Allele-specific electrical genotyping for diagnosis of genetic diseases
The microfluidic device with impedance spectroscopy and allele-specific PCR addresses the slow and costly issues of current genetic testing, enabling rapid and accurate DNA fragment identification for conditions like transthyretin amyloidosis, cystic fibrosis, and sickle cell anemia.
Patent Information
- Application Number
- PCT/US2025/060538
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-19
- Filing Date
- 2025-12-19
- Publication Date
- 2026-06-25
AI Technical Summary
Current genetic testing methods for conditions like hereditary transthyretin amyloidosis, cystic fibrosis, and sickle cell anemia are slow, costly, and complex, making them unsuitable for low-income settings and requiring improvements for rapid and accurate DNA fragment identification.
A microfluidic device with electrodes and a microfluidic system for impedance spectroscopy that uses allele-specific PCR to detect nucleic acids, employing a PDMS chip with gold electrodes and glass layers, connected to a signal generator, amplifier, and computing device for rapid impedance analysis.
Enables quick and accurate identification of specific DNA fragments, allowing for rapid diagnosis of genetic conditions and personalized treatment plans.
Smart Images

Figure US2025060538_25062026_PF_FP_ABST
Abstract
Description
Attorney Docket No. 047162-5386-00WOALLELE- SPECIFIC ELECTRICAL GENOTYPING FOR DIAGNOSIS OF GENETIC DISEASESCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 736,112, filed December 19, 2024 which is hereby incorporated by reference herein in its entirety.FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under 1556253 awarded by the National Science Foundation (NSF) and HD 102537 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0003] This application contains a Sequence Listing, which is submitted electronically via EFS-Web as an XML Document formatted sequence listing with a file name “047162-5386- 00WO_SequenceListing.xml,” having a creation date of December 3, 2025, and having a size of 3,788 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety.BACKGROUND
[0004] Most clinical genetic tests are characterized by slow turnaround times (TAT), often spanning from days to weeks. Both clinicians and patients could benefit from genetic testing that is rapid, affordable and easy-to-interpret. This is particularly important for relatively common and clinically significant DNA variants, such as those linked to hereditary transthyretin amyloidosis (ATTR), cystic fibrosis or sickle cell anemia. Available technologies include multifrequency impedance spectroscopy for the quantification and sizing of DNA fragments, which involve linking PCR products to paramagnetic beads, which increases the cost and complexity of the experimental protocol and restricts its application in low-income settings.
[0005] Thus, there is a need in the art for methods for quick and accurate identification of specific DNA fragments directly in solution. The present invention satisfies this need.SUMMARY OF THE INVENTION
[0006] In some embodiments, the invention provides a microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel.
[0007] In some embodiments, each electrode has a height ranging between 50 nm and 250 nm, and a width ranging between 1 pm and 50 pm, and each electrode is separated by a distance ranging between 1 pm and 50 pm.
[0008] In some embodiments, each electrode is formed from a bottom portion comprising one or more layers of chromium, and a top portion comprising one or more layers of gold.
[0009] In some embodiments, the channel has a height ranging between 1 pm and 50 pm and a width ranging between 1 pm and 50 pm.
[0010] In some embodiments, the at least one chip is formed from poly dimethyl siloxane (PDMS) and the layer is formed from glass.
[0011] In some embodiments, the at least one chip comprises a plurality of chips arranged in a radial pattern on the layer.
[0012] In some embodiments, the invention provides a microfluidic system comprising: at least one microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel; a signal generator electrically connected to a first electrode of the pair of electrodes; an amplifier electrically connected to a second electrode of the pair of electrodes; a spectroscope electrically connected the amplifier; and a computing device communicatively connected to the spectroscope, configured to receive data from the spectroscope.
[0013] In some embodiments, the signal generator provides a plurality of excitation signals to the first electrode, the amplifier transforms the signal of the second electrode from current to voltage, the spectroscope demodulates the signal by mixing with the original excitation signal and passes the signal to the computer to calculate rate of impedance change of a sample in a solution passing across the electrodes in the channel.
[0014] In some embodiments, the plurality of excitation signals comprises signals produced at one or more frequencies and voltages. In some embodiments, the frequencies range between 10 kHz and 3 mHz, and the voltages range between 0.1 V and 10 V. In some embodiments, the frequencies are 10 kHz, 50 kHz, 100 kHz, 250 kHz, 500 kHz, 1 MHz, 2 MHz, 3 MHz, each provided at 1 V.
[0015] In some embodiments, the invention provides a microfluidic system comprising: at least one microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel; a computing device connected to each microfluidic device comprising a non- transitory computer readable medium having software instructions stored thereon that when executed by a processor cause the processor to execute steps comprising: a) providing the first electrode of the chip with a plurality of excitation signals; b) calculating an impedance output response based on a signal from the second electrode as a sample in a solution flows across the electrodes in the channel; and c) calculating a quantification score based on the impedance output response.
[0016] In some embodiments, the step of calculating an impedance output response comprises measuring impedance change and calculating rate of impedance change.
[0017] In some embodiments, the invention provides a method of detecting at least one nucleic acid in a sample by microfluidic impedance cytometry using a microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel or a microfluidic system comprising: at least one microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel; a signal generator electrically connected to a first electrode of the pair of electrodes; an amplifier electrically connected to a second electrode of the pair of electrodes; a spectroscope electrically connected the amplifier; and a computing device communicatively connected to the spectroscope, configured to receive data from the spectroscope.
[0018] In some embodiments, the invention provides a method of detecting a target nucleotide sequence in a sample, comprising: amplification of the target nucleotide sequence; and calculating an impedance output response by microfluidic impedance cytometry using a microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel or a microfluidic system comprising: at least one microfluidic device comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel; a signal generator electrically connected to a first electrode of the pair of electrodes; an amplifier electrically connected to a second electrode of the pair of electrodes; a spectroscope electrically connected the amplifier; and a computing device communicatively connected to the spectroscope, configured to receive data from the spectroscope.
[0019] In some embodiments, the sample is a biological sample. In some embodiments, the sample is blood.
[0020] In some embodiments, the step of amplification of the target nucleotide sequence is performed by polymerase chain reaction (PCR). In some embodiments, the step of amplification of the target nucleotide sequence by PCR comprises contacting the sample with at least one amplification primer specific for hybridizing to the target nucleotide sequence, and a reverse primer. In some embodiments, at least one amplification primer is an allele-specific primer.
[0021] In some embodiments, the step of calculating an impedance output response comprises measuring impedance change and calculating rate of impedance change.
[0022] In some embodiments, the invention provides a method of identifying a subject as being homozygous or heterozygous for a variant nucleotide sequence as compared to a wild-type nucleotide sequence, comprising obtaining a sample from the subject; and detecting at least one nucleotide sequence in the sample using the method of detecting a nucleic acid in a sample as described herein, wherein the subject is identified as homozygous for a wild-type nucleotide sequence when only a wild-type nucleotide sequence is detected in the sample, the subject is identified as homozygous for a variant allele when only a variant nucleotide sequence is detectedin the sample, and the subject is identified as heterozygous for a variant when both a variant nucleotide sequence and wild-type nucleotide sequence are identified in the sample.
[0023] In some embodiments, the variant nucleotide sequence is a disease-associated variant allele. In some embodiments, the variant nucleotide sequence is a transthyretin 424G>A variant.
[0024] In some embodiments, the method further comprises diagnosing the subject as having a disease or disorder or having an increased risk of developing a disease or disorder.
[0025] In some embodiments, the disease or disorder is selected from the group consisting of transthyretin (TTR) amyloidosis, senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), and familial amyloid cardiomyopathy (FAC).
[0026] In some embodiments, the method further comprises administering a treatment or therapeutic agent to the subject diagnosed as having a disease or disorder or having an increased risk of developing a disease or disorder. In some embodiments, the therapeutic agent is a transthyretin stabilizer. In some embodiments, the therapeutic agent is tafamidis or acoramidis.BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0028] Figure 1, comprising Figure 1A through Figure ID, depicts a device for multifrequency impedance spectroscopy for electrical genotyping. Figure 1 A is a pictorial representation of the microfluidic chip. Figure IB is a photograph of the microfluidic chip on a fused silica wafer. Figure 1C is a cross-sectional view of the electrical model of the microfluidic chip shown with the capacitances and the resistances that affect the sensor impedance. Figure ID depicts a microscopic image of the microfluidic channel and integrated gold electrodes. The passage of PCR products through the gold electrodes occludes the current path and disturbs the electric field formed between the gold electrodes.
[0029] Figure 2, comprising Figure 2A and Figure 2B, depicts a block diagram of a microfluidic system and a generic computing environment. Figure 2A is a diagram of an exemplary microfluidic system. Figure 2B is a diagram of an exemplary computing device.
[0030] Figure 3, comprising Figure 3A and Figure 3B, depicts representative experimental results demonstrating the comparison between low and high frequency response of different samples. Figure 3A depicts the comparison between the normalized impedance response of DNA in water, DNA in buffer, Water (Negative Control), and Buffer (Negative Control) at 10 kHz. Figure 3B depicts the comparison between the normalized impedance response of DNA in water, DNA in buffer, Water (Negative Control), and Buffer (Negative Control) at 3 kHz.
[0031] Figure 4, comprising Figure 4A through Figure 4H, depicts representative experimental results demonstrating the impedance response at different frequencies for DNA eluted in water or buffer. Figure 4A depicts the impedance response for DNA eluted in water and buffer at 10 kHz. Figure 4B depicts the impedance response for DNA eluted in water and buffer at 50 kHz. Figure 4C depicts the impedance response for DNA eluted in water and buffer at 100 kHz. Figure 4D depicts the impedance response for DNA eluted in water and buffer at 250 kHz. Figure 4E depicts the impedance response for DNA eluted in water and buffer at 500 kHz. Figure 4F depicts the impedance response for DNA eluted in water and buffer at 1 MHz. Figure 4G depicts the impedance response for DNA eluted in water and buffer at 2 MHz. Figure 4H depicts the impedance response for DNA eluted in water and buffer at 3 MHz.
