody neutralizing PD1, PDL1, CTLA4, CD137, TIM3, LAG3, and a fragment or variant thereof; or a shRNA targeting TGF-B, a shRNA targeting IL-10, or a shRNA targeting FoxP3.

[0063] Item 6: The recombinant expression system for use according to any one of items 2-5, wherein the at least one immunomodulatory protein is: encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ I D NO: 1 or 3, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 1 or 3, or selected from the group consisting of: a. the alpha subunit of I L- 12; b. the B-subunit of IL-12; c. single chain IL- 12 comprising the a- and B-subunit of IL- 12; d. a single chain I L- 12 comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 4; e. a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 2 or 4, wherein the polypeptide has the biological activity of interleukin-12, and / or selected from the group consisting of: a. IFN-B, preferably as described herein (e.g., SEQ I D NO.: 5), b. IL- 15, such as sushi IL- 15, preferably as described herein (e.g., SEQ ID NO.: 6), c. a chemokine, preferably a CXCL10, preferably as described herein (e.g., SEQ ID NO.: 7), d. FLT3L, e. peptides that block TGF-B, f. peptides that block FoxP3, and g. antibodies or antibody fragments, such as nanobodies, against immune checkpoint inhibitors PD1 or PD-L1.

[0064] Item 7: The recombinant expression system for use according to any one of items 2-6, wherein the nucleic acid construct further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the proteins, preferably wherein the tissue is liver tissue, preferably wherein the sequence motif is a target sequence of a microRNA that is highly abundant in the liver, more preferably wherein the target sequence is selected from the group consisting of miR- 122 target sequence, miR-192 target sequence, miR-199a target sequence, miR-101 target sequence, miR-99a target sequence, Iet7a target sequence, Iet7b target sequence, Iet7ctarget sequence, Iet7f target sequence, and even more preferably is a miR-122 target sequence selected from the list consisting of: a. a miR-122 target sequence having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 10 or having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 11 or is identical to SEQ ID NO: 11; optionally wherein the nucleotide sequence comprises 1 to 12, preferably 3 to 10, more preferably 4 to 8 and particularly preferably 5 copies of the miR-122 target sequence; further optionally wherein the copies are interspaced by one to forty nucleotides, preferably one to thirty nucleotides, more preferably two to twenty nucleotides and particularly preferably two to eight nucleotides; b. a nucleotide sequence comprising 5 copies of the miR-122 target sequence as depicted in SEQ ID NO: 11.

[0065] Item 8: The recombinant expression system for use according to any one of the preceding items, wherein the recombinant expression system is an expression vector; preferably wherein the expression vector is a viral vector, more preferably a viral vector selected from the list consisting of adeno-associated virus (AAV) vector, adenoviral vector, lentiviral vector, vaccine virus vector, or herpes simplex virus vector, even more preferably an adeno-associated virus vector having one or more of the following characteristics: a. the nucleic acid construct sequence further comprises a 5' -ITR and a 3'-ITR sequence, being preferably AAV25'-ITRs having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO.:13 or 27 and a 3' -ITR having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with SEQ ID NO.: 14; most preferably comprising a 5'ITR and a 3'ITR sequence identical to SEQ ID NOs: 13 and 14; b. the AAV vector has preferably the serotype AAV8, AAV1, AAV3, AAV6, AAV9, AAV2, AAV5, AAVrh.10, or anygain-of-function mutant of AAVrh.10, more preferably the AAV vector has the serotype AAV8.

[0066] Item 9: The recombinant expression system for use according to any one of the preceding items, wherein the recombinant expression system is contained in a viral particle, preferably wherein the viral particle is an AAV viral particle or an adenoviral particle; more preferably an AAV viral particle; even more preferably an AAV8 viral particle.

[0067] Item 10: The recombinant expression system for use according to any one of the preceding items, wherein the tumors are a solid tumors, preferably wherein the solid tumor is selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cancer of the thymus, cervical cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head & neck cancers, Hodgkin's lymphoma, primary liver cancer, metastatic liver cancer, gallbladder cancer, lung cancer, melanoma, mesothelioma, multiple myeloma, Merkel cell carcinoma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, urothelial cancer, renal cancer, sarcoma, skin cancer, testicular cancer, thyroid cancer, uterine cancer, plasma cell tumors, neuroendocrine tumors, cholangiocarcinoma, or carcinoid tumors.

[0068] Item 11: The recombinant expression system for use according to any one of the preceding items, wherein the cancer is a metastatic cancer.

[0069] Item 12: The recombinant expression system for use according to any one of the preceding items, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system by intratumoral administration of the recombinant expression system.

[0070] Item 13: The recombinant expression system for use according to any one of the preceding items, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system prior or concurrently or after the at least one tumor (a) is treated with radiation, preferably wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) is treated with radiation, preferably wherein the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours, or between 1 minute and 1 day, preferably between 1 minutes and 12 hours, more preferably between 1 minute and 6 hours, even more preferably between 1 minute and 1 hour.

[0071] Item 14: The recombinant expression system for use according to any one of the preceding items, wherein the at least one further(b) tumor is treated with radiation prior orconcurrently or after the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system, preferably wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one furthertumor (b) is treated with radiation, preferably wherein the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours or between 1 minute and 1 day, preferably between 1 minutes and 12 hours, more preferably between 1 minute and 6 hours, even more preferably between 1 minute and 1 hour.

[0072] Item 15: The recombinant expression system for use according to any one of the preceding items, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) and the at least one furthertumor (b) is treated with radiation. Item 16: The recombinant expression system for use according to any one of the preceding items, wherein at least two tumors are treated with radiation and only one of the tumors treated with radiation is treated with the recombinant expression system.

[0073] Item 17: The recombinant expression system for use according to any one of the preceding items, wherein the radiation is ionizing radiation, preferably wherein the ionizing radiation is based on photon rays, preferably wherein the photon ray is selected from the group consisting of X-rays or gamma-rays, or particle rays, preferably wherein the particle of the particle ray is selected from the group consisting of beta particle, alpha particle, neutron, muon, pion, proton or other heavier positive ions, preferably wherein the radiation is applied locally, preferably wherein the radiation is applied as a single dose.

[0074] Item 18: The recombinant expression system for use according to any one of the preceding items, wherein the radiation has a total dose of radiation of 100 Gy or less, preferably 40 Gy or less and more preferably of 8 Gy and less.

[0075] Item 19: The recombinant expression system for use according to any one of the preceding items, wherein the radiation is administered using stereotactic radiosurgery (SRS), intraoperative radiation therapy (IORT), stereotactic body radiotherapy (SBRT), single dose radiotherapy (SDRT), intensity-modulated radiation therapy (IM RT), Image-Guided Radiation Therapy (IGRT), stereotactic ablative radiotherapy (SABR) or a form of hypofractionated radiation therapy preferably performed by linear accelerator (LINAC) machines, gamma Knife machines or proton beam therapy.

[0076] Item 20: The recombinant expression system for use according to any one of the preceding items, wherein the method is a combination therapy further comprising at least one further therapy selected from the group consisting of: a. a therapy comprising at least one checkpoint inhibitor, preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, CTLA-4, LAG3, BTLA, B7H3, B7H4, TIM3, KIR, or A2aR, more preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, or CTLA-4; and / or b. a therapy comprising at least one adoptive cell therapy, preferably selected from adoptive NK cell therapy, adoptive dendritic cell therapy, or adoptive T-cell therapy, wherein the adoptive T-cell therapy preferably is a CAR-T-cell therapy, TCR-T-cell therapy or a therapy using TIL; and / or c. a therapy comprising at least one cancer vaccine; and / or d. a therapy comprising at least one exogenous cytokine; and / or e. a therapy compromising at least a chemotherapy agent before, jointly or after the radiation. 21. The recombinant expression system for use according to any one of the preceding items, wherein: a. wherein the radiation inducible promoter comprises a nucleotide sequence according to SEQ ID NO: 18, b. wherein the at least one immunomodulatory protein is encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ ID NO: 1 or 3, c. wherein the sequence motif that inhibits transgenic expression of the immunomodulatory protein is a nucleotide sequence comprising 5 copies of the miR- 122 target sequence as depicted in SEQ ID NO: 11 d. wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after the at least one tumor (a) and the at least one furthertumor (b) is treated with radiation . BRIEF DESCRIPTION OF SEQUENCES

[0077] BRIEF DESCRIPTION OF FIGURES

[0078] Figure 1: Radiotherapy enhances AAV-mediated tumor transduction both in vitro and in vivo.

[0079] Transduction efficiency of AAV-cGFP in mouse MC38 (A) or human RT-112 (B) tumor cells, determined by flow cytometry at day 3. Cells were irradiated (8Gy) or not and AAV vectors were added immediately after at indicated MOIs. C) GFP mean fluorescence intensity (MFI) levels in GFP+MC38 (left) and RT-122 (right) 3 days after transduction with AAV-cGFP. D) Percentage (left) and MFI (right) of GFP+cells 3 days after indicated doses of RT, followed by AAV-cGFP transduction (MOI 5xl04). E) Quantification of AAV-ITR relative to actin expression by qPCR from control or irradiated (8Gy) MC38 cells at indicated time points after AAV transduction. F) CAG qPCR from chromatin immunoprecipitation with anti-H3K27ac. G) Percentage (top) and MFI (bottom) in control or irradiated (8Gy) B16 cells in presence of indicated concentrations of A-484. Western blot for H3K27ac and total H3 in cells treated or not with A-485 (lOuM). H) ITR qPCR from chromatin immunoprecipitation with anti-YYl with AVV WT or YYl-binding site mutant. I) GFP MFI levels in GFP+B16 cells transduced with AAV- GFP WT (left) or YYl-binding site mutant (right) 3 days after transduction. I HQ analysis of GFP expression in MC38 (J) or RT112 (K) tumor sections, next to representative images with the indicated conditions (n=6-8 sections from 3-4 mice per group). Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test). Figure 2: Inducible AAV vector enables selective transgene expression in irradiated tumors.

[0080] A) Schematic representation of the inducible AAV vector design. B) Luciferase activity of B16 cells after 6h-incubation with IFN, 48h after radiation (0 / 8Gy) followed by AAV-cLuc (up) or AAV-iLuc (down) infection. C) Comparison of in vivo bioluminescence five days after i.t. injection of 5xlO10vg / mouse of AAV-cLuc (left) or AAV-iLuc (right) in MC38 tumor-bearing mice (n= 5 / group). D) In vivo bioluminescence expression five days after treatment. C57BL / 6J mice were inoculated with with 5xl05MC38 tumor cells s.c. in both flanks. Twelve days later, mice received RT (8Gy) or not followed by i.t. injection of AAV-iLuc (5xlO10vg / mouse) (n= 5 / group). E) In vivo bioluminescence two days after treatment. Bilateral MC38 tumor-bearing mice received RT (0, 8, or 20Gy) in the right tumor, followed by intravenous injection of AAV- iLuc (5xlO10vg / mouse) (n=5 / group). F) Experimental design: right tumors were treated with RT (8Gy), followed by i.t. injection of AAV-iLuc (5xlO10vg / mouse). Three days later, the left tumor received 8Gy. After AAV administration, in vivo bioluminescence was monitored on days 1, 4, 10, and 15. (n= 5 / group). Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test).

[0081] Figure 3: AAV-based cytokine delivery for cancer immunotherapy.

[0082] A) Schematic representation of the AAV vectors used for local immunotherapy with the I FN - inducible promoter. B) IL- 12, 1 L15 / I L15Rct, and FLT3L levels in B16 cells 72h afterO, 4 and 8 Gy of RT. Cells were transduced with a 104pg / cell dose and stimulated with IFNa for the last 12h of culture. Data are presented as n = 3 mean ± SEM. Analysed by one -way ANOVA followed by Tukey's test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). C) IL12, IL15 / IL15Rct and FLT3L levels in tumor from animals inoculated with B16 tumor cells 3 days after RT (OGy, 4Gy or 8Gy) followed by i.t. injection of indicated AAVs (5xlO10vg / mouse) (n = 5 mice / group). Data are presented as mean ± SEM. Analysed by unpaired two-sided Student's t-test. D) TME infiltrating lymphoid and myeloid cell analysis. B16 tumors obtained 6 days after treated with 8 Gy RT and indicated AAVs (5xlO10pg / mouse) (n=5 mice / group). Data were analysed by oneway ANOVA followed by Tukey's post hoc test. E) Tumor growth of s.c. B16 tumor-bearing individual mice after 8Gy RT and i.t. injection of indicated AAVs (lxlO10vg / mouse) (n=6-7 mice / group) merged with control treatment (AAV-iLuc) (up) and Kaplan-Meier survival plot (down), analysed with Log-rank test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0083] Figure 4: Local radiotherapy enhances the antitumor activity of AAV-HL12 without systemic toxicity.

[0084] Tumor growth of s.c. MC38 (A), B16 (B) or LLC (C) tumor-bearing mice received RT (OGy or 8Gy) followed by intratumoral injection of AAV-iLuc or AAV-HL12 (5xlO10vg / mouse) (n= 6- 10 / group). Data are represented as tumor volume mean ± SEM of different experimental groups. D) Waterfall plots showing increase in tumor volume measured by echography. E) Overall survival of mice implanted with GL261 orthotopic tumors and treated as indicated. F) Human PBMC-reconstituted MHC-dKO NSG mice were inoculated subcutaneously with RT- 122 human bladder cancer cells and treated with local RT (8 Gy) followed by intratumora l injection of AAV-iLucor AAV-ilL12 (5xlO10vg / mouse) (n= 6 / group). G) Tumor levels of IL- 12 in animals inoculated with MC38 (left) or B16 (right) tumor cells 3 or 7 days afterthe indicated treatment (mean ± SEM, n= 4-8 mice / group). H) Levels of IL- 12 in sera obtained at indicated time points after treatmentwith local RT (8Gy) followed by intratumoral injection of AAV-iLuc or AAV-IL12 (5xl010vg / mouse). *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test and log-rank test for Kaplan-Meier survival curves). *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test and log-rank test for Kaplan-Meier survival curves).

[0085] Figure 5: The therapeutic effect of RT and AAV-HL12 is IFNy-dependentand does not require CD8+T cell-mediated cytotoxicity.

[0086] A) Representative images and quantification of multiplex immunofluorescence from B16 tumors obtained 6 days after indicated treatments (n= 4-6 / group). Two tumors from untreated animals were obtained as reference (no statistical analysis was performed). B) Quantification of indicated tumor cytokine levels 6 days after treatment with RT (8Gy) followed by i.t. injection of AAV-iLuc or AAV-HL12 (5xlO10vg / mouse) in B16 tumor bearingmice (n= 5-6 / group). C) Tumor volume 21 days after B16 cell inoculation in mice depleted of specific immune cell subsets and treated as indicated. Depleting monoclonal antibodies against CD8 , NK1.1 (alone or in combination), CFSR1 or Ly6G were i.p. injected (n= 4- 6 / group). D) Tumor volume overtime in B16tumor-bearing C57BL / 6 wild type (left) and Batf3- deficient (right) mice. E) Tumor volume over time in B16 tumor-bearing C57BL / 6 wild type (left) and Pr / l-deficient (right) mice. F) B16 tumor growth in animals treated as indicated. G) Tumor growth of control, Jakl- or / / ngrl-deficient B16 cells, inoculated s.c. in C57BL / 6 mice and treated as indicated. H) Tumor growth of control or B2m-deficient B16 cells, inoculated s.c. in C57BL / 6 mice and treated as indicated. Data are mean ± S.E.M. from n=5-6 mice. Data were analyzed by ANOVA followed by Sidak's post hoc test (A) and unpaired, two-sided Student's t-test (B-l). *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001.

[0087] Figure 6: Local treatment promotes an intense rewiring of the tumor microenvironment.

[0088] A) Uniform manifold approximation and projection (UMAP) plots of immune -infiltrating populations isolated from B16 tumors (left panel) and density projections showing shifts in cell populations in RT + AAV-iLuc(middle) and RT + AAV-HL12 (right) treatment conditions. B) Quantification of cell population proportions from Figure 5A. C) GSEA of differentially expressed genes (DEG) in bulk myeloid cells within tumors from mice treated with RT + AAV- iLuc or RT + AAV-HL12. Top pathways in the Hallmark database were ranked based on -log FDR q-values. D) UMAP and density projections of T and NK cell populations from TILs isolated from indicated tumors (top panels) and overlaid heat maps showing relative expression of proliferation and effector genes (bottom panels). E) Quantification of T and NK cell population proportions from Figure 5D. F) Violin plot indicating effector signatures, cytolytic score, and IFN response signatures in bulk T and NK populations. Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t- test).

[0089] Figure 7: Local treatment induces systemic antitumor immunity capable of controlling distant tumors.

[0090] A-B) MC38 (left) or B16 (right) tumor cells were s.c. inoculated into the right (5xl05cells) and left (2xl05cells) flanks of C57BL6 / J mice. When right flank tumors reached 100 mm3, tumors received local irradiation (8Gy) followed by i.t injection of AAV-iLuc or AAV-ilL12 as indicated. Left tumors remained untreated or received RT only as indicated. Graphs show tumor growth over time (n=5-7 mice per group). C) Representative images of left and right B16 tumor sections 6 days after treatment as in A) showing immunoreactivity forthe indicated markers. D) Graphs show quantitative analysis of CD8+T cell density and ICAMl-expressingendothelial cells (n=3 sections per mouse, 4-6 mice per group). E) Percentage of GzB-expressing CD8+T cells measured by flow cytometry six days after treatment from left tumors of indicated treatments (n=4 mice per group). F) 5xl05B16 cells were injected s.c. in the right flank (primary tumor) of C57BL / 6 mice. Three days later, 2xl05B16-Luc cells were intravenously injected. Eight days after primary tumor inoculation, mice were treated as indicated. Graphs show tumor volume overtime of primary tumors (left), lung untreated tumors measured by bioluminescence (middle) and survival (right). Pictures show representative bioluminiscence images taken 10 days after tumor inoculation. Groups were compared with unpaired, two- sided Stude nt's t-test and log-rank test for Ka plan- Meier survival curves. *p<0.05, **p < 0.01, ***p<0.001, ****p< 0.0001.

[0091] Figure 8: Radiotherapy enhances AAV-mediated tumor transduction in vitro.

[0092] A) Transduction efficiency of AAV-cGFP in mouse B16 tumor cells, determined by flow cytometry at indicated time points after transduction. Cells were irradiated (8Gy) or not and AAV vectors (MOI 5xl04) were added immediately after. B) GFP mean fluorescence intensity (MFI) levels in GFP+B16 cells 3 days aftertransduction with AAV-cGFP. C) GFP MFI in GFP+B16 cells 3 days after transduction with AAV-cGFP. AAV vectors were added at indicated times after irradiation. D) Percentage of GFP+B16 tumor cells after RT and AAV5-cGFP (left) orAAV9- cGFP (right) transduction measured by flow cytometry. E) Relative changes induced by RT in luciferase activity measured in tumor cells receiving AAV-Luc or mRNA-Luc lipid nanoparticle (LNP).F) Transduction efficiency of AAV-cGFP in murine MC38 control or MC38 AA 7?-deficient cells in vitro. G) GFP MFI of GFP+MC38 tumor cells three days after transduction with ssAAV- cGFP or dsAAV-cGFP (MOI lxlO4). Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test).

[0093] Figure 9: Radiotherapy enhances AAV-mediated tumor transduction in vitro.

[0094] A) Top 20 hallmark pathways from differentially phosphorylated proteins in B16 48h upon irradiation (8Gy). B) STRING network analysis with proteins included in Chromatin modifying enzymes and Epigenetic regulation of gene expression hallmark categories. C) Percentage of DNA methylation in AAV ITR amplicon obtained 24h after AAV transduction in control or irradiated (8Gy) B16 cells.

[0095] Figure 10: Radiotherapy enhances AAV-mediated tumor transduction in vivo

[0096] A) Technetium-99m labeled vector biodistribution analyzed by SPECT / CT 3h after AAV inoculation. Mice received intravenous injection of99mTc-AAV8 (left). The central and right photographs represent the intratumoral route, where mice received OGy (center) or 8Gy (right) followed by99mTc-AAV8 intratumoral injection of99mTc-AAV8. (n=4 / group). L: liver; Sp: spleen; B: urinary bladder; T: tumor. B) Percentage of injected activity 24h after intratumora l injection of99mTc-AAV8 measured in B16 tumors ex vivo. C) Biodistribution of AAV genomes 48h after intratumoral injection. D) Representative images from GFP-stained sections of murine MC38 s.c. tumorstreated with lxlO9AAV-cGFPvg after local irradiation (0, 8 or 20 Gy) E) Representative imagesfrom GFP-stained sections of human RT112 s.c. tumors implanted in NSG immunodeficient treated with 5xl09AAV-cGFP vg after local irradiation (0, 8 or 20 Gy). Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test).

[0097] Figure 11: Inducible AAV vector enables selective transgene expression in irradiated tumors.

[0098] A) Representative images of GFP-stained sections from tumors treated with 5xl010AAV-iGFP vg after local irradiation (0 / 8Gy). Graph shows percentage of GFP-positive area in 6 sections from 3 animals. B) Serum I L12 levels in mice one week after i.v. injection of 5xl010vg of AAVJIL12 with or without target sequence for miR122 (miR122-BS or no miR122-BS, respectively). C) Percentage of body weight change. Tumorgrowth (D) and percentage of body weight (E) in B16 tumor-bearing mice treated with local RT followed by i.t. injection of AAV - iLuc, AAV-clL12 (constitutive promoter) or AAV-HL12 ( I FN -ind ucible promoter). F) Tumor (left) and serum (middle) levels of IL-12 at day 7 after treatment with indicated AAV. Right panel shows the tumor / serum ratios. Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test).

[0099] Figure 12: Local radiotherapy enhances the antitumor activity of AAV-HL12 without systemic toxicity.

[0100] A) IL- 12 levels asdetermined by ELISA in tumor homogenates 3d afterthe indicated treatment (n=4-ll / group). Data are given as mean ± SEM. Overall survival of MC38 (B) or B16 (C) tumorbearing animals from Figures 4A-B (n= 6 mice pergroup). Subcutaneous MB49 (D) or KPC (E) tumor-bearing mice received RT (OGy or 8Gy) followed by i.t. injection of AAV-iLuc or AAV- il L12 (5xlO10vg / mouse) (n= 6-9 mice pergroup). Data are represented astumorvolume mean ± SEM of different experimentalgroups. F) Tumor growth in B16 tumor-bearing mice treated with RT followed by i.t. injection of AAV-iLuc or AAV-HL12 (5xlO10vg / mouse). Treatments were delayed until tumors reached 400mm3. G) Tumor growth in MC38 tumor-bearing Rag2 / ll2- / - mice treated with RT followed by i.t. injection of AAV-iLuc or AAV-HL12 (5xlO10vg / mouse) (n= 6 mice per group). H) Cured mice from experiment shown in Figure HE were then rechallenged with KPC cells ~40 days after complete tumor rejection. I) Tumor volume over time of B16 tumors inoculated in mice treated with local RT followed by i.t. AAV-iLuc or AAV-HL12 (5xlO10vg / mouse) (left panel) alone or in combination with i.p. administration of antibodies against PD1 (center) or CTLA-4 (right panel) (n= 6 / group). Groups were compared with log-rank test (A) and unpaired, two-sided Student's t-test (B-C). *p<0.05, **p < 0.01, ***p<0.001, ****p< 0.0001.

[0101] Figure 13: Local radiotherapy enhances the antitumor activity of AAV-HL12 without systemic toxicity.

[0102] A-C) Blood cell counts and serum levels of indicated biomarkers in B16 tumor-bearing mice. WBC (white blood cells), Neu (neutrophils), Lym (Lymphocytes), Mono (monocytes), RBC (red blood cells), PLT (platelets), HGB (hemoglobin), ALT (alanine transaminase), AST (aspartate transferase). D) Hematoxylin-eosin staining in peripheral organs (lung, intestine, kidney, liver, and spleen) from MC38 tumor-bearing mice receiving RT (OGy or 8Gy) followed by i.t. injection of AAV-iLuc or AAV-HL12 collected 15 days after treatment.

[0103] Figure 14: The therapeutic effect of RT and AAV-HL12 is IFNy-dependent and Fas-mediated.

[0104] A) Quantification of CD31+endothelial cells in multiplex immunofluorescence images from B16 tumors obtained six days after indicated treatments (Figure 5A). B) Levels of IL- 12 in tumors collected 3 daysafter receiving the indicated treatments. C) GSEA comparison of RNA- seq profiles from ex vivo purified B16 tumor cells from subcutaneous tumors three days after treatment with either AAV-iLuc or AAV-ilL12 following RT. Genes were ranked based on relative expression from the more upregulated genes by AAV-ilL12 (left) to more upregulated genes by AAV-iLuc (right). D) Enrichment score for indicated pathways. The vertical lines indicate the position of each of the genes of the studied gene set in the ordered, non - redundant data set. E) Tumor growth of control or B2m-deficient B16 cells, inoculated s.c. in C57BL / 6 mice and treated as indicated. F) Representative IHQ images showing Fas expression from tumors treated as indicated. G) Percentage of FasL-expressingCD8+ T cells (top) and NK cells (bottom) obtained from tumors treated as indicated. Data are mean ± S.E.M. from n=5- 6 mice. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t- test).

