Allulose epimerase variant having high conversion activity, preparation method therefor, and allulose preparation method using same
The novel allulose epimerizing enzyme variant W29K/E41A/A77S/G216S/M234I addresses the low conversion rate issue of wild-type D-allulose 3-epimerase by amino acid substitutions, achieving high fructose-to-allulose conversion for efficient industrial production.
Patent Information
- Application Number
- PCT/KR2025/004308
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-23
- Filing Date
- 2025-04-02
- Publication Date
- 2026-07-02
AI Technical Summary
Wild-type D-allulose 3-epimerase derived from Flavonifractor plautii has a low conversion rate of fructose to allulose, making it unsuitable for industrial-scale production, and existing variants like W29K/A77S/G216S/M234I require further improvements in conversion activity.
A novel allulose epimerizing enzyme variant W29K/E41A/A77S/G216S/M234I is developed by substituting specific amino acids in the enzyme's sequence, enhanced through protein structure modeling, and produced using recombinant vectors and strains, with optimized conditions for high fructose-to-allulose conversion.
The novel variant significantly enhances the conversion activity of fructose to allulose, reducing production time and costs, suitable for industrial-scale production of allulose.
Smart Images

Figure KR2025004308_02072026_PF_FP_ABST
Abstract
Description
Allulose epimerizing enzyme variant having high conversion activity, method for preparing the same, and method for preparing allulose using the same
[0001] The present invention relates to allulose epimerizing enzyme variants, etc., and more specifically, to an allulose epimerizing enzyme variant having significantly improved conversion activity of fructose to allulose compared to a D-allulose 3-epimerizing enzyme derived from Flavonifractor plautii, and various inventions derived therefrom.
[0002] D-allulose is an epimer of the 3rd carbon of fructose and is also called D-psicose. D-allulose has a sweetness level of about 70% compared to sugar (Oshima 2006) but only 0.3% of the energy, making it a functional monosaccharide applicable as a low-calorie sweetener for diet foods (Matsuo et al. 2002). In addition, D-allulose has the function of inhibiting glucose absorption and blood sugar levels, so it can be applied to foods for diabetic patients and foods for water consumption. Furthermore, since it can inhibit abdominal fat accumulation by inhibiting the activity of enzymes involved in lipid synthesis in the liver, it can be used in various functional foods such as health foods (Matsuo et al. 2001; Iida et al. 2008; Hayashi et al. 2010; Hossain et al. 2011).
[0003] Due to the characteristics mentioned above, allulose is a good source for replacing sugar; however, since it belongs to the category of rare sugars—monosaccharides that exist extremely rarely in nature—an efficient method for producing allulose is required for its application in the food industry. The most industrially efficient method for allulose production is the conversion of fructose into allulose using D-allulose 3-epimerase. However, wild-type D-allulose 3-epimerase derived from microorganisms is not suitable for industrialization because its conversion rate of fructose to allulose is not high. Therefore, there is a need to develop novel D-allulose 3-epimerase variants that demonstrate significantly enhanced fructose-to-allulose conversion activity compared to the wild-type D-allulose 3-epimerase derived from microorganisms. Regarding D-allulose 3-epimerase variants, Korean Registered Patent Publication No. 10-2682846 discloses a novel allulose epimerase variant derived from Flavonifractor plautii in which tryptophan (Trp) at the 29th position in the amino acid sequence of the wild-type D-allulose 3-epimerase is substituted with lysine (Lys), alanine (Als) at the 77th position is substituted with serine (Ser), glycine (Gly) at the 216th position is substituted with serine (Ser), and methionine (Met) at the 234th position is substituted with isoleucine (Ile).
[0004] The present invention is derived from the background of the prior art, and the first objective of the present invention is to provide a novel D-allulose 3-epimerase variant having significantly improved conversion activity of fructose to allulose compared to the D-allulose 3-epimerase derived from Flavonifractor plautii.
[0005] The second objective of the present invention is to provide a method for producing a novel D-allulose 3-epimerase variant or various elements necessary for producing a novel D-allulose 3-epimerase variant.
[0006] The third objective of the present invention is to provide a method for producing allulose from fructose or various elements necessary for producing allulose from fructose.
[0007] The applicant of the present invention has filed and received a patent for a novel allulose epimerase variant derived from Flavonifractor plautii, in which tryptophan (Trp) at the 29th position in the amino acid sequence of the wild-type D-allulose 3-epimerase is substituted with lysine (Lys), alanine (Als) at the 77th position is substituted with serine (Ser), glycine (Gly) at the 216th position is substituted with serine (Ser), and methionine (Met) at the 234th position is substituted with isoleucine (Ile) [Korean Registered Patent Publication No. 10-2682846 (July 30, 2024)]. The allulose epimerization enzyme variant disclosed in the above-mentioned Korean Registered Patent Publication No. 10-2682846 has high thermal stability, but its conversion activity of fructose to allulose still needs to be improved from an industrialization perspective for the mass production of allulose. To improve the conversion activity of fructose to allulose of the allulose epimerization enzyme variant disclosed in Korean Registered Patent Publication No. 10-2682846, the inventor of the present invention derived a total of four candidate amino acid residue positions expected to be involved in the conversion of fructose to allulose through protein structure modeling and protein structure analysis, and confirmed that the conversion activity of fructose to allulose is significantly improved only when an amino acid residue at a specific position among these is substituted with another specific amino acid, thereby completing the present invention.