[0032] Figure 5, comprising Figure 5A and Figure 5B, depicts representative experimental results demonstrating the electrical genotyping of TTR V142I in clinical samples. Figure 5A depicts allele-specific PCR products for the ancestral and the variant allele for TTR variant c.424G>A analyzed using gel electrophoresis. Figure 5B depicts DNA quantification score calculated using electrical impedance response of six patients tested. Four patients (P1-P4) were heterozygous (G / A) for V142I, and two patients (P5 and P6) were homozygous reference (G / G). Negative control samples (N) did not show a product. L indicates the 100 bp DNA Ladder. The DNA quantification score showed positive signals corresponding with the identified genotypes for the six patients.
[0033] Figure 6, comprising Figure 6A through Figure 6C, depicts bioanalyzer images of purified PCR amplification products. Figure 6A depicts the results of bioanalyzer analysis demonstrating PCR amplicons generated from a patient DNA sample heterozygous for TTR V142I using the allele-specific ancestral primer showed the desired peak size at 538 bp. Figure 6B depicts the results of bioanalyzer analysis demonstrating PCR amplicons generated from apatient DNA sample heterozygous for TTR VI 421 using the allele-specific alternative primer showed the desired peak size at 538 bp. Figure 6C depicts the results of bioanalyzer analysis of the no-template control sample.DETAILED DESCRIPTION
[0034] In some embodiments, the invention provides a microfluidic device and system for detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the invention provides a device and system configured to perform microfluidic impedance cytometry on a sample. In some embodiments, a microfluidic device comprises a microfluidic chip with at least one microfluidic channel, and conductive electrodes positioned in the channel. In some embodiments, the invention provides a microfluidic system comprising a microfluidic device connected to an impedance spectroscope, a transimpedance amplifier, and a computing device. In some embodiments, the invention provides a microfluidic device and system configured for multiplexing with a plurality of microfluidic devices arranged in a pattern.
[0035] In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one target nucleotide sequence in a sample. In some embodiments, the method comprises amplifying the target nucleotide sequence by polymerase chain reaction (PCR). In some embodiments, the method comprises amplifying the target nucleotide sequence by allele-specific amplification by PCR. In some embodiments, the method comprises amplifying the target nucleotide sequence followed by detecting the presence, concentration, or both, of the target nucleotide sequence by microfluidic impedance cytometry.
[0036] In some embodiments, the invention provides a method of identifying a subject as homozygous or heterozygous for a variant nucleotide sequence as compared to a wild-type nucleotide sequence. In some embodiments, the method comprises diagnosing a subject as having, or being at increased risk of developing, a disease or disorder associated with being homozygous or heterozygous for a variant nucleotide sequence. In some embodiments, themethod comprises treating a subject diagnosed with a disease or disorder associated with a variant nucleotide sequence.Definitions
[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice of and / or for the testing of the invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used according to how it is defined, where a definition is provided.
[0038] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0039] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0040] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or in some instances ±10%, or in some instances ±5%, or in some instances ±1%, or in some instances ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0041] The term “allele” refers to any of the forms of the same gene that occur at the same locus on a homologous chromosome but differ in base sequence.
[0042] “Amplification reaction mixture” refers to an aqueous solution comprising the various reagents used to amplify a target nucleic acid. These include enzymes, aqueous buffers, salts, target nucleic acid, and deoxynucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture.
[0043] “Amplifying” or “Amplification”, which typically refers to an “exponential” increase in target nucleic acid, is being used herein to describe both linear and exponential increases in the numbers of a select target sequence of nucleic acid.
[0044] The term “complementary” (or “complementarity”) refers to the specific base pairing of nucleotide bases in nucleic acids within a contiguous region of double stranded nucleicacid, such as between a primer sequence and its complementary sequence in a target polynucleotide.
[0045] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
[0046] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
[0047] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0048] “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared, multiplied by 100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
[0049] “Hybridizing” refers to the binding of two single stranded nucleic acids via complementary base pairing.
[0050] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0051] In the context of the invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0052] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
[0053] “Nucleotide polymerases” refers to enzymes able to catalyze the synthesis of DNA or RNA from nucleoside triphosphate precursors. In the amplification reactions of the invention, the polymerases are template-dependent and typically add nucleotides to the 3 '-end of the polymer being formed. It is most preferred that the polymerase is thermostable as described in U.S. Pat. Nos. 4,889,818 and 5,079,352.
[0054] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vivo, in vitro, ex vivo, or in situ, amenable to the methods described herein. In some embodiments, the patient, subject, or individual is a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) and a primate (e.g., monkey and human. In certain non-limiting embodiments, the patient, subject, or individual is a human.
[0055] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleicacid sequences from a recombinant library or a cell genome, using ordinary cloning and amplification technology, and the like, and by synthetic means. An “oligonucleotide” as used herein refers to a short polynucleotide, typically less than 100 bases in length.
[0056] “Antisense” refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, wherein the regulatory sequences control expression of the coding sequences.
[0057] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, and fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
[0058] The term “primer” refers to an oligonucleotide, whether natural or synthetic, capable of acting as a point of initiation of DNA synthesis under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand is induced, i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. A primer is preferably a single-stranded oligodeoxyribonucleotide. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 25 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybridcomplexes with the template. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template.
[0059] The term “primer” may refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding one or both ends of the target region to be amplified. For instance, if a region shows significant levels of polymorphism in a population, mixtures of primers can be prepared that will amplify alternate sequences. A primer can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include 32 P, fluorescent dyes, electron-dense reagents, enzymes (as commonly used in an ELISA), biotin, or haptens and proteins for which antisera or monoclonal antibodies are available. A label can also be used to “capture” the primer, so as to facilitate the immobilization of either the primer or a primer extension product, such as amplified DNA, on a solid support.
[0060] The term “isolated” when used in relation to a nucleic acid, as in “isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one contaminant with which it is ordinarily associated in its source. Thus, an isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids (e.g., DNA and RNA) are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences (e.g., a specific mRNA sequence encoding a specific protein), are found in the cell as a mixture with numerous other RNAs, including mRNAs that encode a multitude of proteins. An isolated nucleic acid includes, for example, nucleic acid found in cells that typically express it, but where the nucleic acid is located in a chromosomal position different from its natural location, or is flanked by a nucleic acid sequence that differs from its natural form. The isolated nucleic acid or oligonucleotide may be present in single-stranded or double-stranded form. When an isolated nucleic acid or oligonucleotide is to be utilized to express a protein, the oligonucleotide contains at a minimum, the sense or coding strand (i.e., the oligonucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide may be double-stranded).
[0061] The term “position” refers to a defined site on a nucleic acid molecule. Such a position may, for example, be occupied by a nucleotide.
[0062] A “therapeutic” treatment is a treatment administered to a subject who exhibits at least one sign or symptom of a diseases or disorder, for the purpose of ameliorating, reducing, or eliminating at least one sign or symptom of the disease or disorder.
[0063] The phrase “therapeutically effective amount,” as used herein, refers to an amount that is sufficient or effective to prevent or treat (delay or prevent the onset of, prevent the progression of, inhibit, decrease or reverse) a disease or disorder, including alleviating at least one sign or symptom of the disease or disorder.
[0064] To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0065] “Variant” as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions or truncations. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
[0066] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.Description
[0067] In some embodiments, the invention provides a microfluidic device and system for detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the invention provides a device and system configured toperform microfluidic impedance cytometry on a sample. In some embodiments, a microfluidic device comprises a microfluidic chip with at least one microfluidic channel, and conductive electrodes positioned in the channel. In some embodiments, the invention provides a microfluidic system comprising a microfluidic device connected to an impedance spectroscope, a transimpedance amplifier, and a computing device. In some embodiments, the invention provides a microfluidic device and system configured for multiplexing with a plurality of microfluidic devices arranged in a pattern.
[0068] In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one target nucleotide sequence in a sample. In some embodiments, the method comprises amplifying the target nucleotide sequence by polymerase chain reaction (PCR). In some embodiments, the method comprises amplifying the target nucleotide sequence by allele-specific amplification by PCR. In some embodiments, the method comprises amplifying the target nucleotide sequence followed by detecting the presence, concentration, or both, of the target nucleotide sequence by microfluidic impedance cytometry.
[0069] In some embodiments, the invention provides a method of identifying a subject as homozygous or heterozygous for a variant nucleotide sequence as compared to a wild-type nucleotide sequence. In some embodiments, the method comprises diagnosing a subject as having, or being at increased risk of developing, a disease or disorder associated with being homozygous or heterozygous for a variant nucleotide sequence. In some embodiments, the method comprises treating a subject diagnosed with a disease or disorder associated with a variant nucleotide sequence.Microfluidic Device and System
[0070] In some embodiments, the invention provides a microfluidic device and system for detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the microfluidic device comprises a polydimethylsiloxane (PDMS) chip with at least one microfluidic channel, and a pair of conductive electrodes (in some examples referred to as a digital genotyping sensor) configured to measure a sample in the channel. In some embodiments, a solution with a sample is deposited into the microfluidicdevice, and the sample is allowed to flow through the microfluidic channel across the electrodes to measure impedance at different excitation frequencies. In some embodiments, the device and system are configured for digital genotyping of a genetic variant using allele-specific polymerase chain reaction (ASPCR) and passive-flow microfluidic impedance cytometry at different excitation frequencies. Exemplary genetic variants that can be identified using digital genotyping include, but are not limited to, transthyretin VI 421.
[0071] Referring now to Fig. 1A, shown is an exemplary microfluidic device 100 comprising a microfluidic chip 102 having a first end 104 and a second end 106. In some embodiments, chip 102 is positioned on a layer 108 which forms a bottom for the device. Generally, chip 102 comprises at least one opening forming an inlet 110 in first end 104, and at least one opening forming an outlet 112 in second end 106, with a channel 114 extending between and fluidly connecting inlet 110 and outlet 112. At least one pair of electrodes 114 are positioned at least partially within and / or across channel 114. The electrodes configured to measure impedance of a solution containing a sample flowing from inlet 110 to outlet 112 and across, over and / or between the electrodes. The pair of electrodes 114 may be described herein as having a first electrode 120a and a second electrode 120b. Chip 102 and / or layer 108 may be formed from any suitably rigid and non-porous material, such as plastic, polymer, polydimethylsiloxane (PDMS), glass, and any combinations thereof. For example, in some embodiments, chip 102 is formed from PDMS and is bonded or attached to a layer 108 formed from a glass substrate or wafer.