[0105] Figure 15: Combination of RT and AAV-HL12 promotes a rewiring of the TME.

[0106] A) Flow cytometry analysis of the TME performed six days after indicated treatment. B) Dot plot showing the expression of chemokines and cytokines differentially expressed in the bulk myeloid population. C) Percentage of migratory DC on tumor-draining lymph nodes by flow cytometry. D) Dot plot demonstrating the expression of lineage specific genes expressed in the different lymphocyte populations. E) Quantification of intracellular staining of IFNy (left) and TNFot (center) production by tumor infiltrating CD8+T cells upon ex vivo restimulation. On the right panel, the percentage of TRP2-tetramer+ of B16-inf iltrating CD8 T cells is shown. Data are presented as mean ± SEM. *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001 (unpaired, two-sided Student's t-test).

[0107] Figure 16: Local treatment induces systemic antitumor immunity capable of controlling distant tumors.

[0108] A) Overall survival of mice bearing MC38 (left) or B16 (right) tumors on both flanks. Mice were treated as indicated. B) Levels of IL- 12 in tumors collected three days aftertreatment with RT followed by indicated AAV (right tumors) or just RT (lefttumors). C) Quantification of Foxp3+cells in multiplex immunofluorescence images from B16 tumors from both flanks obtained six days after indicated treatments (Figure 7C). D) Representative hematoxylin-eosin staining from lung metastasis (Figure 7E). Groups were compared with log-rank test (A) and unpaired, two-sided Student's t-test (B-C). *p<0.05, **p < 0.01, ***p<0.001, ****p < 0.0001. DETAILED DESCRIPTION OF THE INVENTION

[0109] Recombinant expression system

[0110] The recombinant expression system of the invention comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter.

[0111] The recombinant expression system of the invention may additionally comprise a post- transcriptional regulatory element.

[0112] In a further embodiment, the recombinant expression system further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the protein.

[0113] The term "recombinant expression system" as used in the present application includes any nucleotides, analogues thereof, and polymers thereof. Hence, any of the recombinant expression system disclosed herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DN A). These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA.

[0114] "Recombinant" is intended to refer to nucleic acids or polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and / or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and / or direct expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof; and / or polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and / or otherwise generating a nucleic acid that encodes and / or directs expression of the polypeptide or one or more component(s), portion(s), element(s), or domains(s) thereof. In some embodiments, one or more of such selected sequence elements is found in nature. In some embodiments, one or more of such selected sequence elements is designed in silico. In some embodiments, one or more such selected sequence elements results from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.). By "expression system" or "expression construct" is meant one or more nucleic acid molecules that is / are capable of directing transcription. An expression system includes, at a minimum, one or more transcriptional control elements (such as promoters, enhancers or a structure functionally equivalent thereof) thatdirect gene expression in one or more desired cell types, tissues or organs. Additional elements, such as a transcription termination signal, may also be included. The term “expression system” and the term “recombinant expression system" therefore encompass DNA or RNA nucleic acid molecules that is / are capable of directing transcription. In the context if the present invention, the respective DNA or RNA nucleic acid molecules are also designated as “nucleic acid construct".

[0115] The term “nucleic acid" includes any nucleotides, analogues thereof, and polymers thereof. The terms “polynucleotide", “nucleic acid construct", or “nucleotide sequence" as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double-and single-stranded RNA. These terms include, as equivalents, analogues of either RNA or DNA made from nucleotide analogues and modified polynucleotides such as, though not limited to, methylated, p rotected and / or capped nucleotides or polynucleotides. The terms encompass poly- or oligoribonucleotides (RNA) and poly- or oligo deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus-atom bridges. The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified phosphorus atom bridges. Examples include, and are not limited to, nucleic acids containing ribose moieties, the nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. The skilled person is awa re that he might substitute a variable number of nucleosides in a nucleic acid by modified nucleosides which may include derivatives of purine and pyrimidine bases such as pseudo uridine, N 1-methyl pseudo uridine, 5-methyl uridine, 5-methyl Cytosine. 6-methyl Adenosine, 2- thiouridine in order to enhance translation efficiency.

[0116] In some embodiments, the prefix poly- refers to a nucleic acid containing 2 to about 10,000, 2 to about 50,000, or 2 to about 100,000 nucleotide monomer units. In some embodiments, the “oligonucleotide" refers to a nucleic acid containing 2 to about 200 nucleotide monomer units. The term "linked", when used with respectto two or more moieties, meansthat the moieties are physically associated or connected with one another to form a molecular structure that is sufficiently stable so that the moieties remain associated under the conditions in which the linkage is formed and, preferably, underthe conditions in which the new molecular structure is used, e.g., physiological conditions. In certain preferred embodiments of the invention the linkage is a covalent linkage. In other embodimentsthe linkage is noncovalent. Moieties may be linked either directly or indirectly. When two moieties are directly linked, they are either covalently bonded to one another or are in sufficiently close proximity such that intermolecular forces between the two moieties maintain their association. When two moieties are indirectly linked, theyare each linked eithercovalently or noncovalently to a third moiety, which maintains the association between the two moieties. In general, when two moieties are referred to as being linked by a “linked' or "linking moiety" or "linking portion", the linkage between the two linked moieties is indirect, and typically each of the linked moieties is covalently bonded to the linker. The linker can be any suitable moiety that reacts with the two moieties to be linked within a reasonable period of time, under conditions consistent with stability of the moieties (which may be protected as appropriate, depending upon the conditions), and in sufficient amount, to produce a reasonable yield.

[0117] The terms "operably linked" or "operatively linked" refer to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control element such as a promoter "operably linked" to a functional element is associated in such a way that expression and / or activity of the functional element is achieved under conditions compatible with the control element.

[0118] In some embodiments, "operably linked" control elements are contiguous (e.g., covalently linked) with the coding elements of interest, in some embodiments, control elements act in trans to the functional element of interest.

[0119] The individual components of the recombinant expression system of the present invention are further explained in the following sections.

[0120] Immunomodulatory gene or protein

[0121] In a preferred embodiment, the expression construct comprises a sequence encoding at least one immunomodulatory gene or protein.

[0122] Therefore, in one embodiment, the expression construct comprises a sequence encoding one or two immunomodulatory genesor proteins. Combinations of immunomodulatory proteins are discussed below. Any immunomodulatory protein or a fragment or a variant thereof that stimulates the immune system into targeting cancer cells is a suitable immunomodulatory protein according to the invention.

[0123] As used herein, the term "immunomodulatory" refers to the property of initiating or modifying (e.g., increasing or decreasing) an activity of a cell involved in an immune response. An immunomodulatory composition or method may increase an activity of a cell involved in an immune response, e.g., by increasing pro- oranti-inflammatory markers, and / ormay decrease an activity of a cell involved in an immune response, e.g., by decreasing pro- or antiinflammatory markers.

[0124] The terms "protein,” "peptide," and "polypeptide," are used interchangeably herein, and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may referto an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof.

[0125] As used herein, the term "gene" means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression. Also, shRNA are included by this definition.

[0126] The term "natural variant" refers to variants of genes or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Said natural variants occur in nature and are not artificially generated. In contrast, when the term "variant" is used without the word "natural" being associated to it, the variants may comprise artificially generated variants such as mutations. As used herein "wild-type" refers to the naturally occurring sequence of a nucleic acid at a genetic locus in the genome of an organism, and sequences transcribed or translated from such a nucleic acid. Thus, the term "wild-type" also may refer to the amino acid sequence encoded by the nucleic acid. As a genetic locus may have more than one sequence or alleles in a population of individuals, the term "wild-type" encompasses all such naturally occurring alleles. As used herein the term "polymorphic" means that variation exists (i.e., two or more alleles exist) at a genetic locus in the individuals of a population. As used herein, "mutant" refers to a change in the sequence of a nucleic acid or its encoded protein, polypeptide, or peptide that is the result of recombinant DNA technology.

[0127] In one embodiment, the at least one immunomodulatory gene or protein encoded by the sequence of the nucleic acid construct is selected from the group consisting of the family of interleukins, the family of chemokines, the family of colony-stimulating factors, the family of transforming growth factors, the family of tumor necrosis factors, any blocking peptide against immunosuppressive factors, any monoclonal antibody or any scFv or any nanobody reactive with immune checkpoint proteins, or a shRNA targeting immunosuppressive factors.

[0128] In one embodiment, the at leastone immunomodulatory proteins is interleukin-1, interleukin- 2, interleukin-3, interleukin-4, interleukin-5, interleukin-7, interleukin-8, interleukin-9, interleukin-11, single-chain interleukin-12, interleukin-12, interleukin-13, interleukin-14, interleukin-15, interleukin-15-sushi, interleukin-16, interleukin-17, interleukin-18, interleukin- 19, interleukin-20, interleukin-21, interleukin-22, interleukin-23, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, CX3CL1, granulocyte -macrophage colonystimulating factor, type I interferons, IFN-y, TNF-a, FLT3-ligand, a blocking peptide targeting TGF-B, a blocking peptide targeting IL- 10, a blocking peptide targeting FoxP3, a monoclonal antibody or single-chain variable fragment (scFv) or nanobody neutralizing PD1, PDL1, CTLA4, CD137, TIM3, LAG3, and a fragment or variant thereof. A non-limiting list of immunomodulatory genes consists of shRNA targeting TGF-B, a shRNA targeting IL-10, or a shRNA targeting FoxP3.

[0129] In a preferred embodiment of the invention, the at least one immunomodulatory gene or protein encoded by the recombinant expression construct is selected from the group consisting of interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-7 (IL-7), interleukin-12 (IL- 12), single chain interleukin-12 (sclL-12), interleukin-15 (IL- 15), interleukin-15-sushi (IL-15-sushi), e.g., as described in SEQ ID NO.: 6 or 66, interleukin- 21 (IL-21), interleukin-23 (IL-23), granulocyte-macrophage colony-stimulating factor (GM- CSF), type I interferons (I FN -a and IFN-B), IFN-y, TNF-a, CXCL10, FLT3-ligand, a blocking peptide targeting TGF-B, a blocking peptide targeting IL-10, a blocking peptide targeting FoxP3, a monoclonal antibody or scFv or nanobody neutralizing PD1, PDL1, CTLA4, CD137, TIM3, LAG3, and a fragment orvariant thereof.

[0130] IL- 12

[0131] In a preferred embodiment according to the invention the sequence encoding the immunomodulatory protein encodes IL- 12. The cytokine IL- 12 is composed by two subunits (IL-12A or p35 and IL-12B or p40). The single chain (sc) is the recombinant version of the complete protein (sclL-12 or IL-12p70).

[0132] IL- 12 re-programs myeloid-derived suppressor cells (MDSCs) to become efficient antigen- presenting cells (APC). In addition, IL-12 strongly stimulates T- cells and NK cells and increases IFN-y production propitiating a Thl type of response capable of controlling the growth of the treated tumor but also of distant metastasis (Lasek, 2014). Furthermore, IL-12 has anti- angiogenic effects, which may impair tumor vascularization and thereby limit tumor growth. IL- 12 is a heterodimeric cytokine which is encoded by two separate genes. To facilitate its expression in recombinant expression systems it is feasible to use the re combinant single chain IL- 12 transgene that encodes both subunits of IL-12.

[0133] It may optionally be possible that the at least one immunomodulatory protein is selected from the group consisting of the a-subunit of IL- 12, the B-subunit of IL- 12, single chain IL- 12 comprising the a- and B-subunit of IL-12. In the context of the present invention, a single chain IL- 12 (sclL-12) is defined as a fusion protein comprising the a- and B-subunit, wherein the peptide sequences either are directly connected or interspaced by a linker peptide, wherein the linker peptide may have a length ranging from 1 to 100 amino acids. Preferably the linker has a length ranging from 4 to 60 amino acids, more preferably from 8 to 40 amino acids and particularly preferably from 12 to 25 amino acids. The linker may have a length of 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acids.

[0134] The sequence encoding at least one immunomodulatory gene or protein may comprise or consist of the nucleic acid sequences of SEQ ID NO: 1 or 3 (encoding human or murine single chain IL- 12), or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 1 or 3, wherein the polypeptide encoded by the nucleic acid sequence has the biological activity of interleukin-12. The sequence identity of the nucleic acid sequence with respect to SEQ ID NO: 1 or 3 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0135] The at least one immunomodulatory protein may be a single chain IL-12 comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or4 (human or murine single chain IL- 12), or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 2 or 4, wherein the polypeptide has the biological activity of interleukin-12. The sequence identity of the polypeptide sequence with re spect to SEQ ID NO: 9 or 10 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of interleukin-12, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of an interleukin-12 assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 2 or4.

[0136] The biological activity of IL-12 can be estimated in vitro by the ability of the peptide to increase IFN-y production by cells expressing both the IL-12 receptor and the corresponding signaling pathway, such as peripheral blood mononuclear cells or human macrophage cell lines. Alternatively reporter cell lines can be used as, for instance, the Promega bioluminescent IL- 12 Bioassay (Cat.# JA2601, JA2605).

[0137] In vivo IL- 12 bioactivity can be estimated by the ability to increase IFN-y serum levels.

[0138] Alternative immunomodulatory proteins

[0139] Alternatively, in a further embodiment of the invention, the sequence encoding at least one immunomodulatory gene or protein may encode other immunomodulatory genes or proteins, as outlined below.

[0140] In one embodiment, the at least one immunomodulatory protein may be an IFN-B comprising or consisting of the amino acid sequence of SEQ ID NO: 5. or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 5, wherein the polypeptide has the biological activity of IFN -B. The sequence identity of the polypeptide sequence with respect to SEQ ID NO: 5 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of IFN-B, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of an IFN-B assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 5.

[0141] The biological activity of IFN-Bcan be estimated by the ability to induce IFN type I responsive genes. To this aim, a human cell line (like HEK 293) may be incubated with the polypeptide and the expression of IFN-responsive genes may be determined by RT-qPCR. Alternatively, IFN-reporter cells encoding luciferase under the control of an ISRE-containing promoter can be used to estimate I FN-B bioactivity of the polypeptide by measuring lucife rase expression in the luminometer 3h after addition of the polypeptide to the cell culture.

[0142] In vivo IFN-B bioactivity can be estimated by the induction of IFN-responsive genes (RT- qPCR) in peripheral blood mononuclear cells.

[0143] In a furtherembodiment, the at least one immunomodulatory protein may be an IL-15-sushi, preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 6 or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 6, wherein the polypeptide has the biological activity of IL-15. The sequence identity of the polypeptide sequence with respect to SEQ ID NO: 6 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of interleukin-15, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of an interle ukin-15 assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 6.

[0144] In another embodiment, the at least one immunomodulatory protein may be an IL-15-sushi, preferably encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 66 or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 66, wherein the polypeptide has the biological activity of IL-15. The sequence identity with respect to SEQ ID NO: 66 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of interleukin-15, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of an interleukin-15 assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 66. The biological activity of IL- 15 can be estimated in vitro by a CTLL-2 cell proliferation assay.

[0145] In vivo IL- 15 bioactivity can be estimated by its ability to induce the proliferation of NK cells and T cells using FACS analysis.

[0146] Furthermore, the at least one immunomodulatory protein may be a CXCL10, preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 7, where in the polypeptide has the biological activity of CXCL10. The sequence identity of the polypeptide sequence with respect to SEQ ID NO: 7 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of CXCLIO, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of a CXCL10 assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 7. CXCL10 is also known as IP-10.

[0147] The bioactivity of CXCL10 may be estimated by its ability to attract T lymphocytes and natural killer cells either in vivo or in an in vitro migration assay.

[0148] The at least one immunomodulatory protein may be FLT3L (FMS-like tyrosine kinase 3 ligand). Hence, the at least one immunomodulatory protein may be a FLT3L, preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76, wherein the polypeptide has the biological activity of FLT3L. The sequence identity of the polypeptide sequence with respect to SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76, can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of FLT3L, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of a FLT3L, for instance assessed with one of the b ioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76. Combination of immunomodulatory proteins

[0149] In a further embodiment, the nucleic acid construct comprises two or more sequences each encoding a different immunomodulatory gene or protein.

[0150] Therefore, in a further embodiment, nucleic acid construct comprises a first and a second sequence encodinga firstand a second first immunomodulatory gene or protein, respectively.

[0151] In one embodiment, the sequence encoding the first immunomodulatory gene or protein may comprise or consist of the nucleic acid sequences of SEQ ID NO: 1 or 3 (encoding human or murine single chain IL- 12), or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 1 or 3, wherein the polypeptide encoded by the nucleic acid sequence hasthe biological activity of interleukin -12. The sequence identity of the nucleic acid sequence with respect to SEQ ID NO: 1 or 3 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0152] The first immunomodulatory protein may be a single chain IL-12 comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 4 (human or murine single chain IL-12), or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence ide ntity with respect to SEQ ID NO: 2 or 4, wherein the polypeptide has the biological activity of interleukin - 12. The sequence identity of the polypeptide sequence with respect to SEQ ID NO: 9 or 10 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In the context of the invention, for a polypeptide to be viewed as having the biological activity of interleukin-12, it has to have at least 10%, preferably at least 20%, more preferably at least 30% and even more preferably at least 50% of the biological activity of an interleukin -12 assessed with one of the bioactivity tests described in the following compared to the bioactivity of a polypeptide according to SEQ ID NO: 2 or4.

[0153] The second immunomodulatory protein may be either (i) an IFN-B, preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 5, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 5, wherein the polypeptide has the biological activity of IFN-B; or (ii) the second immunomodulatory protein may be an IL-15-sushi, comprising or consisting of the amino acid sequence of SEQ ID NO: 6, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respectto SEQ ID NO: 6, wherein the polypeptide has the biological activity of IL- 15; or (iii) the second immunomodulatory protein may be a chemokine, preferably a CXCL10, comprising or consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 7, wherein the polypeptide has the biological activity of CXCL10.

[0154] In another embodiment, the second immunomodulatory protein may be either (i) an IFN -B, preferably comprising or consisting of the amino acid sequence of SEQ ID NO: 5, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 5, wherein the polypeptide has the biological activity of IFN -B; or (ii) the second immunomodulatory protein may be an IL-15-sushi, comprising or consisting of the amino acid sequence of SEQ ID NO: 6, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 6, wherein the polypeptide has the biological activity of IL-15; or (iii) the second immunomodulatory protein may be a chemokine, preferably a CXCL10, comprising or consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 7, wherein the polypeptide has the biological activity of CXCL10, or (iv), the second immunomodulatory protein may be FLT3L, preferably, comprising or consisting of the amino acid sequence of SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 76 or 77, preferably SEQ ID NO.: 76, wherein the polypeptide has the biological activity of FLT3L.

[0155] Also, other combinations of immunomodulatory proteins are feasible. The single -chain IL- 12 may be the first immunomodulatory protein whereas the second immunomodulatory protein may be selected from the group consisting of peptides that block TGF-B, peptides that block FoxP3, or monoclonal antibodies against immune checkpoint inhibitors PD1 or PD-L1, or nanobodies against immune checkpoint inhibitors PD1 or PD-L1, or FLT3L.

[0156] Hence, in one embodiment, IL-12 (e.g., single-chain IL- 12), as described herein, e.g., SEQ ID NO.: 2, is the first immunomodulatory protein whereas the second immunomodulatory protein may be selected from:

[0157] IFN-B, preferably as described herein (e.g., SEQ ID NO.: 5),

[0158] IL- 15, such as sushi IL-15, preferably as described herein (e.g., SEQ ID NO.: 6), a chemokine, preferably a CXCL10, preferably as described herein (e.g., SEQ ID NO.: 7),

[0159] - FLT3L, peptides that block TGF-B, peptides that block FoxP3, and antibodies or antibody fragments, such as nanobodies, against immune checkpoint inhibitors PD1 or PD-L1. It should be noted that the terms first and second immunomodulatory protein in the context of the second nucleic acid comprising two immunomodulatory proteins do not describe the order ofthe coding sequencesonthe second nucleic acid but merelyare used to illustrate the two different immunomodulatory proteins. Hence, the coding sequence of the second immunomodulatory protein may lie upstream of the coding sequence of the first immunomodulatory protein on the nucleic acid. Here, upstream means that the coding sequence of the second immunomodulatory protein lies in front of the coding sequence of the first immunomodulatory protein in the 5' to 3' direction on the nucleic acid.

[0160] A peptide blocking TGF-B is a peptide that interfereseitherwithTGF-B itselforwith a receptor that binds TGF-B so that at least some of the TGF-B signalling is reduced or even completely prevented. Examples of peptides blocking TGF-B are P17 and P144.

[0161] A peptide blocking FoxP3 is a peptide that interfereseitherwith FoxP3 itself or with a receptor that binds FoxP3 so that at least some of the FoxP3 signalling is reduced or even completely prevented. An example of a peptide blocking FoxP3 is P60.

[0162] In another preferred embodiment the second nucleic acid construct is a bi- or polycistronic expression cassette, wherein the sequences encoding the immunomodulatory genes or proteins are separated by a sequence encoding an IRES; and / or the sequences encoding the immunomodulatory genes or proteins are separated by a sequence encoding a 2A peptide, preferably a sequence encoding a P2A peptide. The IRES sequence and the 2A peptide encoding sequence are translation regulatory elements (TRE).

[0163] In this context, proteins or RNA having anticancer properties are any of said molecules that are capable of retarding, stopping or reversing cancer progression.

[0164] A bi- or polycistronic expression cassette is a genetic construct that contains two or more separate coding regions orgeneswithin a single transcript. Generally speaking, it contains two or more different sequences within a single transcript. To allow for separate translation of the two or more immunomodulatory proteins and / or transcription of the immunomodulatory genes, a kind of TRE is needed that allows for individual translation of the proteins.

[0165] One possible solution is to use an internal ribosomal entry site (IRES). An IRES is a specific sequence of RNA within a transcript that allows fortranslation initiation at a non -AUG codon, bypassing the normal cap-dependent initiation process. This mechanism allows for the regulation of gene expression and the co-expression of multiple proteins from a single mRNA molecule. Another possible solution are 2A peptides, also known as 2A self-cleaving peptides. 2A peptides are a class of 18-22 aa-long peptides, which can induce ribosomal skipping during translation of a protein in a cell. These peptides share a core sequence motif of DxExNPGP (SEQ ID NO: 8) and are found in a wide range of viral families. They help generating polyproteins by causing the ribosome to fail at making a peptide bond. Because of their short length 2A peptides are ideal for use in viral vector systems that have a limited capacity such as AAV. Another advantage of these peptides is that they allow for equimolar expression of the coding sequences separated by these peptides. Members of the 2A pe ptide family are T2A, P2A, E2A and F2A. These peptides may be flanked by linker peptides of differing lengths which may result in improved functionality. For example, the F2A element preceded by a linker domain consisting of the amino acid sequence GGSG (SEQID NO: 9) showed significant expression of the proteins separated by this element. In one embodiment, the 2A peptide is a P2A peptide preferably comprising or consisting of the amino acid sequence of any one of SEQ ID NOs: 57 or 59, or a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to any one of SEQ ID NO: 57 or 59. In another embodiment, the 2A peptide is a P2A peptide preferably coded by a nucleic acid comprising or consisting of the any one of SEQ ID NOs: 57 or 59, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to any one of SEQ ID NO: 57 or 59.

[0166] Table 1: Examples of combinations of two immunomodulatory proteins separated by translation regulatory elements (TRE) in a bicistronic vector

[0167] A - being preferably a human single chain IL-12 as depicted in SEQ ID NO: 2

[0168] B - being preferably a human IFN- as depicted in SEQ ID NO: 5

[0169] C - being preferably a human IL-15-sushi as depicted in SEQ ID NO: 6

[0170] D - being preferably a human CXCL10 as depicted in SEQ ID NO: 7

[0171] Promoter

[0172] In the nucleic acid construct, the therapy-associated expression of the immunomodulatory gene or protein may be ensured by placing the transgene under the control of a promoter, preferably an inducible promoter, most preferably a radiation inducible promoter.

[0173] As outlined above, in a preferred embodiment, the recombinant expression system comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter.

[0174] The term "promoter" is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene and is capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence. It may contain genetic elements at which regu latory proteins and molecules may bind, such as RNA polymerase and othertranscription factors, to initiate the specific transcription of a nucleic acid sequence. The phrase " operatively positioned", "operatively linked", "under control", and "under transcriptional control" mean that a promoter is in a correct functional location and / or orientation in relation to a nucleic acid sequence to control transcriptional initiation and / or expression of that sequence.

[0175] A "constitutive promoter" refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0176] An "inducible promoted' refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.

[0177] In particularly preferred embodiment, the inducible promoter is a radiation inducible promoter which, as used herein, is a promoter that induces the expression of the therapeutic gene sequence when the cell is irradiated. These promoters may be natural, sy nthetic or artificially made from recombination products of natural promoters.

[0178] In a further embodiment, the radiation inducible promoter is an interferon (IFN) -inducible promoter.

[0179] In a preferred embodiment of the invention, the IFN -inducible promoter responds to type I IFN and / or type II IFN, more preferably wherein the promoter responds to type I and type II IFN produced through cGAS / STING activation following radiation and type II IFN derived from adaptive immune responses.

[0180] More preferably, the radiation inducible promoter comprises at least one interferon- stimulated response element (ISRE).

