Double-stranded RNA targeting pcsk9 and use thereof

Double-stranded RNA targeting PCSK9 is developed to inhibit PCSK9 expression and proliferation, addressing the need for effective treatments for diseases associated with PCSK9 by inducing RNAi and forming stable complexes to cleave target RNA, thus providing therapeutic benefits for cancer and hypercholesterolemia.

WO2026141238A1PCT designated stage Publication Date: 2026-07-02TOAGOSEI CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/044697
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-24
Filing Date
2025-12-22
Publication Date
2026-07-02

Smart Images

  • Figure JP2025044697_02072026_PF_FP_ABST
    Figure JP2025044697_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides double-stranded RNA that can be used in treatment of at least one type of disease. Double-stranded RNA disclosed herein includes a first strand and a second strand. The first strand includes a main sequence. The second strand includes a complementary sequence that complementarily binds to the main sequence. The main sequence comprises any of the base sequences represented by SEQ ID NO: 1-5.
Need to check novelty before this filing date? Find Prior Art

Description

Double-stranded RNA targeting PCSK9 and its use

[0001] The present disclosure relates to double-stranded RNA targeting PCSK9 (Proprotein Convertase Subtilisin / Kexin type 9) and its use. This application claims priority based on Japanese Patent Application No. 2024-226862 filed on December 24, 2024, and the entire contents of that application are incorporated herein by reference.

[0002] PCSK9 is known to be involved in the progression of various cancers and cholesterol metabolism. For example, Wang et al., “PCSK9 promotes tumor cell proliferation and migration by facilitating CCL25 secretion in esophageal squamous cell carcinoma”, Oncology Letters, volume 26, issue 5, Article Number 500, 2023 discloses the relationship between esophageal cancer and PCSK9. In addition, Japanese Patent Publication No. 2016-506240 discloses an RNAi agent targeting the PCSK9 gene.

[0003] Japanese Patent Publication No. 2016-506240

[0004] Wang et al., “PCSK9 promotes tumor cell proliferation and migration by facilitating CCL25 secretion in esophageal squamous cell carcinoma”, Oncology Letters, volume 26, issue 5, Article Number 500, 2023

[0005] Incidentally, the present inventors intend to provide double-stranded RNA that can be used to treat at least one type of disease. Double-stranded RNA can be an active ingredient in nucleic acid drugs. Examples of nucleic acid drugs include cell proliferation inhibitors that suppress cell proliferation (e.g., anticancer drugs), and therapeutic agents for diseases in which PCSK9 may be associated.

[0006] As one aspect of this technology, a double-stranded RNA targeting PCSK9 is provided. In some embodiments, the double-stranded RNA comprises a first strand containing a main sequence and a second strand containing a complementary sequence that binds complementaryly to the main sequence. The main sequence consists of any of the following nucleotide sequences: CACUGCUCUGCUGCUCUGCU (SEQ ID NO: 1); CCUGGUGGCGCUCUGCCCACU (SEQ ID NO: 2); GGCCGCUCUCCACUGCCU (SEQ ID NO: 3); CGCUGCCCACUGCUGCCU (SEQ ID NO: 4); and GGUGGCCGCUCUCCACU (SEQ ID NO: 5). The double-stranded RNA can inhibit the proliferation of at least one type of cell. Therefore, the double-stranded RNA can be used, for example, as a component of a cell proliferation inhibitor.

[0007] In some embodiments, the first strand includes a first additional sequence consisting of a sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the main sequence, and the second strand includes a second additional sequence consisting of a sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the complementary sequence.

[0008] In some embodiments, the base sequence constituting the first additional sequence is thymine-thymine (TT). This can improve the stability of double-stranded RNA.

[0009] In some embodiments, the base sequence constituting the second additional sequence is thymine-thymine (TT). This can improve the stability of double-stranded RNA.

[0010] In some embodiments, the base sequence constituting the first chain is 19 to 27 bases, and the base sequence constituting the second chain is 19 to 27 bases.

[0011] In one aspect of this technology, a composition comprising the double-stranded RNA disclosed herein is provided. This composition can inhibit the proliferation of at least one type of cell.

[0012] One aspect of this technology provides a method for inhibiting the proliferation of at least one type of cell. This method includes the steps of preparing a composition disclosed herein and providing the composition to the cells.

[0013] Figure 1 is a graph showing the cell viability of each case in cell proliferation test 1. Figure 2 is a graph showing the cell viability of each case in cell proliferation test 2.

[0014] <Definition of Terms> Matters other than those specifically mentioned herein (e.g., the structure of double-stranded RNA) that are necessary for carrying out this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, constructs mainly composed of peptides and nucleic acids, etc.) can be understood as design matters of those skilled in the art based on prior art in fields such as cell engineering, physiology, medicine, pharmacy, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, and genetics. The technology disclosed herein can be carried out based on the contents disclosed herein and common technical knowledge in the relevant art.