[0008]
[0009] To achieve the first objective above, one example of the present invention provides an allulose epimerizing enzyme variant consisting of the amino acid sequence of SEQ ID NO. 25.
[0010] To achieve the second objective above, one example of the present invention provides a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25. Furthermore, the present invention provides a recombinant vector comprising a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25. Furthermore, the present invention provides a recombinant strain transformed by a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25 or by a recombinant vector comprising said polynucleotide. Furthermore, the present invention provides a method comprising the step of culturing a recombinant strain transformed by a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25 or by a recombinant vector comprising said polynucleotide to express an allulose epimerase variant; The present invention provides a method for producing an allulose epimerization enzyme variant, comprising the step of isolating the allulose epimerization enzyme variant from a lysate of a recombinant strain in which the allulose epimerization enzyme variant is expressed.
[0011] To achieve the third objective above, one example of the present invention provides a composition for producing allulose comprising an allulose epimerizing enzyme variant having the amino acid sequence of SEQ ID NO. 25. Furthermore, the present invention provides a composition for producing allulose comprising a polynucleotide encoding an allulose epimerizing enzyme variant having the amino acid sequence of SEQ ID NO. 25, a recombinant strain transformed by a recombinant vector containing said polynucleotide, a culture of said recombinant strain, or a lysate of said recombinant strain. Additionally, the present invention provides a method for producing allulose comprising the step of reacting fructose with an allulose epimerizing enzyme variant having the amino acid sequence of SEQ ID NO. 25 or a composition containing said allulose epimerizing enzyme variant. In addition, the present invention provides a method for producing allulose comprising the step of reacting fructose with a polynucleotide encoding an allulose epimerizing enzyme variant having the amino acid sequence of SEQ ID NO. 25, a recombinant strain transformed by a recombinant vector containing said polynucleotide, a culture of said recombinant strain, a lysate of said recombinant strain, or a composition comprising one or more of these.
[0012] The novel allulose epimerase variant according to the present invention has a very high conversion activity of fructose to allulose compared to the wild-type D-allulose 3-epimerase derived from Flavonifractor plautii or the D-allulose epimerase variant W29K / A77S / G216S / M234I. Therefore, the novel allulose epimerase variant according to the present invention can shorten production time and reduce production costs during industrial-level enzymatic conversion reactions for the mass production of allulose.
[0013] Figure 1 is a schematic diagram showing the positions of a total of four amino acid residues selected by the inventors of the present invention as substitution candidates to improve the conversion activity of fructose to allulose of the D-allulose epimerase variant W29K / A77S / G216S / M234I.
[0014] Figure 2 is a cleavage map of the recombinant expression vector pET28a_FpDPE_W29K / A77S / G216S / M234I produced in an embodiment of the present invention.
[0015] The present invention will be described in detail below.
[0016]
[0017] One aspect of the present invention relates to a novel D-allulose 3-epimerase variant capable of converting fructose into allulose (hereinafter referred to as the "allulose epimerase variant"). An allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to one example of the present invention is a wild-type D-allulose 3-epimerizing enzyme derived from Flavonifractor plautii in which tryptophan (Trp) at the 29th position from the N-terminus of the amino acid sequence (Sequence No. 1) is substituted with lysine (Lys), glutamic acid (Glu) at the 41st position is substituted with alanine (Ala), alanine (Ala) at the 77th position is substituted with serine (Ser), glycine (Gly) at the 216th position is substituted with serine (Ser), and at the same time, methionine (Met) at the 234th position is substituted with isoleucine (Ile). The allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention has a very high activity of converting fructose to allulose compared to the wild-type D-allulose 3-epimerizing enzyme derived from Flavonifractor plautii or its variant W29K / A77S / G216S / M234I.The above D-allulose 3-epimerase variant W29K / A77S / G216S / M234I is a wild-type D-allulose 3-epimerase derived from Flavonifractor plautii in which tryptophan (Trp) at the 29th position from the N-terminus of the amino acid sequence (Sequence No. 1) is substituted with lysine (Lys), alanine (Ala) at the 77th position is substituted with serine (Ser), glycine (Gly) at the 216th position is substituted with serine (Ser), and methionine (Met) at the 234th position is substituted with isoleucine (Ile), and is composed of the amino acid sequence of Sequence No. 3, and the manufacturing method and characteristics are disclosed in Korean Registered Patent Publication No. 10-2682846. The above allulose epimerase variant W29K / E41A / A77S / G216S / M234I can be obtained by using a polynucleotide encoding the D-allulose 3-epimerase variant W29K / A77S / G216S / M234I (consisting of the nucleotide sequence of SEQ ID NO. 4) or a recombinant vector containing it as a template, performing PCR to induce site-directed mutagenesis using an oligonucleotide having the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide having the nucleotide sequence of SEQ ID NO. 10 as primer pairs, then inserting the amplified variant fragment into an expression vector using a Gibson assembly method or an overlap extension PCR method to produce a recombinant expression vector, then transforming a host strain with the recombinant expression vector to produce a recombinant strain, and then culturing and expressing the recombinant strain. The allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention is composed of the amino acid sequence of SEQ ID NO. 25, but the equivalence range of the allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention is not necessarily limited thereto.For example, the equivalence range of the allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention may be one in which some amino acids in the amino acid sequence of SEQ ID NO. 25 are substituted, inserted, and / or deleted, as long as the activity of converting fructose to allulose is maintained. The substitution of said amino acids is preferably carried out by conservative amino acid replacement, which does not alter the properties of the protein. In addition, the modification of said amino acids may be carried out by glycosylation, acetylation, phosphorylation, etc. Furthermore, the equivalence range of the allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention may include a protein in which structural stability against heat, pH, etc., is increased or activity for the conversion of fructose to allulose is increased by mutation or modification in the amino acid sequence. In addition, the equivalence range of the allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I according to the present invention may include an amino acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology with any one of the amino acid sequences of SEQ ID NO. 25.