[0181] Most preferably. The radiation inducible promoter is selected from the list consisting of: a. a nucleotide sequence comprising one to ten copies, preferably two to seven copies, more preferably three to five copies and particularly preferably 4 copies of a sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 17 or is or is most preferably identical to SEQ ID NO: 17; optionally wherein the copies are interspaced by up to forty nucleotides, preferably four to thirty-five nucleotides, more preferably ten to thirty nucleotides and particularly preferably fifteen to twenty-five nucleotides; b. a nucleotide sequence according to SEQ ID NO: 18; c. a nucleotide sequence according to SEQ ID NO: 19. Post-transcriptional regulatory element

[0182] In another embodiment, the recombinant expression system may further comprise a post- transcriptional regulatory element.

[0183] In a preferred embodiment, the nucleic acid construct can further comprise a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). The WPRE is known to increase transgene expression, whereby it is most effective when placed downstream of the transgene (i.e., the immunomodulatory gene or protein), proximal to the polyadenylation signal.

[0184] In a preferred embodiment, the sequence encoding the post-transcriptional regulatory element may comprise or consist of the nucleic acid sequencesof SEQ ID NO : 12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 12. The sequence identity of the nucleic acid sequence with respect to SEQ ID NO: 12 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0185] Alternatively, the sequence encoding the post-transcriptional regulatory element may comprise or consist of the nucleic acid sequences of SEQ ID NO: 26, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 26. The sequence identity of the nucleic acid sequence with respect to SEQ ID NO: 26 can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0186] Inhibition of transgenic expression of the immunomodulatory protein

[0187] In a further preferred embodiment, the recombinant expression system further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the protein, preferably being the liver, wherein the sequence motif is preferably a target sequence of a microRNA which is highly abundant in the liver.

[0188] It is known that several viral particles, especially AAV, show a tropism towards liver cells. This meansthat when viral particles gain access to the blood circulatory system, they preferentially transduce liver cells, eventually causing the expression of the encoded transgene in the liver. Also in the event of intratumor injections of said viral particles, some of these particles will access the blood circulatory system, as the tumor is highly vascularized. To prevent the unwanted expression of the transgene encoded by the viral particle in the liver it is therefore suitable to control its expression. Several methodsare known by the pe rson skilled in the art to achieve this goal.

[0189] In general, a suitable method to limit transgene expression to a specific tissue or a specific cell type is to use viral particles with a distinct tropism towards said tissues or cell types. A way to achieve this is by altering the serotype of an AAV or by altering the capsid of the AAV. Several AAV serotypes are known in the art each with distinct tropisms. However, as the invention is intended to target several different types of cancers, it would be necessary to optimize the serotype or capsid for each cancer or tumor type. Nonetheless, this may be a suitable way to achieve tissue- or cell type-specific expression of a transgene.

[0190] The skilled person may also use DNA- or RNA-binding repressors to avoid unwanted expression of the transgene encoded by the viral particle in tissues or cells not intended to express the transgene. Therefore, the nucleic acid construct of the recombinant expression system may comprise an operon that binds a repressor. The repressor may be operatively linked to a promoter that is active in hepatocytes, hence, inducing the expression of the repressor in these cells, thereby, inhibiting expression of the transgene.

[0191] Another possibility is to use RNA interference (RNAi). RNA1 is characterized in that an RNA molecule reduces or inhibits expression of a nucleic acid sequence with which the RNA molecule shares substantial or total homology. Non-limiting examples of RNAi are small interfering RNA, small hairpin RNA or microRNA (miR).

[0192] As used herein, the term "RNA interference" refers generally to a process in which a RNA molecule reduces or inhibits expression of a nucleic acid sequence with which the RNA molecule shares substantial or total homology. Without wishing to be bound by any theory, it is believed that, in nature, the RNA interference pathway is initiated by a Type III endonuclease known as Dicer, which cleaves long double-stranded RNA (dsRNA) into double -stranded fragments typically of 21-23 base pairs with 2-base 3' overhangs (although variations in length and overhangs are also contemplated), referred to as "short interfering RNAs" ("siRNAs"). Such siRNAs comprise two single-stranded RNAs (ssRNAs), with an "antisense strand" or "guide strand" that includes a region that is substantially complementary to a target sequence, and a "sense strand" or "passenger strand" that includes a region that is substantially complementary to a region of the antisense strand. Those of ordinary skill in the art will appreciate that a guide strand may be perfectly complementary to a target region of a target RNA or may have less than perfect complementarity to a target region of a target RNA. As used herein, the terms "microRNA” or "miRNA” or "miR” refer to a specific type of siRNA that are produced physiologically in the organism rather than produced synthetically. miRNA bind to respective miRNA target sequences and reduce or inhibit expression of a nucleic acid sequence with which the miRNA shares a substantial or total homology. As used herein, the term "shRNA" or "short hairpin RNAs" refers to individual transcripts that adopt stem-loop structures which are processed into siRNA by RNAi machinery. Typical shRNA molecules comprise two inverted re peats containing the sense and antisense target sequence separated by a loop sequence. The base-paired segment may be any suitable length that allows inactivation of a target gene in vivo, wherein one strand of the base -paired stem is complementary to the mRNA of said target gene. The loop of the shRNA stem-loop structure may be any suitable length that allows inactivation of the target gene in vivo. The base paired stem may be perfectly base paired or may have 1 or 2 mismatched base pairs.

[0193] A "target gene", as used herein, refers to a gene whose expression is to be modulated, e.g., upregulated or inhibited. As used herein, the term "target RNA" refers to an RNA to be degraded or translationally repressed or otherwise inhibited using one or more agents, e.g ., one or more miRNAs or siRNAs. A target RNA may also be referred to as a target sequence or target transcript. The RNA may be a primary RNA transcript transcribed from the target gene (e.g., a pre-mRNA) or a processed transcript, e.g., mRNA encoding a polypeptide. As used herein, the term "target portion" or "target region" refers to a contiguous portion of the nucleotide sequence of a target RNA. In some embodiments, a target portion of an mRNA is at least long enough to serve as a substrate for RNA interference (RNAi) -mediated cleavage within that portion in the presence of a suitable miRNA or siRNA. A target portion may be from about 8-36 nucleotides in length, e.g., about 10-20 or about 15-30 nucleotides in length. A target portion length may have specific value or subrange within the afore -mentioned ranges. For example, in certain embodiments a target portion may be between about 15-29, 15-28, 15-27, 15- 26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18- 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19- 28, 19-27, 19-26, 19-25, 19- 24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20- 26, 20-25, 20-24, 20- 23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length.

[0194] To reduce or inhibit transgene expression in a specific tissue using RNAi it may be conceivable that for example a shRNA targeting the nucleotide sequence of said transgene may be operatively linked to a tissue specific promoter. When said shRNA is administered it thereby reduces or inhibits transgene expression in the tissue. Although this method would be feasible in the context of the invention it may be disadvantageous in that an additional administration of said shRNA would be necessary to limit transgene expression in the target tissue, e.g. the liver. An elegant way to avoid this drawback is to operatively link a miRNA target sequence to the nucleotide sequence of the transgene. Thereby, expression of the transgene will be reduced or inhibited in tissues where a miRNA that is associated to said miRNA ta rget sequence is present. Accordingly, a preferred embodimentof the invention comprises that the sequence motif is a target sequence of a microRNA which is highly abundant in the liver. Thereby, a single administration of a nucleic acid construct is sufficient to avoid transgene expression in the liver while transcription in othertissues or organs is not impaired.

[0195] In a further embodiment, the nucleic acid construct further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the proteins.

[0196] In a further embodiment, the tissue is liver tissue .

[0197] In a furtherembodiment, the sequence motif is a target sequence of a microRNA that is highly abundant in the liver.

[0198] In one embodiment, the microRNA abundant in the liver is selected from the group consisting of miR-122, miR-192, miR-199a, miR-101, miR-99a, Iet7a, Iet7b, Iet7c or Iet7f. Furthermore, it may be advantageous that the microRNA abundant in the liver is miR-122.

[0199] The advantage of miR-122 is that it is highly expressed in the liverand, importantly, specifically expressed in the liver. Hence, by choosing a miR-122 target sequence a significant reduction of the transgene in the liver is ensured while expression in other tissues is not impaired. Moreover, it has been shown that miR-122 is downregulated in most liver tumors so that the recombinant expression system according to the invention is also suitable to treat liver cancer.

[0200] According to a preferred embodiment of the invention, the respective miR-122 target sequence is a miR-122 target sequence having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 10 or is identical to SEQ ID NO: 10. Preferably, the target sequence comprises 1 to 12, preferably 3 to 10, more preferably 4 to 8 and particularly preferably 5 copies of the miR-122 target sequence as depicted in the previous sentence. Increasing the copy number of miR-122 target sequences increased the miR-mediated reduction, whereas no significant improvement was observed above the disclosed number of 5 copies.

[0201] In a preferred embodimentthe copies are interspaced by one to forty nucleotides, preferably one to thirty nucleotides, more preferably two to twenty nucleotides and particularly preferably two to eight nucleotides. It is preferred that the nucleotide sequence comprises 5 copies of the miR-122 target sequence asdepicted in SEQ ID NO: 11. In an embodiment ofthe invention, the miR-122 target sequence has at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 11 or is identical to SEQ ID NO: 11

[0202] Expression vectors

[0203] In another embodime nt of the invention the recombinant expression system is an expression vector encodingthe nucleic acid construct of the recombinant expression system according to the invention.

[0204] Using an expression vector comprising the nucleic acid construct has certain advantages.

[0205] Firstly, expression vectors are specifically designed to allow the introduction of the encoded nucleotide sequences into a host cell and commandeer their expression. Secondly, expression vectors are plasmids that are very stable and thereby protected from degradation. Thirdly, expression vectors are conceivable for gene delivery using different methods.

[0206] A non-limiting example of an expression vector and a preferred embodimentof the invention is a viral vector, more preferably a viral vector selected from the list consisting of adeno- associated virus (AAV) vector, adenoviral vector, lentiviral vector, vaccine virus vector, or herpes simplex virus vector.

[0207] Viral vectors in particular combine several advantages of expression vectors such as general safety, low toxicity and stability.

[0208] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA or RNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterialvectors havinga bacterial origin of replication and episomal mammalian vectors). Othervectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors." One of ordinary skill in the art understands that a “viral vector", as described herein, includes viral components in addition to a transgene described herein, e.g., capsid proteins.

[0209] A "plasmid" is a common type of a vector, is an extra-chromosomal DNA molecule separate from the chromosomal DNA that is capable of replicating independently of the chromosomal DNA. In certain cases, it is circular and double stranded.

[0210] The term “AAV" refers to adeno-associated virus and may be used to refer to the naturally occurring wild-type virus itself or derivativesthereof. The term covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms, except where required otherwise. The AAV genome is built of single stranded DNA and comprises inverted terminal repeats (ITRs) at both endsofthe DNA strand, and two open reading frames: rep and cap, encoding replication and capsid proteins, respectively. A foreign po lynucleotide can replace the native rep and cap genes. AAVs can be made with a variety of different serotype capsids which have varying transduction profiles or, as used herein, “tropism" for different tissue types. As used herein, the term “serotype" refers to an AAV which is identified by and distinguished from other AAVs based on capsid protein reactivity with defined antisera, e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh .10. For example, serotype AAV2 is used to refer to an AAV which contains capsid proteins encoded from the cap gene of AAV2 and a genome containing 5' and 3' ITR sequences from the same AAV2 serotype. Pseudotyped AAV refers to an AAV that contains capsid proteins from one serotype and a viral genome including 5' - 3' ITRs of a second serotype. Pseudotyped rAAV would be expected to have cell surface binding properties of the capsid serotype and genetic properties consistent with the ITR serotype. Pseudotyped rAAV are produced using standard techniques described in the art.

[0211] The term "adenovirus" refersto any virus in the genus Adenoviridiae including, but not limited to, human, bovine, ovine, equine, canine, porcine, murine, and simian adenovirus subgenera. Typically, an adenoviral vector is generated by introducing one or more mutations (e.g., a deletion, insertion, or substitution) into the adenoviral genome of the adenovirus so as to accommodate the insertion of a non-native nucleic acid sequence, for example, for gene transfer, into the adenovirus.

[0212] As used herein, the term “lentivirus” refers to a group (or genus) of complex retroviruses. Illustrative lentiviruses include but are not limited to: HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2); visna-maedi virus (VMV) virus; the caprine arthritisencephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV). In a preferred embodiment, the nucleic acid construct of the expression vector further comprises a 5'ITR and a 3'ITR sequence, being preferably AAV 2 ITR having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to as depicted in SEQ ID NOs: 13 and 14, respectively. Most preferably, the expression vector further comprises a 5'ITR and a 3'ITR sequence identical to SEQ ID NOs: 13 and 14.

[0213] In a further embodiment, the nucleic acid construct sequence comprises an alternative 5'ITR having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NOs: 27 or is identical to SEQ ID NOs: 27.

[0214] It is also advantageous that the nucleic acid construct of the expression vector(s) further comprise a 5'ITR, a QJ packaging signal and a 3'ITR sequence, being preferably the 5'ITR, the QJ packaging signal and the 3'ITR of an adenovirus (Ad). It may be advantageous that the expression vector(s) is (are) an adenoviral vector, preferably a high-capacity adenoviral vector. Adenoviruses are commonly used in biotechnology and therefore are well characterized. An advantage of adenoviral vectors is that they have a higher size limitation compared to AAV vectors. Moreover, adenoviruses are already approved by severalgovernmentalorganizations around the world for use in human.

[0215] Viral particles

[0216] Another aspect of the invention is a viral particle comprising the aforementioned viral vector which comprises the nucleic acid construct of the invention. This has the advantage that one administration of said viral particle is sufficientto expressthe recombinant expression system according to the invention in the patient.

[0217] As used herein, the term "viral particle" refers to all or part of a virion. For example, the viral particle comprises a recombinant genome and may further comprise a capsid. The viral particle may be a gene therapy vector. Herein, the terms "viral particle" and "vector" are used interchangeably. Forthe purpose of the present application, a "gene therapy" vector is a viral particle that can be used in gene therapy, i.e. a viral particle that comprises all the required functional elements to expressa transgene, such as a CFI nucleotide sequence, in a host cell afteradministration. Suitable viral particles ofthe invention include a parvovirus, a retrovirus, a lentivirus or a herpessimplex virus. The parvovirus may be an adeno-associated virus (AAV). Optionally, the viral particle is an AAV or adenoviral particle.

[0218] It may be advantageous that the expression vector(s) is (are) an AAV vector and preferably has (have) the serotype AAV1, AAV3, AAV6, AAV8, AAV9, AAV2, AAV5, AAVrh.10, or any gain - of-function mutant of AAVrh.10, whereas AAV8 is most preferred. AAVs are commonly used in biotechnology and therefore well characterized. Advantages of using AAV vectors are that they are generally regarded as safe, display low toxicity and are stable. Moreover, AAVs are already approved by several governmental organizations around the world for use in human.

[0219] The aforementioned viral particle(s) is (are) preferably (an) AAV or (an) adenoviral particle(s); more preferably (an) AAV viral particle(s). As described hereinbefore, Ad and AAV display several advantages over other viral particles such as that they are well characterized, frequently used and approved for treatment in humans. These viruses display further advantages that renderthem particularly useful in gene therapy such as that they are capable of transducing dividing as well as non-dividing cells and that they do not integrate into the host genome.

[0220] Medical uses and methods of treatment

[0221] The present invention provides the recombinant expression system, expression vector(s), the viral particle(s) or pharmaceutical composition, e.g., as described herein for use in methods of treatment (for use in medicine), preferably for treating a proliferative disease, preferably cance r.

[0222] Hence, the present invention provides methodsfortreating a proliferative disease, preferably cancer, comprising administering a therapeutically effective amountof the recombinant, e.g., expression system, expression vector(s), the viral particle(s) or pharmaceutical compositions as described herein to a subject in need thereof.

[0223] Without wishing to be bound by theory, the treatment of tumors with radiotherapy and the recombinant expression construct, e.g., as described herein inhibits metastasis and induces CD8+ T cell infiltration and regression of distant tumors, i.e., has an abscopal effect. As used herein, the term "abscopal effect" describes the size reduction of a tumor by a direct treatment of another tumor. More explicitly, the direct treatment of a tumor may cause the organism to also target another tumor that has not been contacted with a compound, an expression system, an expression vector, a viral vector, a viral particle, a pharmaceutical composition, or any therapy, e.g., as described herein. This can avoid "systemic administration", which refers to administration of a compound (e.g., a therapeutic agent, expression vector, viral particle, pharmaceutical composition, and / or formulation, e.g., as described herein) such that the compound becomes widely distributed in the body in significant amounts and has a biological effect, e.g., its desired effect, in the blood and / or reaches its desired site of action via the vascular system, but often leads to severe side effects.

[0224] In the present invention, the inventors have surprisingly found that treatment with only radiation of the at least one further tumor (primary or metastatic) differentfrom the at least one tumor treated with both the recombinant expression construct and radiation leads to a synergistic effect beyond the abscopal effect and avoiding systemic administration of the expression system. The irradiation may preferably be local irradiation, as described herein.

[0225] Radiotherapy and the expression system, in particular the AAV-based immunotherapy of the preferred embodiments, act synergistically to induce vigorous local and systemic antitumor immune responses culminating in tumor rejection. In particular, as shown herein, local radiotherapy (i.e., radiotherapy applied locally to each of the tumors, and not systemically to the whole body) and the expression system, in particular the AAV-based immunotherapy of the preferred embodiments, act synergistically to induce vigorous local and systemic antitumor immune responses culminating in tumor rejection. This treatment constitutes a novel, safe and efficienttherapeutic approach for localized and metastatic malignancies, with significant potential for further clinical development

[0226] "Treatment" or "treating" includes (1) inhibiting a disease, disorder or condition in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and / or symptomatology), (2) ameliorating a disease, disorder or condition in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and / or symptomatology), and / or (3) effecting any measurable decrease in a disease, disorder or condition in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease.

[0227] "Prophylactically treating" includes: (1) reducing or mitigating the risk of developing the disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease.

[0228] The term "effective" or "therapeutically effective amount" means at least the minimum amount of a compound (e.g., a therapeutic agent, expression vector, viral particle, pharmaceutical composition, and / or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amountof a substance is an amountthat is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell ortissue, etc. For example, the effective amount of compound in a formulation to treat a disease, disorder, and / or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and / or reduces incidence of one or more symptoms or signs of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount. A therapeutically effective amount is also one in which any toxic or detrimental effectsof the treatment are outweighed by the therapeutically beneficial effects. In the case of cancer or tumor, an effective amount of a compound may have the effect in reducing the number of cancer cells; reducing the tumor size; inhibiting (i.e., slow to some extent or desirably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and desirably stop) tumor metastasis; inhibiting to some extent tumor growth; and / or relieving to some extent one or more of the symptoms associated with the disorder.

[0229] The term "immunotherapy", as used herein, refers to a therapy, whereby the modulation or stimulation of the immune system is used to treat a disease, preferably a proliferative disease such as cancer, utilizing immunomodulatory genes or proteins. The immunotherapy may cause a stimulation of the immune system which is often used in immunotherap ies targeting cancer. However, also other diseases may be treated with immunotherapies, such as autoimmune diseases, diabetes, cardiovascular diseases and inflammation. For example, IFN - B is used to treat multiple sclerosis. In addition, IL-2 has been shown to regulate the balance of regulatory and effectorT cells thereby preserving B- cell function. Immunotherapies may be used to treat non-cancer diseases such as lupus, rheumatoid arthritis, diabetes.

[0230] Treatment of proliferative diseases

[0231] As used herein, the term "proliferative disease" refers to conditions in which unregulated or abnormal growth, or both, of cells can lead to the developmentof an unwanted condition or disease, which may or may not be cancerous. Exemplary cell proliferative disorders of the disclosure encompass a variety of conditions wherein cell division is deregulated. Exemplary cell proliferative disorders include but are not limited to, neoplasms, benign tumors, malignant tumors, pre-cancerous conditions, in situ tumors, encapsulated tumors, metastatic tumors, liquid tumors, solid tumors, immunological tumors, hematological tumors, cancers, carcinomas, leukemias, lymphomas, sarcomas, and rapidly dividing cells.

[0232] The term "tumor" refers to the presence of cells possessing characteristics typical of cancercausing cells, such as uncontrolled proliferation, immortality, invasive or metastatic potential, rapid growth, and certain characteristic morphological features. In some embodiments, such cells exhibitsuch characteristics in part or in full due to the expression and activity of immune checkpoint proteins, such as PD-1, PD-L1, PD-L2, and / or CTLA-4. Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell.

[0233] As used herein, the term "cancer" includes premalignant as well as malignant cancers. Cancers include, but are not limited to, a variety of cancers, carcinoma including that of the bladder (including accelerated and metastatic bladder cancer), breast, colon (including colorectal cancer), kidney, liver, lung (including small and non-small cell lung cancer and lung adenocarcinoma), ovary, prostate, testes, genitourinary tract, lymphatic system, rectum, larynx, pancreas (including exocrine pancreatic carcinoma), esophagus, stomach, gall bladder, cervix, thyroid, and skin (including squamous cell carcinoma); hematopoietic tumors of lymphoid lineage including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell lymphoma, histiocytic lymphoma, and Burkitt's lymphoma; hematopoietic tumors of myeloid lineage including acute and chronic myelogenous leukemias, myelodysplastic syndrome, myeloid leukemia, and promyelocytic leukemia; tumors of the central and peripheral nervous system including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin including fibrosarcoma, rhabdomyosarcoma, and osteosarcoma; othertumors including melanoma (skin and uveal), xeroderma pigmentosum, keratoacanthoma, seminoma, thyroid follicular cancer, and teratocarcinoma;, squamouscell carcinoma, small -cell lung cancer, non-small cell lung cancer, glioma, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, colorectal cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, pancreatic cancer, glioblastoma multiforme, cervical cancer, stomach cancer, bladder cancer, hepatoma, cholangiocarcinoma, breast cancer, colon carcinoma, and head and neck cancer, gastric cancer, germ cell tumor, bone cancer, bone tumors, adult malignant fibrous histiocytoma of bone; childhood, malignant fibrous histiocytoma of bone, sarcoma, pediatric sarcoma, Sino nasal natural killer, neoplasms, plasma cell neoplasm; myelodysplastic syndromes; neuroblastoma; testicular germ cell tumor, intraocular melanoma, myelodysplastic syndromes; myelodysplastic / myeloproliferative diseases, synovial sarcoma, chronic myeloid leukemia, acute lymphoblastic leukemia, Philadelphia chromosome positive acute lymphoblastic leukemia (Ph+ ALL), multiple myeloma, acute myelogenous leukemia, chronic lymphocytic leukemia, mastocytosis and any symptom associated with mastocytosis, and any metastasis thereof. In addition, disorders include urticaria pigmentosa, mastocytosises such as diffuse cutaneous mastocytosis, solitary mastocytoma in human, and some rare subtypes like bullous, erythrodermic and telangiectatic mastocytosis, mastocytosis with an associated hematological disorder, such as a myeloproliferative or myelodysplastic syndrome, or acute leukemia, myeloproliferative disorder associated with mastocytosis, mast cell leukemia, in addition to other cancers. Other cancers are also included within the scope of disorders including, but are not limited to, the following: carcinoma, including that of the bladder, urothelial carcinoma, hepatocellular carcinoma, hepatoblastoma, breast, colon, kidney, liver, lung, ovary, pancreas, stomach, cervix, thyroid, testis, particularly testicular seminomas, and skin; including squamous cell carcinoma; gastrointestinal stromal tumors ("GIST"); hematopoietic tumors of lymphoid lineage, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B- cell lymphoma, T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell lymphoma and Burkitt's lymphoma; hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias and promyelocytic leukemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyosarcoma; other tumors, including melanoma, seminoma, teratocarcinoma, neuroblastoma and glioma; tumors of the central and peripheral nervous system, including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin, including fibrosarcoma, rhabdomyosarcoma, and osteosarcoma; and othertumors, including melanoma, xeroderma pigmentosum, keratoacanthoma, seminoma, thyroid follicular cancer, teratocarcinoma, chemotherapy refractory non-seminomatous germ-cell tumors, and Kaposi's sarcoma, and any metastasis thereof.

[0234] Other non-limiting examples of types of cancers applicable to the methods encompassed by the present invention include human sarcomas and carcinomas, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, bone cancer, brain tumor, lung carcinoma (including lung adenocarcinoma), small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease. In some embodiments, cancers are epithelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, neuroendocrine tu mors, carcinoid tumors, Merkel cell carcinoma, or skin cancer. A solid tumor is an abnormal mass of tissue that usually does not contain cysts or liquid areas. As such, a solid tumor is a specific tumorwithin the meaning defined above. Solid tumors may be benign, or malignant. Different types of solid tumors are named for the type of cells that form them.

[0235] Examples of solid tumors are carcinomas, sarcomas, germinomas and blastomas.

[0236] Carcinomas are cancers derived from epithelial cells and account for 80% to 90% of all cancer cases since epithelial tissues are most abundantly found in the body.

[0237] This group includes many of the most common cancers, particularly in the aged, and include lung cancer, colorectal cancer, pancreatic cancer, larynx cancer, tongue cancer, prostate cancer, breast cancer, ovarian cancer, liver cancer, head and neck cancer, esophageal cancer, renal cancer, endometrial cancer, gall bladder cancer, bladder cancer and gastric cancer.