[0015] In this specification, "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a polymer containing both deoxyribonucleotides and nucleotides is also included in the definition of "polynucleotide" in this specification. Furthermore, in this specification, "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (total length) does not exist naturally on its own, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).

[0016] In this specification, "first chain" and "second chain" refer to a sense chain (which may also be called a coded chain or passenger chain) and an antisense chain (which may also be called a template chain, non-coded chain, or guide chain). That is, if the first chain is a sense chain, the second chain is an antisense chain. Also, if the second chain is a sense chain, the first chain is an antisense chain.

[0017] In this specification, unless otherwise indicated by "5'" and "3'", the left side of a nucleotide sequence is always the 5' end and the right side is always the 3' end. Furthermore, in this specification, "amino acid residue" refers to the N-terminal and C-terminal amino acids of a peptide chain, unless otherwise specified. Also, in amino acid sequences described in this specification, the left side is always the N-terminus and the right side is always the C-terminus.

[0018] In this specification, "tumor" is a broad term encompassing carcinomas, sarcomas, and lesions of the blood and hematopoietic tissue (such as leukemia and lymphoma), including tumors in general (typically malignant tumors). "Tumor cell" is synonymous with "cancer cell," referring to cells that form such tumors, typically those that have abnormally proliferated independently of surrounding normal tissue (so-called cancerous cells). Therefore, unless otherwise specified, any cell classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or characteristics.

[0019] In this specification, when a numerical range is described as "A to B (where A and B are arbitrary numbers)," it means "A or greater and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and less than or equal to B," and "A or greater and less than B."

[0020] <Double-stranded RNA> The double-stranded RNA disclosed herein comprises a first strand and a second strand. In some embodiments, the first strand comprises a main sequence and a first addition sequence, and the second strand comprises a complementary sequence that binds complementaryly to the main sequence of the first strand and a second addition sequence. The first and second strands are hybridized in the main sequence and the complementary sequence. The first and second strands may be artificially synthesized polynucleotides. In some embodiments, the first and second addition sequences may be omitted.

[0021] The double-stranded RNA disclosed herein can function as PCSK9-targeting siRNA (small interfering RNA). That is, the double-stranded RNA disclosed herein can induce RNA interference (RNAi). RNAi is a gene silencing process that uses short double-stranded RNA such as siRNA to sequence-specifically suppress gene expression. Although not limited to the following mechanism, when siRNA is introduced into a cell, it forms a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to a homologous sequence of RNA (e.g., mRNA) containing the base sequence encoding the target protein (in this case, PCSK9). Subsequently, RISC can specifically cleave the RNA. This inhibits the translation of the target protein.

[0022] Although the detailed mechanism is unknown, the double-stranded RNA disclosed herein can suppress the proliferation of at least one type of cell when introduced into a cell. Therefore, the double-stranded RNA disclosed herein may be used as a cell proliferation inhibitor (e.g., an antitumor agent). Furthermore, since the double-stranded RNA disclosed herein can significantly suppress PCSK9 expression, it may be used as a therapeutic agent for diseases related to PCSK9 expression levels (e.g., hypercholesterolemia). In this specification, "therapeutic agent" includes drugs intended to reduce, improve, or cure the symptoms of a disease, as well as drugs intended to prevent or prevent the recurrence of a disease.

[0023] <First Strand> The main sequence of the first strand may consist of polynucleotides, which are polymers of ribonucleotides. In other words, the main sequence may consist of RNA. That is, the base sequence of the main sequence is typically represented by four letters: A (adenine), U (uracil), G (guanine), C (cytosine), or a, u, g, c. However, in the attached sequence listing, uracil may be represented by T (thymine).

[0024] The main sequence of the first strand may have the same sequence as a portion of the nucleotide sequence encoding PCSK9 (i.e., the nucleotide sequence of the CDS of PCSK9 mRNA). For example, the main sequence may include any of the following nucleotide sequences: CACUGCUCUGCUGUGCCUGUGCU (SEQ ID NO: 1); CCUGGUGGCGCUCGCUGUGCCACU (SEQ ID NO: 2); GGCCGCCUGUGCCACUGUGCCU (SEQ ID NO: 3); CGCUGCCACUGUGCCUGUGCU (SEQ ID NO: 4); and GGUGGCCGCCUGUGCCACUGCU (SEQ ID NO: 5). The main sequence may consist of only any of the nucleotide sequences shown in SEQ ID NOs: 1 to 5. Note that the nucleotide sequences shown in SEQ ID NOs: 1 to 5 may be composed of RNA.