[0072] Device 100 may be configured for multiplexing with any number of chip 102 positioned on layer 108. A figure depicting a plurality of device 100 bonded on a layer 108 (e.g., a glass wafer) each with a pair of electrodes 120 is shown in Fig. IB. In some embodiments, a single layer 108 (e.g., 3” wafer) can accommodate any number (e.g., 6) of device 100 arranged or patterned in a configuration on layer 108. In some embodiments, pair of electrodes 120 comprise electrical traces or leads 130 extending away from each electrode, each lead terminating at a terminal or contact 132.
[0073] Fig. 1C depicts a side view of an exemplary device 100 showing an electrical model formed by the pair of electrodes 120 in channel 114. The electrical model shows the major capacitances and resistances associated with the structure of the electrical sensor (e.g., pair of electrodes 120 across channel 114) while measuring a sample in a solution. “Cpar” refers to theparasitic capacitance associated with the electrodes on the layer 108. The Cpar is an unwanted parameter, and its effects should be minimized during impedance measurements. “Cdl” refers to the double layer capacitance which is formed due to the ion barrier formed in a solution when a solution is subjected to an electrical field. The electrical field creates a charge ion distribution that exhibits capacitance characteristics which negatively impacts impedance measurements. When performing impedance-based measurements, focus should be on the impedance of the solution itself. “Rsol”, refers to the solution resistance. The solution resistance is directly affected by the conductivity of the solution present in the sensing region of the biosensor (e.g., the region between, across, and / or above pair of electrodes 120). Furthermore, another capacitance is also modelled for the measurement of nucleic acids. As a nucleic acid, such as DNA and RNA, is a negatively charged molecule, it alters the ion distribution around itself, creating characteristics akin to a dipole and generating capacitance-like features. This is modeled in the disclosed electrical model as “Cdi” which refers to the dipole capacitance.
[0074] The impedance-based sensor functions are based on the principle that the conductivity of the sample (e.g., DNA or RNA) solution differs from that of a basic buffer or negative control solution. The sample affects the Cdi capacitance to modify the impedance of the overall sensor. The impedance alteration occurs gradually as the sample in the solution moves from the inlet to the outlet. Over time, the concentration of sample in the sensing region varies, manifesting as a rate of impedance change.
[0075] Fig. ID depicts a magnified view of channel 114 and pair of electrodes 120. In some embodiments, pair of electrodes 120 (e.g., gold electrodes) are patterned on layer 108 (e.g., a glass wafer) through standard lithographic techniques, and the electrode material (e.g., gold) is then deposited using electron beam deposition. Each electrode is formed by depositing layers or coatings of material on layer 108. In some embodiments, a base layer or bottom portion is formed below the electrode material to help adhere the electrodes to layer 108. In some embodiments, the base layer has a height ranging between 1 nm and 10 nm. In some embodiments, the base layer comprises chromium. In some embodiments, each electrode has a gold top portion or layering positioned on a bottom portion or layer. In some embodiments, pair of electrodes 120 are formed from a 100 nm coating of gold on a 10 nm coating of chromium. Each electrode of pair of electrodes 120 has a height ranging between 1 nm and 250 nm, and awidth ranging between 1 gm and 50 gm. For example, in some embodiments, each electrode has a height of about 110 nm and a width of about 20 gm.
[0076] Fig. ID shows a microscopic image of the microfluidic device 100 with the critical dimensions of the device and digital genotyping sensor. First electrode 120a and second electrode 120b are separated by a distance or gap 122 as shown in Fig. ID. In some embodiments, gap 122 ranges between 1 pm and 40 gm. For example, in some embodiments, each electrode is separated by a gap 122 of about 15 gm. In some embodiments channel 114 in chip 102 has a width ranging between 10 gm and 50 gm, or is about 20 gm. In some embodiments, channel 114 has a height ranging between 5 gm and 30 gm, or is about 15 gm. In some embodiments, channel 114 has a length ranging between 1 mm and 100 mm, or about 50 mm. Inlet 110 and / or outlet 112 have sidewalls that extend from a top surface at least partially to a bottom surface of chip 102 and form openings in chip 102 connected to channel 114. In some embodiments, inlet 110 and / or outlet 112 has a diameter or width ranging between 1 mm and 10 mm. In some embodiments, inlet 110 ha a diameter of about 5 mm, and outlet 112 has a diameter of about 3 mm.
[0077] Referring now to Fig. 2A shown is a diagram depicting an exemplary microfluidic system 200 comprising a microfluidic device 100 electronically connected to one or more components in a circuit or configuration. In some embodiments, microfluidic system 200 comprises at least one device 100 connected to any of a signal generator, an impedance spectroscope, a transimpedance amplifier, a filter, a mixer and / or a computing device (e.g., computer 300 discussed herein). In some embodiments, system 200 comprises at least one signal generator 210 connected to at least one microfluidic device 100, which is connected to a transimpedance amplifier 220, and a transimpedance spectroscope 230. In some embodiments, any portion of system 200 may be electronically and communicatively connected to a computing device for controlling or measuring portions of device 100 and / or system 200. In some embodiments, the computing device may further be used for data storage and / or data analysis. In some embodiments, signal generator 210 comprises a multi-frequency function generator (e.g., Zurich Instruments HF2IS) that provide one or more excitation signals to device 100 (e.g., first electrode 120a) at different frequencies (e.g., 8 different frequencies). In some embodiments, transimpedance amplifier 220 is configured to receive a signal or output from device 100 (e.g., second electrode 120b) and transform the signal from current to voltage to pass the signal totransimpedance spectroscope 230. In some embodiments, transimpedance spectroscope 230 comprises a digital lock-in amplifier (e.g., Zurich Instruments HF2IS) configured as a mixer and filter for signals received from device 100, signal generator 210 and / or transimpedance amplifier 220. In some embodiments, a computer (e.g., computer 300 discussed herein) receives a filtered (e g., low-pass filter) output of transimpedance spectroscope 230 for data storage and processing.
[0078] In some embodiments, eight excitation signals at different frequencies are set to operate within the range of 10 kHz to 3MHz and are divided into two signal paths. In some embodiments, a first signal path is external to spectroscope 230 and is connected to only one of the electrodes 120 (i.e., first electrode 120a). In some embodiments, second electrode 120b is connected to a spectroscope 230 by passing the signal through an amplifier 220. In some embodiments, a second signal path is connected internally to a mixer, which is part of the internal demodulator of the spectroscope 230. In some embodiments, second electrode 120b produces a signal to a transimpedance amplifier 220 based on the excitation signal provided to first electrode 120a. In some embodiments, amplifier 220 converts the measured signal of current values resulting from passing a solution between pair of electrodes 120 into a voltage which can be demodulated and measured.
[0079] The impedance spectroscope 230 may operate at any number of excitation frequencies (e.g., 8 multiple excitation frequencies). Exemplary electrical parameters chosen for the impedance spectroscope 230 are presented herein. In some embodiments, the frequencies are chosen in the range of 10 kHz to 3 MHz, with the specific frequencies as 10 kHz, 50 kHz, 100 kHz, 250 kHz, 500 kHz, 1 MHz, 2 MHz, 3 MHz respectively. The excitation voltage has a direct correlation with the demodulated signal which means the higher the excitation voltage, the higher the demodulated signal. However, at 8 excitation frequencies, a high voltage may damage the electrodes. Therefore, in some embodiments, 1 V may be chosen as the excitation voltage level for each of the 8 frequencies. Since a gradual change in the impedance due to the change in the solution resistance and the dielectric capacitance due to the presence of DNA in a solution is being measured, the cut-off frequency of the low pass filter of the impedance spectroscope 230 is set to 7 Hz. A transimpedance gain of 1 kV / A is selected for the amplifier 220.
[0080] In some embodiments, the output from transimpedance amplifier 220 is fed back into the input of signal generator 210, where it is demodulated digitally by mixing with the original excitation signal, and then is subsequently low pass filtered and fed to computer 300. Insome embodiments, the parameters for the low pass filter and the analog-to-digital converter of spectroscope 230 can be set from a display and graphical user interface (GUI) of the impedance spectroscope 230, or from a display and GUI of computer 300. In some embodiments, the low- pass filter is configured to minimize noise while also ensuring a clear signal for the gradual impedance change. In some embodiments, the impedance change is measured, which indicates the presence of a sample or nucleotide sequence (e.g., DNA) in the solution. In some embodiments, the data collected from device 100 and / or system 200 regarding the impedance changes is subsequently stored in a computing device 300 and is then post-processed using an algorithm to determine or calculate the rate of impedance change as seen in Fig. 2A.
[0081] A cross-sectional view of an exemplary device 100 for system 200 can be seen in Fig. 1C The solution to be measured is pipetted into inlet 110 and the fluid flows under the action of capillary flow towards outlet 112. First electrode 120a is connected to the output of signal generator 210, which provides a plurality of excitation voltages. Second electrode 120b is connected to an input of the transimpedance amplifier 220 which amplifies the signal and passes it to the input of the impedance spectroscope 230 where it is again demodulated.
[0082] Device 100 may be used for detecting at least one nucleic acid molecule in a sample in a solution, measuring impedance change, rate of impedance change, impedance values and other metrics or measurements related to impedance cytometry. Further, device 100 enables microfluidic impedance cytometry on a sample comprising nucleic acid molecules. In some embodiments, the nucleic acid molecules are generated using a polymerase chain reaction (PCR) or a PCT-based technique including, but not limited to, allele-specific PCR, reverse transcription (RT)-PCR, and nested PCR.
[0083] Device 100 enables the steps of pipetting or depositing a solution into inlet 110, flowing the solution through channel 114 across electrodes 120, producing one or more signals to at least one electrode of electrodes 120, and measuring rate of impedance change of the solution at one or more excitation frequencies. In some embodiments, the solution comprises a target nucleotide sequence in a buffer. In some embodiments, the solution comprises a target nucleotide sequence in water. In some embodiments, the solution comprises amplified nucleotide sequences. Any suitable buffer may be used as would be known by one of ordinary level of skill in the art.Computing Device
[0084] In some aspects of the present invention, software executing the instructions provided herein may be stored on a non-transitory computer-readable medium, wherein the software performs some or all of the steps of the present invention when executed on a processor.