[0238] Carcinomas are of two types: adenocarcinoma and squamous cell carcinoma.

[0239] Adenocarcinoma develops in an organ or gland and squamous cell carcinoma originates in squamous epithelium. Adenocarcinomas may affect mucus membranes and are first seen as a thickened plaque-like white mucosa. These are rapidly spreading cancers.

[0240] Sarcomas are cancers arising from connective tissue including muscles, bones, cartilage and fat. Examples of sarcomas include osteosarcoma (of the bone), chondrosarcoma (of the cartilage), leiomyosarcoma (smooth muscles), rhabdomyosarcoma (skeletal muscles), mesothelial sarcoma or mesothelioma (membranous lining of body cavities), fibrosarcoma (fibrous tissue), angiosarcoma or hemangioendothelioma (blood vessels), liposarcoma (adipose or fatty tissue), glioma or astrocytoma (neurogenic connective tissue found in the brain), myxosarcoma (primitive embryonic connective tissue) and mesenchymous or mixed mesodermal tumor (mixed connective tissue types).

[0241] Germinomas referto germ cell tumors, derived from pluripotent cells, most often presenting in the testicle or the ovary (seminoma and dysgerminoma, respectively).

[0242] Blastomas are cancers derived from immature precursor cells or embryonic tissue. Blastomas are more common in children than in older adults. Examples of blastomas include hepatoblastoma, medulloblastoma, nephroblastoma, pancreatoblastoma, pleruropulmonary blastoma, retinoblastoma and glioblastoma multiforme.

[0243] Cancers of particular interest for the medical uses of the present invention are the solid tumors and their metastasis: breast cancer, colorectal cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, pancreatic cancer, liver cancer, head and neck cancer, sarcoma, gastroesophageal cancer, mesothelioma or skin and uveal melanoma.

[0244] Particularly preferred in the context of the present invention is that the cancer is a "metastatic cancer". Metastasis describes the spread of cancer cells from the place where they first formed to another part of the body. In metastasis, cancer cells break away from the original (primary) tumor, travel through the blood or lymph system, and form a new tumor (the "metastatic tumor") in other organs or tissues of the body. The new, metastatic tumor is the same type of cancer as the primary tumor. For example, if breast cancer spreads to the lung, the cancer cells in the lung are breast cancer cells, not lung cancer cells. An "oligometastatic cancer" has a numberof metastatic tumors, i.e., more than one. These metastatic tumors may then also be referred to as "oligometastatic tumors".

[0245] Radiation therapy

[0246] The present invention provides a recombinant expression system, expression vector(s), the viral particle(s) or pharmaceutical composition for use in methods of treating a proliferative disease, preferably cancer, wherein a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one furthertumor different from the at least one tumor treated in step a. is treated with radiation.

[0247] The at least one further tumor differentfrom the tumor treated in step a. is not treated with the recombinant expression system.

[0248] This means that in a patient with multiple tumors (primary or metastatic), more than one tumor is treated with radiation and one or more but not all tumors treated with radiation are treated with the recombinant expression system. By way of example, if a subject has 6 tumors (primary or metastatic), all six may be treated with radiation and 1, 2, 3, 4, or 5 tumors may additionally be treated with the recombinant expression system.

[0249] For instance, in one embodiment, the cancer comprises more than two tumors, primary or metastatic, (i.e., the subject has more than two tumors), but only two tumors are treated. For instance, one tumor will be treated with the recombinant expression system and both tumors will be treated with radiation, locally or systemically, as described herein. Hence in one embodiment, the cancer comprises two or more tumors (primary or metastatic), such as X tumors (wherein X is 2 or a number higher than 2). In this case, all of the tumors may be treated with radiation, locally or systemically, as described herein, and X-l tumors (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more tumors) may be treated with the recombinant expression system. In another case, when X is higher than 2, X-l tumors will be treated with radiation, locally or systemically, as described herein, and X-2 tumors (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more tumors) may be treated with the recombinant expression system.

[0250] However, in some embodiments, the at least one tumor (a) treated with the recombinant expression system and treated with radiation and the at least one furthertumor (b) different from the at least one tumor treated in step a. treated with radiation are all treated with further therapeutic means in a combination therapy.

[0251] The term "radiation" or "radiotherapy" refers hereinafter to the medical use of ionizing radiation, generally as part of cancer treatment to control or kill malignant cells. Radiation as part of standard care is preferably applied as only one cycle, fractionated, prior or jointly with chemotherapy, ortumor resection.

[0252] Radiation may be applied locally to each of the tumors or systemically (to the whole body, i.e., whole-body irradiation). In a preferred embodiment, radiation is applied locally, i.e., in a preferred embodiment, the radiation is applied locally to each tumor in the body, but it is not whole-body irradiation, see also below.

[0253] In one preferred embodiment, (ionizing) radiation is applied locally. As used herein, "local radiation" refers to ionizing radiation applied locally and confined to a defined anatomica l target volume that encompasses a tumor or lesion, preferably an image -guided irradiation limited to a planning target volume (PTV) identified on subject-specific CT, with beam collimation and delivery parameters selected to minimize clinically significant dose outside the PTV. Hence, local radiation is not whole-body radiation. The ionizing radiation might be based on photon rays such as X-rays or gamma-rays or particle rays, wherein the particle of the particle ray is preferably selected from the group consisting of beta particle, alpha particle, neutron, muon, pion, proton or other heavier positive ions. It may also be used as part of adjuvanttherapy, to prevent tumor recurrence after surgery that removes a primary malignant tumor. Radiation therapy may be synergistic with other anti-cancer therapies, and may be used before, during, and after other anti-cancer therapies in susceptible cancers, including but not limited to all chemotherapy regime ns, immunomodulation therapies, ablation or partial remotion techniques.

[0254] The term "low-dose radiotherapy" refers hereinafter to radiotherapies with an ionizing radiation dose of less than 40 Gy, preferably 10 Gy or less and more preferably 8 Gy or less. Low-dose radiotherapy can be any radiotherapy with an ionizing radiation dose of less than 40 Gy, 38 Gy, 36 Gy, 34 Gy, 32 Gy, 30 Gy, 28 Gy, 26 Gy, 24 Gy, 22Gy, 20 Gy, 19 Gy, 18 Gy, 17 Gy, 16 Gy, 15 Gy, 14 Gy, 13 Gy, 12 Gy, 11 Gy, 10 Gy, 9 Gy, 8 Gy, 7 Gy, 6 Gy, 5 Gy, 4 Gy, 3 Gy, 2.5 Gy, 2.0 Gy, 1.5 Gy, 1 Gy, 0.5 Gy, 0.25 Gy, 0.2 Gy, 0.15 Gy, 0.1 Gy, 0.05 Gy, or 0.01 Gy.

[0255] In one embodiment, ionizing radiation is applied only once. Hence, in one embodiment, the treatment with radiation consists on a single application of the radiation, i.e., a single radiation session or dose. For instance, the radiation treatment may be the application of a single dose of radiation of less than 40 Gy, preferably 10 Gy or less and more preferably 8 Gy or less. For instance, the radiation treatment may be the application of a single dose of radiation of less than 40 Gy, 38 Gy, 36 Gy, 34 Gy, 32 Gy, 30 Gy, 28 Gy, 26 Gy, 24 Gy, 22Gy, 20 Gy, 19 Gy, 18 Gy, 17 Gy, 16 Gy, 15 Gy, 14 Gy, 13 Gy, 12 Gy, 11 Gy, 10 Gy, 9 Gy, 8 Gy, 7 Gy, 6 Gy, 5 Gy, 4 Gy, 3 Gy, 2.5 Gy, 2.0 Gy, 1.5 Gy, 1 Gy, 0.5 Gy, 0.25 Gy, 0.2 Gy, 0.15 Gy, 0.1 Gy, 0.05 Gy, or 0.01 Gy.

[0256] Hence, in one embodiment, the treatment with radiation consists on a single application of the radiation to each of the tumors present in the body, locally, i.e., a single local radiation session or dose pertumor, as described above. For instance, the radiation treatment may be the application of a single dose of radiation locally in each of the tumors, as described above, of lessthan 40 Gy, preferably 10 Gy or less and more preferably 8 Gy or less. For instance, the radiation treatment may be the application of a single dose of radiation of less than 40 Gy, 38 Gy, 36 Gy, 34 Gy, 32 Gy, 30 Gy, 28 Gy, 26 Gy, 24 Gy, 22Gy, 20 Gy, 19 Gy, 18 Gy, 17 Gy, 16 Gy, 15 Gy, 14 Gy, 13 Gy, 12 Gy, 11 Gy, 10 Gy, 9 Gy, 8 Gy, 7 Gy, 6 Gy, 5 Gy, 4 Gy, 3 Gy, 2.5 Gy, 2.0 Gy, 1.5 Gy, 1 Gy, 0.5 Gy, 0.25 Gy, 0.2 Gy, 0.15 Gy, 0.1 Gy, 0.05 Gy, or 0.01 Gy.

[0257] In particular, the present invention concerns the surprising finding that the treatment with radiation of tumors that have not been treated with a recombinant expression system, expressionvector(s), viral particle(s) or pharmaceutical compositions of the present invention leads to a therapeutic benefit in those tumors (i.e., those only treated with radiation), as long as at least one differenttumor has been treated with the recombinant expression system and treated with radiation.

[0258] Furthermore, in some embodiments, it was further found that the combined treatment of a tumor with both the recombinant expression system of the present invention and radiation produced an unexpectedly high synergistic anti-tumor effectas compared to radiation alone. In particular, in tumors exposed to radiation and subsequentadministration of the expression system to at least one different tumor (treated with radiation as well) in the subject, the reduction in tumor size achieved was at least about 1.6 fold, 1.7-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, or 8-fold greater than the reduction in tumor size observed in tumors treated with radiation alone, thereby demonstrating a robust synergistic interaction between radiation and the administration of the recombinant expression system to at least one differenttumor in mediating systemic anti-tumor responses. Hence, in one embodiment, the invention provides a recombinant expression system as described herein for use in a method of treating a proliferative disease, such as cancer, wherein: a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one furthertumor different from the at least one tumor treated in step a. is treated with radiation, wherein the treatment achieves a reduction in tumor size of at least about 1.6 fold, 1.7-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, or 8-fold greater, than the reduction in tumor size observed in tumors treated with radiation alone. Preferably, the treatment with radiation is performed before the treatment with the recombinant expression system. Preferably, the treatment with radiation consists of a single radiation dose.

[0259] In a preferred embodiment, treatment with radiation is performed locally, as described herein. Further preferably, the treatment with radiation is performed as a single dose, as described herein.

[0260] Furthermore, in the contextof the present invention, "tumor" is used broadly, i.e., the at least one tumor treated with the recombinant expression system and treated with radiation may be an original (primary) tumor or a metastatic tumor. Similarly, the at least one further tumor different from the at least one tumor treated with the recombinant expression system and treated with radiation may be an original (primary) tumor or a metastatic tumor.

[0261] In some embodiments, all tumor in a subject are treated with radiation and any subset of tumors are treated with the recombinant expression system. In a further embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation and the at least one further tumor (b) different from the at least one tumor treated with the recombinant expression system and treated with radiation are the same type of cancer or different types of cancer.

[0262] In a preferred embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation and the at least one furthertumor (b) different from the at least one tumor treated with the recombinant expression system and treated with radiation are the same type of cancer, preferably a solid cancer.

[0263] As outlined above, this includes that the at least one tumor treated with the recombinant expression system and treated with radiation is the primary tumor and the at least one further tumor differentfrom the at least one tumor treated with the recombinant expression system and treated with radiation is a metastatic tumor, or vice versa.

[0264] As used herein, the term "concurrent administration" or "concomitant administration" with respect to two or more therapeutic approaches, e.g., treatment with the recombinant expression system, expression vector(s), viral particle(s) or pharmaceutical compositions of the present invention and treatment with radiation, is administration using time intervals such that the therapeutic approaches are present together within the body, e.g., at one or more sites of action in the body, over a time interval in non- negligible quantities.

[0265] The time interval between the two therapeutic approaches of the present invention (e.g., treatment with the recombinant expression system, expression vector(s), viral particle(s) or pharmaceutical compositions of the present invention and treatment with radiation as described herein) can be minutes (e.g., at least 1 minute, 1-30 minutes, 30-60 minutes), hours (e.g., at least 1 hour, 1-2 hours, 2-6 hours, 6-12 hours, 12-24 hours), days (e.g., at least 1 day, 1-2 days, 2-4 days, 4-7 days, etc.), weeks (e.g., at least 1, 2, or 3 weeks, etc.).

[0266] Accordingly, the two therapeutic approaches of the present invention, e.g., treatment with the recombinant expression system, expression vector(s), viral particle(s) or pharmaceutical compositions of the present invention and treatment with radiation, may, but need not be, administered together simultaneously.

[0267] In addition, the therapeutic approaches of the present invention, e.g., treatment with the recombinant expression system, expression vector(s), viral particle(s) or pharmaceutica l compositions of the present invention and treatment with radiation may, but need not be, administered essentially simultaneously (e.g., within less than 5 minutes, or within less than 1 minute apart) or within a short time of one another (e.g., less than 1 hour, less than 30 minutes, less than 10 minutes, approximately 5 minutes apart).

[0268] Consequently, in a further embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system (i) prior or (ii) concurrently or (iii) after the at least one tumor (a) and / or the at least one tumor (b) is / are treated with radiation.

[0269] In a further preferred embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) is treated with radiation, preferably wherein the time interval between the radiation and the subsequent treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours.

[0270] In another embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after the at least one tumor (a) and / or the at least one further tumor (b) is / are treated with radiation, preferably wherein the time interval between the radiation and the subsequent treatment with the expression system is between 1 minute and 1 day, preferably between 1 minutes and 12 hours, more preferably between 1 minute and 6 hours, even more preferably between 1 minute and 1 hour.

[0271] In a further embodiment, the at least one further tumor (b) is treated with radiation prior or concurrently or after the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system .

[0272] In a further preferred embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one furthertumor (b) and / or the at least one tumor (a) is / are treated with radiation, preferably wherein the time interval between the radiation and the subsequent treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours.

[0273] In a further embodiment, the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after the at least one tumor (a) and the at least one furthertumor (b) are treated with radiation. In a further embodiment, the at least two tumors are treated with radiation and only one of the tumors treated with radiation is treated with the recombinant expression system.

[0274] In a further embodiment, the at least two tumors are treated with radiation and only one of the tumors treated with radiation is treated with the recombinant expression system, wherein the treatment with radiation of the at least two tumors and the treatment with the recombinant expression system of the at least one tumor occur essentially at the same time (concurrent administration, as described above) .

[0275] Hence, in one embodiment, the invention provides a recombinant expression system as described herein for use in a method of treating a proliferative disease, such as cancer, wherein: a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor different from the at least one tumor treated in step a. is treated with radiation, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system after the at least one tumor (a) and / or the at least one tumor (b) is / are treated with radiation, preferably wherein the time interval between the radiation and the subsequent treatment with the expression system is: between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours; and / or between 1 minute and 1 day, preferably between 1 minute and 12 hours, more preferably between 1 minute and 6 hours, even more preferably between 1 minute and 1 hour.

[0276] In another embodiment, the invention provides a recombinant expression system as described herein for use in a method of treating a proliferative disease, such as cancer, wherein: a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor different from the at least one tumor treated in step a. is treated with radiation, wherein the treatment with radiation of the at least one tumor (a) and the at least one further tumor (b) and the treatment with the recombinant expression system of the at least one tumor (a) occur essentially at the same time (i.e., they are administered together simultaneously), i.e., wherein the treatment with radiation for the at least one tumor (a) and the at least one furthertumor (b) and the treatment with the recombinant expression system of the at least one tumor (a) are administered concurrently.

[0277] In another embodiment, the invention provides a recombinant expression system as described herein for use in a method of treating a proliferative disease, such as cancer, wherein: a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one furthertumor different from the at least one tumor treated in step a. is treated with radiation, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system before the at least one tumor (a) and / orthe at least one tumor (b) is / are treated with radiation.

[0278] In a further embodiment, the radiation is administered using stereotactic radiosurgery (SRS), intraoperative radiation therapy (IORT), stereotactic body radiotherapy (SBRT), single dose radiotherapy (SDRT), intensity-modulated radiation therapy (IM RT), Image-Guided Radiation Therapy (IGRT), stereotactic ablative radiotherapy (SABR) or a form of hypofractionated radiation therapy preferably performed by linear accelerator (LINAC) machines, gamma Knife machines or proton beam therapy.

[0279] Delivery of the recombinant expression system, expression vector(s), the viral particle(s) or pharmaceutical composition

[0280] In one embodiment, the recombinant expression system, the expression vector(s), the viral particle(s) or the pharmaceutical composition according to the invention are administered locally to the at least one tumor, preferably by intratumor administration.

[0281] As used herein, the term "local administration" or "local delivery", in reference to delivery of a recombinant expression system, an expression vector, a viral particle or a pharmaceutical composition described herein, refers to delivery that does not rely upon transport of said products to its intended target tissue or site via the vascular system. Said products described herein may be delivered directly to its intended target tissue or site, or in the vicinity thereof, e.g., in close proximity to the intended target tissue or site. For example, said products may be delivered by injection or implantation of the composition or compound or by injection or implantation of a device containing the composition or compound. Following local administration in the vicinity of a target tissue or site, said products described herein, or one or more components thereof, may diffuse to the intended target tissue or site. It will be understood that once having been locally delivered a fraction of said products described herein (typically only a minorfraction of the administered dose) mayenterthe vascular system and be transported to another location, including back to its intended target tissue or site.

[0282] The term "intratumor administration" refers to the administration of a compound (e.g., a therapeutic agent, expression vector, viral particle, pharmaceutical composition, and / or formulation) such that the compound is present within the tumor after administration. Those of ordinary skill in the art will appreciate that the administration thereby can occur directly within the tumor or in close proximity to the tumor.

[0283] Combination therapy

[0284] The recombinant expression system, expression vector(s), the viral particle(s) or pharmaceutical composition of the invention may be employed in a combination therapy with any other standard of care treatment known to the skilled person. Several anti-cancer therapies are known in the art such as chemotherapy, hormone therapy, radiotherapy, photodynamic therapy, stem cell transplants, surgery, targeted therapy, hyperthermia, or other immunotherapies.

[0285] In a particularly preferred embodiment, any of the described treatments with radiotherapy and / or the expression system occur after previous treatment with chemotherapy.

[0286] In other words, the patient first receives chemotherapy and then, as described in the remaining disclosure, a recombinant expression system for use in a method of treating cancer, wherein a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor different from the at least one tumor treated in step a. is treated with radiation.

[0287] In some embodiments, the chemotherapeutic agent is selected from the group consisting of mitotic inhibitors, alkylating agents, anti-metabolites (e.g., nucleoside analogs), intercalating agents, growth factor inhibitors, cell cycle inhibitors, enzymes, topoisomeRASe inhibitors, biological response modifiers, anti-hormones, angiogenesis inhibitors, hypomethylating agents, and anti-androgens.

[0288] Non-limiting examples of therapeutic agents that can be used together with the recombinant expression system and radiation described herein are chemotherapeutic agents, cytotoxic agents, and non-peptide small molecules such as Gleevec® (Imatinib Mesylate), Velcade® (bortezomib), Casodex (bicalutamide), Iressa® (gefitinib), and Adriamycin as well as a host of chemotherapeutic agents.

[0289] Non-limiting examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, calicheamicin, carabicin, carminomycin, carzinophilin, Casodex®, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, stre ptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenishersuch as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK.RTM.; razoxane; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, e.g., paclitaxel (TAXOL™, Bristol- Myers Squibb Oncology, Princeton, NJ.) and docetaxel (TAXOTERE™, Rhone-Poulenc Rorer, Antony, France); retinoic acid; esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0290] In some embodiments, one ormore furthertherapeuticagents comprises a nucleoside analog or an intercalating agent. In other embodiments, the one or more further therapeutic agents comprise a nucleoside analog and an intercalating agent.

[0291] Nucleoside analogs function by disrupting DNA or RNA synthesis, and include purine analogs and pyrimidine analogs. In embodiments, the nucleoside analog may be: a purine analog such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; or a pyrimidine analog, such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine (e.g., Ara-C, dideoxyuridine, doxifluridine, enocitabine, or floxuridine. In particular embodiments, the nucleoside analog comprises cytarabine.

[0292] Intercalating agents are molecules that can bind between base pairs of DNA. In embodiments, the intercalating agent is doxorubicin, daunorubicin (also known as daunomycin), or dactinomycin.

[0293] In some aspects of the first embodiment, the one or more further therapeutic agents comprises a hypomethylating agent. Hypomethylating agents are molecules that inhibit DNA methylation, for example, by inhibiting DNA methyltransferase.

[0294] In another preferred embodiment the recombinant expression system, expression vector(s), the viral particle(s) or pharmaceutical composition of the invention is (are) employed in a combination therapy with at least one other therapy selected from the group consisting of a therapy comprising at least one checkpoint inhibitor, a therapy comprising at least one adoptive cell therapy, a therapy comprising at least one cancer vaccine, a therapy comprising a chemotherapy and / or a therapy comprising at least one exogenous cytokine.

[0295] "Combination therapy" refers to those situations in which two or more different compounds (e.g., a therapeutic agent, expression vector, viral particle, pharmaceutical composition, and / or formulation) are administered in overlapping regimens so that the subject is simultaneously exposed to both compounds. When used in combination therapy, two o r more different compounds may be administered simultaneously or separately. This administration in combination can include simultaneous administration of the two or more compounds in the same dosage form, simultaneous administration in separate dosage forms, and separate administration. That is, two or more compounds can be formulated together in the same dosage form and administered simultaneously. Alternatively, two or more compounds can be simultaneously administered, wherein the compounds are present in separate formulations. In another alternative, a first compound can be administered followed by one or more additional compounds. In the separate administration protocol, two or more compounds may be administered a few minutes apart, or a few hours apart, a fewdays apart, or a few weeks apart. In some embodiments, two or more compounds may be administered 1-2 weeksapart.

[0296] An "immune checkpoint inhibitor" or "checkpoint inhibitor", refers to a compound that inhibits a protein in the checkpoint signaling pathway. Proteins in the checkpoint signaling pathway include for example, CD27, CD28, CD40, CD 122, CD137, 0X40, GITR, ICOS, A2AR, B7-H3, B7- H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, PD-L1, PD-L2, TIM-3, TIGIT, Lairl, CD244, HAVCR2, CD200 CD200R1, CD200R2, CD200R4, LILRB4, PILRA, ICOSL, 4-1BB or VISTA.

[0297] The inhibitor of the therapy comprising at least one checkpoint inhibitor may be selected of the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, CTLA-4, LAG3, BTLA, B7H3, B7H4, TIM3, KIR, or A2aR, more preferably selected from the group consisting of an inhibitor of PD- 1, PD-L1, PD-L2, or CTLA-4. Immune checkpoints are molecules expressed on T cells or cells interacting with T cells that help regulate the immune response and prevent excessive or prolonged immune activation. However, cancer cells can take advantage of these checkpoint proteins to evade detection by the immune system. By blocking these checkpoint proteins, immune checkpoint inhibitors can release the brakes on the immune response and allow the immune system to attack and destroy cancer cells. Using immune checkpoint inhibitors as an additional therapy is particularly advantageous in the context of this invention as the expression system of the invention causes infiltration of T cells into the tumor environment. As these T cells might be impaired in theirfunction due to the immune che ckpoints, means to overcome this hurdle may greatly benefit the treatment outcome.

[0298] Immune checkpoint inhibitors are known in the art. For example, the immune checkpoint inhibitor can be a small molecule. A "small molecule" as used herein, is meant to refer to a composition that has a molecular weight in the range of less than about 5 kDa to 50 Da, for example less than about 4 kDa, less than about 3.5 kDa, less than about 3 kDa, less than about 2.5 kDa, less than about 2 kDa, less than about 1.5 kDa, less than about 1 kDa, less than 750 Da, less than 500 Da, less than about 450 Da, less than about 400 Da, less than about 350 Da, less than 300 Da, less than 250 Da, less than about 200 Da, less than about 150 Da, less than about 100 Da. Small molecules can be, e.g., nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic or inorganic molecules. Alternatively, the immune checkpoint inhibitor is an antibody or fragment thereof. For example, the antibody or fragment thereof is specific to a protein in the checkpoint signaling pathway, such as CD27, CD28, CD40, CD 122, CD137, 0X40, GITR, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, PD-L1, PD-L2, TIM-3, TIGIT, Lairl, CD244, HAVCR2, CD200, CD200R1, CD200R2, CD200R4, LILRB4, PILRA, ICOSL, 4-1BB or VISTA. Exemplary, anti-immune checkpoint antibodies include for example ipilimumab (anti-CTLA-4), pembrolizumab (anti- PD-LI), nivolumab (anti-PD-Ll), atezolizumab (anti-PD-Ll), duralumab (anti-PD-Ll) or relatlimab (anti-LAG- 3).

[0299] "Adoptive cell therapy", as used herein, refers to therapies in which autologous or allogenic immune cells are infused into patients to treat certain diseases such as cancer. Various cell types can be used for this purpose, such as dendritic cells, natural killer (NK) cells or T-cells.