[0025] The nucleotide sequences shown in SEQ ID NOs: 1 to 5 may have one or more nucleotides (e.g., two nucleotides) substituted with other nucleotides, within the range that the effects of this technology are achieved. Furthermore, the nucleotide sequences shown in SEQ ID NOs: 1 to 5 may have one or more nucleotides (e.g., two nucleotides) deleted and / or added (inserted), within the range that the effects of this technology are achieved. The main sequence may be a nucleotide analog such as a modified ribonucleotide, within the range that the effects of this technology are achieved.

[0026] Information on the nucleotide sequence encoding PCSK9 can be obtained from international databases. Examples of such international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniPlot, and Ensemble. For example, the nucleotide sequence of the mRNA encoding human PCSK9 is provided in NCBI under accession number NM_174936.4, etc. Sequence ID 6 shows the nucleotide sequence of the mRNA disclosed under accession number NM_174936.4. Sequence ID 7 shows the amino acid sequence of human PCSK9 based on the CDS (base sequence from start codon to stop codon) of the mRNA disclosed in accession number NM_174936.4. Human PCSK9 is a protein that contains a signal peptide. The base sequence encoding the signal peptide region is the base sequence from the 1st to the 90th base of the CDS of human PCSK9. Sequence ID 8 shows the base sequence encoding the signal peptide region of human PCSK9.

[0027] Based on the information from accession number NM_174936.4, the nucleotide sequence shown in SEQ ID NO: 1 is the nucleotide sequence from position 41 to 59 of the nucleotide sequence encoding human PCSK9 (the CDS of human PCSK9 mRNA). The nucleotide sequence shown in SEQ ID NO: 2 is the nucleotide sequence from position 26 to 44 of the CDS of human PCSK9 mRNA. The nucleotide sequence shown in SEQ ID NO: 3 is the nucleotide sequence from position 32 to 50 of the CDS of human PCSK9 mRNA. The nucleotide sequence shown in SEQ ID NO: 4 is the nucleotide sequence from position 35 to 53 of the CDS of human PCSK9 mRNA. The nucleotide sequence shown in SEQ ID NO: 5 is the nucleotide sequence from position 29 to 47 of the CDS of human PCSK9. The nucleotide sequences shown in SEQ ID NOs: 1 to 5 are all parts of the nucleotide sequence encoding the signal peptide region of PCSK9. Note that SEQ ID NOs: 19 to 23 are DNA sequences corresponding to the RNA sequences of SEQ ID NOs: 1 to 5, respectively.

[0028] The nucleotide sequences shown in Sequence IDs 1-5 may be conserved in the PCSK9 gene of organisms other than humans. Therefore, the organism from which PCSK9 originates is not limited to humans in this specification. For example, the aforementioned international database can be used to confirm whether the nucleotide sequences shown in Sequence IDs 1-5 may be present in the nucleotide sequences of the PCSK9 gene of organisms other than humans. For example, the nucleotide sequences shown in Sequence IDs 1-5 are found in the mRNA of PCSK9 in primates (e.g., gorillas, orangutans, etc.) (e.g., mRNA with accession numbers starting with XM).

[0029] The number of nucleotides (bases) constituting the main sequence may be, for example, 19 to 23, or 19 to 21. Alternatively, the main sequence may consist of 19 bases.

[0030] In some embodiments, the 5' end of the main sequence is guanine (G) or cytosine (C). Because guanine and cytosine have a higher binding affinity to the complementary strand than adenine and uracil, the stability of the 5' end of the first strand (i.e., the 3' end of the second strand) is increased. In other words, the stability of the 5' end of the second strand is relatively lower. Although the details of the mechanism are not clear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand whose 5' end is more energetically unstable than the sense strand or antisense strand. Therefore, having guanine or cytosine at the 5' end of the main sequence makes it easier for the antisense strand (in this case, the second strand) to be incorporated into RISC, thus more favorably inducing RNAi. This allows double-stranded RNA to function favorably as siRNA.

[0031] In some embodiments, at least two of the five bases at the 3' end of the main sequence are adenine and / or uracil, preferably three or more, and more preferably four or more. This results in the stability of the 5' end of the second strand being relatively lower than that of the 3' end. Consequently, the second strand is more readily incorporated into RISC, allowing for more favorable induction of RNAi.

[0032] The total GC content of the main sequence (the total percentage of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but is often 40% to 75%, preferably 50% to 70%, and may be 60% to 70%. The GC content is a parameter related to the binding strength between the antisense strand incorporated into the RISC and the RNA having the main sequence, as well as the ease of RNA cleavage. With the above GC content, the effects of RNAi can be efficiently exerted.

[0033] The first strand may include a first addition sequence that is attached to the 5' and / or 3' ends of the main sequence. Preferably, the first addition sequence is attached to the 3' end of the main sequence. The addition of the first addition sequence to the main sequence can more effectively induce RNAi.

