Systems and methods for stimulating mitochondria biogenesis using nanomaterials with atomic vacancies
MoS2 nanoflowers with atomic vacancies stimulate mitochondrial biogenesis in stem cells, enhancing their ability to transfer healthy mitochondria, addressing the inefficiencies and limitations of current therapies for mitochondrial diseases.
Patent Information
- Application Number
- PCT/US2025/060248
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-23
- Filing Date
- 2025-12-18
- Publication Date
- 2026-07-02
AI Technical Summary
Current therapies for mitochondrial dysfunction suffer from limited efficacy, high toxicity, and inadequate bioavailability, and methods to enhance mitochondrial transfer are cumbersome and inefficient, failing to address the root cause of mitochondrial diseases effectively.
Utilizing molybdenum disulfide (MoS2) nanoflowers with atomic vacancies to stimulate mitochondrial biogenesis in mesenchymal stem cells, transforming them into 'biofactories' that enhance intercellular mitochondrial transfer and transplantation, thereby increasing mitochondrial mass and function.
The method significantly enhances mitochondrial biogenesis and bioenergetics, improving the efficiency and efficacy of mitochondrial transfer and transplantation, offering a promising therapeutic approach for a wide range of diseases associated with decreased mitochondrial function.
Smart Images

Figure US2025060248_02072026_PF_FP_ABST
Abstract
Description
TITLE OF THE INVENTIONSYSTEMS AND METHODS FOR STIMULATING MITOCHONDRIA BIOGENESIS USING NANOMATERIALS WITH ATOMIC VACANCIESCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to U.S. Provisional Appl. Ser. No.63 / 738,173, filed December 23, 2024, the entire disclosure of which is incorporated herein by reference.STATEMENT OF GOVERNMENT RIGHTS
[0002] This invention was made with government support under DP2-EB026265 and R01DE032031 awarded by the National Institutes of Health and under W81XWH2210932 awarded by the Department of Defense. The government has certain rights in the invention.INCORPORATION OF SEQUENCE LISTING
[0003] A sequence listing containing the file named “TAMC090WO_ST26.xml” which is 6,253 bytes (measured in MS-Windows®) and created on December 9, 2025, and comprises 6 sequences, is incorporated herein by reference in its entirety.TECHNICAL FIELD
[0004] The present disclosure relates to the field of diseases or conditions associated with decreased mitochondrial function. More specifically, in certain embodiments, this disclosure relates to systems and methods for stimulating mitochondria biogenesis using nanomaterials with atomic vacancies.BACKGROUND
[0005] Mitochondria are semiautonomous organelles that account for the maintenance of metabolic homeostasis necessary for cell function. Mitochondrial bioenergetics and function are the backbone of cellular health. Many errors of energy metabolism underly common pathologies, both inherited and environmental. Therefore, monitoring, modulating, and1US_ACTIVE\131850427W-2protecting mitochondrial function is of utmost importance. Mitochondrial dysfunction is associated with many human pathologies and can arise from environmental and genetic factors making it difficult to treat, and clinical presentation of mitochondrial diseases encompasses dysfunction of any organ or tissue. Defects in mitochondrial function are associated with a number of disorders and diseases including cancer, type 2 diabetes, osteoporosis, and neurodegenerative disorders, such as Parkinson’s and Alzheimer’s. The transfer of mitochondria between cells has been observed as a spontaneous way to repair injured tissues and cells. However, the utilization of this natural transfer process is limited by its efficiency. Furthermore, although some mitochondria-targeting therapeutics have been developed, they suffer from limited efficacy, high toxicity, and inadequate bioavailability.
[0006] Molybdenum disulfide (M0S2) is a promising 2D nanomaterial that has attracted significant interest due to its superior electrochemical characteristics. M0S2 includes one layer of molybdenum (Mo) oriented between two sulfur (S) layers with a strong covalent bond. M0S2 can boost electrocatalytic performance by enhancing electrochemical kinetics and low-loss electrical transport.SUMMARY
[0007] In one aspect, the present disclosure provides a method for preparing a mitochondria transplantation therapy, the method comprising: exposing cells to nanomaterial structures causing increased mitochondrial biogenesis in at least a portion of the exposed cells; obtaining exposed cells; and preparing the obtained cells and / or mitochondria from the obtained cells for administration as a mitochondria transplantation therapeutic.