[0300] The term "adoptive T-cell therapy", as used herein, refers to therapies in which autologous or allogenic T-cells are infused into patients to treat certain diseases such as cancer. One type of adoptive T-cell therapy is to isolate tumor-infiltrating-leukocytes (TIL) from the tumor, optionally expand these cells outside of the patient and infuse them back into the patient. Other types of adoptive T-cell therapy include chimeric antigen receptor (CAR) T-cell therapy or T cell receptor (TCR)-engineered T-cell therapy. CAR-T-cells may be designed in several ways that enhance tumor cytotoxicity and specificity, evade tumor immunosuppression, avoid host rejection, and prolong their therapeutic half-life.

[0301] A therapy comprising at least one adoptive cell therapy may be an adoptive NK cell therapy, adoptive dendritic cell therapy, or adoptive T-cell therapy, wherein the adoptive T-cell therapy preferably is a CAR-T-cell therapy, TCR-T-cell therapy or a therapy using tumor infiltrating leukocytes (TIL). In some cases, tumors silence the expression of MHC class I molecules and / or IFN-y molecules as a means to evade T cell immunity. Using adoptive cell therapy may circumvent these problems as these adopted cells are normally capable of recognizing and targeting tumor cells. Thus, synergistic effects may be expected in a combinatory approach.

[0302] Also, the combination of the expression system of the invention with a cancer vaccine or exogenous cytokines may cause synergistic effectsas the recruited T cells are primed towards cancer cells by cancer vaccines or exogeneous cytokine .

[0303] The term "cancer vaccine", as used herein, refers to a vaccine that either treats existing cancer or prevents development of cancer.

[0304] Pharmaceutical compositions

[0305] Another aspect of the invention is a pharmaceutical composition that comprises a pharmaceutically acceptable excipient togetherwith the recombinant expression system, the expression vector(s) or the viral particle(s) according to the invention. Pharmaceutical compositions have the advantage that they are "ready-to-use" in that they may be administered directly to the patient for treatment. In addition, pharmaceutic compositions are tailored to optimize stability and availability of the ingredients according to the therapeutic need while avoiding unwanted side effects for the patient.

[0306] The term "pharmaceutical composition" refers to a preparation which is in such form as to permit the biological activity of the active ingredient to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. Such formulations are sterile.

[0307] "Pharmaceutically acceptable" excipients (vehicles, additives) are those which can reasonably be administered to a subject mammal to provide an effective dose of the active ingredient employed.

[0308] The term "excipient" refers to a vehicle, diluent or adjuvant that is administered with the active ingredient. Such pharmaceutical excipientscan be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and similars. Water or saline aq ueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are particularly used as vehicles. Suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E.W. Martin, 21st Edition, 2005; or"Handbook of Pharmaceutical Excipients", Rowe C. R.; Paul J. S.; Marian E. Q., sixth Edition. Suitable pharmaceutically acceptable vehicles include, e.g., water, salt solutions, alcohol, vegetable oils, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, monoglycerides and diglycerides of fatty acids, fatty acid esters petroetrals, hydroxymethyl cellulose, polyvinylpyrrolidone and similars.

[0309] Definitions

[0310] Substantially: As used herein, the term "substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0311] Approximately: The term "approximately" as used herein may be applied to modify any quantitative comparison, value, measurement, orother representation that could permissibly vary without resulting in a change in the basic function to which it is related. A / an: As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising" the words “a" or “an" may mean one or more than one.

[0312] Or; and / or: The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only orthe alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or."

[0313] The term “about" means, in general, within a standard deviation of the stated value as determined using a standard analytical technique for measuring the stated value. The terms can also be used by referring to plus or minus 5 % of the stated value.

[0314] Essentially: The term "essentially" is to be understood that methods or compositions include only the specified steps or materials and those that do not materially affect the basic and novel characteristics of those methods and compositions.

[0315] Stereoisomers: In addition, the compounds used in the present invention may contain one or more asymmetric carbon atoms and therefore exists in two or more stereoisomeric forms. Where a compound contains an alkenyl or alkenylene group, cis (E) and trans (Z) isomerism may also occur. The present invention includes use of the individual stereoisomers of the compound and, where appropriate, the individual tautomeric forms thereof, together with mixtures thereof.

[0316] Analogues: As used herein the term “analogue" refers to a chemical compound that is structurally similar to another but differs slightly in composition, such as in the replacement of one atom by an atom of a different element or by a functional group.

[0317] Isotopes in compounds: The present invention also includes use of all suitable isotopic variations of the compounds described herein or a pharmaceutically acceptable salt thereof. An isotopic variation of a compound of the present invention ora pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Examples of isotopes that can be incorporated into the compounds and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as 2H, 3H, 13C, 14C, 15N, 170, 180, 31P, 32P, 35S, 18F and 36CI, respectively. Certain isotopic variations of the compound and pharmaceutically acceptable salts thereof, for example, those in which a radioactive isotope such as 3H or 14C is incorporated, are useful in drug and / or substrate tissue distribution studies. Tritiated, i.e., 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred fortheir ease of preparation and detectability. Further substitution with isotopes such as deuterium, i.e., 2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of the compounds of the present invention and acceptable salts thereof can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents.

[0318] Cytokine: The term "cytokine" refers to the general class of biological molecules which effect / affect cel Is of the immune system. The definition is meant to include, but is not limited to, those biological molecules that act locally or may circulate in the blood, and which, when used in the compositions or methods of the present invention serve to regulate or modulate an individual's immune response to cancer. Cytokines may be a number of different substances such as interferons, interleukins, chemokines and growth factors. Exemplary cytokines for use in practicing the invention include but are not limited to interferons (e.g. IFN-a, IFN-B, and IFN-y), interleukins (e.g., IL-l to IL-29, in particular, IL-2, IL-7, IL- 12, IL- 15 and IL-18), tumor necrosis factors (e.g., TNF-a and TNF-B), chemokines (e.g. CXCL9, CXCL10), granulocyte-macrophage colony-stimulating factor (GM-CSF), TGF-B, FLT3-ligand, and fragments or variants thereof. Notably, exogenously provided cytokines are a type of immunotherapy. As used herein, the term "antibody" collectively refers to immunoglobulins or immunoglobulin-like molecules including by way of example and without limitation, IgA, IgD, IgE, IgG and IgM, combinations thereof, and similar molecules produced during an immune response in any vertebrate, for example, in mammals such as humans, goats, rabbits, llama and mice, as well as non-mammalian species, such as shark immunoglobulins. As used herein, the term "monoclonal antibody" refers to an antibody produced by a single clone of B-lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody forming cells from a fusion of myeloma cells with immune spleen cells. Monoclonal antibodies include humanized monoclonal antibodies. : The terms "single-chain variable fragment" and "scFv" refer to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed asa single polypeptide chain, and wherein the scFv retains the specificity of the intact antibody from which it is derived. The term "nanobody", as used herein, refers tothe smallest antigen binding fragment or single variable domain (VHH) derived from naturally occurring heavy chain antibody and is known to the person skilled in the art.

[0319] Hybridize: The terms "hybridizing" or "hybridizes" as used herein is to be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex.

[0320] Mutation: The term "mutation," as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual.

[0321] Identity: As used herein, the term "identity" refers to the overall relatedness between polymeric molecules, e.g., between polypeptide molecules and / or between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules). In some embodiments, polymeric molecules are considered to be "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides or amino acids at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needsto be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller, which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequencescan, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0322] Exogenous / exogenic:The terms "exogenous" or “exogenic” when used in relation to a protein, gene, nucleic acid, or polynucleotide in a cell or organism refers to a protein, gene, nucleic acid, or polynucleotide that has been introduced into the cell or organism by artificial or natural means; or in relation to a cell, the term refers to a cell that was isolated and subsequently introduced to other cells or to an organism by artificial or natural means. An exogenous nucleic acid may be from a different organism or cell, or it may be one or more additional copies of a nucleic acid that occurs naturally within the organism or cell. An exogenous cell may be from a different organism, or it may be from the same organism. By way of a non-limiting example, an exogenous nucleic acid is one that is in a chromosomal location different from where it would be in natural cells, or is otherwise flanked bya different nucleic acid sequence than that found in nature.

[0323] Subject: As used herein, the terms “subject”, “test subject” or “patient" refer to any organism to which a provided compound or composition is administered in accordance with the present invention e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from, and / or susceptible to a disease, disorder, and / or condition.

[0324] EXAMPLES

[0325] The examples have been carried out with constructs comprising:

[0326] Single chain IL 12 sequences of SEQ ID NO.: 1 or 3;miR-122 target sequence of SEQ ID NO.: 11;

[0327] WPRE sequence of SEQ ID NO.: 12;

[0328] 5'- ITR of SEQ ID NO.: 13;

[0329] 3'-ITR of SEQ ID NO.: 14;

[0330] ISRE promoter of SEQ ID NO 18. METHOD DETAILS

[0331] Mice

[0332] Experiments involving mice were approved by the Ethics Committee of the Government of Navarra under Spanish regulations (protocols 051-19, 011-23, 041-23, and 058-23). Seven- week-old mice were housed for at least 7 days on a 12-hour light / dark cycle before manipulation. Mice had free access to food and water throughout the course of the experiments and were maintained under pathogen-free conditions in the animal facility at CIMA-Universidad de Navarra, Pamplona, Spain). C57BL / 6JOIaHsd (referred to as C57BL / 6 ) and B6 129-Rag2tmlFwaIL2rgtmlRsky / Dw\Hsd (Rag2 / ll2rg ^) mice were purchased from Envigo (Barcelona, Spain), B6.129S(C)-Batf3tmlKmm / J (Batf3~ / ~) and C57BL / 6J-Stinglgt / J (Tmeml73^) mice were purchased from Jackson Laboratory (The Jackson Laboratory, Bar Harbor, Maine). A colony of NSG (NOD.Cg-PrkdcscidI l2rgtmlWjl / SzJ ) mice was bred in our animal facility (CIMA, Pamplona, Spain). Mice lacking perforin (C57BL / 6-P rf ltmlsdz / J ) were provided by Dr. J. Pardo (Centro de Investigacion Biomedica de Aragon, CIBA). MHC-dKO NSG (NOD.Cg-PrkdcscidH2- Kib tmiBpe |_|2-Ablg7 emlMvwH2-Dlb tmlBpeI l2rgtmlwj' / SzJ ) mice were purchased from The Jackson Laboratory (Bar Harbor, Maine, USA) and maintained underspecific pathogen- free conditions

[0333] Cell lines

[0334] The human embryonic kidneycell line (HEK-293T) was obtained fromATCC. B16F10 and MC38 mouse cell lines were kindly provided by I. Melero (CIMA-University of Navarra, Spain. RT112 human bladder cancer cell line was provided byX. Aguirre (CIMA-University of Navarra, Spain). The murine glioma GL261 was a kind gift from Dr. Safrany (Frederic Joliot-Curie National Research Institute for Radiobiology and Radiohygiene, Budapest, Hungary) . MB49 mouse bladder carcinoma cell line (cat. number SCC148) was purchased from Sigma-Aldrich. KPC mouse pancreatic cancer cell line was a gift from R. Manguso (Broad Institute, Cambridge, US) and S. Dougan (Dana-Farber Cancer Institute). All cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM) with Glutamax (Gibco, Invitrogen, Carlsbad, CA, USA) containing 10% heat-inactivated FBS (Sigma-Aldrich, Dorset, UK), 100 I U / mL pe n icillin, 100 g / mL streptomycin (Bio whittaker, Walkersville, MD, USA) at 37°C in 5% CO2. Cell lines were routinely tested for mycoplasma contamination after seven days of culture using the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).

[0335] Plasmid design

[0336] All plasmids were sythesized by GenScript (GenScript, Piscataway, USA), amplified into DH5a competent cells (Invitrogen, Thermo Fisher Scientific Inc. USA) and purified with PureLink HiPure Plasmid Maxiprep Kit (Invitrogen, Thermo Fisher Scientific Inc). The eGFP sequence was obtained from GeneBank (NZ_CP024869); the firefly luciferase sequence was cloned from the pHIV-Luc-ZsGreen (Addgene Massachusetts, USA); the murine single -chain IL- 12 sequence was kindly provided by Dr. Hernandez (CIMA-University of Navarra, Spain); the murine I L15 sequence was kindly provided by Dr. Berraondo (CIMA-University of Navarra); the FLT3L sequence was kindly provided by Dr. Labiano (CIMA-University of Navarra). The YYl-mutant vector was designed by introducing two nucleotide mutation in the YYl-binding motif in the ITR region (113-116, CCAT to CAAA). The inducible plasmids were designed with an ISREx4 promoter sequence, designed with optimal spacing (Mohamed, 2016) and the five miR122 target sites in tandem sequence (5xmiR122T) (Qiao, 2011), synthesized by GenScript (GenScript, Piscataway, USA). Single-stranded AAV-CMV-eGFP (ssAAV) and double-stranded AAV-CMV-GFP (dsAAV) plasmids were kindly provided by Dr. Gonzalez (CIMA-University of Navarra, Spain).

[0337] Production of rAAV

[0338] AAV serotypes 5, and 8 were produced by co-transfection of pDP5 or pDP8.ape respectively (PlasmidFactory GmbH & Co. KG, Bielefeld Germany) and pAAV into HEK-293T cells. For the AAV serotype 9, the pDP9 was used, kindly given by Dr. Gonzalez (Cl MA, University of Navarra, Spain). For each production, a mix of 20 pg of pAAV-expressing protein, 55 pg of pDP, and linear PEI 25 kDa (Sigma-Aldrich) was transfected into HEK-293T cells. Vector particles were obtained from cells and supernatant. After 72 h, the supernatant was treated with polyethylene glycol solution (PEG8000, Sigma-Aldrich) for48 h at 4 °C and centrifuged for 15 min at 3000 rpm. Viral particles present in the pellet were resuspended in lysis buffer(50 mM Tris-CI, 150 mM NaCI, 2 mM MgCI2, 0.1% Triton X-100) and stored at -80 °C. Both supernatant and cells were subjected to 3 freeze / thaw cycles, centrifuged, and treated with DNase and RNase solutions. The lysate was purified in an iodixanol gradient (Optiprep, Serumwerk Bernburg AG) by ultracentrifugation (69000 rpm, 16°C, 2.5h) and concentrated by Ultra-15 mL Amicon® columns (Millipore, Bedford, MA, USA). AAV vector genomes were extracted using the High Pure Viral Nucleic Acid Kit (Roche, Switzerland) following the manufacturer's specifications. Titration of viral particles was subsequently determined by real-time quantitative PCR using primers specific to the AAV ITR2 consensussequences Fw: 5'-GGA ACC CCT AGT GATGGA GTT-3' (SEQ ID NO.: 28) and Rv: 5'-CGG CCT CAG TGAGCG A-3' (SEQ ID NO.: 29).

[0339] Generation of cell lines

[0340] For CRISPR knockout, cells were transiently transfected with pX459 (Addgene, 62988) targeting control (GCGAGGTATTCGGCTCCGCG, SEQ ID NO.: 30), Kiaa0319l (AAVR; CATTCACGTAGCCTTCCCCA, SEQ ID NO.: 31), Jakl (CAGCGGAGAGTATACAGCCG, SEQ ID NO.: 32), Ifngrl (CGACTTCAGGGTGAAATACG, SEQ ID NO.: 33), B2m (AGTATACTCACGCCACCCAC, SEQ ID NO.: 34) or Tmeml73 (TATCTCGGAATCGAATGTTG, SEQID NO.: 37) with Lipofectamine transfection reagent (Thermo Fisher Scientific, L3000015). Transfected populations were selected in antibiotics for 2-4 d, and bulk transfectant populations were validated by flow cytometry analysis and used for subsequent experiments. The luciferase -B16 cell line was generated by lentiviral infection. Lentiviral particles were produced in HEK293 cells by cotransfection of pHIV-Luc-ZsGreen with psPAX2 and pMD2.G plasmids (Addgene) using Lipofectamine 3000 (Invitrogen, ThermoFisher). Virus-containing 48- and 72-hour posttransfection supernatant was filtered through a 0.45um filter (Millipore) and centrifuged at 90000g for 2 h at 4°C. The supernatant was discarded and lentiviruses were resuspended in PBS and frozen until use. B16 cells were incubated with lentiviral particles overnight, and transduced cells were sorted by flow cytometry based on the expression of ZsGreen reporter protein one week after infection.

[0341] In vitro AAV transduction assays

[0342] For in vitro transduction assays, cells were irradiated in a Nordion Gammacell GC 3000 equipment (Best Theratronics Ltd.) when necessary and seeded at a density of 1.2x105cells / well in a 12-well plate. Immediately after, cells were transduced with indicated AAV8 vectors. In some experiments, serotypes AAV5 or AAV9 were used. GFP+expression was measured by flow cytometry at indicated time points. When indicated, cells were treated with A-485 (MedChemExpress) 24h before AAV transduction. The drug was maintained at indicated concentrations for the entire duration of the experiment. When indicated, cells were transduced with an GFP-mRNA lipid nanoparticle (GeneScript) as control.

[0343] For in vitro luciferase activity study, cells received 8 Gy in a Nordion Gammacell GC 3000 equipment (Best Theratronics Ltd.) or remained untreated as control. Cells were immediately seeded at a density of 85,000 cells / well in a 24-well plate and transduced with AAV8-iLuc or AAV8-cLuc (MOI 105). 48h post-infection, cells were incubated for 6h with l,000UI / ml of I FNct, IFN or IFNy (Peprotech). Luciferase activity was then measured using the Luciferase assay system kit (Promega) following the manufacturer's instructions in GloMax® Explorer Multimode Microplate Reader (Promega).

[0344] Real-time methylation-specific PCR (MSP)

[0345] For the ITR methylation analysis, B16 cells were irradiated and transduced as described above. DNA was extracted from B16 cells using NucleoSpin Tissue, Mini kit for DNA from cells and tissue (Macherey-Nagel, Duren, Alemania). The concentration and purity of extracted DNA were assessed using a nanodrop NanoDrop One (Thermo Fisher Scientific, Waltham, MA, EE.UU.). DNA methylation status was assessed using the EpiJET DNA Methylation Analysis Kit( Mspl / Hpal I ) from Thermo Scientific (Thermo Fisher Scientific Inc., Vilnius, Lithuania) following the manufacturer's protocol. Real-time PCR was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). Primers were designed to amplify a fragment of the determinant differential methylation region of promoter CAG (details in PM ID 28158319):

[0346] CAGp Fw: 5'-CTGGAGACGCCATCCACGCTGT-3' (SEQ ID NO.: 64) CAGp Rv: 5'-GCGTTCCAATGCACCGTTCCCG-3' (SEQ ID NO.: 65).

[0347] Bisulfite conversion was performed using EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

[0348] Real-time methylation-specific PCR (MSP) was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). Primers were designed to amplify either methylated or unmethylated bisulfite-converted DNA sequences as follows:

[0349] Methylated forward: 5'-TGAGGTCGTTCGGGCGTCGGG-3' (SEQ ID NO.: 20) Methylated reverse: 5'-TCCCTCTCTACGCGCTCGCTCG-3' (SEQ ID NO.: 21) Unmethylated forward: 5'-TGAGGTTGTTTGGGTGTTGGGTGA-3' (SEQ ID NO.: 22) Unmethylated reverse: 5'-ACCACTCCCTCTCTACACACTCACT- 3' (SEQ ID NO.: 23)

[0350] PCR reactions were performed in a total volume of 10 pL containing 5 pL of iQ SYBR Green Supermix (Bio-Rad Laboratories, Inc.), 0.3 pM each of forward and reverse primers, 2 pL of bisulfite-converted DNA, and nuclease-free water. The PCR cycling conditions were: initia l denaturation at 95°C for 10 minutes, followed by 35 cycles of 95°C for 15 seconds, 60°C for 1 minute and 722C for 45 seconds. The percentage of methylated cytosines at the analyzed CCGG sites was calculated using the formula: % of 5 mC=100 / (l+E)Cq2-Cql , being Cql the undigested DNA sample, Cq2 the Epi Hpall-digested sample, and E the PCR efficiency. Control reactions using unmethylated and CpG-methylated pUC19 / Smal DNA provided in the kit were included to validate the assay. Melting curve analysis was performed to verify the specificity of the amplification.

[0351] To quantify the ITR methylation levels, two standard curves were constructed with known copies of 100% methylated and 0% methylated DNA. The level of ITR methylation was obtained comparing the amplification curves of the test samples with those of the standard curves using the formula: Methylation level (%) = 100 x (number of methylated ITR copies) / (Number of methylated ITR copies + number of unmethylated ITR copies) Chromatin immunoprecipitation (ChlP)-PCR

[0352] ChIP studies were carried out using Pierce Agarose ChIP kit (Thermo Scientific) following manufacturer's instructions. Briefly, irradiated (8Gy) or control B16 cells were transduced with AAV8-cGFP at an MOI of 104as described above. 24 h later, chromatin immunoprecipitation was carried out with Rabbit anti-H3K27Ac (Abeam 4729) or Normal Rabbit IgG using Pierce Agarose ChIP kit (Thermo Scientific) following manufacturer's instructions. A volume equivalent to 10% of total chromatin was set aside as input. Following chromatin immunoprecipitation, the eluted DNA was quantified using a spectrophotometer.

[0353] PCR reactions were performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer's instructions with the following primers:

[0354] CAGp Fw: 5'-AGTCCAAGCTAGGCCCTTTTGCT-3' (SEQ ID NO.: 24)

[0355] CAGp Rev: 5'-GCCAGCACACAGACCAGCACGT-3' (SEQ ID NO.: 25)

[0356] ITR Fw: 5'-GCGCAGAGAGGGAGTGGCCAAC-3' (SEQ ID NO.: 73)

[0357] ITR Rev: 5'-AACTAATGACCCCGTAATTGA-3' (SEQ ID NO.: 74)

[0358] PCR amplification was performed using a CFX Connect thermocycler (Bio-Rad Laboratories, Hercules, CA, USA). Quantitative PCR data were analyzed using the comparative Ct method (2A(-AACt)). AACt being ACt(anti-H3K27ac) - ACt(control IgG) and ACt = Ct( I P anti-H3K27ac) - Ct(lnput sample 10%). The results were expressed as fold enrichment over IgG immunoprecipitation.

[0359] AAV Radiolabeling with Technetium-99m (99mTc)

[0360] A direct SnCL-mediated viral protein radio-labelling method was set up. For this, 40 pL of a 1,5 mg / mL SnCb was added into a clean vial, which was then purged using a flow of N 2 (1,5 bar, 5 minutes) to flush any oxygen. A threefold excessofviral particles, as determined by PCR to compensate for processing losses, were then added in 100 pL of PBS into the vial, followed by 52-100 MBq of [99mTc] NaTcO4 diluted to a final volume of 100 pL with NaCI 0,9%. The reaction was then left for 10 minutes at room temperature in the closed vial. The radiolabelling yield was determined by radio-TLC using iTLC-SG as the stationary phase and 2- butanone as the mobile phase. Radio-labelled viral particles appeared on the seeding zone (Rf=O), while unreacted [99mTc] NaTcO4 appeared at the solvent front (Rf=l). In vivo tumor models

[0361] For single-tumor experiments, 5xl05tumor cells (MC38, B16, LLC, KPC or MB49) were subcutaneously (s.c.) inoculated into the right flank of C57BL / 6 mice. When tumors reached 100 mm3approximately, mice were randomized and tumors were locally irradiated (8Gy) using a 225 Kv Small Animals Radiation Research Platform (SARRP) (Xstrahl Inc., Camberley, UK). Unless otherwise indicated, AAV vectors were administered intratumorally immediately after tumor irradiation. Tumor growth was monitored twice a week with an electronic caliper until endpoint. The tumor volume was calculated according to the formula V = (4 / 3) x n x (W / 2)2x (L / 2), where V is tumor volume, W is tumor width and L is tumor length . When indicated, mice received i.p. injections of 100 pg anti-PD-1 antibody (RMP1-14) or anti-CTLA-4 antibody (9D9) in 100 pl PBS on days 1, 4, and 7 after treatment. For depletion, anti-CD8[3 (53-5.8), anti-NKl.l (PK136) or anti-FasL (MFL3) antibodies were given at 200 pg / mouse, and anti-CSFIR (AFS98) and anti-Ly6G (1A8) were administered at 1 mg for the first dose and 0.5 mg thereafter; anti-IFNy (XMG1.2) was injected i.p. at 500 pg / mouse one day before treatment and then every 3-4 days. InvivoMab rat lgG2b (LTF-2) served as isotype control. All antibodies were started one day before tumor inoculation and then given every 3-4 days. Immediately after tumor irradiation, mice were transferred to the procedure room for intratumoral (i.t.) injection of AAV vectors. Tumor growth was monitored twice a week with an electronic caliper, and mice were euthanized when the diameter of the tumor reached 15 mm. The tumor volume was calculated according to the formula V = (4 / 3) x n x (W / 2)2x (L / 2) where V is tumor volume, W is tumor width and L is tumor length. In some experiments, mice received an intraperitoneal injection of 100 pg of anti-PD-1 antibody (clone RMP1-14, BioXCell, L'Aigle, France) or CTLA-4 (clone 9D9, Bioxcell) in 100 pl of PBS on days 1, 4, and 7 after treatment. For depletion experiments, antibodies against CD8 (clone 53-5.8, BioXCell) and NK1.1 (clone PK136, BioXCell) were i.p. injected (200 pg / mouse) alone or in combination. The first dose for antibodies directed to CFSR1 (clone AFS98, BioXCell) and Ly6G (clone 1A8, BioXCell) was 1 mg, while the following doses were 0.5 mg per mouse. InvivoMab rat lgG2b (clone LTF-2, BioXCell) was used as a control. Antibodies were initially administered the day before tumor cell inoculation, and every 3 or 4 days throughout the study. To investigate the role of IFNy on the antitumor effect observed, a specific antibody against IFNy (clone XMG1.2, BioXCell) was i.p. administered (500 pg / mouse) one day before treatment, and every 3 or 4 days throughout the study. In the humanized model (Eguren-Santamaria, 2024), MHC- dKO NSG mice were intravenously injected with 107human fresh PBMCs. Seven days later, RT-122 cells (5xl06cells / mouse) were s.c. injected into the right flank of mice. Animals were treated as described before.