[0018]
[0019] Another aspect of the present invention relates to a method for producing a novel allulose epimerase variant W29K / E41A / A77S / G216S / M234I or to various elements required to produce the novel allulose epimerase variant W29K / E41A / A77S / G216S / M234I. Various elements required to produce the novel allulose epimerase variant W29K / E41A / A77S / G216S / M234I include polynucleotides, primer pairs, recombinant vectors, recombinant strains, etc.
[0020] The above polynucleotide is a polynucleotide encoding an allulose epimerase variant composed of the amino acid sequence of SEQ ID NO. 25, and preferably composed of the nucleotide sequence of SEQ ID NO. 26. The term "polynucleotide" as used in the present invention means any non-modified or modified polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA). The above polynucleotide includes, but is not limited to, single- or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is a mixture of single- and double-stranded regions, or hybrid molecules thereof. Additionally, the equivalent range of the polynucleotide encoding the allulose epimerase variant includes a sequence having substantial identity with respect to the nucleotide sequence of SEQ ID NO. 26. The above substantial identity means that the nucleotide sequence of SEQ ID NO. 26 and any other sequence are aligned to correspond as much as possible, and the sequences are analyzed such that the any other sequence has sequence homology of 70% or more, 90% or more, or 98% or more with the nucleotide sequence of SEQ ID NO. 9. A person skilled in the art will readily understand that a polynucleotide encoding an allulose epimerase variant having the same activity within the range of substantial homology can be prepared by substituting, adding, or deleting one or more nucleotides of the nucleotide sequences of the polynucleotide using gene recombination techniques known in the art. Such comparison of homology can be performed by calculating the homology between two or more sequences as a percentage (%) using a commercially available computer program.
[0021] In addition, the primer pair is a component for synthesizing a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25. When a polynucleotide encoding W29K / A77S / G216S / M234I, which is a variant of D-allulose 3-epimerase, or a recombinant vector containing it is used as a template in a polymerase chain reaction (PCR) to induce site-directed mutagenesis, the primer pair consists of a forward primer having the nucleotide sequence of SEQ ID NO. 9 and a reverse primer having the nucleotide sequence of SEQ ID NO. 10.
[0022] Additionally, the recombinant vector comprises a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25. The recombinant vector may be provided in a form in which the polynucleotide encoding the allulose epimerase variant is inserted into a cloning vector or an expression vector using known standard methods. The term "cloning vector" as used in the present invention is defined as a substance capable of transporting a DNA fragment into a host cell and reproducing it. In the present invention, the cloning vector may further comprise a polyadenylation signal, a transcription termination sequence, and multiple cloning sites. In this case, the multiple cloning sites comprise at least one endonuclease restriction site. Additionally, the cloning vector may further comprise a promoter. For example, in the present invention, the polynucleotide encoding the allulose epimerase variant W29K / E41A / A77S / G216S / M234I may be located upstream of the polyadenylation signal and the transcription termination sequence. Additionally, the term "expression vector" as used in the present invention is defined as a DNA sequence necessary for the transcription and translation of cloned DNA within a suitable host. Furthermore, the term "expression vector" as used in the present invention refers to a genetic construct comprising an essential regulatory element operably linked to an insert so that the insert is expressed when present within the cell of an individual. The expression vector may be prepared and purified using standard recombinant DNA technology.The type of the expression vector is not particularly limited as long as it functions to express a desired gene and produce a desired protein in various host cells of prokaryotic and eukaryotic cells, but a vector capable of producing a large amount of foreign proteins in a form similar to their natural state while possessing a promoter exhibiting potent activity and strong expression power is preferred. The expression vector preferably comprises at least a promoter, a start codon, a gene encoding the desired protein, and a stop codon terminator. In addition, it may appropriately include DNA encoding a signal peptide, additional expression regulatory sequences, non-translating regions on the 5' and 3' sides of the desired gene, a selection marker region, or a replicable unit. "Promoter" refers to a minimum sequence sufficient to direct transcription. Furthermore, the promoter may include promoter configurations sufficient to express a cell-type specific or regulatory promoter-dependent gene induced by an external signal or agent, and these configurations may be located in the 5' or 3' portion of the gene. The above promoters include both conservative promoters and inductive promoters. Promoter sequences may be derived from prokaryotes, eukaryotes, or viruses. The term "operably linked" as used in the present invention means that one function is regulated by another through a polynucleotide sequence association on a single polynucleotide. For example, if a promoter can control the expression of a coding sequence (i.e., if the coding sequence is under the transcriptional control of the promoter), the promoter is operatively linked to the coding sequence, or if a ribosome binding site is positioned to facilitate translation, the ribosome binding site is operatively linked to the coding sequence. The coding sequence may be operatively linked to the regulatory sequence in the sense direction or the antisense direction. The recombinant vector according to the present invention is preferably an expression vector.