[0008] In certain embodiments, the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide. In certain embodiments, the method further comprises preparing the nanomaterial structures by combining a molybdenum precursor and sulfur precursor at a predefined ratio and heating the combined molybdenum precursor and sulfur precursor to a temperature of at least 140 °C for at least 6 hours. The method may further comprise exposing the cells to an effective amount of the nanoflowers. In some embodiments, an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1. In some embodiments, an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1. In some embodiments, the nanomaterial structures are about 5 nm to about 400 nm in diameter. In some embodiments, the method further includes preparing a whole cell therapy by collecting at least one of the exposed cells. In some2US_ACTIVE\131850427W-2embodiments, the method further includes obtaining the mitochondria from the obtained cells by extracting or isolating mitochondria from the obtained cells. In some embodiments, the method further comprises packaging the extracted or isolated mitochondria by encapsulating at least a portion of the obtained mitochondria in liposomes or a gel.
[0009] In another aspect, the present disclosure provides a method of increasing mitochondrial function in a subject in need thereof, the method comprising obtaining a cell sample from the subject; exposing cells of the cell sample to nanomaterial structures, thereby increasing mitochondrial biogenesis in at least a portion of the cells of the cell sample: preparing a mitochondria transplantation therapeutic using at least one of the exposed cells or mitochondria obtained from the exposed cells; and administering to the subject an effective amount of the mitochondria transplantation therapeutic.
[0010] In some embodiments, preparing the mitochondria transplantation therapeutic comprises obtaining an amount of the exposed cells; and administering to the subject the effective amount of the mitochondria transplantation therapeutic comprises administering at least a portion of the exposed cells to the subject. In some embodiments, preparing the mitochondria transplantation therapeutic comprises obtaining mitochondria from the exposed cells; and packaging the mitochondria for administration as the mitochondria transplantation therapeutic. In some embodiments, packaging the mitochondria for administration as the mitochondria transplantation therapeutic comprises coating or encapsulating the mitochondria in liposomes or a gel.
[0011] In some embodiments, the subject is afflicted with or at risk of developing a disease or condition associated with decreased mitochondrial function. In some embodiments, the disease or condition associated with decreased mitochondrial function is selected from the group consisting of: Barth syndrome, mitochondrial encephalopathy, lactic acidosis, strokelike episodes (MELAS), Myoclonus epilepsy with ragged-red fibers (MERRF), neuropathy, ataxia, and retinitis pigmentosa (NARP), Leber's hereditary optic neuropathy (LHON), Kearns-Sayre syndrome (KSS), Pearson syndrome (PS), progressive external ophthalmoplegia (PEO), autosomal-dominant / recessive PEO (ad / ar PEO), mitochondrial DNA (mtDNA) depletion syndrome (MDDS), mitochondrial neurogastrointestinal encephalopathy (MNGIE), mitochondrial recessive ataxia syndrome (MIRAS), Alpers syndrome (AS), Leigh syndrome (LS), optic nerve atrophy, subacute necrotizing encephalopathy, early-onset hepatocerebral disorder, juvenile catastrophic epilepsy, adult-onset ataxia-neuropathy syndrome, cardiomyopathy, cerebral white matter disease, ovarian dysfunction, hearing loss, cancer,3US_ACTIVE\131850427W-2diabetes mellitus, osteoporosis, dyskeratosis congenita (DC), bone marrow failure, idiopathic pulmonary fibrosis, cryptogenic liver cirrhosis, telomere biology disorders, and neurodegenerative disease.
[0012] In some embodiments, said administering comprises injection, microneedle administration, oral administration, buccal administration, vaginal administration, inhalation, intraosseous administration, transnasal application, topical administration, transdermal application, or rectal administration. In some embodiments, the method further comprises administering a second therapy to said subject. In some embodiments, the second therapy is a therapeutic agent or surgery.