[0034] The first addition sequence may consist of nucleotides or polynucleotides (dimers, trimers, or tetramers). The polynucleotides constituting the first addition sequence may consist of ribonucleotides only, deoxyribonucleotides only, or both ribonucleotides and deoxyribonucleotides. That is, the first strand may be entirely RNA, or it may be a chimeric polynucleotide of RNA and DNA.

[0035] The first addition sequence is composed of, for example, a sequence of 1 to 4 bases, preferably a sequence of 2 to 4 bases, and more preferably a sequence of 2 bases. The base sequence constituting the first addition sequence preferably contains adenine, uracil, or thymine. From the viewpoint of improving the stability of double-stranded RNA, the base sequence constituting the first addition sequence is preferably TT (thymine-thymine). The first addition sequence may protrude from the 5' or 3' end of the second strand. In some examples, the first addition sequence may be an overhang in the siRNA. When the first addition sequence is added to both the 5' and 3' ends of the main sequence, the total number of bases may be, for example, 2 to 4 bases.

[0036] The first strand is composed of, for example, a base sequence of 21 to 27 bases, and may consist of 21 to 25 bases, or 21 to 23 bases. In a preferred embodiment, it consists of 21 to 23 bases, comprising a main sequence of 19 to 21 bases and a first additional sequence of 2 bases. In such an embodiment, RNAi can be effectively induced.

[0037] The first strand may contain modified RNA or DNA or other nucleotide analogs, insofar as the effects of this technology are achieved. Examples of modifications include methylation, pseudouridylation, fluorination, and deamination. Examples of nucleotide analogs include pseudouridine, N1-methylpseudridine, 5-methylcytosine, 5-fluorouracil, inosine, and acyclic artificial nucleic acids. For example, one or more (e.g., two to five) nucleotides constituting the first strand may be substituted with nucleotide analogs. For example, the nucleotides constituting one or two bases at the 5' end and / or one or two bases at the 3' end of the first strand may be acyclic artificial nucleic acids. The first strand may also have a ligand that binds to a receptor specifically expressed in the target cell. The ligand can be, for example, attached to the 5' end and / or 3' end of the first strand. The ligand may be, for example, N-acetylgalactosamine (GalNAc) or a derivative thereof. Having GalNAc as a ligand may improve delivery to hepatocytes.

[0038] <Second Strand> The complementary sequence of the second strand has a base sequence that binds complementaryly to the main sequence of the first strand. This hybridizes the first and second strands, forming a double-stranded structure. The complementary sequence can be composed of polynucleotides, which are polymers of ribonucleotides. In other words, the complementary sequence can be composed of RNA.

[0039] In the present specification, "complementary binding" typically refers to forming a base pair in which adenine is hydrogen-bonded to uracil or thymine, and / or guanine is hydrogen-bonded to cytosine. However, in the case of modified bases, it may also include cases where a base pair can be formed with other bases by hydrogen bonding.

[0040] The complementary sequence preferably has a base sequence complementary to the entire main sequence. That is, it is preferable that each base constituting the main sequence forms a base pair with a base contained in the complementary sequence. Thereby, a stable double-stranded structure in which each base is complementary-bound can be formed, and RNAi can be easily induced.

[0041] As long as the effects of the present technology are achieved, the complementary sequence may be partially complementary-bound to the bases constituting the main sequence. That is, the complementary sequence does not have to form a base pair with a part of the bases constituting the main sequence. For example, the complementary sequence does not have to form a base pair with one or more (e.g., two bases) of the bases constituting the main sequence.

[0042] The number of bases constituting the complementary sequence may be, for example, the same as the number of bases constituting the main sequence. In a preferred embodiment, the complementary sequence has the same number of bases as the bases constituting the main sequence, and all the bases constituting the main sequence and the bases constituting the complementary sequence are complementary-bound. Thereby, a stable double-stranded structure can be formed, and RNAi can be easily induced.

[0043] As long as the effects of the present technology are achieved, the number of nucleotides constituting the complementary sequence may be more than the number of nucleotides constituting the main sequence. For example, it may have one or more (e.g., two or more and four or less) nucleotides that do not form a base pair with the main sequence on the 5'-end side of the complementary sequence. Also, for example, one or more (e.g., two or more and four or less, such as a loop structure) nucleotides that do not form a base pair with the bases of the main sequence may be arranged between the sequences that are complementary-bound to the main sequence of the complementary sequence.

[0044] As long as the present technology exhibits its effects, the number of nucleotides constituting the complementary sequence may be less than the number of nucleotides constituting the main sequence. For example, the number of nucleotides constituting the complementary sequence may be 1 or 2 less than the number of nucleotides constituting the main sequence.

[0045] The second strand may include a second additional sequence added to the 5'-end side and / or 3'-end side of the complementary sequence. From the viewpoint of improving the function as siRNA, when the first additional sequence is added to the 3'-end side of the main sequence in the first strand, it is preferable that the second additional sequence is added to the 3'-end side of the complementary sequence.