[0023] In addition, the recombinant strain is transformed by a polynucleotide encoding an allulose epimerase variant consisting of the amino acid sequence of SEQ ID NO. 25, or transformed by a recombinant vector containing said polynucleotide. The term "recombinant strain" as used in the present invention refers to a cell transformed by introducing a polynucleotide encoding one or more target proteins or an expression vector having said polynucleotide into a host cell. Methods for producing a transformant by introducing the above-mentioned expression vector into a host cell include, but are not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, chemical treatment methods such as PEG, methods using a gene gun, and heat shock methods. The host cell that can be transformed into the expression vector in the present invention is not significantly limited in type as long as it is known in the art, such as prokaryotic cells, plant cells, insect cells, and animal cells; preferably, a host cell that has a high DNA introduction efficiency and a high expression efficiency of the introduced DNA is typically used. For example, the host cell may be Escherichia coli. The above-mentioned E. coli include BL21, JM109, K-12, LE392, RR1, DH5α, or W3110, but are not limited thereto.In addition, as the above host cell, it is acceptable to use a strain selected from the group consisting of strains of the genus Bacillus such as Bacillus subtilis and Bacillus churingensis, strains of the genus Corynebacterium such as Corynebacterium glutamicum, strains of the genus Salmonella such as Salmonella typhimurium, and other intestinal bacteria such as Serratia marcescens and various Pseudomonas species.
[0024] In addition, the method for preparing the allulose epimerase variant W29K / E41A / A77S / G216S / M234I comprises the steps of: culturing a recombinant strain transformed by a polynucleotide encoding an allulose epimerase variant composed of the amino acid sequence of SEQ ID NO. 25 or transformed by a recombinant vector containing said polynucleotide to express the allulose epimerase variant; and isolating the cytos epimerase from the lysate of the recombinant strain in which the allulose epimerase variant is expressed. The expression of the protein by the host cell can be induced using lactose, an induction factor such as IPTG (isopropyl-1-thio-β-D-galactopyranoside), etc., and the induction time can be controlled to maximize the amount of protein. In the present invention, the allulose epimerase variant can be recovered from the lysate of the recombinant strain. Cells used for protein expression may be destroyed by various material or chemical means such as repeated freeze-thaw cycles, sonication, mechanical destruction, or cell degrading agents, and can be separated or purified by conventional biochemical separation techniques (Sambrook et al., Molecular Cloning: A laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). For example, methods for separating or purifying proteins expressed by host cells include, but are not limited to, electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reverse phase HPLC, gel infiltration HPLC), isoelectric focus, and various variations or combinations thereof.Meanwhile, in the present invention, the step of isolating an allulose epimerizing enzyme variant from the lysate of a recombinant strain can preferably be performed by affinity chromatography using a peptide tag. Various known tags can be used as the peptide tag, such as HA tag, FLAG tag, His tag, BCCP (biotin carboxyl carrier protein), c-myc tag, V5 tag, glutathione-S-transferase (GST), or MBP (maltose binding protein), and among these, His tag is preferred. The His-tagged protein is specifically trapped on a column of Ni-NTA (nickel-nitrilotriaacetic acid) resin and can be eluted by EDTA or imidazole.
[0025]
[0026] Another aspect of the present invention relates to a method for producing allulose from fructose or various elements necessary for producing allulose from fructose. The various elements necessary for producing allulose from fructose include a composition for producing allulose.
[0027] One example of the above composition for producing allulose includes an allulose epimerase variant W29K / E41A / A77S / G216S / M234I having the amino acid sequence of SEQ ID NO. 25. In addition, another example of the above composition for producing allulose includes a recombinant strain transformed by a polynucleotide encoding an allulose epimerase variant having the amino acid sequence of SEQ ID NO. 25 or transformed by a recombinant vector containing said polynucleotide, a culture of said recombinant strain, or a lysate of said recombinant strain. In this case, the above composition for producing allulose may preferably further include one or more selected from the group consisting of manganese ions, nickel ions, and cobalt ions. The novel allulose epimerizing enzyme variant according to the present invention exhibits metalloenzyme characteristics in which activation is regulated by metal ions, and the production yield of allulose can be increased by carrying out the reaction by said enzyme in the presence of specific metal ions such as manganese ions, nickel ions, or cobalt ions.