[0085] Aspects of the invention relate to algorithms executed in computer software. Though certain embodiments may be described as written in particular programming languages, or executed on particular operating systems or computing platforms, it is understood that the system and method of the present invention is not limited to any particular computing language, platform, or combination thereof. Software executing the algorithms described herein may be written in any programming language known in the art, compiled, or interpreted, including but not limited to C, C++, C#, Objective-C, Java, JavaScript, MATLAB, Python, PHP, Perl, Ruby, or Visual Basic. It is further understood that elements of the present invention may be executed on any acceptable computing platform, including but not limited to a server, a cloud instance, a workstation, a thin client, a mobile device, an embedded microcontroller, a television, or any other suitable computing device known in the art.
[0086] Parts of this invention are described as software running on a computing device. Though software described herein may be disclosed as operating on one particular computing device (e.g. a dedicated server or a workstation), it is understood in the art that software is intrinsically portable and that most software running on a dedicated server may also be run, for the purposes of the present invention, on any of a wide range of devices including desktop or mobile devices, laptops, tablets, smartphones, watches, wearable electronics or other wireless digital / cellular phones, televisions, cloud instances, embedded microcontrollers, thin client devices, or any other suitable computing device known in the art.
[0087] Similarly, parts of this invention are described as communicating over a variety of wireless or wired computer networks. For the purposes of this invention, the words “network”, “networked”, and “networking” are understood to encompass wired Ethernet, fiber optic connections, wireless connections including any of the various 802.11 standards, cellular WAN infrastructures such as 3G, 4G / LTE, or 5G networks, Bluetooth®, Bluetooth® Low Energy (BLE) or Zigbee® communication links, or any other method by which one electronic device iscapable of communicating with another. Tn some embodiments, elements of the networked portion of the invention may be implemented over a Virtual Private Network (VPN).
[0088] Fig. 2B and the following discussion are intended to provide a brief, general description of a suitable computing environment in which the invention may be implemented. While the invention is described above in the general context of program modules that execute in conjunction with an application program that runs on an operating system on a computer, those skilled in the art will recognize that the invention may also be implemented in combination with other program modules.
[0089] Generally, program modules include routines, programs, components, data structures, and other types of structures that perform particular tasks or implement particular abstract data types. Moreover, those skilled in the art will appreciate that the invention may be practiced with other computer system configurations, including hand-held devices, multiprocessor systems, microprocessor-based or programmable consumer electronics, minicomputers, mainframe computers, and the like. The invention may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network. In a distributed computing environment, program modules may be located in both local and remote memory storage devices.
[0090] Fig. 2B depicts an illustrative computer architecture for a computer 300 for practicing the various embodiments of the invention. The computer architecture shown in Fig. 3 illustrates a conventional personal computer, including a central processing unit 350 (“CPU”), a system memory 305, including a random access memory 310 (“RAM”) and a read-only memory (“ROM”) 315, and a system bus 335 that couples the system memory 305 to the CPU 350. A basic input / output system containing the basic routines that help to transfer information between elements within the computer, such as during startup, is stored in the ROM 315. The computer 300 further includes a storage device 320 for storing an operating system 325, application / program 330, and data.
[0091] The storage device 320 is connected to the CPU 350 through a storage controller (not shown) connected to the bus 335. The storage device 320 and its associated computer- readable media provide non-volatile storage for the computer 300. Although the description of computer-readable media contained herein refers to a storage device, such as a hard disk or CD-ROM drive, it should be appreciated by those skilled in the art that computer-readable media can be any available media that can be accessed by the computer 300.
[0092] By way of example, and not to be limiting, computer-readable media may comprise computer storage media. Computer storage media includes volatile and non-volatile, removable and non-removable media implemented in any method or technology for storage of information such as computer-readable instructions, data structures, program modules or other data. Computer storage media includes, but is not limited to, RAM, ROM, EPROM, EEPROM, flash memory or other solid state memory technology, CD-ROM, DVD, or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store the desired information, and which can be accessed by the computer.
[0093] According to various embodiments of the invention, the computer 300 may operate in a networked environment using logical connections to remote computers through a network 340, such as TCP / IP network such as the Internet or an intranet. The computer 300 may connect to the network 340 through a network interface unit 345 connected to the bus 335. It should be appreciated that the network interface unit 345 may also be utilized to connect to other types of networks and remote computer systems.
[0094] The computer 300 may also include an input / output controller 355 for receiving and processing input from a number of input / output devices 360, including a keyboard, a mouse, a touchscreen, a camera, a microphone, a controller, a joystick, or other type of input device. Similarly, the input / output controller 355 may provide output to a display screen, a printer, a speaker, or other type of output device. The computer 300 can connect to the input / output device 360 via a wired connection including, but not limited to, fiber optic, Ethernet, or copper wire or wireless means including, but not limited to, Wi-Fi, Bluetooth, Near-Field Communication (NFC), infrared, or other suitable wired or wireless connections.
[0095] As mentioned briefly above, a number of program modules and data files may be stored in the storage device 320 and / or RAM 310 of the computer 300, including an operating system 325 suitable for controlling the operation of a networked computer. The storage device 320 and RAM 310 may also store one or more applications / programs 330. In particular, the storage device 320 and RAM 310 may store an application / program 330 for providing a variety of functionalities to a user. For instance, the application / program 330 may comprise many typesof programs such as a word processing application, a spreadsheet application, a desktop publishing application, a database application, a gaming application, internet browsing application, electronic mail application, messaging application, and the like. According to an embodiment of the present invention, the application / program 330 comprises a multiple functionality software application for providing word processing functionality, slide presentation functionality, spreadsheet functionality, database functionality and the like.
[0096] The computer 300 in some embodiments can include a variety of sensors 365 for monitoring the environment surrounding and the environment internal to the computer 300. These sensors 365 can include a Global Positioning System (GPS) sensor, a photosensitive sensor, a gyroscope, a magnetometer, thermometer, a proximity sensor, an accelerometer, a microphone, biometric sensor, barometer, humidity sensor, radiation sensor, or any other suitable sensor. Computer 300 may further comprise any of a spectroscope, oscilloscope, signal generator, pulse generator, power source, amplifier, mixer, filter, or the like, each connected to portions of device 100.Device Fabrication
[0097] An exemplary method of fabricating or manufacturing a device 100 is discussed herein. In some embodiments, device 100 comprises embedded gold electrodes and is formed from PDMS on a glass surface. An initial stage in creating device 100 comprises patterning and creating the pair of electrodes 120 on layer 108. In some embodiments, layer 108 is formed from a 3” fused silica wafer is used to manufacture the electrodes on a top surface of the layer using conventional photolithography. In some embodiments, the steps in the procedure comprise liftoff processing, electron beam metal evaporation, and photo-patterning resist on layer 108. Further steps in the photo-patterning process comprise wafer cleaning, spin coating of the photoresist, soft baking of the resist, exposure to ultraviolet light via a chromium mask printed on a 4” by 4” glass plate, development of the resist, and hard baking of the resist. After photo patterning, an electron beam evaporation technique deposits a 100-nm-thick coating of gold on layer 108. For better gold adherence to the layer 108, a 10 nm coating of chromium may be utilized; otherwise, the gold fdm was readily torn off. Due to its inertness and resistance to corrosion, gold is selected as the electrode material. In some embodiments, the electrodes are formed to be 20 pm wide, and arranged with a 15 pm gap 122 between each electrode.
[0098] Using soft lithography, a microfluidic channel 114 is created in PDMS (Polydimethyl siloxane) on a 3" silicon wafer that serves as a master mold, and a mask (e.g., a layer of SU-8) is patterned. Standard cleaning, spin coating, soft baking, exposure, development, and hard baking are all steps in the SU-8 photo-patterning process. Following the creation of the master mold, PDMS (10: 1 prepolymer / curing agent) is applied to the master mold, which is then baked at 80°C for two hours to cure it. Then, the PDMS channel is separated from the mold. The entrance and outflow (e.g., inlet 110 and outlet 112) are then formed by punching two holes, one measuring 5 mm and the other 3 mm. Both substrates (e.g., chip 102 and layer 108) receive oxygen plasma treatment, the PDMS substrate (e.g., chip 102) is then positioned and adhered to the electrode chip (e.g., layer 108). In some embodiments, chip 102 is bonded to layer 108 using air plasma and subsequent thermal baking of the chip and layer. The irreversible bond is then created by baking the chip and layer for 40 minutes at 70 °C. In some embodiments, chip 102 is treated with air plasma at 800 mTorr for 90 s to make microfluidic channel 114 hydrophilic.Method of detection
[0099] In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one nucleic acid in a sample. In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one target nucleotide sequence in a sample.
[0100] In some embodiments, the method comprises amplifying the target nucleotide sequence by polymerase chain reaction (PCR). In some embodiments, the method comprises amplifying the target nucleotide sequence by PCR followed by detecting the presence, concentration, or both, of the target nucleotide sequence by microfluidic impedance cytometry.
[0101] In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one variant nucleotide sequence (e.g., allele) in a sample. In some embodiments, the variant nucleotide sequence is selected from a deletion, duplication, indel, insertion, single nucleotide variant (SNV), copy number variant (CNV), alternative splice variant, epigenetic changes such as DNA methylation and histone modification, and microsatellite instability in comparison to a wild-type (e g., reference) sequence.
[0102] In some embodiments, the method comprises detecting the presence, concentration, or a combination thereof, of at least one variant nucleotide sequence in abiological sample. Tn some embodiments, the method comprises detecting the presence, concentration, and length (in base pairs), or a combination thereof, of a nucleic acid molecule in a biological sample. In some embodiments, the biological sample is selected from blood, saliva, serum, cell culture, dried blood spots, nasal swabs, urine, and tissue specimens. In some embodiments, the sample comprises isolated nucleic acids. In some embodiments, the method comprises isolating nucleic acids from the sample. In some embodiments, the method comprises directly detecting nucleic acids from a sample without isolating nucleic acids from the sample. A variety of techniques for extracting ribonucleic acids from biological samples are known in the art. For example, see those described in Rotbart et al., 1989, in PCR Technology (Erlich ed., Stockton Press, New York) and Han et al. 1987, Biochemistry 26:1617-1625. In some embodiments, if the sample is fairly readily disruptable, the nucleic acid need not be extracted, i.e., if the sample is comprised of cells, particularly peripheral blood lymphocytes or monocytes, lysis and dispersion of the intracellular components may be accomplished merely by suspending the cells in hypotonic buffer.