[0046] The second additional sequence may be composed of nucleotides or polynucleotides (dimer, trimer, or tetramer). The polynucleotide constituting the second additional sequence may be composed of only ribonucleotides, only deoxyribonucleotides, or both ribonucleotides and deoxyribonucleotides. That is, the second strand may be entirely RNA or a chimeric polynucleotide of RNA and DNA.

[0047] The second additional sequence is composed of, for example, a base sequence of 1 or more and 4 or less, preferably a base sequence of 2 or more and 4 or less bases, and more preferably a base sequence composed of 2 bases. The second additional sequence preferably contains adenine, uracil, or thymine. From the viewpoint of improving the stability of double-stranded RNA, the base sequence constituting the second additional sequence is preferably TT (thymine-thymine). The second additional sequence may protrude from the 5'-end or 3'-end of the first strand. In some examples, the second additional sequence may be an overhang in siRNA. When the second additional sequence is added to both the 5'-end side and 3'-end side of the main sequence, the total number of bases may be, for example, 2 or more and 4 or less bases.

[0048] While not particularly limited, the base sequence of the second strand may consist of, for example, 21 to 27 bases, 21 to 25 bases, or 21 to 23 bases. In a preferred embodiment, the base sequence of the second strand consists of a 21 to 23 base sequence comprising 19 to 21 bases of the complementary sequence and 2 bases of the second addition sequence. In such an embodiment, RNAi can be effectively induced.

[0049] The second strand may contain modified RNA or DNA or other nucleotide analogs, insofar as the effects of this technology are achieved. The types of modifications and examples of nucleotide analogs may be the same as those for the first strand described above. For example, one or more (e.g., 2 to 5) of the nucleotides constituting the second strand may be replaced with nucleotide analogs.

[0050] <Method for Producing Double-Stranded RNA> The first and second strands constituting the double-stranded RNA disclosed herein can be produced according to general chemical synthesis methods. For example, they can be synthesized using a commercially available automated DNA / RNA synthesizer. Alternatively, the first and second strands may be synthesized in vitro or in vivo based on genetic engineering techniques. It is preferable that the synthesized first and second strands be purified, which can be done, for example, by HPLC.

[0051] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) the first and second strands. The annealing method can be any conventionally known method. For example, the first and second strands can be mixed in equal amounts in a solvent, heated at 90°C for 1 to 5 minutes, and then cooled to 4°C to room temperature to perform annealing. Suitable solvents include, for example, distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer with pH 7.4, PBS, etc.). To prevent contamination of the solvent with active RNase (RNA-degrading enzyme), it is preferable to use a solvent that has been treated, for example, by DEPC treatment or autoclaving.

[0052] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein may include a form in which the first strand and the second strand are partially double-stranded via a loop structure. That is, double-stranded RNA can also be used as shRNA (short hairpin RNA) in another embodiment. ShRNA is RNA in which a main sequence, its complementary sequence, and a loop sequence for forming the loop structure are present on a single strand. Due to the presence of the loop structure, the main sequence and its complementary sequence hybridize, forming a partially double-stranded structure. As a result, the shRNA can be processed by the intracellular enzyme Dicer, and the double-stranded RNA described above can be formed.

[0053] The structure of the shRNA may be the same as that of conventionally known shRNAs. The length of the base sequence constituting the shRNA may be, for example, 50 to 80 bases. The length of the base sequence constituting the loop sequence may be, for example, 19 to 29 bases. The shRNA can be incorporated into a vector (for example, a lentiviral expression vector). By using shRNA, the effects of this technology can be stably achieved.

[0054] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may also contain various pharmaceutically acceptable carriers depending on the form of use. Preferred carriers include, for example, carriers commonly used in pharmaceuticals as diluents, excipients, etc. Such carriers vary appropriately depending on the use and form of the composition. Typically, these include water, physiological buffers, various organic solvents, etc. Such carriers may also be aqueous solutions of alcohol (ethanol, etc.) of appropriate concentration, glycerol, non-drying oils such as olive oil, lipid nanoparticles (LNPs), or liposomes, etc. Such carriers may also be transfection reagents (e.g., cationic molecules) or other reagents used for cell introduction. By-components that may be included in the pharmaceutical composition include various fillers, bulking agents, binders, humectants, surfactants, dyes, fragrances, etc. It may also include carriers used in conventionally known drug delivery systems (DDS).

[0055] The form of the composition disclosed herein is not particularly limited. For example, typical forms of the composition include liquids, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. It can also be prepared as a lyophilized product or granules for use by injection, etc., by dissolving it in physiological saline or a suitable buffer (e.g., PBS) immediately before use to prepare a drug solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (sub-components) as materials can be based on conventionally known methods, and such formulation methods themselves do not characterize this disclosure, so a detailed explanation is omitted. For detailed information on formulations, see, for example, Comprehensive Medicinal Chemistry, edited by Corwin Hansch, published by Pergamon Press (1990).