[0028] In addition, an example of a method for producing allulose from the fructose described above comprises the step of reacting fructose with an allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I having the amino acid sequence of SEQ ID NO. 25, a recombinant strain transformed by a polynucleotide encoding the allulose epimerizing enzyme variant having the amino acid sequence of SEQ ID NO. 25 or transformed by a recombinant vector containing said polynucleotide, a culture of said recombinant strain, a lysate of said recombinant strain, or a composition comprising one or more of these. In addition, the method for producing allulose from the fructose described above may further include the step of adding a metal ion, and the type of metal ion is as described above. For example, said metal ion may be added to the fructose substrate or to a mixture of the enzyme variant and fructose. In addition, as another example, the metal ion may be added to a carrier on which the enzyme variant is immobilized, added to a mixture of the carrier on which the enzyme variant is immobilized and fructose, or added in the form of a mixture with fructose when fructose is added. In addition, when allulose is produced using a recombinant strain, the metal ion may be added to the culture medium. Furthermore, in the method for producing allulose from fructose, the allulose epimerizing enzyme variant or the recombinant strain is preferably immobilized on a carrier. The carrier is capable of creating an environment in which the activity of the immobilized enzyme can be maintained for a long period and may be selected from any known carrier that can be used for enzyme immobilization. For example, sodium alginate may be used as the carrier.Sodium alginate is a natural colloidal polysaccharide abundant in the cell walls of seaweed, composed of β-D-mannuronic acid and α-L-gluronic acid, and formed by randomly connecting β-1,4 bonds in terms of content, which can stably immobilize strains or enzymes and may be advantageous in terms of allulose yield. For example, to further enhance the allulose yield, a sodium alginate solution with a concentration of 1.5 to 4.0% (w / v) (e.g., an aqueous sodium alginate solution), preferably a sodium alginate solution with a concentration of about 2.5% (w / v), can be used for the immobilization of recombinant strains. In addition, in the method for producing allulose from fructose, the reaction temperature is in the range of 50 to 70°C, preferably 50 to 60°C, and more preferably 50 to 55°C when considering the stability and half-life of the enzyme variant, and the reaction pH is in the range of 6.0 to 8.0, preferably 6.0 to 7.0. In addition, in the method for producing allulose from fructose, the concentration of fructose is not particularly limited, but when considering productivity or economic efficiency, it is preferable to be 1 to 50% (w / w) based on the total reactants, and more preferable to be 35 to 50% (w / w). In addition, the concentration of the enzyme variant used in the method for producing allulose from fructose may be 0.001 to 0.5 mg / ml, preferably 0.01 to 0.2 mg / ml, and more preferably 0.02 to 0.1 mg / ml based on the total reactants. In addition, when producing allulose from fructose using a recombinant strain, it is desirable that the host strain of the recombinant strain be a food-safe strain. The food-safe strain refers to a GRAS (generally accepted as safe) grade strain that is generally recognized as safe, and may be selected from, for example, strains of the genus Saccharomyces (Saccharomycess p.), Bacillus (Bacillus sp.), Corynebacterium (Corynebacterium sp.), etc.The above strains are industrial microorganisms that produce chemicals with various uses in fields such as animal feed, pharmaceuticals, and food. These strains are easy to genetically modify and mass-culture, or possess high stability under various process conditions. In addition, because these strains possess a relatively rigid cell membrane structure compared to other bacteria, they exhibit biological characteristics in which the cells remain in a stable state even under the influence of osmotic pressure caused by high sugar concentrations. Specific examples of the above GRAS (generally accepted as safe) grade strains include Saccharomyces cerevisiae, Bacillus subtilis, and Corynebacterium glutamicum.
[0029]
[0030] The present invention will be explained in more detail below through examples. However, the following examples are intended only to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.
[0031]
[0032] Example 1: Exploration of amino acid substitution sites to enhance the conversion activity of D-allulose 3-epimerase
[0033] The applicant of the present invention previously filed a patent application for a novel allulose epimerase variant W29K / A77S / G216S / M234I, in which tryptophan (Trp) at the 29th position from the N-terminus of the amino acid sequence of wild-type D-allulose 3-epimerase derived from Flavonifractor plautii is substituted with lysine (Lys), alanine (Als) at the 77th position is substituted with serine (Ser), glycine (Gly) at the 216th position is substituted with serine (Ser), and methionine (Met) at the 234th position is substituted with isoleucine (Ile), in order to improve the conversion rate of fructose to allulose and the thermal stability of the wild-type D-allulose 3-epimerase [Korean Registered Patent Publication [No. 10-2682846 (July 30, 2024)]. The wild-type D-allulose 3-epimerase derived from Flavonifractor plautii consists of the amino acid sequence of SEQ ID NO. 1, and the polynucleotide fragment encoding the wild-type D-allulose 3-epimerase consists of the nucleotide sequence of SEQ ID NO. 2. Additionally, the D-allulose epimerase variant W29K / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 3, and the polynucleotide fragment encoding the amino acid sequence of the D-allulose epimerase variant W29K / A77S / G216S / M234I consists of the nucleotide sequence of SEQ ID NO. 4.
[0034] To enhance the conversion activity of fructose to allulose of the D-allulose epimerase variant W29K / A77S / G216S / M234I, the inventors of the present invention performed protein structure modeling using Alphafold2, an artificial intelligence (AI) software developed by DeepMind Technologies Limited, and analyzed the generated protein structure using PyMOL software. As a result, through the three-dimensional structure modeling and analysis of the D-allulose epimerase variant W29K / A77S / G216S / M234I, a total of four amino acid residue positions expected to be associated with conversion activity and amino acid residues to be substituted at said positions were selected.
[0035] FIG. 1 is a schematic diagram showing the positions of a total of four amino acid residues selected by the inventors of the present invention as substitution candidates to enhance the conversion activity of fructose to allulose of the D-allulose epimerase variant W29K / A77S / G216S / M234I. In FIG. 1, "S39" represents serine located at the 39th position from the N-terminus of the amino acid sequence of SEQ ID NO. 3, "A40" represents alanine located at the 40th position from the N-terminus of the amino acid sequence of SEQ ID NO. 3, "A41" represents glutamic acid located at the 41st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3, and "E71" represents glutamic acid located at the 71st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3.