[0362] For pancreatic cancer orthotopic model, mice were anesthetized with isoflurane forthe entire procedure. A ~1 cm subcostal incision was made in the left hemithorax. Pancreas was localized, externalized, and injected with 5xl05of KPC cells in PBS. The pancreas was then reinserted into the abdominal cavity and the peritoneum and skin of the mice were stitched. At day 10, pancreatic tumors were locally irradiated with computed tomography (CT) -guided SARRP. Once irradiation was completed, pancreas were surgically exposed fori. t. injection of the AAV. Tumor volumes were monitored by echography (VEVO 3100, Visualsonics) at days 7 (pre-treatment) and 21 (11 days post-treatment) after implantation. At day 22, animals were euthanized and tumors were collected and weighted.

[0363] For the glioblastoma orthotopic model, GL261 (50,000 cells per mouse in 3pl of free medium) was administered in the supratentorial region (+2.5mm lateral, +lmm anterior and 3mm depth respect to bregma) using a guide-screwsystem (Lal, 2000) of 4-week-old C57BI / 6 mice. After seven days, mice were irradiated using a SARRP as described (Garate-Soraluze, 2024) . Briefly, a CT was acquired for each mouse, to determine the target area (PTV) and surrounding healthy tissues. A locoregional dose of lOGy was selected using a 3x3mm collimator "nozzle” system. Once the treatment was finished, 5xl010viral genomes of AAV-ilL12 were administered using the guide-screw system as described above. The animals were checked daily and were sacrificed when symptoms (hemiparesis, loss of weight, or immobility) were visible.

[0364] For the abscopal antitumor model, 5xl05cells on the right side and 2xl05cells on the leftside were implanted subcutaneously. Tumors were treated when they reached 100 mm3: right tumors received local irradiation followed by i.t. AAV injection (5xlO10vg), while left tumors received only local irradiation.

[0365] For the lung metastatic model, tumor burden was monitored by in vivo bioimaging using the IVIS Spectrum Imaging system (PerkinElmer, USA). Three days after the primary tumor inoculation (s.c), 2xl05B16-Luciferase or B16 tumor cells were inoculated intravenously. When s.c. tumors reached 100mm3, they were treated with local radiotherapy followed by i.t. AAV-cGFP (5xlO10vg). For the antitumor effect, luciferase expression was measured every 2 / 3 days until the end of the experiment.

[0366] Hemogram and biochemical blood analysis

[0367] Blood samples from tumor-bearing mice were collected in tubes with 0.5% heparin (Mayne Pharma) at indicated time points. Hemograms were analyzed using the Drew Scientific HemaVet Hematology Analyzer (CDC Technologies) following the manufacturer's recommendations. For biochemical analysis, serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) and creatinine (CRE) were measured using an automatic biochemical analyzer (Cobas C711). Mice were euthanized fifteen days after treatment and lungs, spleen, kidneys, intestine, and liver were harvested for cell infiltration analysis. AAV biodistribution analysis

[0368] On day 12 after tumor inoculation, MC38 tumor-bearing mice received local radiotherapy (8Gy) followed by AAV-iLuc or AAV-cLuc (5xl010vg / mouse) injection. Five days after treatment, in vivo imaging was performed. Forthe intravenous biodistribution study, bilateral MC-38 tumor-bearing mice received different doses of radiation (0, 8, or 20 Gy) in the right tumors followed by intravenous injection of AAV-iLuc (lxlO11vg / mouse). Bioluminescence was measured two days aftertreatment. To examine the effect of tumor radiation in the dualflank antitumor model, MC38 tumor-bearing mice received 8Gy in the right tumor, followed by a single injection of AAV-iLuc (5xl010vg / mouse). Three days later, the left tumors received 8Gy. In vivo bioluminescence was analyzed on days 1, 4, 10, and 15 after treatment. In vivo imaging was performed upon i.p. D-luciferin injection (20 mg / mL) as substrate and visualized using the IVIS Spectrum Imaging System (PerkinElmer). Regions of interest (ROIs) were quantified as average radiance (ph / s / cm2 / sr) represented as color-scaled images superposed on grayscale photos of mice using Living Image software (Caliper Life Sciences).

[0369] To evaluate the presence of viral particles in tumors, ITR2 DNA sequence copies were determined by Real-Time PCR two days after treatment. Tumors were mechanically disrupted and DNA extraction was performed using the Macherey Nagel NucleoSpin Tissue® kit (Macherey-Nagel, Germany). Real-time PCR analysis was performed in a CFX Connect Real- Time PCR System (Bio-Rad, Hercules, CA, USA) with iQ SYBR Green Supermix (Bio-Rad) using specific primers for AAV ITR2. The actine gene was used to standardize (Fw: 5'-CTA AGG CCA ACC GTG AAG-3' and Rev: 5'-TGC AAA GAT CCA AGG GAG AC-3'). The amount of viral DNA was expressed by the formula 2ACt [ct(Actin) -ct(iTR)], Q being the point at which the fluorescence rises significantly above the background fluorescence.

[0370] For SPECT / CT in vivo biodistribution studies, single photon emission computed tomography (SPECT) scans were acquired in a U-SPECT6 / E-class (MILabs) 30 minutes, 3 and 24 hours post- administration using a UHR-RM collimator and a multi-mouse bed. Two groups of animals were studied depending on the route of virus administration. In the first group,99mTc-AAV8 was administered intravenously through the tail vein (110 pL / ll,8±0,8 MBq). In the second group,99mTc-AAV8 was administered with i.t. injection (40 pL / 3,5±0,3 MBq) in mice bearing control or irradiated tumors. For image acquisition, animals were placed prone on the scanner bed undercontinuous anesthesia with isoflurane (2 % in 100 % Chgas), and a whole-body scan was acquired over30 min. Following the SPECT acquisition, CT scans were performed to obtain anatomical information using a tube setting of 55 kV and 0,33 mA. The SPECT images were reconstructed using the technetium-99m photopeak centered at 140 keV with a 20% energy window width and using a calibration factor to obtain the activity information (M Bq / mL); then, the attenuation correction was performed using the CT attenuation map. Studies were analyzed using PMOD software (PMOD Technologies Ltd., Adliswil, Switzerland). To properly compare all the images, they were corrected with a numerical factor to compe nsate for the radioactive decay of99mTc. After the last image (24 h p.i.), animals were sacrificed and the99mTc signal was ex vivo measured using a gamma counter (Hidex Automatic Gamma Counter, Hidex Oy, Turuk, Finland) calibrated for99mTc to calculate the percentage of injected dose in the tumors and in liver and brain samples (used as reference tissues with and without AAV arrival).

[0371] Multiplex immunofluorescence staining and analysis

[0372] Multiplex immunofluorescence staining and analysis was performed as previously described on a Bond RX autostainer (Abengozar-Muela, 2020; Lopez-Janeiro, 2022). Four-microns-thick FFPE tissue sections were deparaffinized (Bond De Wax, Leica Biosystems) and rehydrated per standard protocols. Antigen retrieval was performed with Bond Epitope Retrieval Solution 1 (ER1, Leica Biosystems) or 2 (ER2, Leica Biosystems, product number AR9640), followed by four sequential cycles of staining with each cycle including a 30-minute combined block and primary antibody incubation (Akoya antibody diluent / block), followed by a secondary HRP - conjugated polymer. Signal amplification was achieved with TSA-Opal fluorophores. Between cycles of staining, tissue sections underwent heat-induced epitope retrieval to remove the primary / secondary-HRP antibody complexes before staining with the next antibody. The primary antibodies and corresponding fluorophores are anti-CD8 (rabbit monoclonal, IgG, clonce D4W2Z, dilution: 1:75, product number: 98941; Cell Signaling) in Opal 570; anti-Foxp3 (rabbit monoclonal, clone D6O8R, dilution: 1:200, product number: 12653; Ce II Signaling) in Opal 780; anti-CD31 (IgG, rabbit monoclonal, clone D8V9E, dilution: 1:100, product number: 77699; Cell Signaling) in Opal 520; and anti-ICAM (IgG, rabbit monoclonal, clone EPR16608, dilution: 1:2000, product number: Abl79707; Abeam) in Opal 620. Nuclei were counterstained with Spectral DAPI (Akoya Biosciences, FP1490) and mounted the stained tissues with ProLong Diamond Antifade mounting medium (Thermo Fisher Scientific). The stained slides were scanned using the PhenoImager™ HT Automated Quantitative Pathology Imaging System (Akoya Biosciences). After image aquisition, unmixing of the spectral libraries was performed with inForm software (Akoya Biosciences). Unmixed images were then imported into the open-source digital pathology software QuPath version 0.4.4 for stitching, cell segmentation and cell phenotyping. Marker expression was used to identify CD8+, FOXP3+, CD31+ ICAM+, and CD31+ ICAM- cells. Total cell counts, cell densities, or cell percentage of each cell population were quantified. Spatial analysis of cell-cell distances were calculated on QuPath software using the Euclidean distances between their centroids. Flow cytometry

[0373] For flow cytometry of cell lines, trypsin was added to the culture, and cells were washed in PBS + 2% FBS + 5 mM EDTA. Where IFNy stimulation is indicated, cells were cultured with 20- 100 ng ml-1 IFNy (Pe proTech). For gene knockout validation, cells were stained for 15 min at 4 °C with indicated conjugated fluorescent monoclonal antibodies to the indicated proteins.

[0374] Tumors and draining lymph nodes were collected 5-6 days after treatment and processed to obtain single-cell suspensions. Tumors were disrupted using the Tumor Dissociation Kit and gentle MACS™ dissociator (Miltenyi Biotec, Germany). The resulting suspensions were filtered through 70 pm-cell strainers (Miltenyi Biotec), centrifugated at 300 g at 42C and resuspended in FACS buffer (1% FBS, 0.5 mM EDTA in Ca2+and Mg2+-free PBS). Dissociated cells were centrifuged with Lymphoprep™ density gradient medium (STEMCELL Technologies, Vancouver, Canada), making a gradient to eliminate parenchymal cells. Lymph nodes and spleens were disrupted mechanically, followed by incubation with collagenase and DNase (Roche) for 30 min at 37°C. Samples were incubated with ACK buffer (Invitrogen, USA) for 5 minutes at room temperature, followed by centrifugation at 400 g at 42C for 5 min. Samples were then stained with Zombie NIR (Biolegend) on ice for 15 minutes. To reduce nonspecific staining, samples were pretreated with Fc-Block (anti-CD16 / 32, eBioscience, USA), followed by staining with mAbs against different markers (referto supplementary table l for a detailed description of the mAbs used) for 30 min on ice in the dark. Cytofix / cytoperm fixation permeabilization kit (BD Bioscience, San Diego, CA) was used forthe analysis of transcription factors. Intracellular staining was performed to detect Granzyme B and IFNy production after T cell stimulation for4 h with 5 ng / ml of PMA (Sigma-Aldrich) and 0.5pg / ml ionomycin calciu m salt (Sigma-Aldrich), two hours in the presence of the protein secretion inhibitors GolgiPlug™ (BD, USA) and GolgiStop (BD). CytoFlex LX cytometer, Cytoflex XS, and Cytoflex DxFIex (Beckman Coulter, High Wycombe, UK) were used for cell acquisition, and data analysis was performed using FlowJo 10 (Tree Star Inc., Ashland, OR, USA).

[0375] Phosphoproteomic analysis

[0376] Sample preparation

[0377] B16 cells were stimulated overnight with IFNy before irradiation (8Gy). Pelletsfrom irradiated or control cells were homogenized in a lysis buffer (8 M urea, 50 mM dithiothreitol (DTT), supplemented with protease (complete Mini, Roche #11836153001) and phosphatase inhibitors (PhosSTOP, Roche #4906845001). Lysates were centrifuged at 20,000 g (1 h, 15 °C), and the resulting supernatant was quantified with the Bradford assay kit (BioRad, Barcelona, Spain). To obtain the phosphorylated peptide sample fraction, 600 pg of protein was separated for protein digestion. Proteins were reduced with DTT (final concentration of 20 mM; room temperature, 30 min), alkylated with iodoacetamide (final concentration of 30 mM; room temperature, 30 min in the dark), diluted to 0.9 M with ABC and digested with trypsin (Promega, Madison, Wl, USA; 1:20 w / w enzyme protein ratio, 18 h, 37 °C). P rotein digestion was interrupted by acidification (pH < 6, acetic acid), and the resulting peptides were cleaned-up using Pierce™ Peptide Desalting Spin Columns (ThermoFisher Sci., Waltham MA, USA). The following phosphorylated peptide enrichment was performed using the High - Select™ TiO2 Phosphopeptide enrichment Kit (ThermoFisher Sci., Waltham, MA, USA) according to the manufacturer's instructions. Finally, the enriched phosphopeptide sample fraction was cleaned- up as described before and dried down in a Speed -Vac system. A 10 pg aliquot of cleaned-up peptidesfrom protein digestion was set aside fortotal protein analyses.

[0378] Data independent acquisition (DIA)-mass spectrometry

[0379] Dried down peptide samples were reconstituted with 2% ACN -0.1% FA (Acetonitrile-Formic acid), spiked with internal retention time peptide standards (iRT, Biognosys), and quantified by NanoDropTM spectrophometer (ThermoFisher Sci.) prior to LC-MS / MS analysis using an EVOSEP ONE system coupled to an Exploris 480 mass spectrometer (Thermo Fisher Sci.). Peptides were resolved using C18 Performance column (75pm x 15cm, 1.9 pm particles; Evosep) with a predefined Xcalibur WhisperlOO 20 SPD (58min, lonOpticks Aurora Elite, EV1112) method. Peptides were ionized using 1.6 kV spray voltage at a capillary temperature of 275 °C. Sample data were acquired in data-independent acquisition (DIA) mode with full MS scans (scan range: 400 to 900 m / z; resolution: 60,000; maximum injection time: 22 ms; normalized AGC target: 300%) and 24 periodical MS / MS segments applying 20 Th isolation windows (0.5 Th overlap: Resolution: 15000; maximum injection time: 22 ms; norma lized AGC target: 100%). Peptides were fragmented using a normalized HCD collision energy of 30%.

[0380] Bioinformatics and statistical analysis

[0381] Mass spectrometry data files were analyzed using Spectronaut (Biognosys) by direct DIA analysis (dDIA). MS / MS spectra were searched against the Uniprot proteome reference from human database using standard settings. Enzyme was set to trypsin in a specific mode. On the one hand, Carbamidomethyl (C) was set as a fixed modification, and oxidation (M), acetyl (protein N-term), deamidation (N), and Gln-> pyro-Glu as variable modifications for total protein analysis. On the other hand, Carbamidomethyl (C) was setas a fixed modification, and oxidation (M), acetyl (protein N-term), and Phospho (STY) as variable modifications for phospho-proteome analysis. Identifications were filtered by a 1% Q-value. The obtained quantitative data for total protein were exported to Perseus software (version 1.6.15.0) (Tyanova, 2016) for statistical analysis and data visualization. For total protein analysis, unpaired Student'st test was used for direct comparisons. Statistical significance was setat p- value lowerthan 0.05 in all cases and 1% peptide FDR threshold was considered. Differentially expressed proteins were considered significant when their absolute fold change was below 0.77 (downregulated proteins) and above 1.3 (up-regulated proteins) in linear scale. Quantitative data obtained from the phosphoproteome were collapsed using a custom coded plugin Peptide Collapse (v.1.4.4) in Perseus (v.1.6.15.0) that convert a normal Spectronaut report into a site-level report (Martinez-Vai, 2021). Plugin settings were set as default grouping posttranslational modifications (PTMs) by sample (FileName), collapsing matrix by site-level and setting the PTM localization probabilities filter at more than 0.75. Statistical analyses were conducted following the same protocol as the total protein study. Differential (phospho) proteins was analyzed using Metascape (Zhou, 2019) using default settings (min. overlap: 3, min. enrichment: 11.51 , p<0.05), and false discovery rate (FDR) adjusted p<0.05. Specifically, for signature (phospho) proteins, Reactome database was used under the same statistical significance cut-off. Functional protein association networks were generated using STRING (Szklarczyk, 2017). Mass-spectrometry data and search results files were deposited in the Proteome Xchange Consortium via the JPOST partner repository (https: / / repository.jpostdb.org) (Okuda, 2017) with the identifiers PXD056537 for ProteomeXchange and JPST003410 for jPOST .

[0382] Histological analysis

[0383] All tissue samples were harvested, fixed in 4% formaldehyde (PanReac AppliChem) for 48 h, and then in 70% ethanol until being embedded in paraffin blocks. Subcutaneous tumor samples were incubated overnight at 42C with anti-GFP (Abeam). After rinsing in TBS-T, they were incubated with goat anti-rabbit labeled polymer EnVisionTM+System (Dako, Glostrup, Denmark) for 30 min at room temperature, and peroxidase activity was revealed using DAB+(Dako). Sections were lightly counterstained with Harris hematoxylin, dehydrated, coverslipped with Eukitt (Labolan), and scanned using a Scanscope CS2 scanner (Leica Biosystem, Wetzlar, Germany). Images were analyzed by outlining tumors and determining the percentage of pixels with intense GFP staining according to "Algoritm9" of Image Scope software (Leica Biosystem). Forhistopathological analysis of lung metastatic tumors, lugs were harvested ten days after treatment, fixed, and included in paraffin blocks as previously described. Sections were stained with Hematoxylin and Eosin and scanned using a CS2 Aperio scanner (Leica Biosystem).

[0384] RNA-seq of and data analysis

[0385] For transcriptomic studies of tumor cells, single-cell suspensions from B16 tumors taken 5 days after treatment were stained with antibodies against CD45 and CD31 and Zombie Nir staining. CD45- CD31- cells were sorted in a MoFlo Astrios-EQ cell sorter (Beckman Coulter). RNA was extracted from cell pellets using the Qiagen RNeasy Mini kit according to the manufacturer's instructions. RNA was subjected to quantity and quality control using Qubit HS RNA Assay Kit (Thermo Fisher Scientific) and 4200 Tapestation with High Sensitivity RNA ScreenTape (Agilent Technologies). All RNA samples were high-quality, with RIN values higher than 8. Library preparation was performed using the Illumina Stranded mRNA Prep Ligation kit (Illumina) following the manufacturer's protocol. All sequencing libraries were constructed from 50 ng of total RNA according to the manufacturer's instruction. Briefly, the protocol selects and purifies poly(A) containing RNA molecules using magnetic beads coated with poly(T) oligos. Poly(A)-RNAs are fragmented and reverse transcribed into first cDNA strand using random primers. The second cDNA strand is synthesized in the presence of dUTP to ensure strand specificity. Resulting cDNA fragments are purified with AMPure XP beads (Beckman Coulter), adenylated at 3' ends and then ligated with uniquely indexed sequencing adapters. Ligated fragments are purified and PCR amplified to obtain the final libraries. The quality and quantity of the libraries were verified using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) and 4200 Tapestation with High Sensitivity D1000 ScreenTape (Agilent Technologies). Libraries were then sequenced using a NextSeq2000 sequencer(lllumina). 20- 30 million pair-end reads (100 bp; Rdl:51; Rd2:51) were sequenced for each sample and demultiplexed using bcl2fastq. RNAseq was carried out at the Genomics Unit of Cl MA- Universidad de Navarra.

[0386] RNA sequencing data analysis was performed using the following workflow: (1) the quality of the samples was verified using FastQC software (https: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) and the trimming of the reads with trimmomatic (Bolger, 2014); (2) alignment against the mouse reference genome (GRCm39) was performed using STAR (Dobin, 2013); (3) gene expression quantification using read counts of exonic gene regions was carried out with featureCounts82; (4) the gene annotation reference was Gencode vM32 (Frankish, 2023); and (5) differential expression statistical analysis was performed using R / Bioconductor ( https: / / www.R-project.org / ). First, gene expression data was normalized with edgeR (Robinson, 2010) and voom (Ritchie, 2015) . After quality assessment and outlier detection using R / Bioconductor, a filtering process was performed. Genes with read counts lowerthan 4 in more than the 50% of the samples of all the studied conditions were considered as not expressed in the experiment under study. LIMMA (Ritchie, 2015) was used to identify the genes with significant differential expression between experimental conditions. Further functional and clustering analyses and graphical representations were performed using R / Bioconductor and clusterProfiler (Wu T. H., 2021). Single cell RNA-seq and data analysis

[0387] For scRNAseq studies, single-cell suspensionsfrom tumors taken 6 days aftertreatment were stained with Zombie Nir and CD45. Viable CD45+cells were sorted in a MoFlo Astrios-EQ cell sorter (Beckman Coulter). Droplet-based isolation of single cells was performed with the Chromium Controller (lOx Genomics). Subsequent generation of 3' sequencing libraries was performed per the manufacturer's instructions (lOx Genomics). Briefly, 17000 to 20000 cells were loaded at a concentration of 1000 cells / pL on a Chromium X instrument (10X Genomics) to capture single cells in gel bead -in-emulsions (GEMs). In th is step, each cell was encapsulated with primers containing a fixed Illumina Read 1 sequence, a cell-identifying 16 nt 10X barcode, a 12 nt Unique Molecular Identifier (UMI) and a poly-dT sequence. Upon cell lysis, reverse transcription yielded full-length, barcoded cDNA. This cDNA was then released from the GEMs, PCR-amplified and purified with magnetic beads (SPRIselect, Beckman Coulter). Enzymatic Fragmentation and Size Selection was used to optimize cDNA size prior to library construction. Fragmented cDNA was then end-repaired, A-tailed and ligated to Illumina adaptors. A final PCR-amplification with barcoded primers allowed sample indexing. Library quality control and quantification was performed using Qubit 3.0 Fluorometer (Life Technologies) and Agilent's 4200 TapeStation System (Agilent), respectively. Sequencing was performed in a NextSeq2000 (Illumina) using paired-end 91-base pair reads.

[0388] Raw sequencing data were demultiplexed with bcl2fastq v2.20.0 and, aligned and quantified using lOx Genomics Cell Ranger v7.1.0 [9] and mmlO reference (2020-A) downloaded from the 10x Genomics website. Downstream quality control, filtering, normalization, and analysis were performed using Scanpy (vl.9.3). Cells with mitochondrial gene contentexceeding 10%, with less than 200 detected genes, or with greaterthan 2,500 detected genes were removed from the dataset. Genes not recovered in at least 1 of the remaining cells were also removed from the dataset. Doublets were computationally predicted and removed using the built-in Scanpy Scrublet function. Raw counts were then normalized to 100,000 and log -transformed with a pseudo-count of 1. Manifold Approximation and Projection (UMAP) plots were generated using the built-in Scanpy Principal Component Analysis (PCA) and nearest neighbor graph functions on the top 10,000 highly variable genes. To minimize technical batch effects, embeddings were corrected using Harmony (Korsunsky, 2019). Cells were then grouped into 29 distinct clusters using the Leiden algorithm. Cluster-level analysis revealed three clusters composed mostly of cells with high predicted doubletscores, so these cells were also removed from the data. The final collection of cells (n=45,958) was then re -embedded, corrected, and grouped into 26 distinct clusters using the Leiden algorithm. Cluster density ("galaxy") plots depict a downsampled quantity of cells to ensure equal representation across treatment groups (n=22,731 / group). Sub-clustering was performed on T and NK cells (defined as cells in clusters differentially expressing Cd8a, Cd4, or Ncrl transcripts based on the built-in Scanpy cluster vs. rest gene expression function). After sub-clustering, new PCA and UMAP embeddings, nearest neighborhood graphs, and Harmony batch corrections were calculated on a new set of 10,000 highly variable genes. T and NK cells (n=7,635) were then grouped into 17 distinct clusters using the Leiden algorithm. Cluster density ("galaxy") plots depict a downsampled quantity of cells to ensure equal representation across treatment groups (n=2,635 / group). Differentially expressed genes between clusters were calculated using a logistic regression model (Ntranos, 2019). To perform GSEA, ranked lists of differential genes were created using signed p-valuescalculated by the logistic regression model and passed to GSEA Preranked using GSEApy library (vl.0.4) in Python (Fang et al. 2023) to search for enriched gene sets (Liberzon etal. 2015). Data are publicly available in GEO database with the accession number GSE280079.