[0056] The compositions disclosed herein can inhibit the proliferation of at least one type of cell. Cells whose proliferation can be inhibited include, for example, cells expressing PCSK9 mRNA. The PCSK9 mRNA preferably has the same base sequence as the main sequence of the double-stranded RNA contained in the composition. Examples of cells expressing PCSK9 mRNA include tumor cells. Tumor cells include, for example, adrenocortical carcinoma, cholangiocarcinoma, bladder cancer, bone tumors, brain tumors, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, lymphoma, myeloma, neuroblastoma, uterine fibroids, ovarian cancer, pancreatic cancer, prostate cancer, rhabdoid tumors, sarcomas, skin cancer, testicular tumors, thyroid cancer, and uterine cancer. The compositions disclosed herein can, for example, inhibit the proliferation of tumor cells. Therefore, the double-stranded RNA and compositions disclosed herein can be suitably used, for example, as antitumor agents (anticancer agents) that inhibit the proliferation of tumor cells.

[0057] Furthermore, while the expression level of PCSK9 RNA varies across tissues, it is highly expressed in organs such as the brain (e.g., cerebellum), lungs, liver, esophagus, and pancreas, with particularly high expression in the liver. Therefore, the double-stranded RNA disclosed herein may exert a particularly strong inhibitory effect on cell proliferation in brain cells, germ cells, liver cells, esophageal cells, pancreatic cells, and other cells.

[0058] In some embodiments, the composition includes, in addition to the double-stranded RNA described above, a cell membrane-permeable peptide fragment (cell-penetrating peptide; hereinafter referred to as "CPP") that can introduce foreign substances into the cell from outside the cell through the cell membrane. The composition can be introduced into the cytoplasm and / or nucleus by CPP. By directly or indirectly binding (linking) CPP to the double-stranded RNA disclosed herein, a construct containing CPP and double-stranded RNA is constructed. Generally, double-stranded RNA has a negative charge and therefore does not easily pass through the cell membrane. However, for example, by directly or indirectly binding (linking) the double-stranded RNA disclosed herein to the N-terminal and / or C-terminal side of CPP, the construct containing CPP and double-stranded RNA can be efficiently introduced into the cell. The number of amino acid residues of CPP is not limited as long as its cell membrane permeability is not significantly impaired.

[0059] When CPP and double-stranded RNA are indirectly bound, a linker is positioned between them, for example. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, etc. Furthermore, the method of binding CPP and double-stranded RNA is not particularly limited and can be carried out according to various conventionally known scientific methods.

[0060] One embodiment of the composition disclosed herein comprises CPP and the double-stranded RNA of this disclosure. However, the double-stranded RNA does not have to be bound to the N-terminal or C-terminal side of the CPP. For example, the double-stranded RNA and CPP may form a complex through electrical or molecular interactions. Such a complex is more readily introduced into eukaryotic cells, thus enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the CPP used is preferably positively charged with a high proportion of basic amino acids. In this case, the proportion of CPP may be 5 to 100 times the amount of double-stranded RNA in molar terms, and preferably 40 to 60 times.

[0061] For CPPs, known ones can be used. For example, you can refer to van Asbeck et al., "Molecular Parameters of siRNA-Cell Penetrating Peptide Nanocomplexes for Efficient Cellular Delivery", ACS Nano., vol.7, No.5, pp. 3797-3807, 2013.

[0062] <Method of Use> This disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes a preparation step of preparing the composition disclosed herein and an administration step of administering the composition to cells in vitro or in vivo.

[0063] In the preparation step, for example, the composition disclosed herein can be prepared by conventionally known methods as described above.

[0064] In the administration step, the composition prepared in the preparation step is administered to at least one type of cell (e.g., tumor cells) in vivo or in vitro. Such cells may be, for example, eukaryotic cells. In this specification, "eukaryotic cells" in vivo includes, for example, various tissues, organs, tissues, blood, and lymph. In this specification, "eukaryotic cells" in vitro includes, for example, various cell aggregates, tissues, organs, tissues, blood, and lymph extracted from living organisms, as well as cell lines. The species of eukaryotic cells are not particularly limited and may include, for example, mammals, birds, amphibians, reptiles, fish, etc. The target cells may be, for example, cells expressing PCSK9 mRNA having the same base sequence as the main sequence of the double-stranded RNA contained in the composition (e.g., human cells). In one example, such cells may be tumor cells (e.g., neuroblastoma, liver cancer cells). The cell types to which the composition is administered may be one or two or more.