[0103] In some embodiments, the invention provides a method of detecting the presence, concentration, or a combination thereof, of at least one RNA transcript. In some embodiments, the method comprises amplifying the target transcript by reverse transcription polymerase chain reaction (RT-PCR). In some embodiments, the method comprises amplifying the target transcript by RT-PCR followed by detecting the presence, concentration, or both, of the target transcript sequence by microfluidic impedance cytometry. In some embodiments, RT-PCR may be used to detect genetic changes that affect the expression or splicing of RNA such as reduced levels or abnormal splicing of Survival Motor Neuron (SMN) transcripts associated with Spinal Muscular Atrophy (SMA), exon skipping in Dystrophin (DMD) transcripts associated with Duchenne Muscular Dystrophy (DMD), and the levels of normal and aberrant hemoglobin subunit beta (HBB) mRNA associated with Beta-Thalassemia (HBB).Amplification by polymerase chain reaction (PCR)
[0104] In some embodiments, the method of detecting the presence, concentration, or a combination thereof, of at least one nucleic acid comprises amplifying a target nucleotide sequence. In some embodiments, the method of amplifying a target nucleotide sequence is performed using a polymerase chain reaction (PCR) based method. In some embodiments themethod comprises contacting a sample with at least one amplification primer specific for hybridizing to target nucleotide sequence, and a reverse primer; amplifying the target nucleic acid sequence from the sample, and analyzing the amplification product using microfluidic impedance cytometry.
[0105] In some embodiments, the method comprises contacting at least a portion of a sample with an allele-specific primer and amplifying the target nucleotide sequence by PCR. In some embodiments the method comprises contacting a first portion of a sample with at least one amplification primer specific for hybridizing to a variant nucleotide sequence of interest (e.g., an allele specific primer) and a reverse primer; and contacting a second portion of a sample with at least one amplification primer specific for hybridizing to the non-variant or wild type allele of the nucleotide sequence of interest and the reverse primer, amplifying the target nucleotide sequence from the first and second portions of the sample, and analyzing the amplification products using microfluidic impedance cytometry. Methods of designing and using allele specific primers are described in detail in U.S. Patent Publication No. 2023054413A1, which is incorporated by reference herein in its entirety.
[0106] In some embodiments, the method comprises the use of PCR methods well known in the art (see U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188, each of which is incorporated herein by reference). In some embodiments, the method comprises the amplification of a target nucleic acid using PCR.
[0107] In some embodiments, the first step of each cycle of the PCR involves the separation of a nucleic acid duplex. In some embodiments, if the target nucleic acid is singlestranded, i.e., single-stranded DNA or RNA, no initial separation step is required during the first cycle. Once the strands are separated, the next step in PCR involves hybridizing the separated strands with primers that flank the target sequence. The primers are then extended to form complementary copies of the target strands. In some embodiments, the primers are designed so that the position at which each primer hybridizes along a duplex sequence is such that an extension product synthesized from one primer, when separated from the template (complement), serves as a template for the extension of the other primer. The cycle of denaturation, hybridization, and extension is repeated as many times as necessary to obtain the desired amount of amplified nucleic acid.
[0108] In some embodiments, the target nucleic acid molecule is DNA or RNA, including messenger RNA (mRNA), wherein DNA or RNA may be single stranded or double stranded. In the event that the target nucleic acid is RNA, enzymes, and / or conditions optimal for reverse transcribing the template to DNA may be utilized. In some embodiments, the target nucleic acid molecule is a DNA-RNA hybrid. In some embodiments, a mixture of target nucleic acids are used. In some embodiments, the target nucleic acid molecule is a nucleic acid produced in a previous amplification reaction. In some embodiments, the target nucleotide sequence to be amplified is a fraction of a larger molecule or can be present initially as a discrete molecule, such that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form; it may be a minor fraction of a complex mixture, such as contained in whole genomic DNA.
[0109] In some embodiments, the primers used in the amplification by PCR according to the method of the invention are oligonucleotides of sufficient length and appropriate sequence which provides specific initiation of polymerization of a significant number of nucleic acid molecules containing the target nucleic acid under the conditions of stringency for the reaction utilizing the primers. In this manner, it is possible to selectively amplify the specific target nucleic acid containing the nucleic acid sequence of interest. The oligonucleotide primer typically contains 15-22 or more nucleotides, although it may contain fewer nucleotides as long as the primer is of sufficient specificity to allow essentially only the amplification of the specifically desired target nucleotide sequence (i.e., the primer is substantially complementary).Microfluidic impedance cytometry
[0110] In some embodiments the method of detecting the presence, concentration, or a combination thereof, of at least one nucleic acid comprises comprises microfluidic impedance cytometry. In some embodiments, the method comprises microfluidic impedance cytometry using the device and system described herein. In some embodiments, the method comprises detecting the presence, concentration, or a combination thereof of a nucleic acid by microfluidic impedance cytometry using the device and system described herein. In some embodiments, the method comprises detecting the presence, concentration, or a combination thereof, of one or more target nucleotide sequence amplified by PCR by microfluidic impedance cytometry using the device and system described herein.
[0111] In some embodiments, the method comprises using microfluidic device 100 and / or system 200 for microfluidic impedance cytometry. In some embodiments, the method comprises the steps of pipetting or depositing a solution into inlet 110, flowing the solution through channel 114 across electrodes 120, producing one or more signals to at least one electrode of electrodes 120, and measuring rate of impedance change of the solution at one or more excitation frequencies. In some embodiments, the solution comprises a nucleic acid in a buffer. In some embodiments, the solution comprises a nucleic acid in water. In some embodiments, the solution comprises amplified nucleotide sequences. In some embodiments, the solution comprises the product of allele-specific amplification. In some embodiments, the solution comprises PCR products.
[0112] In some embodiments, the solution comprises nucleic acids in a concentration between 1 ng / pL and 100 pg / pL. In some embodiments, the solution comprises nucleic acids in a concentration of about 33 ng / pL. In some embodiments, the solution comprises nucleic acids in a concentration of about 100 ng / pL.
[0113] In some embodiments, the method comprises depositing Ipl to lOpl of the solution into inlet 110. In some embodiments, the method comprises depositing 5 pl of the solution into inlet 110.
[0114] An impedance alteration occurs gradually as a nucleotide sequence in solution moves from inlet 110 to outlet 112. In some embodiments, the method comprises measuring impedance alteration, change in impedance, and / or rate of impedance change. In some embodiments, the one or more signals or excitation frequencies comprise a plurality of different excitation frequencies, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different excitation frequencies. In some embodiments, each excitation frequency ranges between 1 kHz and 10 MHz. In some embodiments, the excitation frequencies are selected from 10 kHz, 50 kHz, 100 kHz, 250 kHz, 500 kHz, 1 MHz, 2 MHz, and 3 MHz.
[0115] In some embodiments, the overall impedance of the digital genotyping sensor is given by Equation (1):Where Zcpar= ( coCpar)'1, Zcdi = ( coCdi ) , and Zcdi = ( coCdi)'1.
[0116] In some embodiments, the rate of change of impedance of the digital genotyping sensor is given by Equation (2):(2)
[0117] In some embodiments, the method comprises determining the concentration of a nucleic acid in the sample based on the rate of change of impedance of the digital genotyping sensor. In some embodiments, the nucleic acid concentration is given by Equation (3):Nucleic Acid Concentration oc —dZsensorKd Isensor dt dt(3)-Methods of Diagnosis and Treatment
[0118] In some embodiments, the invention provides a method of identifying a subject as homozygous or heterozygous for an allele, or a method of genotyping a subject. In some embodiments, the allele is a variant allele comprising at least one genetic mutation as compared to a wild-type nucleotide sequence. Exemplary genetic mutations include but are not limited to insertions, deletions, and single nucleotide polymorphisms (SNPs.) In some embodiments, the allele comprises a disease associated genetic mutation. In some embodiments, the method comprises diagnosing a subject as subject as having, or being at increased risk of developing, a disease or disorder associated with being homozygous or heterozygous for a disease associated genetic mutation. In some embodiments, the method comprises treating a subject diagnosed with a disease or disorder associated with being homozygous or heterozygous for a disease associated genetic mutation.
[0119] In some embodiments, the method of identifying a subject as homozygous or heterozygous for a variant nucleotide sequence comprises obtaining a nucleic acid sample from a subject, contacting at least a first portion of the sample with first set of allele-specific primers to generate a first primer / target mixture and at least a second portion of the sample with a second set of allele-specific primers to generate a second primer / target mixture, wherein at least one set of allele-specific primers is specific for amplification of a “wild-type” allele and at least one setof PCR primers is specific for amplification of a variant allele, performing amplification of both the first and second primer / target mixtures to generate a first and second PCR reaction comprising potential allele-specific amplification products; applying at least a portion of the first and second PCR reaction mixture to an electrical genotyping device, and calculating an impedance output response by microfluidic impedance cytometry for each of the first and second PCR reaction mixture. In some embodiments, a subject is identified as homozygous for an allele when amplified PCR products are detected in only a single allele-specific PCR reaction mixture. In some embodiments, a subject is identified as homozygous for a wild-type nucleotide sequence when only a wild-type nucleotide sequence is detected in the sample. In some embodiments, a subject is identified as homozygous for a variant nucleotide sequence when only a variant nucleotide sequence is detected in the sample. In some embodiments, a subject is identified as heterozygous for a variant when both a variant nucleotide sequence and wild-type nucleotide sequence are identified in the sample.