[0389] Cytokine determination

[0390] Blood samples were incubated for 15-30 min at room temperature and centrifuged at 2000 g for 10 min at 42C. 3 or 7 days after treatment, tumors and blood samples were collected Tumors were homogenized by mechanic disruption in PBS buffer with Complete Protease Inhibitors and incubated 15 min on ice. Tumors were weighted and homogenized in 4 volumes of ice-cold RIPA buffer (150 mM NaCI, 50 mM Tris-HCI pH8, 0.1 % SDS, 1% Triton X- 100, 1 mM EDTA, 1 mM Sodium Ortovanadate and protease inhibitor cocktail) using a Heidolph RZR-1 homogenizer. After sitting on ice for at least 15 min, samples were sonicated for 5 min (10 sec on / 10 sec off) in a cool-bath Diagenode Bioruptor Sonication system (UCD- 200TM-EX, Tosho Denki Co. LTD). Samples were then centrifuged at 16000 g at 42C for 40 min. Protein was determined by the BCA method (Pierce BCA Protein Assay Kit). All samples were stored at -802C until used. I FIXip levels were measured using a VeriKine™ Mouse Interferon Alpha ELISA Kit (PBL Assay Science, Piscataway, NJ) following the manufacturer's recommendations. Single determinations of IL-12 and I FNy levels were carried out with BD OptEIA Mouse IL- 12 (p70) and BD OptEIA Mouse IFNy (BD Biosciences) ELISA sets, respectively. For multiple determinations, Mouse Luminex Discovery Assay (R&D Systems, catalog number: LXSAMSM) was used to measure IL- 12 792 (p70), IFNy, TNF-ct, CXCL10, CXCL16, GM-CSF, and IL- 12 p70, in tumor homogenates according to the manufacturer's instructions. Data were collected by using the Magpix instrument (LuminexCorp. Austin, TX) and expressed in pg / mL. Samples in which beads count was below 50 events per cytokine were excluded for further analysis.

[0391] Statistical analysis

[0392] GraphPad Prism version 8.2 software (GraphPad Software, Inc.) was used for statistical analysis. Shapiro-Wilk test was used to confirm normal distribution of the data before the use of parametric tests. Data were analyzed by unpaired two-way Student's t-test, one-way or two-way ANOVA followed by Tukey's multiple comparisons as indicated in the figure legends. Kaplan-Meier curves were analyzed by log-rank test.

[0393] Example 1: RT enhances AAV-mediated tumor transduction both in vitro and in vivo

[0394] To analyze the influence of RT on AAV-mediated tumor transduction, the transduction efficiency of AAV in irradiated tumor cells in vitro was first assessed. Tumor cells were irradiated (8Gy) immediately before transduction with an AAV vector (AAV8 serotype) encoding the fluorescence protein GFP under the control of the constitute promoter CAG (AAV-cGFP). The percentage of GFP-expressing cells was consistently higher in the irradiated condition at the tested MOIs in both mouse and human cell lines (Figure 1A-B and Figure 8A). Although transgene expression decreased progressively due to cell proliferation and vector dilution, GFP+cells were detected for more than 10 days after infection in irradiated cells. Moreover, the level of expression of GFP per cell was significantly higher among transduced cells in the irradiated conditions (Figure 1C and Figure 8B). This phenomenon was observed in a dose-dependent manner, as increasing RT doses correlated with higher levels of GFP expression (Figure ID), an effectthat was progressively lost when radiation and AAV-mediated transduction were delayed (Figure 8 C). The effectof radiation was not serotype-specificand similar results were obtained with AAV5 and AAV9 serotypes (Figure 8D). This phenomenon was related to AAV biology as it was not observed with other non-viral vectors such as mRNA lipid nanoparticles (Figure 8E). Celltransduction was entirely blocked in cells deficient in AAVR, a transmembrane protein essentialfor efficient intracellular transport of multiple AAV serotypes including AAV8 (Pillay, 2016), ruling out alternative trafficking routestriggered by RT (Figure 8F). The inventors did not observe differences in numbers of vector genomes (vg) between conditions (Figure IE) suggesting that RT enhanced transgene expression without significantly affecting the entrance of the vector into the cell.

[0395] Radiation triggers DNA damage responses (DDR) which have been associated with AAV cycle, shown to promote the synthesis of complementary DNA strand and circularization which are required for efficient viral transduction and persistence (Choi, 2006; Peng, 2000; Schwartz, 2009). To test the role of DDR in radiation-enhanced transduction, the inventors first compared the transduction efficacy of single-stranded (ss) and double-stranded (or self- complementary, ds) AAVs. The effect of IR was comparable in both ssAAV and dsAAV (Figure 8G) indicating that RT promote alternative mechanisms to enhance AAV-mediated transduction.

[0396] To get insight into the biological processes activated by cell irradiation that could explain enhanced AAV-mediated transduction, the inventors analyzed the phosphoproteome of B16 cells 48h after RT. As previously reported (Peitzsch, 2016; Belli, 2020), epigenetic regulation and chromatin remodeling, including histone and DNA modification enzymes (EZH2, HDAC2, CBP, KDM7A, KAT6A) and SWI / SNF complex members (ARID1A, ARID1B, PBRM1, SMARCA4 and SMARCC1) were found among the main pathways altered by cell irradiation (Figure 9A- B). Notably, recent studies have reported that transduction efficiency is related to epigenetic modifications of AAV episomes (primarily circularized dsDNA) which can form chromatin-like structures similarly to genomic DNA (Gonzalez-Sandoval, 2023; Loeb, 2024; Pekrun, 2024; Penaud-Budloo, 2008; Chanda, 2017). In particular, AAV-DNA demethylation and enrichment in the histone modification H3K27ac have been linked with active transgene expression (Gonzalez-Sandoval, 2023). Thus, the inventors interrogated the implication of epigenetic regulation in prompting AAV-transduction upon irradiation of tumor cells. In cells transduced upon RT, AAV ITR regions exhibited a significant reduction of methylation (Figure 9C) and increased association with activating histone mark H3K27ac on the constitutive CAG promoter (Figure IF). Importantly, selective inhibition of histone acetyl transferases (HAT) p300 / CBP with A-485 (Lasko, 2011) resulted in a significant reduction of AAV transgene expression in irradiated cells (Figure 1G). In line with these findings, we observed an increased binding to the vector genome upon radiation of YY1 (Figure 1H), a transcription factor with a wide range of functionalities, including cell growth, proliferation and DNA repair that can regulate gene expression through direct interaction with p300 / CBP. Mutation of two single nucleotides in YYl-binding motif partially reduced the effects of RT on AAV transduction, comparable to the levels observed with HATinhibition (Figure 1G and II). Collectively, these findings indicate that epigenetic modification is a key mechanism underlying the stimulatory effect of RT on AAV-mediated transduction.

[0397] Next, the effects of RT in modulating AAV-mediated tumortransduction in vivo were analyzed. For that we first evaluated AAV biodistribution upon intratumor (i.t.) injection by measuring the presence of capsid and viral genomes in tumors with or without prior RT and several organs. AAV capsids were labelled with technetium-99m (Tc-99m) and analyzed by singlephoton emission computed tomography / computed tomography (SPECT / CT) scan. 3h after i.t. injection, capsids were detected almost exclusively within the tumors as opposed to intravenous delivery that reflects a strong tropism of AAV8 for the liver (Figure 10A). To carefully compare irradiated and control conditions, tumors were excised and analyzed ex vivo at 24h. Tumor irradiation favored capsid retention 24h after vector administration (Figure 10B) although no significant differences were observed in viral genomes between conditions 48h after i.t. delivery of AAV (Figure 10C).

[0398] Finally, the inventors measured AAV transgene expression in control or RT-treated tumors in vivo. For that, we implanted MC38 (mouse) or RT112 (human) cells into wild-type (WT) or immunodeficient NSG mice, respectively. Established tumors were locally irradiated 8 or 20Gy before i.t. injection of AAV-cGFP. RT enhanced transduction of tumors as observed by GFP- expressing cells 48h after AAV delivery (Figures II -J and 10D-E). In summary, local irradiation primes tumors for enhanced AAV transduction highlighting a synergistic interplay that can be exploited for cancer therapy.

[0399] Example 2: Design of an AAV vector enabling selective transgene expression in irradiated tumors

[0400] Leveraging the ability of IR to enhance AAV-mediated tumor transduction, the inventors developed a cancer therapy based on the combination of RT and local AAV-based immunogene therapy. To this aim, the inventors designed an AAV vector that efficiently transduces irradiated tumors and increases local expression of immunostimulatory payload while minimizing its systemic release (Figure 2A). First, the inventors controlled transgene expression with an inducible promoter containing IFN -stimulated response elements (ISRE) as IR causes DNA damage triggering the production of type-1 IFN through the cGAS-STING pathway (Deng, 2014; Burnette, 2011). In addition, AAV8 is highly hepatotropic and a significant amount of vector genomes were found in the liver after i.t. administration of the AAVs (Figure 10C). Therefore, the inventors equipped the vector genome with binding sites for the liver-specific miR122 to block transgene expression in hepatocytes (Qiao, 2011).

[0401] To test the robustness of the system we performed an in vitro bioluminescence imaging (BLI) assay. Tumor cells were transduced with an AAV expressingfirefly luciferase underthe control of the I FN-inducible promoter (AAV-iLuc) at high MOI to ensure similartransduction efficiency (data not shown). As predicted, luciferase expression was triggered upon IFN stimulation. Interestingly, IR was sufficient to induce transgene expression with the inducible promoter, although this effect was reduced compared to the observed with the constitutive promoter CAG (AAV-cLuc) (Figure 2B). However, IFN stimulation caused a marked induction of transgene expression in irradiated cells. As expected, the addition of IFN had no effects on cells transduced with AAV-cLuc (Figure 2B).

[0402] Next, the inventors assessed the performance of the inducible promoter in vivo. BLI analysis showed that i.t. administration of I FN -ind ucible AAV-iLuc resulted in a localized luciferase expression restricted to the tumor tissue. Conversely, mice inoculated i.t. with AAV -cLuc displayed a systemic transgene expression (Figure 2C). As observed in previous experiments, RT enhanced transduction of tumors inoculated with AAV-iLuc or AAV-iGFP (Figure 2D and 11A). Of note, the expression of the transgene was restricted to irradiated tumors even upon systemic administration of AAV-iLuc in mice with tumors in both flanks (Figure 2E). Local injection of AAV-iLuc into irradiated tumors resulted in prolonged transgene expression, with increasing levels of luciferase activity (Figure 2F). Importantly, we did not observe activation of transgene expression in distal untreated tumors (no AAV) that received RT three days after intratumor inoculation of tumors injected with AAV-iLuc (Figure 2F).

[0403] Example 3: AAV-based cytokine delivery for cancer immunotherapy

[0404] The inventors then sought to engage tumor irradiation with antitumor immunity by using immuno-gene therapy to demonstrate the potential of an AAV-based platform for immunotherapy of cancer. Based on the expression profile achieved with the IFN -inducible promoter, we generated a series of AAV vectors equipped to deliver immunostimulatory cytokines into irradiated tumors. In particular, we generated vectors encoding for single chain IL-12p70 (AAV-HL12), IL-15 and IL-15Rct, FLT3L (SEQ ID NO.: 43) and a bicistronic construct containing both IL- 12 and I L-15 / 1 L-15Rct separated by a self-cleaving peptide P2A in a single expression cassette (Figure 3A). In all cases, cytokine expression was significantly enhanced by tumor radiation both in vitro and in vivo (Figure 3B-C). As described above, unwanted transduction of the liver and systemic cytokine release was inhibited by miR122 binding sites, which proved to be highly effective even upon intravenous administration of the vector (Figure 11B). To demonstrate the biological activity of AAV-based cytokine delivery, we first analyzed changes within the TME. AAV-mediated expression of IL- 12, 1 L15 / I L-15Rct or FLT3L in irradiated tumors increased infiltration of CD8+T cells, NK and dendritic cells (DC) respectively (Figure 3D). Next, we explored potential antitumor activity of the AAV-mediated cytokine expression in combination with RT. Expression of I L-15 / 1 L-15Rct or FLT3L had no impact on tumor growth (Figure 3E). Both IL12-encoding vectors induced a marked antitumor control and were well tolerated (Figure 3E and 11C). Importantly, inducible expression of IL- 12 maintained a long-term antitumor efficacy without evident signs of toxicity. On the contrary, an AAV expressing IL-12 under the control of the constitutive promoter CAG (AAV-clL12) caused a dramatic weight loss in treated animals (Figure 11D-E). Finally, we confirmed that the I FN-inducible vector exhibited a highly selective local transgene expression compared to the constitutive vector by measuring intratumoral and systemic IL- 12 levels (Figure 11F). Altogether, these findings demonstrate that AAV containing an I FN-inducible promoter achieves spatial control of transgene expression into irradiated tumors and can be exploited as an efficient immunogene therapy forcancer.

[0405] Example 4: Combination of RT and AAV-based IL- 12 delivery eradicates tumors without systemic toxicity

[0406] The inventors next determined the tumor levels of IL-12 achieved by the I FN-inducible system at different radiation and vector doses to optimally design an AAV-based immunogene therapy for cancer in combination with RT. To this aim, MC38 cells were subcutaneously inoculated into C57BL / 6 mice. Tumors of ~100 mm3in volume were locally irradiated with 0, 8, or 20 Gy, followed by i.t. injection with lxlO10or 5xlO10vg of AAV-ilL12. The inventors observed a dose dependent effect for both parameters, as intratumor levels of IL-12 correlated with radiation and viral doses, analyzed 3 days after treatment administration (Figure 12A). To determine the therapeutic potential of local RT and AAV-mediated delivery of IL- 12, the inventors tested its efficacy in several subcutaneous and orthotopic tumor models. RT in combination with a control AAV (AAV-iLuc) had minimal effects in MC38 (colorectal carcinoma), B16 (melanoma), LLC (lung adenocarcinoma), MB49 (bladder cancer) and KPC(pancreatic cancer) tumor-bearinganimals (Figure 4A-D and 12B-E). Local injection of AAV-HL12 showed a significant reduction of tumor growth in all tumor models, although it led to complete tumor rejection in only a small fraction of the animals. However, administration of AAV-ilL12 into irradiated tumors resulted in complete tumor cleara nce in all MC38 tumorbearing mice, ~80% of the animals in KPC and MB49 models and 33% in the aggressive LLC lung adenocarcinoma model. Moreover, a strong antitumor effect was observed even when treatment onset was delayed until tumor reached 400mm3(Figure 12 F). The antitumor effects of RT + AAV-HL12 were dependent on the immune system (Figure 12G) and were able to generate immune memory (Figure 12H). In the B16 melanoma model, although no tumor rejection was achieved at these doses, the combination of RT and AAV-HL12 induced a robust tumor growth inhibition that was sustained during the entire duration of the experiment resulting in a substantial increase in overall survival (Figure 4B and 12C). In this model, the inventors' strategy synergized with immune checkpoint blockade (ICB) and addition of anti- PD-1 or CTLA-4 antibodies exhibited enhanced antitumor responses (Figure 121). In addition, local administration of AAV-HL12 after RT significantly increased the survival of treated mice in a non-curable orthotopic model of glioblastoma (Figure 3E). Finally, the inventors tested the combinatorial strategy in a translational model using MHC-I and MHC-II double KO NSG (MHC-dKO NSG) immunodeficient mice reconstituted with human PBMCs (Eguren- Santamaria, 2024). For that, the inventors used an AAV containing the I FN -ind ucible vector with human IL-12 (AAV-ihlL12). Intratumor injection of AAV-ihlL12 in irradiated tumors achieved superiorantitumor responses compared to control AAV (AAV-iLuc) in RT-122-bearing humanized mice (Figure 4F).

[0407] The antitumor responses correlated with AAV-mediated production of IL-12 within the tumors, which peaked at day 3 after treatment and remained detectable at least one week (Figure 4G). The decrease of transgene expression observed between day 3 and 7 was likely due to the tumor regression caused by the therapy and the associated loss of AAV -transduced cells as no transgene expression was observed in previous BLI assays (Figure 2F). Importantly, elevated levels of local IL-12 were followed by a moderate increase in serum that declined over time (Figure 4H). No remarkable changes were detected in serum levels of IFNy, transaminases or blood parameters (Figure 13A-C). Likewise, no tissue damage was detected in lung, intestine, kidney, liver or spleen (Figure 13D). Collectively, these data demonstrate that the combination of RT with AAV-mediated inducible delivery of IL-12 is a safe strategy able to activate potent antitumor immunity in a variety of preclinical tumor models.

[0408] Example 5: Combination of RT and AAV-HL12 induces tumor T cell infiltration

[0409] To gain insight into the immune mechanisms resulting in therapeutic activity of RT+AAV-HL12, the inventors first conducted multiparametric immunofluorescence in tumors collected 6 days after treatment. B16 tumors exhibit an immune-excluded phenotype that can explain their limited response to immunotherapies (Ghasemi, 2024). Indeed, even upon RT, B16 tumors showed negligible CD8+T cell infiltration (Figure 5A). However, local administration of AAV - ilL12 triggered a strong recruitment of CD8+T cells within the tumors, being significantly higher in tumors receiving AAV-HL12 after radiation (Figure 5A) which correlated with elevated levels of IL- 12 (Figure 4G). Although no significant changes in total CD31+endothelial cells were observed (Figure 14A), tumors treated with AAV-HL12 showed greater expression of integrin ICAM1 by endothelial cells resulting in increased interaction with CD8+T cells (Figure 5A) thereby facilitating lymphocyte extravasation and tumor infiltration. The inventors next analyzed immune mediators and chemoattractant factors in B16 tumor extracts 6 days after treatment. RT was unable to elicit relevant changes in proinflammatory cytokines when combined with a control AAV (AAV-iLuc). However, treatment with AAV-HL12 into irradiated tumors triggered the expression of I FNy, an immune effector of the IL-12 cascade, together with TNFot, GM-CSF and I FN -ind ucible chemokines such as CXCL10 and CXCL16 (Figure 5B). This surge in pro-inflammatory cytokines aligned with the strong CD8+T cell infiltration observed in treated tumors.

[0410] Example 6: The antitumor effect of RT and AAV-HL12 is IFNy-dependent and Fas-mediated

[0411] The inventors next investigated the contribution of different immune cell populations to the therapeutic effect of RT + AAV-HL12 using cell population-specific depleting antibodies and transgenic mouse models. Surprisingly, despite the dense T cell infiltration observed upon treatment, depletion with CD8-targetting antibodies did not abrogate the therapeutic activity of the combination treatment with RT + AAV-HL12 (Figure 5C). Similarly, antitumor responses were observed in NK-depleted animals. However, depletion of both CD8 T cells and NK cells completely abrogated the efficacy of the therapy in mice whose tumors received RT + AAV- ilL12. A partial reduction in treatment efficacy was observed in groups depleted of macrophage (CSFR1) and neutrophils (Ly6G) (Figure 5C). Consistent with the antitumor responsesobserved in absence of CD8+T cells, the combination of RT with AAV-HL12 elicited tumor regression in Bot / 3-deficient mice (Figure 5D) which lack cross-presenting dendritic cells (DC), essential for cytotoxic T cell responses (Hildner, 2008), and have shown resistance to other cytokine-based immunotherapies (Ghasemi, 2024; Santollani, 2024) . Accordingly, Prfl f- treated mice had similar antitumor responses compared to C57BL / 6 mice (Figure 5E), suggesting that direct anti-tumor cell cytotoxicity is dispensable forthe therapeutic effect of RT + AAV-ilL12. CD8+T cells and NK cells are not only direct killers of tumor cells but also constitute the main source of I FNy, an immune effector molecule induced by IL-12, which elicits multiple immune functions and is essential in tumor immunity (Shankaran, 2001; Ayers, 2017). Indeed, blockade of I FNy completely abolished the antitumor responses elicited by RT and local delivery of AAV-ilL12 (Figure 5F). Even though transgene expression is controlled by an I FN -ind ucible promoter, neutralization of IFNy was not associated with a complete abrogation of IL- 12 production by AAV-transduced cells. Intratumor IL- 12 values at day 3 in mice treated with IFNy-blockingantibodies were comparable tothose observed afterinjecting AAV-HL12 into non-irradiated tumors (Figure 14B).

[0412] Next, the inventors treated subcutaneous B16 tumors with RT followed by local injection of AAV-iLuc or AAV-HL12 and 3 days later sorted tumor cells for RNA sequencing (RNA-seq). This comparison revealed a marked downregulation of hallmarks of cell proliferation and DNA repair suggesting a reinforcement of direct antitumor effects of RT (Figures 14C-D). This was accompanied by enhanced expression of genes involved in response to IFNy, antigen processing and presentation and macroautophagy which are important for immune- mediated antitumor effects. Given the direct effects that IFNy displays on cancer cells, malignant cells can acquire loss-of-function mutations in the signaling pathway of IFNy and antigen presentation machinery, both of which have been associated with resistance to immunotherapy (Zaretsky, 2016; Gao, 2016; Sade-Feldman, 2017). To explore the potential impact of abrogating cancer-cell responsiveness to IFNy in antitumor responses observed in animals treated with RT + AAV-HL12, the inventors tested the combination therapy in mice bearing Ifngrl- and Jo / cl-null B16 tumors (Figure 5G). Despite the strong IFN-sensingsignature observed in the tumor cells, the antitumor effects of the RT + AAV-HL12 remained intact in IFN signaling-deficient cells. Moreover, treatment with RT + AAV-HL12 was also effective in B16 tumors lacking antigen presentation through MHC class I complex (Figure 14E), a process regulated by IFN. The inventors reasoned that antigen-independent mechanisms could drive the immune responses elicited by treatment. Indeed, we observed strong expression of Fas in tumors treated with RT + AAV-HL12 (Figure 14F) and increased presence of FasL+CD8+T and NK cells (Figure 14G). Functionally, FasL blockade completely suppressed the antitumor effect of RT + AAV-HL12 indicating a predominant role of Fas-FasLin the antitumor responses elicited by treatment (Figure 5H).

[0413] Altogether, our data indicate the response induced by AAV-mediated local delivery of IL-12 depends on immune-related effects of IFNy and Fas-mediated tumor cytotoxicity and can overcome mechanisms of resistance to immunotherapy.

[0414] Example 7: Combination of RT and AAV-ilL12 reshapes the immune composition of the TME

[0415] To better understand the cellular mechanisms accounting for the antitumor responses the inventors studied the immunological landscape in B16 tumors treated with RT in combination with AAV control (AAV-iLuc) or AAV-HL12 collected six days after treatment. Flow cytometry analyses of the TME showed a marked inflammatory phenotype in tumors treated with RT + AAV-HL12 with an increase of total immune cells (CD45+), and significantly increased proportions of CD8+T cells, pro-inflammatory tumor-associated macrophages (TAM1) and MHCH-expressing myeloid cells (Figure 15A). Compared to control groups, AAV-ilL12-treated tumors had significantly decreased proportions of regulatory CD4 T cells (Treg), NK cells, antiinflammatory macrophages (TAM2) and tumor-associated neutrophils (TAN). Single-cell RNA- seq (scRNA-seq) of tumor-infiltrating CD45+immune cells confirmed the rewiring of the TME with a strong repolarization of the myeloid compartment in tumors treated with AAV-HL12 (Figure 6A-B). AAV-based delivery of IL- 12 altered the phenotype and proportions of myeloid subsets, with higher frequencies in pro-inflammatory monocytes and Ml macrophages and decreased presence of suppressive populations such as myeloid -derived suppressor cells (MDSC) or M2 (Figures 6A-B) compared to control tumors. Gene set enrichment analysis (GSEA) performed in the bulk myeloid populations showed enhanced expression of hallmarks associated with response to type I and II IFNs, suggesting a role of these cytokines in the shift observed in AAV-ilL12-treated tumors (Figure 6C). Consequently, tumor-infiltrating myeloid cells expressed higher levels of Ccl5, Cxcl9 and CxcIlO chemokines (Figure 15B), which are potentT cell chemo-attractants and required forantitumor immune responses (Dangaj, 2019; Chow, 2019). In addition, treatment with AAV-ilL12 increased migration of DC from tumors to tumor-draining lymph nodes (Figure 6A-B and 15C).

[0416] Based on the predominant role of I FNy in the therapeutic activity of the RT + AAV-HL12 the inventors next interrogated T cells and NK cells lineages in more depth. The inventors identified several subpopulations of T and NK cells, including six distinct subsets of CD8+T cells representing a range of phenotypes from resting to exhausted (Figures 6D and 12D). A comparison between the two treatment conditions revealed higher proportions of proliferative (Mki67+), effector (lfng+, Gzmb+and Prfl+) and stem-like exhausted CD8+T cells (Tcfl+, Pdcdl+) accompanied by fewer resting (Sell+and Tcf7+) and terminally exhausted (Tox+, Pdcdl+and Havcr2+) CD8+T cells in the RT + AAV-ilL12-treated condition (Figures 6D-E and 15D). Additionally, NK cells from tumors treated with RT + AAV-HL12 exhibited proliferative and effector phenotypes in sharp contrast with the resting phenotype observed in NK from control tumors (Figures 6D-E and 15D). Moreover, combined expression score for gene sets of effector signature, cytolytic activity, and IFN response on T and NK clusters were significantly increased in the AAV-ilL12-treated condition (Figure 6F). Accordingly, we found higher production of I FNy and TNFot in tumor-infiltrating CD8+T cells from AAV-ilL12-treated tumors, as well as an IL12-dependent expansion of TRP2 tumor-specific CD8+T cells (Figure 15 E).

[0417] Collectively, these data reveal that the combination of RT and local administration of AAV - ilL12 promotes an intense rewiring of the TME, with pro-inflammatory myeloid populations that supports CD8 T cell and NK-mediated effector functions in a cooperative manner.