[0036]
[0037] Example 2: Production of a polynucleotide fragment encoding a Flavonifractor plautii-derived D-allulose 3-epimerase variant
[0038] As disclosed in Korean Registered Patent Publication No. 10-2682846 (July 30, 2024), a polynucleotide fragment (Sequence No. 4) encoding the amino acid sequence of the D-allulose epimerase variant W29K / A77S / G216S / M234I was inserted into the expression vector pET28a (Novagen) to construct the recombinant expression vector pET28a_FpDPE_W29K / A77S / G216S / M234I. FIG. 2 is a cleavage map of the recombinant expression vector pET28a_FpDPE_W29K / A77S / G216S / M234I constructed in an example of the present invention. In Figure 2, "Fp_DFS2", a component of the cleavage map, represents a polynucleotide fragment (Sequence No. 4) encoding the amino acid sequence of the D-allulose epimerase variant W29K / A77S / G216S / M234I.
[0039] A PCR reaction was performed using the above-mentioned recombinant expression vector pET28a_FpDPE_W29K / A77S / G216S / M234I as template DNA and pre-designed primers, and site-directed mutagenesis was induced to produce eight D-allulose epimerase variants (W29K / S39A / A77S / G216S / M234I, W29K / A40W / A77S / G216S / M234I, W29K / E41A / A77S / G216S / M234I, W29K / E41D / A77S / G216S / M234I, W29K / E41H / A77S / G216S / M234I, Polynucleotide fragments encoding the amino acid sequences of W29K / E41K / A77S / G216S / M234I, W29K / E41W / A77S / G216S / M234I, and W29K / E71Y / A77S / G216S / M234I were constructed.The above D-allulose epimerase variant W29K / S39A / A77S / G216S / M234I is in which the serine located at the 39th position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with alanine, W29K / A40W / A77S / G216S / M234I is in which the alanine located at the 40th position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with tryptophan, W29K / E41A / A77S / G216S / M234I is in which the glutamic acid located at the 41st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with alanine, and W29K / E41D / A77S / G216S / M234I is SEQ ID NO In SEQ ID NO. 3, the glutamic acid at the 41st position from the N-terminus of the amino acid sequence is substituted with aspartic acid, and W29K / E41H / A77S / G216S / M234I is in which the glutamic acid at the 41st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with histidine, and W29K / E41K / A77S / G216S / M234I is in which the glutamic acid at the 41st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with lysine, and W29K / E41W / A77S / G216S / M234I is in which the glutamic acid at the 41st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is It is substituted with tryptophan, and W29K / E71Y / A77S / G216S / M234I is a variant in which glutamic acid at the 71st position from the N-terminus of the amino acid sequence of SEQ ID NO. 3 is substituted with tyrosine. Table 1 below summarizes the primers used to amplify polynucleotide fragments encoding eight types of D-allulose epimerase variants.
[0040] Sequence No. Primer Description Primer Base Sequence (5'→3') 5S39A Forward Primer GTGGCCGCGGCCGAGTGGGGCTATTA 6S39A Reverse Primer CTCGGCCGCGGCCACCTCGCAGATGT 7A40W Forward Primer GCCTCCTGGGAGTGGGGCTATTACGAC 8A40W Reverse Primer CCACTCCCAGGAGGCCACCTCGCAGAT 9E41A Forward Primer TCCGCCGCGTGGGGCTATTACGACGAC 10E41A Reverse Primer GCCCCACGCGGCGGAGGCCACCTCG 11E41D Forward Primer TCCGCCGATTGGGGCTATTACGACGAC 12E41D Reverse Primer GCCCCAATCGGCGGAGGCCACCTCG 13E41H Forward Primer TCCGCCCATTGGGGCTATTACGACGAC 14E41H Reverse Primer GCCCCAATGGGCGGAGGCCACCTCG 15E41K Forward Primer TCCGCCAAATGGGGCTATTACGACGAC16E41K Reverse Primer GCCCCATTTGGCGGAGGCCACCTCG17E41W Forward Primer TCCGCCTGGTGGGGCTATTACGACGAC18E41W Reverse Primer GCCCCACCAGGCGGAGGCCACCTCG19E71Y Forward Primer GGCCTGTATGCCAAATACGACCTGAG20E71Y Reverse Primer TTTGGCATACAGGCCGATGGAATAGGT
[0041] Specifically, a PCR reaction mixture with a final volume of 50 µl was prepared containing 5 ng of template DNA, 10 pmol of forward primers designed for each variant, 10 pmol of reverse primers, and 25 µl of PrimeSTAR Max Premix (TAKARA BIO). Subsequently, the PCR reaction mixture was placed in a T100 Thermal Cycler (BIO-RAD), and the genes were amplified by repeating a three-step reaction consisting of (98°C, 10 sec) → (60°C, 5 sec) → (72°C, 60 sec) 30 times. The amplified PCR products were separated by electrophoresis, and eight linear polynucleotide fragments encoding D-allulose epimerase variants were obtained.