[0120] In some embodiments, the method comprises identifying a subject as homozygous or heterozygous for a variant nucleotide sequence in a disease-associated gene. Variants in disease-associated genes include, but are not limited to, those identified in the art as risk factors, pathogenic, likely pathogenic, having uncertain significance, likely benign, or benign. In some embodiments, the variant in a disease associate-gene is selected from transthyretin (TTR) c.424G>A (p.Vall42Ile), TTR c, 148G>A (p.Val50Met), rsl0757278, CFTR c, 1520_1522delTCT, (p.Phe508del), APOL1 c, 1024A>G (p.Ser342Gly) and c.l 152T>G (p.Ile384Met) (“Gl variant”), APOL1 c.H64_1169del (p.Asn388_Tyr389del) (“G2 variant”), and the common sickle cell mutation HBB c.20A>T (p.Glu7Val).
[0121] In some embodiments, the method comprises identifying variants in the nucleotide sequence of the transthyretin (TTR) in a subject. In some embodiments, the method identifying the presence of the variant c.424G>A, p.V142I (aka V122I) TTR allele in a subject. In some embodiments, the method comprises obtaining a sample from a subject, identifying the presence of the V122I TTR allele in the sample and / or identifying the presence of wild-type TTR allele in the sample, and identifying the subject as homozygous or heterozygous for the V122I TTR allele. In some embodiments, the method comprises diagnosing the subject as having, or being at increased risk of developing transthyretin amyloidosis (ATTR) or a disease or disorder associated therewith. Other diseases associated with altered levels or function of the TTR gene,include, but are not limited to, senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), and familial amyloid cardiomyopathy (FAC). Subjects that are heterozygous for the VI 221 TTR allele may develop a disease or disorder associated therewith, such as ATTR, later than those that are homozygous or the variant VI 221 TTR allele.
[0122] In some embodiments, the method comprises treating a subject diagnosed with a disease or disorder associated with a variant nucleotide sequence. In some embodiments, the method comprises administering a treatment or therapeutic agent to the diagnosed subject. As used herein, the term “therapeutic agent” includes agents that provide a therapeutically desirable effect when administered to an animal (e.g., a mammal, such as a human). The agent may be of natural or synthetic origin. For example, it may be a nucleic acid, a polypeptide, a protein, a peptide, or an organic compound, such as a small molecule. The term “small molecule” includes organic molecules having a molecular weight of less than about, e.g., 1000 amu. In one embodiment a small molecule can have a molecular weight of less than about 800 amu. In another embodiment a small molecule can have a molecular weight of less than about 500 amu. Such a therapeutic agent may be formulated as pharmaceutical composition and administered to a subject, such as a human patient, in a variety of forms adapted to the chosen route of administration, e.g., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.
[0123] In certain embodiments, the treatment or therapeutic agent is salt restriction, loop diuretics (e.g., torsemide, bumetanide), aldosterone antagonists, angiotensin inhibitors, angiotensin receptor blockers, beta blockers, calcium channel blockers, digoxin, midodrine, and venous compression stockings. In certain embodiments, the treatment or therapeutic agent is an agent to treat or prevent a comorbid condition or complication of transthyretin amyloidosis, for example, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, and cardiomyopathy and gastrointestinal features, occasionally accompanied by vitreous opacities and renal insufficiency. In some embodiments, the therapeutic agent is a transthyretin stabilizer. In some embodiments, therapeutic agent is tafamidis (Maurer, M. S. et al. New England Journal of Medicine. 2018;(379): 1007-1016). In some embodiments, the therapeutic agent is acoramidis (Gillmore, J. D. et al. New England Journal of Medicine. 2024;(390): 132-142).EXPERIMENTAL EXAMPLES
[0124] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0125] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, are not to be construed as limiting in any way the remainder of the disclosure.Example 1 : Allele-specific electrical genotyping for diagnosis of transthyretin amyloidosis
[0126] Clinical genetic testing usually takes days to weeks for results, yet patients could benefit from rapid and affordable tests available during an outpatient visit to a healthcare provider. This is particularly applicable to common and clinically actionable point mutations, including those linked to hereditary transthyretin (TTR) amyloidosis (ATTR). ATTR is a treatable cause of heart failure with a hereditary form that disproportionally affects patients of West African ancestry (Ruberg et al., 2019, J Am Coll Cardiol., Jun 11;73(22):2872-2891; Jacobson et al., 1997, N Engl J Med. 1997 Feb 13;336(7):466-73). The TTR variant c.424G>A, p.V142I (aka V122I) is pathogenic and occurs in 3-4% of individuals of West African ancestry. Despite a significant association with heart failure, clinical manifestations often precede diagnosis by years (Buxbaum et al., 2017, Genet Med. 2017 Jul;19(7):733-742; Papoutsidakis et al., 2018, J Card Fail. 2018 Feb;24(2): 131-133). V142I ATTR remains underdiagnosed in the US and other countries due to the lack of available information about the variant's clinical significance, coupled with the high cost of genetic diagnosis. Timely ATTR diagnosis is important now that effective ATTR-specific therapies are approved (Maurer et al., 2018, N Engl J Med. 2018 Sep 13 ;379(11): 1007-1016) or in clinical trials (Adams et al., 2018, N Engl J Med. 2018 Jul 5 ; 379( 1 ) : 11 -21 ; Solomon et al . , 2019, Circulation. 2019 Jan 22; 139(4) :431 -443 ; Shah,2019, Circulation, Jan 22;139(4):444-447). In response to this unmet need, a rapid molecular test to obtain a genetic diagnosis for TTR V142I from a drop of blood in less than 30 minutes was previously developed (Yale School of Medicine: Rapid Genotyping to Improve Patient Care; C. Anyika et al., The American Society of Human Genetics, 72nd Annual Meeting, Los Angeles, CA. October 2022). This approach combines allele-specific polymerase chain reaction (PCR) (Wu et al., 1989, PNAS. (86):2757-2760) and rapid gel electrophoresis to identify patients that are positive V142I heterozygous or homozygous, or negative (wildtype). The rapid TTR assay was employed in post-hoc analyses of a congestive heart failure (CHF) clinical trial, which found that 11% of African-Americans carried V142I in the TOPCAT trial (Papoutsidakis, N. et al.2020, medRxiv.) suggesting under-recognition of TTR-related heart failure in this cohort.
[0127] In this research, the objective was to substitute agarose gel-electrophoresis readout with electrical DNA detection, aiming to advance the development of point-of-care (POC) testing for cardiac amyloidosis. DNA detection using impedance-based biosensors provide a label-free alternative to fluorescent and colorimetric techniques (Kokabi et al., 2023, Biosensors (Basel), 13(3):316) with the added advantage of being easily miniaturized and inexpensive (Tayyab et al., 2022, Sci. Rep., 12(l):20119; Chin et al., 2012, Lab. Chip, 12(12), 2118-34). Electric DNA detection in conjunction with microfluidics have been employed for the detection of mitochondrial DNA (Sui et al., 2021, Sci Rep. 1 l(l):6490), clinical pathogens (Tayyab et al., 2023, Sci Adv. 9(36):eadi4997), and cancer biomarkers (Javanmard et al., 2009, Transducers, 947-950).
[0128] A method for electrical genotyping of known DNA variants is presented, combining allele-specific polymerase chain reaction (ASPCR) and microfluidic impedance cytometry at different excitation frequencies. Using passive flow of PCR products in solution passing the gold electrodes in a microfluidic channel, the amount of DNA can be accurately quantified using impedance-based electrical detection. A direct correlation between the gradual impedance change and DNA concentrations was observed. Experiments investigating impedance response across eight different frequencies identified an optimal frequency range for DNA detection at the lower end of the spectrum, between 10-250 kHz. Building upon these findings, a robust DNA quantification score was devised that consolidates impedance measurements from four frequencies within this range. Additionally, the efficacy of microfluidic impedance cytometry for DNA eluted in water and buffer was assessed, identifying differences betweenthese solutions and demonstrating that varying DNA concentrations in buffer are more readily distinguishable. The application of this technology for detecting a prevalent point mutation in the TTR gene (V142I) was emphasized. TTR V142I genotypes identified in six patients (four heterozygous, two wildtype) using electrical impedance were 100% concordant with results from gel electrophoresis and sequencing.
[0129] Impedance-based detection of DNA molecules in solution has been documented, yet previous studies did not distinguish between different sequences (Liu et al., 2008, Appl. Phys. Lett., 92(14) 143902). In prior work, multifrequency impedance spectroscopy for the quantification and sizing of DNA fragments was reported (Sui et al., 2021, Scientific reports,! 1(1) 6490). However, this method required linking PCR products to paramagnetic beads, thereby escalating the cost and complexity of the experimental protocol and limiting its feasibility in low-income settings. Consequently, this study focused on detecting specific DNA fragments directly in solution using label-free impedance-based technology.DNA sample preparation
[0130] Allele-specific PCR amplification was performed using oligonucleotide primers designed to selectively amplify the ancestral and variant allele of TTR c.424G>A (p.Vall42Ile). These primers used are: TTR-424G (CATTCCTTGGGATTGGTTAC, SEQ ID NO:1), TTR- 424A (CATTCCTTGGGATTGGTTAT, SEQ ID NO:2) and the common reverse primer TTR- 424R (TGGGAAGAATGTTTCCAGCTC, SEQ ID NO:3). The PCR product length for both was 538 bp. Four patient samples heterozygous for TTR V142I were studied, two samples negative for this variant and two no-template control samples. All samples were amplified under the same PCR conditions and amplification products were inspected on a 1.5% agarose gel. PCR products were purified using a QIAquick PCR purification kit (Qiagen Inc.) following manufacturer’s recommendations. The purified PCR products were eluted either in water or elution buffer and quantified using the Qubit 3 fluorometer as per the manufacturer’s recommendations. Aliquots for each sample were run on the Agilent bioanalyzer to ensure sample purity and removal of primer dimers (Fig. 6). Samples were prepared at an approximate final concentration of lOOng / pl.Microfluidic chip fabrication
[0131] The microfluidic chip has embedded gold electrodes and was built of PDMS on a glass surface. The initial stage in creating the microfluidic chip included patterning and creating the electrodes on the glass wafer. A 3" fused silica wafer was used to manufacture electrodes on glass using conventional photolithography. The steps in the procedure include liftoff processing, electron beam metal evaporation, and photo-patterning resist on the fused silica wafer. Wafer cleaning, spin coating of the photoresist, soft baking of the resist, exposure to ultraviolet light via a chromium mask printed on a 4 by 4 glass plate, development of the resist, and hard baking of the resist are all steps in the photo-patterning process. After photo patterning, an electron beam evaporation technique deposits a 100-nm-thick coating of gold on the substrate. For better gold adherence to the glass wafer, a 10-nm coating of chromium was utilized; otherwise, the gold film was readily tom off. Due to its inertness and resistance to corrosion, gold was selected as the electrode. The electrodes were 20 pm wide, with a 15 pm gap between each electrode.