[0065] The method of administering the composition may be in accordance with methods conventionally used in the treatment of animals, and is not particularly limited. The composition may be used in vivo in a manner and in a dosage appropriate to its form and purpose. For example, as a liquid, it can be administered in any desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflamed tissue, etc.) of a patient or animal (i.e., a living organism) by injection intravenously, lymphatically, intramuscularly, subcutaneously, intradermally, or intraperitoneally. Alternatively, solid forms such as tablets, or gels or aqueous jelly forms such as ointments, can be administered directly to the designated tissue (e.g., the affected area, such as tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, solid forms such as tablets can be administered orally. In the case of oral administration, encapsulation or application of a protective (coating) material is preferable to suppress digestive enzyme degradation in the gastrointestinal tract.

[0066] In vivo, the amount of composition administered is not particularly limited. For example, the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. Alternatively, the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, 2 mg or less, or 1 mg or less.

[0067] In vitro, the amount of composition to be administered is not particularly limited. For example, the double-stranded RNA concentration in the culture medium of a target including cells may be 1 nM or more, 10 nM or more, or 50 nM or more. Alternatively, the double-stranded RNA concentration in such a culture medium may be, for example, 5 μM or less, 2 μM or less, 1 μM or less, or 500 nM or less.

[0068] The compositions disclosed herein can be introduced into target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (such as commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Furthermore, as described above, they may be introduced into cells using CPP. The compositions disclosed herein may also contain substances (such as reagents) used in known transfection methods.

[0069] The following describes some test examples relating to the technology disclosed herein, but the technology disclosed herein is not intended to be limited to those shown in such test examples.

[0070] <Preparation of Double-Stranded RNA> Polynucleotides with the base sequences shown in SEQ ID NOs: 9-18 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. The base sequences shown in SEQ ID NOs: 9, 11, 13, 15, and 17 each have the base sequences shown in SEQ ID NOs: 1-5 as their main sequences. In each polynucleotide, the 3' end "TT" (additional sequence) is DNA, and the other sequences (main sequence or complementary sequence) are composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare double-stranded RNAs of samples 1-5 shown in Table 1. The double-stranded RNAs of samples 1-5 were each dissolved in sterile water (DNA-free and RNA-free) to a concentration of 200 μM to prepare RNA solutions.

[0071]

[0072] <Cell Proliferation Test 1> (Example 1) In Cell Proliferation Test 1, human neuroblastoma cells, specifically SK-N-SH cells, were used as the eukaryotic cells. SK-N-SH cells were pre-cultured in the culture medium of 10% FBS (fetal bovine serum) + E-MEM (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 051-07615) + 1% MEM non-essential amino acid solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 139-15651). 0.5% penicillin-streptomycin (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 168-23191) was added to the culture medium only during the pre-culture stage, but not during subsequent culture and evaluation.

[0073] First, as a pre-culture, SK-N-SH cells were cultured on a culture plate. After washing the SK-N-SH cells attached to the culture plate with PBS, a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After incubation, the culture medium was added to inactivate the trypsin. Then, the cells were precipitated by centrifugation at 150 × g for 5 minutes. After removing the supernatant produced by centrifugation, the culture medium was added to the precipitate (cell pellet) and mixed to approximately 5 × 10⁻⁶. 4 A cell suspension was prepared at cells / mL. A commercially available 96-well plate was prepared, and the cell suspension was placed in each well at a rate of 5 × 10⁶. 3 Sow seeds at a density of cells / 100 μL / well, and maintain a temperature of 37°C and 5% CO2. 2 It was incubated overnight below.

[0074] Next, solution A was prepared by mixing 1 μL of RNA solution with a concentration of 200 μM of sample 1 with 25 μL of Opti-MEM (Thermo Fisher Scientific). Solution B was also prepared by mixing 1.5 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific) with 25 μL of Opti-MEM. Next, solution C was prepared by mixing equal volumes of solution A and solution B, and incubated at room temperature for 5 minutes. The prepared solution C was added to the wells containing cultured SK-N-SH cells, adjusting the concentration of sample 1 in the culture medium in the wells to 0.4 μM. Afterward, the culture was incubated at 37°C and 5% CO2. 2 SK-N-SH cells were incubated for 72 hours under the following conditions.

[0075] The cell volume in each well was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). 10 μL of the CCK-8 reagent was added to each well containing SK-N-SH cells cultured on day 4 after the start of culture (day 3 after the addition of double-stranded RNA), and the cells were cultured at 37°C and 5% CO2. 2The cells were incubated for two hours under the following conditions. Afterward, the absorbance at 450 nm was measured for each well. The absorbance was the average of the three wells. A blank well containing only culture medium and CCK-8 reagent was also prepared. The value obtained by subtracting the absorbance of the blank well from the absorbance of Sample 1 was used as the measured value for Sample 1. The relative value for Example 1 was determined using the measured value of the reference example described later as the baseline. This relative value was used as the cell viability to determine the cell viability of Example 1.