[0042] Enzyme variant W29K / S39A / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 21, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 22. Enzyme variant W29K / A40W / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 23, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 24. Enzyme variant W29K / E41A / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 25, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 26. Enzyme variant W29K / E41D / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 27, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 28. Enzyme variant W29K / E41H / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 29, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 30. Enzyme variant W29K / E41K / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 31, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 32. Enzyme variant W29K / E41W / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 33, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 34. Enzyme variant W29K / E71Y / A77S / G216S / M234I consists of the amino acid sequence of SEQ ID NO. 35, and the polynucleotide fragment encoding it consists of the base sequence of SEQ ID NO. 36.
[0043]
[0044] Example 3: Preparation of a recombinant expression vector and a recombinant strain for the expression of a Flavonifractor plautii-derived D-allulose 3-epimerase variant
[0045] Eight recombinant expression vectors for the expression of D-allulose 3-epimerase variants were constructed from eight linear polynucleotide fragments encoding D-allulose epimerase variants using the Gibson assembly method. Specifically, a reaction mixture with a final volume of 10 µl was prepared containing 200 ng of the obtained linear polynucleotide fragment, 1 µl of Overlap Cloner 10X Reaction Buffer, and 1 µl of Overlap Cloner Enzyme Mix, and eight circular recombinant expression vectors expressing D-allulose 3-epimerase variants were constructed by reacting at 37°C for 1 hour using the Overlap Cloner DNA Cloning Kit (ELPIS-BIOTECH).
[0046] Subsequently, eight types of recombinant expression vectors obtained using the recombinant expression vector pET28a_FpDPE_W29K / A77S / G216S / M234I and the Gibson assembly method were introduced into E. coli BL21(DE3) (invitrogen) using the heat shock method (see Sambrook and Russell: Molecular Cloning) to transform the strains, and nine recombinant E. coli strains into which the recombinant expression vectors were introduced were constructed. In addition, the recombinant vectors from the nine recombinant E. coli strains were purified using the DokDo-Prep Plasmid Mini-Prep Kit (ELPIS-BIOTECH), and the presence of mutations was confirmed by submitting a gene sequencing service for the mutated amino acid residues. Subsequently, D-allulose 3-epimerase variants were expressed and purified using the nine recombinant E. coli strains in which amino acid residue mutations were confirmed through gene sequencing.
[0047]
[0048] Example 4: Expression and Purification of D-Allulose 3-Epimerase Variant Derived from Flavonifractor plautii
[0049] The recombinant strain was inoculated into 5 ml of LB medium supplemented with kanamycin at a concentration of 30 µg / ml and cultured at 37°C and stirring at 250 rpm until the absorbance (Optical density, OD) at 600 nm reached 1 or higher. Subsequently, 5 ml of the above primary culture solution was inoculated into 500 ml of LB medium supplemented with kanamycin at a concentration of 30 µg / ml and cultured at 37°C and stirring at 250 rpm. When the absorbance (Optical density, OD) at 600 nm reached 0.8, IPTG (isopropyl-1-thio-β-D-galactopyranoside) was added at a concentration of 0.1 mM to induce overexpression of the enzyme variant. From the time IPTG was added, the culture conditions were changed to a temperature of 16℃ and stirring conditions of 150 rpm, and cultured for an additional 15 hours.
[0050] Subsequently, the overexpressed allulose epimerase variant was isolated by the following method. First, the culture medium of recombinant E. coli was centrifuged at 6,000 rpm for approximately 20 minutes to remove the supernatant and recover the cells. Then, the recovered cells were washed once with a 0.85% (w / v) NaCl solution and centrifuged again to recover the cells. Afterward, the recovered cells were suspended in 30 ml of lysis buffer (containing 50 mM dipotassium phosphate, 300 mM potassium chloride, and 5 mM imidazole; pH 8.0) and then lysed using a sonicator. Subsequently, the lysed cell solution was centrifuged at 6,000 rpm for approximately 20 minutes to remove the cell pellet and recover only the supernatant. Subsequently, 5 mL of lysis buffer (containing 50 mM dipotassium phosphate, 300 mM potassium chloride, and 5 mM imidazole; pH 8.0) was loaded into a Poly-Prep Chromatography Column (BIO-RAD) packed with 1 mL of Ni-NTA Agarose, and the supernatant obtained after cell lysis was loaded into the column. Then, 5 mL of lysis buffer and 5 mL of wash buffer (containing 50 mM dipotassium phosphate, 300 mM potassium chloride, and 10 mM imidazole; pH 8.0) were loaded into the column. Finally, elution buffer (containing 50 mM dipotassium phosphate, 300 mM potassium chloride, and 5 mM imidazole; pH 8.0) was loaded to separate the protein solution containing the allulose epimerase variant. Subsequently, 10 mL of 50 mM Tris-HCl buffer (pH 7.0) was loaded onto Econo-Pac Chromatography Columns (BIO-RAD) packed with 5 mL of Sephadex G-25 Superfine to bring them to equilibrium, and a protein solution containing the allulose epimerase variant was loaded onto the column. Afterwards, 50 mM Tris-HCl buffer (pH 7.0) 5 ml was loaded onto a column to desalt a protein solution containing an allulose epimerase variant, and a purified enzyme solution with an allulose epimerase variant concentration of approximately 0.1 mg / ml was obtained.