[0132] Using soft lithography, the microfluidic channel was created in PDMS (Polydimethyl siloxane). On a 3" silicon wafer that serves as a master mold, a layer of SU-8 was patterned. Standard cleaning, spin coating, soft baking, exposure, development, and hard baking are all steps in the SU-8 photo-patterning process. Following the creation of the master mold, PDMS (10: 1 prepolymer / curing agent) was applied to the master mold, which was then baked at 80°C for two hours to cure it. Then, the PDMS channel was separated from the mold. The entrance and outflow were then formed by punching two holes, one measuring 5 mm and the other 3 mm. After both substrates had received oxygen plasma treatment, the PDMS substrate was then positioned and adhered to the electrode chip. The irreversible bond was then created by baking the chip for 40 minutes at 70 °C. Our microfluidic channel was 20 pm wide and 15 pm tall.Multifrequency impedance spectroscopy
[0133] The microfluidic chip with the integrated gold electrodes was treated with air plasma at 800 mTorr for 90 s to make the microfluidic channel hydrophilic. The gold electrodes on the chip were connected to a commercial benchtop impedance spectroscope (Zurich Instruments, HF2IS) by passing the signal through a programmable commercial transimpedance amplifier (Zurich Instruments, HF2TA). The impedance spectroscope can operate at up to 8 multiple excitation frequencies. The electrical parameters chosen for the impedance spectroscopeare presented here. The frequencies chosen for these experiments were chosen in the range of 10 kHz to 3 MHz, with the specific frequencies as 10 kHz, 50 kHz, 100 kHz, 250 kHz, 500 kHz, 1 MHz, 2 MHz, 3 MHz respectively. The excitation voltage has a direct correlation with the demodulated signal which means the higher the excitation voltage, the higher the demodulated signal. However, it was found through experimentation that at 8 excitation frequencies, a high voltage damages the electrodes. Hence, 1 V was chosen as the excitation voltage level for each of the 8 frequencies. Since a gradual change in the impedance due to the change in the solution resistance and the dielectric capacitance due to the presence of DNA in solution was being measured, the cut-off frequency of the low pass filter of the impedance spectroscope was set to 7 Hz. A transimpedance gain of 1 kV / A was selected for the programmable transimpedance amplifier (Zurich Instruments, HF2TA).Experimental protocol
[0134] 5 pl deionized (DI) water was injected into the microfluidic channel and the baseline signal was observed on the graphical user interface for the commercial impedance spectroscope. The interface provides a real time measurement result for the demodulated signal in the form of baseline voltage. Once the baseline voltage was stabilized and any transient changes die down, the demodulated signal was recorded for 120 seconds. After 120 seconds, the sample to be tested was pipetted in the inlet of the microfluidic sensor. The data was then recorded for 600 seconds, bringing the total experiment time for a single experiment to approximately 720 seconds. All experiments were performed in the Faraday cage to prevent any electromagnetic interference from the environment.Data analysis
[0135] The data was recorded from the commercial benchtop impedance spectroscope (Zurich Instruments, HF2IS) and stored in .csv files in a spreadsheet format on a personal computer. The data analysis was done offline on the personal computer after the dataset had been recorded. A code developed in MATLAB, R2021b was used for the data analysis. The impedance data recorded from the sensor was in a I (in-phase) and Q (quadrature) format in the form of voltage. The I and Q channels are squared and added together to obtain the magnitude ofthe recorded data. The dataset was inspected such that the baseline was stable for the first 2 minutes when there was only DI water in the microfluidic chip. Once the data had been inspected, the analysis was performed, which comprised of a normalization step followed by a linear regression to compute the slopes of the latter part of the measurement. The data was normalized according to the mean of the first 120 seconds of the baseline voltage. Then, only the multifrequency data after the initial 300 seconds have passed was considered. A linear regression was performed on this part of the dataset and the slopes were computed for the straight lines that were fitted through the data. These slopes are significantly higher for the samples containing DNA than that of the negative control, where no DNA is present. Furthermore, a DNA quantification score was developed by adding the slopes for the first 4 lower frequencies: 10 kHz, 50kHz, 100 kHz, 250 kHz.System overview
[0136] A method for the digital genotyping of TTR V142I using allele-specific polymerase chain reaction (PCR) and passive-flow microfluidic impedance cytometry at different excitation frequencies is presented. The custom microfluidic chip (Fig. 1A) is made of polydimethylsiloxane (PDMS) bonded to a glass wafer with gold electrodes. The gold electrodes are patterned on the glass wafer through standard lithographic techniques and the gold is later deposited using electron beam deposition. The PDMS chip is made using a master mold on silicon and the PDMS chip and holes are punched in for the inlet and outlet of the chip. The PDMS is bonded to the glass wafer using air plasma and subsequent thermal baking of the wafer. The DNA solution and DI water is pipetted into the inlet and the solution is allowed to flow over the microfluidic channel between the gold electrodes to measure the impedance at eight different frequencies. A photograph of multiple microfluidic chips bonded on the glass wafer with the gold electrodes is shown in Fig. IB. A single 3” wafer can accommodate six microfluidic chips with the current placement configuration on the wafer. Fig. 2 is an illustration of the electronic readout system used for the microfluidic chip with integrated gold electrodes. This system comprises a commercial benchtop impedance spectroscope, a transimpedance amplifier, the custom microfluidic chip with the integrated gold electrodes, and a personal computer for data storage and analysis. The impedance spectroscope has in-built function generators that provide the excitation signals for the microfluidic chip at eight different frequencies.
[0137] These eight excitation signals at different frequencies are set to operate within the range of 10 kHz to 3MHz and are divided into two signal paths. One of these signal paths is external to the impedance spectroscope and is connected to only one of the two gold electrodes on the microfluidic chip. The second signal path is connected internally to a mixer, which is part of the internal demodulator of the impedance spectroscope. The other gold electrode in the electrode pair of the microfluidic chip is connected to a transimpedance amplifier to convert the current passing through the microfluidic chip into a voltage which can be demodulated and measured. The transimpedance amplifier is a critical component in the system. A commercial transimpedance amplifier with a programmable transimpedance gain from provides low noise performance. The output from the transimpedance amplifier is fed back into the impedance spectroscope’s input, where it is demodulated digitally by mixing with the original excitation signal and then subsequently low pass filtering. The parameters for the low pass filter and the analog-to-digital converter can be set from the graphical user interface (GUI) of the impedance spectroscope. The low-pass filter is set up to minimize noise while also ensuring a clear signal for the gradual impedance change, that is measured, which indicates the presence of DNA in the solution. The data collected from the experiments regarding the impedance changes is subsequently stored in a personal computer. It is then post-processed using an algorithm to determine the rate of impedance change.Principle of detection - the electrical model
[0138] The microfluidic chip’s cross-sectional view can be seen in Fig. 1C. The solution to be measured is pipetted into the inlet and the fluid flows under the action of capillary flow towards the outlet. One electrode is connected to the output of the impedance spectroscope, which provides the excitation voltage for the microfluidic chip. The other electrode is connected to the input of the transimpedance amplifier which amplifies the signal and passes it to the input of the impedance spectroscope where it is again demodulated. Fig. ID shows a microscopic image of the microfluidic chip with the critical dimensions of the digital genotyping sensor. The gold electrodes are 20 pm wide and there is a 15 pm gap between the two electrodes. The microfluidic channel itself is 20 pm wide and 15 pm in height. It is important to understand the operation of the microfluidic impedance-based sensor as well as the various parameters that affect the impedance of the microfluidic sensor. Fig. 1C presents a basic electrical model of thesensor and models the major capacitances and resistances associated with the structure of the electrical sensor. Cpar is the parasitic capacitance associated with the electrodes on the glass wafer. The Cpar is an unwanted parameter, and its effects should be minimized during impedance measurements. Cdl is the double layer capacitance which is formed due to the ion barrier formed in a solution when a solution is subjected to an electrical field. The electrical field creates a charge ion distribution that exhibits capacitance characteristics which negatively impacts impedance measurements. When performing impedance-based measurements, focus should be on the impedance of the solution itself, which can be seen in the Fig. 1C as Rsol, the solution resistance. The solution resistance is directly affected by the conductivity of the solution present in the sensing region of the biosensor. Furthermore, another capacitance was also modelled for the measurement of nucleic acid (e.g., DNA). As nucleic acid is a negatively charged molecule, it alters the ion distribution around itself, creating characteristics akin to a dipole and generating capacitance-like features. This is modeled in our electrical model as Cdi which is the dipole capacitance.
[0139] The impedance-based sensor functions are based on the principle that the conductivity of the nucleic acid solution differs from that of a basic buffer or negative control solution. The nucleic acid affects the Cdi capacitance to modify the impedance of the overall sensor. The impedance alteration occurs gradually as the nucleic acid in the solution moves from the inlet to the outlet. Over time, the concentration of nucleic acid in the sensing region varies, manifesting as a rate of impedance change.