[0076] (Examples 2-5) In Examples 2-5, cell viability was determined in the same manner as in Example 1, except that Sample 1 was replaced with Samples 2-5, respectively. Note that the sample numbers and example numbers correspond.

[0077] (Reference Example) In the reference example, the procedure was the same as in Example 1, except that sterile water was used instead of RNA solution. In other words, double-stranded RNA was not added in the reference example.

[0078] Figure 1 is a graph showing the cell viability of each example in cell proliferation test 1. The reference example is shown with a cell viability of 100%. As shown in Figure 1, the cell viability of Examples 1-5 was lower compared to the reference example. From this, it can be seen that double-stranded RNA having any of the base sequences of SEQ ID NOs. 1-5 as its main sequence can suppress cell proliferation.

[0079] <Cell Proliferation Test 2> In Cell Proliferation Test 2, HepG2 cells, derived from human liver cancer, were used instead of the SK-N-SH cells used in Cell Proliferation Test 1, and cell viability was measured according to the method of Cell Proliferation Test 1. In Example 6, double-stranded RNA from Sample 1 was used. In Example 7, double-stranded RNA from Sample 3 was used. In Example 8, double-stranded RNA from Sample 4 was used. In Example 9, double-stranded RNA from Sample 5 was used. In the reference example, sterile water was used instead of RNA solution.

[0080] Figure 2 is a graph showing the cell viability of each case in cell proliferation test 2. As shown in Figure 2, the cell viability of Examples 6-9 was lower compared to the reference example. This indicates that cell proliferation was suppressed in Examples 6-9.

[0081] The specific examples of the technologies disclosed herein have been described in detail above, but these are merely illustrative and do not limit the scope of the claims. The technologies described in the claims include various modifications and changes to the specific examples described above.

[0082] Specific embodiments of the technology disclosed herein include, for example, those described in the following sections: Section 1: A double-stranded RNA comprising a first strand containing a main sequence and a second strand containing a complementary sequence that binds complementaryly to the main sequence, wherein the main sequence consists of any of the following base sequences: CACUGCUCUGCUGCUCUGCU (SEQ ID NO: 1); CCUGGUGGCGCUCUCUCCACU (SEQ ID NO: 2); GGCCGCUCUCCACUGCCU (SEQ ID NO: 3); CGCUGCCCACUGCUGCCU (SEQ ID NO: 4); and GGUGGCCGCUCUCCACU (SEQ ID NO: 5); Item 2: The double-stranded RNA according to Item 1, wherein the first strand comprises a first additional sequence consisting of a base sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the main sequence, and the second strand comprises a second additional sequence consisting of a base sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the complementary sequence. Item 3: The double-stranded RNA according to Item 2, wherein the base sequence constituting the first additional sequence is thymine-thymine (TT). Item 4: The double-stranded RNA according to Item 2 or 3, wherein the base sequence constituting the second additional sequence is thymine-thymine (TT). Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein the base sequence constituting the first strand is 19 to 27 bases, and the base sequence constituting the second strand is 19 to 27 bases. Item 6: A composition comprising the double-stranded RNA according to any one of Items 1 to 5. Item 7: A method for inhibiting the proliferation of at least one type of cell, comprising the steps of preparing the composition described in Item 6 and providing the composition to the cells.

Claims

1. A double-stranded RNA comprising a first strand containing a main sequence and a second strand containing a complementary sequence that binds complementaryly to the main sequence, wherein the main sequence consists of any of the following base sequences: CACUGCUCUGCUGCUCUGCU (Sequence ID 1); CCUGGUGGCGCUCUCUCCACU (Sequence ID 2); GGCCGCUCUCCACUGCCU (Sequence ID 3); CGCUGCCCACUGCUGCCU (Sequence ID 4); and GGUGGCCGCUCUCCACU (Sequence ID 5).

2. The double-stranded RNA according to claim 1, wherein the first strand includes a first addition sequence consisting of a sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the main sequence, and the second strand includes a second addition sequence consisting of a sequence of 4 or fewer bases attached to the 5' end and / or 3' end of the complementary sequence.

3. The double-stranded RNA according to claim 2, wherein the base sequence constituting the first additional sequence is thymine-thymine (TT).

4. The double-stranded RNA according to claim 2, wherein the base sequence constituting the second additional sequence is thymine-thymine (TT).

5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the first strand is 19 bases or more and 27 bases or less, and the base sequence constituting the second strand is 19 bases or more and 27 bases or less.

6. A composition comprising the double-stranded RNA described in any one of claims 1 to 5.

7. A method for inhibiting the proliferation of at least one type of cell, comprising the steps of: preparing the composition described in claim 6; and providing the composition to the cell in vitro.