[0051]
[0052] Example 5: Confirmation of the conversion activity of fructose to allulose by a D-allulose 3-epimerase variant
[0053] The D-allulose epimerase variant W29K / A77S / G216S / M234I previously patented by the applicant of the present invention [Korean Registered Patent Publication No. 10-2682846 (July 30, 2024)] and eight types of D-allulose epimerase variants newly produced in the present invention (W29K / S39A / A77S / G216S / M234I, W29K / A40W / A77S / G216S / M234I, W29K / E41A / A77S / G216S / M234I, W29K / E41D / A77S / G216S / M234I, W29K / E41H / A77S / G216S / M234I, To confirm the conversion activity of fructose to allulose of W29K / E41K / A77S / G216S / M234I, W29K / E41W / A77S / G216S / M234I, and W29K / E71Y / A77S / G216S / M234I), a D-allulose epimerase variant was added to a fructose-containing solution and reacted, after which the concentration of the produced allulose was measured.
[0054] First, a reaction solution was prepared consisting of purified enzyme solution, 250 mM fructose, 1 mM cobalt chloride (CoCl2), and 50 mM Tris-HCl buffer solution (pH 7.0). The concentration of the D-allulose epimerase variant in the reaction solution was 0.05 mg / mL. Subsequently, the reaction solution was placed in a heating block at 65°C and reacted for 5 minutes under shaking conditions. Afterward, the reaction was stopped by adding a 10% (w / v) hydrochloric acid solution to the reaction product in an amount equivalent to 1 / 10 of the volume of the reaction product. Subsequently, the reaction product was centrifuged at 13,000 rpm and 4°C to recover the supernatant. Subsequently, the supernatant was analyzed using a high-performance liquid chromatography (HPLC) system (Agilent, USA) equipped with an Aminex HPX-87C column (BIO-RAD) and a RID (Refractive Index Detector, Agilent 1100 RID). For the HPLC analysis, distilled water was used as the mobile phase solvent, the column temperature was 80°C, and the flow rate was 0.6 mL / min. The allulose and fructose concentrations in the supernatant were calculated using HPLC peak area values.
[0055] The conversion activity of fructose to allulose of eight types of newly produced D-allulose epimerizing enzyme variants in the present invention was calculated as a relative percentage of activity by comparing it with the conversion activity of the D-allulose epimerizing enzyme variant W29K / A77S / G216S / M234I previously patented by the applicant of the present invention, and the results are summarized in Table 2 below.
[0056] Classification of D-Allulose Epimerase Variants Conversion Activity of Fructose to Allulose (Relative Percentage of Activity Compared to W29K / A77S / G216S / M234I) W29K / A77S / G216S / M234I 100% W29K / S39A / A77S / G216S / M234I 63% W29K / A40W / A77S / G216S / M234I 65% W29K / E41A / A77S / G216S / M234I 134% W29K / E41D / A77 S / G216S / M234I91%W29K / E41H / A77S / G216S / M234I74%W29K / E41K / A77S / G216S / M234I73%W29K / E41W / A77S / G216S / M234INAW29K / E71Y / A77S / G216S / M234I79%
[0057] * NA: No conversion active
[0058] As shown in Table 2 above, among the eight types of D-allulose epimerizing enzyme variants newly produced in the present invention, the conversion activity of fructose to allulose was improved by 34% only in the D-allulose epimerizing enzyme variant W29K / E41A / A77S / G216S / M234I, which was produced by substituting glutamic acid at the 41st position from the N-terminus of the amino acid sequence of D-allulose epimerizing enzyme variant W29K / A77S / G216S / M234I with alanine. On the other hand, in D-allulose epimerase variants prepared by substituting an amino acid residue located at a position other than the 41st from the N-terminus of the D-allulose epimerase variant W29K / A77S / G216S / M234I with another amino acid residue, or by substituting glutamic acid located at the 41st position with an amino acid residue other than alanine, the conversion activity of fructose to allulose was actually lower or showed no results at all.
[0059]
[0060] Although the present invention has been described above through the embodiments, the invention is not necessarily limited thereto, and it is understood that various modifications are possible within the scope and spirit of the invention. Accordingly, the scope of protection of the present invention should be interpreted to include all embodiments falling within the scope of the claims attached to the present invention.
Claims
1. An allulose epimerase variant consisting of the amino acid sequence of sequence number 25.
2. A polynucleotide encoding the allulose epimerase variant of claim 1.
3. The polynucleotide according to paragraph 2, characterized in that the polynucleotide consists of the base sequence of SEQ ID NO.
26.
4. A recombinant vector comprising the polynucleotide of paragraph 2.
5. A recombinant strain transformed by any one of the polynucleotide of paragraph 2, the polynucleotide of paragraph 3, or the recombinant vector of paragraph 4.
6. A step of culturing the recombinant strain of claim 5 to express an allulose epimerization enzyme variant; and A method for preparing an allulose epimerization enzyme variant, comprising the step of isolating the allulose epimerization enzyme variant from a lysate of a recombinant strain expressing the allulose epimerization enzyme variant.
7. A composition for producing allulose comprising the allulose epimerizing enzyme variant of claim 1.
8. A composition for producing allulose comprising the recombinant strain of claim 5, a culture of the recombinant strain, or a lysed product of the recombinant strain.
9. A method for producing allulose comprising the step of reacting fructose with the allulose epimerizing enzyme variant of claim 1 or a composition comprising the allulose epimerizing enzyme variant.
10. A method for producing allulose comprising the step of reacting fructose with a composition comprising the recombinant strain of claim 5, a culture of the recombinant strain, a pulverized product of the recombinant strain, or one or more of these.