[0418] Example 8: Local treatment with RT and AAV-HL12 promotes systemic antitumor immunity

[0419] The inventors next asked whetherthe activation of local antitumor responses with RT+AAV- ilL12 therapy could lead to systemic immunity with abscopal effects and prevention of metastasis.

[0420] For that, MC38 or B16 tumors were inoculated on both flanks of the mice. Right tumors were treated with RT plus either control AAV-iLuc or AAV-ilL12 and responded to the therapy as observed before (Figure 7A-B). In these settings, the combined therapy elicited a clear abscopal effect on untreated contralateral tumors resulting in increased overall survival (Figure 7B and Figure 16A). In this system with two tumor nodules, the therapeutic effects of RT and AAV-ilL12 combination was enhanced by concomitant radiation of distal noninoculated tumor nodules (Figure 7B and Figure 16A). This means that there is a synergistic effect between treatmentof tumors (a) with the expression system and radiation and tumors (b) only treated with radiation that goes beyond the abscopal effect. These results suggest the involvement of systemic immunity probably enhanced by the increased tumor immunogenicity caused by RT of distal tumors, rather than a potential vector escape, since the inventors do not detect IL- 12 expression in the contralateral (left) tumor (Figure 16B).

[0421] To gain more insight into the mechanisms that explain the abscopal effect observed with the local therapy, the inventors performed multiparametric immunofluorescence of treated (right, RT + AAV) and contralateral (left, with or without RT but no AAV) tumors six days after treatment (Figures 7C-D). Right tumors treated locally with RT and control (AAV-iLuc) or AAV- il L12 vectors had similar levels of infiltration as observed in previous experiments (Figure 5A). However, distal untreated (left) tumors in animals receiving local RT+AAV-ilL12 therapy displayed 8-fold increase in CD8+T cell density (Figures 7C-D). This effect was further increased by local radiation of left tumors (no AAV) which achieved levels of T cell infiltration similar to RT+AAV-ilL12-treated tumors. Consistently, both irradiated and non-irradiated left tumors from mice treated with RT+AAV-ilL12 in primary right tumors had more activated endothelial cells as indicated by levels of ICAM1 expression. No changes in Treg density were observed across conditions (Figure 16C). Moreover, radiation of contralateral tumors notonly increased CD8+T cell numbers but also increased granzyme B (GzB) expression in tumor-infiltrating cytotoxic T cells (Figure 7E).

[0422] Finally, the inventors established a lung metastasis model with engineered B16 cells to express firefly luciferase (B16-Luc cells) that were injected intravenously three days after subcutaneous inoculation of parental B16 cells as primary tumors (Figure 7F). Local RT and AAV-ilL12 injection of primary tumors induced potent antitumor responses in both treated primary tumors and lung metastases where no tumor activity was detected (Figure 7F and 16D). Consequently, overall survival of mice treated with RT + AAV-HL12 was significantly increased as 80% of the animals were able to control both primary and metastatic tumors becoming long-survivors (Figure 7F).

[0423] Taken together, these data indicate that local treatment with RT plus AAV-HL12 not only induces regression of the treated tumor but also triggers systemic immunity that can be amplified by concomitant RT to enhance antitumor responses.

[0424] The antitumor immunity generated by local tumor treatment with RT and AAV-HL12 was able to control tumor growth both locally and systemically.

[0425] A single administration of AAV-HL12 into one tumor nodule was enough to induce robust infiltration of effectorcells (i.e., GzB-i- CD8+ T cells) in treated and distant tumor lesions. These observations might have important consequences for patients with oligometastatic disease.

[0426] RT and AAV-based immunotherapy act synergistically to induce vigorous local and systemic antitumor immune responses culminating in tumor rejection. This treatment constitutes a novel, safe and efficienttherapeutic approach for localized and oligometastatic malignancies, with significant potential for further clinical development.

[0427] REFERENCES

[0428] Abengozar-Muela, M. E.-R. (2020). Diverse immune environments in human lung tuberculosis granulomas assessed by quantitative multiplexed immunofluorescence. Mod. Pathol.(33), 2507-2519.

[0429] Ahn, G.-O. T.-H. (2010). Inhibition of Mac-1 (CDllb / CD18) enhances tumor response to radiation by reducing myeloid cell recruitment. Proc. Natl. Acad. Sci. U. S. A. (107), 8363-8368.

[0430] Allard, B. A. (2020). The adenosine pathway in immuno-oncology. Nat. Rev. Clin. Oncol. (17), 611-629.

[0431] Atkins, M. R. (1997). Phase I evaluation of intravenous recombinant human interleukin 12 in patients with advanced malignancies. Clin. Cancer Res. (3), 409-417.

[0432] Ayers, M. L. (2017). IFN-y-related mRNA profile predicts clinical response to PD-1 blockade. J. Clin. Invest.(127), 2930-2940.

[0433] Barker, H. P. (2015). The tumour microenvironment after radiotherapy: mechanisms of resistance and recurrence. Nat. Rev. Cancer( 15), 409-425.

[0434] Belli, M. a. (2020). Ionizing radiation-induced epigenetic modifications and their relevance to radiation protection. Int. J. Mol. Sci. (21), 5993.

[0435] Bolger, A. L. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics(30), 2114-2120.

[0436] Brown, J. (2020). Radiation damage to tumorvasculature initiates a program that promotes tumor recurrences. Int. J. Radiat. Oncol. Biol. Phys. (108), 734-744.

[0437] Burnette, B. L.-X. (2011). The efficacy of radiotherapy relies upon induction of type i interferon-dependent innate and adaptive immunity. Cancer Res. (71), 2488-2496.

[0438] Chanda, D. H. (2017). Effects of cellular methylation on transgene expression and site- specific integration of adeno associated virus. Genes (Basel)(8), 232.

[0439] Charpentier, M. S. (2022). Radiation therapy-induced remodeling of the tumor immune microenvironment. Semin. Cancer Biol. (86), 737-747.

[0440] Choi, V. M. (2006). Host cell DNA repair pathways in adeno-associated viral genome processing. J. Virol. (80), 10346-10356.

[0441] Chow, M. O. (2019). Intratumoral activity of the CXCR3 chemokine system is required forthe efficacy of anti-PD-1 therapy. I mm unity (50), 1498-1512.e5.

[0442] Citrin, D. (2017). Recent developments in radiotherapy. N. Engl. J. Med. (377), 1065-1075.

[0443] Cohen, J. (1995). IL- 12 deaths: Explanation and a puzzle. Science( 270), 908-908.

[0444] Cytlak, U. D. (2022). Immunomodulation by radiotherapy in tumour control and normal tissue toxicity. Nat. Rev. Immunol. (22), 124-138.

[0445] Dangaj, D. B. (2019). Cooperation between constitutive and inducible chemokines enables T cell engraftment and immune attack in solid tumors. Cancer Cell(35), 885-900.el0.

[0446] De Martino, M. D.-B. (2021). Activin A promotes regulatory T-cell-mediated immunosuppression in irradiated breast cancer. Cancer Immunol. Res. (9), 89-102. Ill

[0447] Deng, L. L.-D. (2014). STING-De pendent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors. Immunity(41), 843-852.

[0448] Dobin, A. D. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics(29), 15-21.

[0449] Eguren-Santamaria, I. F.-M.-B.-V. (2024). MHC class I and Il-deficient humanized mice are suitable tools to test the long-term antitumor efficacy of immune checkpoint inhibitors and T-cell engagers. Cancer( 12), e008516.

[0450] Frankish, A. C.-S. (2023). GENCODE: reference annotation forthe human and mouse genomes in 2023. Nucleic Acids Res. (51), D942-D949.

[0451] Gao, J. S. (2016). Loss of IFN-y pathway genes in tumor cells as a mechanism of resistance to anti-CTLA-4 therapy. Ce / / (167), 397-404.e9.

[0452] Garate-Soraluze, E. M.-S.-M.-R.-R. (2024). Radiotherapy protocols for mouse cancer model. Methods Cell Biol.( 185), 99-113.

[0453] Ghasemi, A. M.-U. (2024). Cytokine-armed dendritic cell progenitors for antigen-agnostic cancer immunotherapy. Nat. Cancer(5), 240-261.

[0454] Gonzalez-Sandoval, A. P. (2023). The AAV capsid can influence the epigenetic marking of rAAV delivered episomal genomes in a species dependent manner. Nat. Commun.(lA-), 2448.

[0455] Hildner, K. E. (2008). Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science^ 322), 1097-1100.

[0456] Huang, R.-X. a.-K. (2020). DNA damage response signaling pathways and targets for radiotherapy sensitization in cancer. Signal Transduct. Target. Ther. (5), 60.

[0457] Jobling, M. M. (2006). Isoform-specific activation of latent transforming growth factor beta (LTGF-beta) by reactive oxygen species. Radiat. Res. (166), 839-848.

[0458] Kalbasi, A. K.-J. (2017). Tumor-derived CCL2 mediates resistance to radiotherapy in pancreatic ductal adenocarcinoma. Clin. Cancer Res. (23), 137-148.

[0459] Kerkar, S. G. (2011). IL- 12 triggers a programmatic change in dysfunctional myeloid-derived cells within mouse tumors. J. Clin. Invest.( 121), 4746-4757.

[0460] Korsunsky, I. M.-R. (2019). Fast, sensitive and accurate integration of single-cell data with Harmony. Nat. Methods(16), 1289-1296.

[0461] Lal, S. L. (2000). An implantable guide-screw system for brain tumor studies in small animals. J. Neurosurg., 326-333.

[0462] Lasek. (2014). Cancer Immunol. Immunother.(63), 419 ff.

[0463] Lasko, L. J. (2011). Discovery of a selective catalytic p300 / CBP inhibitor that targets lineage - specific tumours. Nature^ 550), 128-132.

[0464] Lee, Y. A. (2009). Therapeutic effects of ablative radiation on local tumor require CD8+ . Blood( 114), 589-595.

[0465] Lenzi, R. E. (2007). Phase II study of intraperitoneal recombinant interleukin-12 (rhlL-12) in patients with peritoneal carcinomatosis (residual disease < 1 cm) associated with ovarian cancer or primary peritoneal carcinoma. J. Transl. Med. (5), https: / / doi.org / 10.1186 / 1479-5876-5-66.

[0466] Lhuillier, C. R.-P. (2021). Radiotherapy-exposed CD8+ and CD4+ neoantigens enhance tumor control. J. Clin. Invest.(131), https: / / doi.org / 10.1172 / jcil38740.

[0467] Loeb, E. H. (2024). Capsid-mediated control of adenoassociated viral transcription determines host range. Cell Rep. ( 3), 113902.

[0468] Lopez-Janeiro, A. V.-E.-S.-C.-R. (2022). The association between the tumor immune microenvironments and clinical outcome in low-grade, early-stage endometrial cancer patients. J. Pathol. (258), 426-436.

[0469] Lussier, D. A. (2021). Radiation-induced neoantigens broaden the immunotherapeutic window of cancers with low mutational loads. Proc. Natl. Acad. Sci. U. S. A. (118), e 2102611118.

[0470] Martinez-Vai, A. B.-J. (2021). Data processing and analysis for DIA-based phosphoproteomics using Spectronaut. Methods Mol. Biol. (2361), 95-107.

[0471] Mohamed, H. C. (2016). Assembly PCR synthesis of optimally designed, compact, multi- responsive promoters suited to gene therapy application. Sci. Rep. (6), 29388.

[0472] Nguyen, K. V. (2020). Localized interleukin-12 for cancer immunotherapy. Front. Immunol.(ll), 575597.

[0473] Ntranos, V. Y. (2019). A discriminative learning approach to differential expression analysis for single-cell RNA-seq. Nat. Methods(l ), 163-166.

[0474] Okuda, S. W. (2017). jPOSTrepo: an international standard data repository for proteomes. Nucleic Acids Res. (45), D1107-D1111.

[0475] Peitzsch, C. C. (2016). An epigenetic reprogramming strategy to resensitize radioresistant prostate cancer cells. Cancer Res. (76), 2637-2651.

[0476] Pekrun, K. S.-S. (2024). Correlation of antigen expression with epigenetic modifications after rAAV delivery of a human factor IX variant in mice and rhesus macaques. Mol. Ther.(32), 2064-2079.

[0477] Penaud-Budloo, M. L. (2008). Adeno-associated virus vector genomes persist as episomal chromatin in primate muscle. J. Virol. (82), 7875-7885.

[0478] Peng, D. Q. (2000). Transduction of hepatocellular carcinoma (HCC) using recombinant adeno-associated virus (rAAV): in vitro and in vivo effects of genotoxic agents. J. Hepatol.(32), 975-985.

[0479] Penuelas, I. M.-C. (2005). Positron emission tomography imaging of adenoviral-mediated transgene expression in liver cancer patients. Gastroenterology.

[0480] Gastroenterology( 128), 1787-1795.

[0481] Pillay, S. M. (2016). An essential receptorfor adenoassociated virus infection. Nature(530), 108-112.

[0482] Qian, J. a. (2020). Radiotherapy and immunotherapy for head and neck cancer: Current evidence and challenges. Front. Oncol. (10), 608772. Qiao, C. Y. (2011). Liver-specific microRNA-122 target sequences incorporated in AAV vectors efficiently inhibits transgene expression in the liver. Gene Ther.(18), 403-410.

[0483] Reits, E. H. (2006). Radiation modulates the peptide repertoire, enhances MHC class I expression, and induces successful antitumor immunotherapy. J. Exp. Med. (203), 1259-1271.

[0484] Ritchie, M. P. (2015). limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. ( 3), e47.

[0485] Robinson, M. M. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics(26), 139-140.

[0486] Rodriguez-Ruiz, M. V. (2020). Immunological impact of cell death signaling driven by radiation on the tumor microenvironment. Nat. Immunol. (21), 120-134.

[0487] Sade-Feldman, M. J.-R.-P. (2017). Resistance to checkpoint blockade therapy through inactivation of antigen presentation. Nat. Commun.(8), 1136.

[0488] Sangro, B. M. (2004). Phase I trial of intratumoral injection of an adenovirus encoding interleukin-12 for advanced digestive tumors. J. Clin. Oncol. (22), 1389-1397.

[0489] Santollani, L. M. (2024). Local delivery of cell surface -targeted immunocytokines programs systemic antitumor immunity. Nat. Immunol. doi:https: / / doi.org / 10.1038 / s41590- 024-01925-7

[0490] Schaue, D. X. (2021). Regulatory T cells in radiotherapeutic responses. Front. Oncol. (2), 90.

[0491] Schwartz, R. C. (2009). Adeno-associated virus replication induces a DNA damage response coordinated by DNA-dependent protein kinase. J. Virol. (83), 6269-6278.

[0492] Shankaran, V. I. (2001). IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature(AlO), 1107-1111.

[0493] Szklarczyk, D. M. (2017). The STRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. (45), D362-D368.

[0494] Tailor, A. E. (2022). Ionizing radiation drives key regulators of antigen presentation and a global expansion of the immunopeptidome. Mol. Cell. Proteomics (21), 100410.

[0495] Trinchieri, G. (1995). Interleukin-12: A proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol.(13), 251-276.

[0496] Tugues, S. B. (2015). New insights into IL-12-mediated tumor suppression. Cell Death Differ. (22), 237-246.

[0497] Tyanova, S. T. (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods, 731-740.

[0498] Wang, D. T. (2019). Adeno-associated virus vector as a platform for gene therapy delivery. Nat. Rev. Drug Discov. (18), 358-378.

[0499] Wang, Y. L.-G. (2019). The reciprocity between radiotherapy and cancer immunotherapy. Clin. Cancer Res. (25), 1709-1717. Weichselbaum, R. L.-X. (2017). Radiotherapy and immunotherapy: a beneficial liaison? Nat. Rev. Clin. Oncol.(lA), 365-379.

[0500] Woo, S.-R. F. (2014). STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. Immunity (41), 830-842. Wu, M.-S. K.-P.-C.-J.-Y.-H.-Y.-T.-J.-Y. (2021). Type I interferon signaling accelerates liver regeneration by metabolic modulation in noninfectious conditions. Am. J. Pathol.(191), 1036-1048.

[0501] Wu, T. H. (2021). clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb.) (2), 100141. Younes, A. P. (2004). Phase II clinical trial of Interleukin-12 in patients with relapsed and refractory non-Hodgkin's lymphoma and Hodgkin's disease. Clin. Cancer Res. (10), 5432-5438.

[0502] Zaretsky, J. G.-D.-O.-L.-R. (2016). Mutations associated with acquired resistance to PD-1 blockade in melanoma. N. Engl. J. Med. (375), 819-829. Zhou, Y. Z. (2019). Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. (10), 1523.

Claims

CLAIMS1. A recombinant expression system for use in a method of treating cancer, wherein a. at least one tumor is treated with the recombinant expression system and treated with radiation; and b. at least one further tumor different from the at least one tumor treated in step a. is treated with radiation.

2. The recombinant expression system for use according to claim 1, wherein the recombinant expression system comprises a nucleic acid construct comprising a sequence encoding at least one immunomodulatory gene or protein operatively linked to a radiation inducible promoter.

3. The recombinant expression system for use according to any one of claims 1 or 2, wherein the radiation inducible promoter is an interferon (I FN) -inducible promoter, preferably wherein the I FN -inducible promoterrespondsto type I IFN and / or type II IFN, more preferably wherein the promoter responds to type I and type II IFN produced through cGAS / STING activation following radiation and type II IFN derived from adaptive immune responses, preferably wherein the radiation inducible promoter comprises at least one interferon-stimulated response element (ISRE) and more preferably is selected from the list consisting of: a. a nucleotide sequence comprising one to ten copies, preferably two to seven copies, more preferably three to five copies and particularly preferably 4 copies of a sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 17 or is or is most preferably identical to SEQ ID NO: 17; optionally wherein the copies are interspaced by up to forty nucleotides, preferably four to thirty-five nucleotides, more preferably ten to thirty nucleotides and particularly preferably fifteen to twenty-five nucleotides; b. a nucleotide sequence according to SEQ ID NO: 18; c. a nucleotide sequence according to SEQ ID NO: 19.

4. The recombinant expression system for use according to any one of claims 2-3, wherein the at least one immunomodulatory gene or protein is selected from the group consisting of interleukin-1, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-7, interleukin-8, interleukin-9, interleukin-11, single-chain interleukin-12,interleukin-12, interleukin-13, interleukin-14, interleukin-15, interleukin-15-sushi, interleukin- 16, interleukin-17, interleukin-18, interleukin-19, interleukin-20, interleukin-21, interleukin- 22, interleu kin -23, CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10 (I PIO), CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, XCL1, XCL2, CX3CL1, granulocyte-macrophage colony-stimulating factor, type I interferons, IFN-y, TNF-a, FLT3-ligand, a blocking peptide targeting TG F-B, a blocking peptide targeting IL- 10, a blocking peptide targeting FoxP3, a monoclonal antibody or single -chain variable fragment (scFv) or nanobody neutralizing PD1, PDL1, CTLA4, CD137, TIM3, LAG3, and a fragment or variant thereof; or a shRNA targeting TG F-B, a shRNA targeting IL-10, or a shRNA targeting FoxP3.

5. The recombinant expression system for use according to any one of claims 2-4, wherein the at least one immunomodulatory protein is : encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ I D NO: 1 or 3, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ I D NO: 1 or 3, or selected from the group consisting of: a. the alpha subunit of I L- 12; b. the B-subunit of IL-12; c. single chain IL- 12 comprising the a- and B-subunit of IL- 12; d. a single chain I L- 12 comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or 4; e. a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity with respect to SEQ ID NO: 2 or 4, wherein the polypeptide has the biological activity of interleukin-12.

6. The recombinant expression system for use according to any one of claims 2-5, wherein the nucleic acid construct further comprises at least one sequence motif that inhibits transgenic expression of the immunomodulatory protein in tissues or cells not intended to express the proteins, preferably wherein the tissue is liver tissue, preferably wherein the sequence motif is a target sequence of a microRNA that is highly abundant in the liver,more preferably wherein the target sequence is selected from the group consisting of miR- 122 target sequence, miR-192 target sequence, miR-199a target sequence, miR-101 target sequence, miR-99a target sequence, Iet7a target sequence, Iet7b target sequence, Iet7ctarget sequence, Iet7f target sequence, and even more preferably is a miR-122 target sequence selected from the list consisting of: a. a miR-122 target sequence having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 10 or having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respect to SEQ ID NO: 11 or is identical to SEQ ID NO: 11; optionally wherein the nucleotide sequence comprises 1 to 12, preferably 3 to 10, more preferably 4 to 8 and particularly preferably 5 copies of the miR-122 target sequence; further optionally wherein the copies are interspaced by one to forty nucleotides, preferably one to thirty nucleotides, more preferably two to twenty nucleotides and particularly preferably two to eight nucleotides; b. a nucleotide sequence comprising 5 copies of the miR-122 target sequence as depicted in SEQ ID NO: 11.

7. The recombinant expression system for use according to any one of the preceding claims, wherein the recombinant expression system is an expression vector; preferably wherein the expression vector is a viral vector, more preferably a viral vector selected from the list consisting of adeno-associated virus (AAV) vector, adenoviral vector, lentiviral vector, vaccine virus vector, or herpes simplex virus vector, even more preferably an adeno-associated virus vector having one or more of the following characteristics: a. the nucleic acid construct sequence further comprises a 5'-ITR and a 3'-ITR sequence, being preferably AAV25'-ITRs having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with respectto SEQ ID NO.:13 or 27 and a 3'-ITR having at least 70% or at least 80 % or at least 90% or at least 95% sequence identity with SEQ ID NO.: 14; most preferably comprising a 5'ITR and a 3'ITR sequence identical to SEQ ID NOs: 13 and 14; b. the AAV vector has preferably the serotype AAV8, AAV1, AAV3, AAV6, AAV9, AAV2, AAV5, AAVrh.10, or anygain-of-function mutant of AAVrh.10, more preferably the AAV vector has the serotype AAV8.

8. The recombinant expression system for use according to any one of the preceding claims, wherein the recombinant expression system is contained in a viral particle, preferably wherein the viral particle is an AAV viral particle or an adenoviral particle; more preferably an AAV viral particle; even more preferably an AAV8 viral particle .

9. The recombinant expression system for use according to any one of the preceding claims, wherein the tumors are a solid tumors, preferably wherein the solid tumor is selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cancer of the thymus, cervical cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head & neck cancers, Hodgkin's lymphoma, primary liver cancer, metastatic liver cancer, gallbladder cancer, lung cancer, melanoma, mesothelioma, multiple myeloma, Merkel cell carcinoma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, urothelial cancer, renal cancer, sarcoma, skin cancer, testicular cancer, thyroid cancer, uterine cancer, plasma cell tumors, neuroendocrine tumors, cholangiocarcinoma, or carcinoid tumors, optionally wherein the cancer is a metastatic cancer.

10. The recombinant expression system for use according to any one of the preceding claims, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system by intratumoral administration of the recombinant expression system.

11. The recombinant expression system for use according to any one of the preceding claims, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system prior or concurrently or after the at least one tumor (a) is treated with radiation, preferably wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) is treated with radiation, preferably wherein the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours.

12. The recombinant expression system for use according to any one of the preceding claims, wherein the at least one further (b) tumor is treated with radiation prior orconcurrently or after the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system, preferably wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one furthertumor (b) is treated with radiation, preferably wherein the time interval between the radiation and the treatment with the expression system is between 1 minute and 20 days, preferably between 10 minutes and 2 days and more preferably between 30 minutes and 24 hours.

13. The recombinant expression system for use according to any one of the preceding claims, wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) and the at least one furthertumor (b) is treated with radiation.

14. The recombinant expression system for use according to any one of the above claims, wherein the method is a combination therapy further comprising at least one further therapy selected from the group consisting of: a. a therapy comprising at least one checkpoint inhibitor, preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, CTLA-4, LAG3, BTLA, B7H3, B7H4, TIM3, KIR, or A2aR, more preferably selected from the group consisting of an inhibitor of PD-1, PD-L1, PD-L2, or CTLA-4; and / or b. a therapy comprising at least one adoptive cell therapy, preferably selected from adoptive NK cell therapy, adoptive dendritic cell therapy, or adoptive T-cell therapy, wherein the adoptive T-cell therapy preferably is a CAR-T-cell therapy, TCR-T-cell therapy ora therapy using TIL; and / or c. a therapy comprising at least one cancer vaccine; and / or d. a therapy comprising at least one exogenous cytokine; and / or e. a therapy compromising at least a chemotherapy agent before, jointly or after the radiation.

15. The recombinant expression systemfor use according to any one of the above claims, wherein: a. wherein the radiation inducible promoter comprises a nucleotide sequence according to SEQ ID NO: 18,b. wherein the at least one immunomodulatory protein is encoded by a nucleic acid sequence comprising or consisting of the nucleic acid sequences of SEQ ID NO: 1 or 3, c. wherein the sequence motif that inhibits transgenic expression of the immunomodulatory protein is a nucleotide sequence comprising 5 copies of the miR- 122 target sequence as depicted in SEQ ID NO: 11 d. wherein the at least one tumor (a) treated with the recombinant expression system and treated with radiation is treated with the recombinant expression system afterthe at least one tumor (a) and the at least one furthertumor (b) is treated with radiation.