[0140] The overall impedance of the sensor is given by Equation (1):Where ZcPar = ( coCpar / 7, Zea = coCdi / 7, and Zcdi = ( coCdt)'1. Of these capacitances, of note is the change in the impedance due to the Rsoi || Zcdi component of the impedance. More specifically, the rate of change of the impedance due to this component is of interest, which can be represented by Equation (2):(2)
[0141] Equation (2) can be considered as a slope of the impedance response and the slope of the impedance response will determine the concentration of nucleic acid in solution. The more negative the slope of the impedance response, the higher will be the concentration of the nucleic acid in the sensor. And by ohm’s law Z = V / 'I , therefore the current will be inversely proportional to the impedance. Equation (3) represents this mathematically:(3)
[0142] The output response from the sensor is current converted to voltage that is recorded using an analog to digital converter. The rate of change of the current and in turn, the output voltage will be directly related to the concentration of the nucleic acid in the sensing region of the sensor. Therefore, the slope indicates the amount of nucleic acid present in the solution. The experimental protocol is thus designed to consider the rate of change of impedance response.Comparison between high and low excitation frequencies
[0143] Fig. 3A shows a comparison between the DNA in two types of solutions (water and buffer) with the respective solution as negative control with a frequency of excitation as 10 kHz. From this graph, it is evident that the DNA in solution would yield a steeper slope for the output voltage response compared to the sample with the respective negative control. Fig. 3B indicates the same output responses at the higher end of the spectrum at 3 MHz. The slopes of the responses adhere to the initial assumption that the slope will be higher when DNA is present. However the responses are much closer together and more difficult to differentiate from the negative control at higher frequency. Hence, it is advisable to maintain the frequency range of interest towards the lower end of the spectrum during experimentation. To get a complete pictureof how the DNA concentration affects the output response, four experiments were performed for each concentration of DNA in water: 100 ng / pl, 50 ng / pl, 33 ng / pl, and 10 ng / pl.Comparison between DNA in aqueous solution vs. DNA in buffer solution
[0144] The impedance response of DNA eluted in water and DNA eluted in buffer (Fig. 4) show a direct correlation for the amount of DNA present in water and in buffer and with the computed slopes of the output response. Moreover, improved separation of samples containing different amounts of DNA was observed at lower excitation frequency. There are also some clear differences when DNA is quantified in aqueous solution vs. buffer solution. First the slopes of the output response are consistent for both water and buffer and the concentration of DNA is directly correlated with the slope. Second, the negative control / No template control is easily distinguishable at all four concentrations tested, although input at 10 ng / pl shows some irregularity. Third, and perhaps most importantly, the graph for DNA eluted in buffer solution has a smaller standard deviation and generally follows a linear trend. As a result, the data for DNA in buffer is less noisy, and the different concentrations may be easier to distinguish compared to cases where DNA is eluted in water. Furthermore, the slope for the no template control in the buffer solution generates a negative slope leading to a clear distinction between the no template / DNA control from samples that contain DNA that generate a positive slope. Based on these results, further tests were performed with DNA in buffer solution at concentrations greater than lOng / pl. Since the lower excitation frequencies performed better at distinguishing the samples with varying amounts of DNA, the lower four frequencies (10 kHz, 50 kHz, 100 kHz, and 250 kHz) were chosen to form a quantification score.Testing clinical samples for TTR V142I
[0145] Based on results in the assay validation, analysis of clinical samples was performed by eluting the DNA in buffer solution. DNA samples from six patients were tested including four patients heterozygous for TTR V142I and two patients negative for this variant. The values obtained from the slopes with the negative control / no template DNA samples and the positive patient samples were used to generate a quantitative score. Each DNA sample was run induplicate and both replicates were tested using gel electrophoresis and using microfluidic impedance cytometry.
[0146] Fig. 5 shows the TTR V142I genotyping results for six patient DNA samples using agarose gel electrophoresis and the quantification score calculated from the impedance output responses. Each patient sample was tested for the ancestral and the variant allele for TTR V142I. Genotyping results for both detection platform were in concordance and in agreement with the known genotypes in all six samples. Patients 1 through 4 are heterozygous for the variant and the wild type allele. Notably, the DNA quantification score corresponded well with the actual DNA concentrations in each sample. This is in line with observations from previous experiments where the response for different DNA concentrations were evaluated and compared to the negative control. Patients 5 and 6 are homozygous references with a DNA quantification score for the variant allele being similar to that of the negative control sample. These results demonstrate the ability of electrical impedance to correctly identify the TTR VI 421 genotype.
[0147] The sensing region of the sensor can increase the sensitivity for DNA detection. This will lead to a relative higher local DNA concentration resulting in a larger change in impedance. Another approach to increase sensitivity is by employing different channels and multiple electrodes. This will effectively increase the signal to noise ratio by utilizing techniques from the established techniques in wireless communication systems. In order to utilize this technology in a field setting, it must be economically feasible and reasonably portable to make it accessible. Interestingly, there exists a precedent for miniaturizing the electronics for the lock in amplification (Tayyab et al., 2022, Sci. Rep., 12(1 ):20119; Furniturewalla et al., 2018, Microsyst Nanoeng, 4(1), 20; Ahuja et al., 2019, Microsyst Nanoeng, 5(1), 34) and these can be readily adapted for use with our application for detecting common pathogenic TTR variants. Replacing the gel-electrophoresis readout with an electronic DNA detector provides an opportunity for further development of a point-of-care tool for cardiac amyloidosis testing. For example, in combination with point-of-care ultrasound echocardiography using the iPhone-based Butterfly iQ system to measure LV thickness, ejection fraction, and diastolic function, companion digital genotyping of TTR V142I could provide an inexpensive point-of-care screening for ATTR patients with global opportunities in resource-constrained settings. While this study focused on TTR V142I, this method can be adapted and scaled to include other pathogenic variants. The capacity to produce multiple chips on a single wafer at low cost and high precision offers anavenue for enhancing the scalability of this technology and expand its utility in multiplex electrical genotyping applications.
[0148] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
Attorney Docket No. 047162-5386-00WOCLAIMSWhat is claimed is:
1. A microfluidic device, comprising: at least one chip comprising an inlet and an outlet with a channel extending therebetween; a bottom layer positioned under the chip forming a bottom for the device; and a pair of electrodes formed on the bottom layer and positioned across the channel.
2. The microfluidic device of claim 1, wherein each electrode has a height ranging between 50 nm and 250 nm, and a width ranging between 1 pm and 50 pm, and each electrode is separated by a distance ranging between 1 pm and 50 pm.
3. The microfluidic device of claim 2, wherein each electrode is formed from a bottom portion comprising one or more layers of chromium, and a top portion comprising one or more layers of gold.
4. The microfluidic device of claim 3, wherein the channel has a height ranging between 1 pm and 50 pm and a width ranging between 1 pm and 50 pm.
5. The microfluidic device of claim 4, wherein the at least one chip is formed from polydimethylsiloxane (PDMS) and the layer is formed from glass.
6. The microfluidic device of claim 5, wherein the at least one chip comprises a plurality of chips arranged in a radial pattern on the layer.
7. A microfluidic system comprising: at least one microfluidic device of claim 1-6; a signal generator electrically connected to a first electrode of the pair of electrodes; an amplifier electrically connected to a second electrode of the pair of electrodes; a spectroscope electrically connected the amplifier; and a computing device communicatively connected to the spectroscope, configured to receive data from the spectroscope.
8. The microfluidic system of claim 9, wherein the signal generator provides a plurality of excitation signals to the first electrode, the amplifier transforms the signal of the second electrode from current to voltage, the spectroscope demodulates the signal by mixing with the original excitation signal and passes the signal to the computer to calculate rate of impedance change of a sample in a solution passing across the electrodes in the channel.
9. The microfluidic system of claim 10, wherein the plurality of excitation signals comprises signals produced at one or more frequencies and voltages.
10. The microfluidic system of claim 11, wherein the frequencies range between 10 kHz and 3 mHz, and the voltages range between 0.1 V and 10 V.
11. The microfluidic system of claim 11, wherein the frequencies are 10 kHz, 50 kHz, 100 kHz, 250 kHz, 500 kHz, 1 MHz, 2 MHz, 3 MHz, each provided at 1 V.
12. A microfluidic system comprising: at least one microfluidic device of any one of claims 1-6; a computing device connected to each microfluidic device comprising a non- transitory computer readable medium having software instructions stored thereon that when executed by a processor cause the processor to execute steps comprising: a. providing the first electrode of the chip with a plurality of excitation signals; b. calculating an impedance output response based on a signal from the second electrode as a sample in a solution flows across the electrodes in the channel; and c. calculating a quantification score based on the impedance output response.
13. The system of claim 12, wherein the step of calculating an impedance output response comprises measuring impedance change and calculating rate of impedance change.
14. A method of detecting at least one nucleic acid molecule in a sample by microfluidic impedance cytometry using the device of any one of claims 1-6 or system of any one of claims 7-13.
15. A method of detecting a target nucleotide sequence in a sample, comprising: a. amplification of the target nucleotide sequence by polymerase chain reaction (PCR); and b. calculating an impedance output response by microfluidic impedance cytometry using the device of any one of claims 1-6 or system of any one of claims 7-12.
16. The method of claim 14 or 15 wherein the sample is a biological sample.
17. The method of claim 16 wherein the sample is blood.
18. The method of any one of claims 14-17, wherein the step of amplification of the target nucleotide sequence by PCR comprises contacting the sample with at least one amplification primer specific for hybridizing to the target nucleotide sequence, and a reverse primer.
19. The method of any one of claims 14-18, wherein the step of calculating an impedance output response comprises measuring impedance change and calculating rate of impedance change.
20. A method of identifying a subject as being homozygous or heterozygous for a variant nucleotide sequence as compared to a wild-type nucleotide sequence, comprising a. obtaining a sample from the subject; and b. detecting at least one nucleotide sequence in the sample using the method of any one of claims 14-18, wherein the subject is identified as homozygous for a wild-type nucleotide sequence when only a wild-type nucleotide sequence is detected in the sample, the subject is identified as homozygous for a variant allele when only a variant nucleotide sequence is detectedin the sample, and the subject is identified as heterozygous for a variant when both a variant nucleotide sequence and wild-type nucleotide sequence are identified in the sample.
21. The method of claim 20, wherein the variant nucleotide sequence is a disease-associated variant allele.
22. The method of claim 21, wherein the variant nucleotide sequence is a transthyretin 424G>A variant.
23. The method of any one of claims 20-22, wherein the method further comprises diagnosing the subject as having a disease or disorder or having an increased risk of developing a disease or disorder.
24. The method of claim 23, wherein the disease or disorder is selected from the group consisting of transthyretin (TTR) amyloidosis, senile systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP), and familial amyloid cardiomyopathy (FAC).
25. The method of claim 23 or claim 24, wherein the method further comprises administering a treatment or therapeutic agent to the subject diagnosed as having a disease or disorder or having an increased risk of developing a disease or disorder.
26. The method of claim 25, wherein the therapeutic agent is a transthyretin stabilizer.
27. The method of claim 26, wherein the therapeutic agent is tafamidis or acoramidis.