[0013] In yet another aspect, the present disclosure provides a composition comprising mitochondria obtained by a method comprising: exposing cells to nanomaterial structures causing increased mitochondrial biogenesis in at least a portion of the exposed cells; obtaining mitochondria from the exposed cells; and preparing the obtained mitochondria for administration as the pharmaceutical composition. In some embodiments, the mitochondria are coated or encapsulated in liposomes or a gel. In some embodiments, the cells are eukaryotic cells, each comprising: a plurality of nanomaterial structures within the eukaryotic cell; and a plurality of mitochondria within the eukaryotic cell, wherein an amount of the mitochondria is increased by a presence of the plurality of nanomaterial structures. In some embodiments, the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide. In some embodiments, an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1. In some embodiments, an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1. In some embodiments, the nanomaterial structures are about 5 nm to about 400 nm in diameter. In some embodiments, the eukaryotic cell is a stem cell.
[0014] In yet another aspect, the present disclosure provides a eukaryotic cell comprising: a plurality of nanomaterial structures within the eukaryotic cell; and a plurality of mitochondria within the eukaryotic cell, wherein an amount of the mitochondria is increased by a presence of the plurality of nanomaterial structures. In some embodiments, the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide. In some embodiments, an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1. In some embodiments, an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1. In some embodiments, the nanomaterial4US_ACTIVE\131850427W-2structures are about 5 nm to about 400 nm in diameter. In some embodiments, the eukaryotic cell is a stem cell.BRIEF DESCRIPTION OF THE DRAWINGS
[0001] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0002] FIG. 1 demonstrates the synthesis and characterization of size-tunable M0S2 nanoflowers. FIG. 1, Panel A - Hydrodynamic size of high-defect M0S2 nanoflowers synthesized by varying synthesis time and temperature. Representative images of 1 mg / mL solutions synthesized at 6 h compared to 18 h synthesis at 200 °C. FIG. 1, Panel B - X-ray Diffraction (XRD) spectra showing the crystallographic arrangement of Mo and S atoms within the nanoflowers. Peaks (002, 100, 110) show hexagonal crystal structure. FIG. 1, Panel C -Transmission electron microscopy (TEM) images showing M0S2 nanoflower assembly consisting of multiple individual M0S2 nanosheets. TEM images indicate successful nanoflower formation at 140 °C and 6 h of hydrothermal synthesis. X-ray photoelectron spectra (XPS) show the binding energies (BE) for molybdenum (Mo) and sulfur (S) within M0S2 nanoflowers. FIG. 1, Panel D - Graph (left Panel) and image (right Panel) showing zeta potential and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) results indicating protein corona formation on nanoparticles of varying sizes. FIG. 1, Panel E - Bar graph showing biochemical determination of H2O2 reduction by direct comparison with catalase enzyme. Both sizes of nanoflowers displayed catalytic activity (n=3, *p<.05). FIG. 1, Panel F - Plot showing the effect of different sizes of M0S2 nanoflowers on cell viability in human mesenchymal stem cells (hMSCs) following 24 h of exposure. M0S2 nanoflowers exhibit half-inhibitory concentration (IC50) of -200-250 ug / ml.. FIG. 1, Panel G - Bar graph showing the effect of atomic defects of M0S2 nanoflowers on cell cycle evaluated after 72 h (n=3). FIG. 1, Panel H - Fluorescence images showing the internalization of M0S2 nanoflowers of different sizes (1:6) after 24 h. (White: MoS2 nanoflowers, Yellow: actin cytoskeleton. Blue: DAPI, nucleus).
[0003] FIG. 2 demonstrates that treatment of cells with M0S2 nanoflowers stimulates mitochondrial biogenesis and bioenergetics. FIG. 2, Panel A - Diagram illustrating a proposed mechanism of action of M0S2 with high atomic vacancies for triggering mitochondrial5US_ACTIVE\131850427W-2biogenesis. According to this possible mechanism, atomic vacancies of M0S2 exhibit free radical scavenging activity through rapid reactions with reactive oxygen species (ROS), including hydrogen peroxide (H2O2), superoxide anions (()?•-). and hydroxyl radicals (*OH). Reduction in intracellular reactive oxygen species (ROS) due to the presence of atomic vacancies on M0S2 is believed to trigger the SIRTl / PGCla / NRF2 pathway. FIG. 2, Panel B -Bar graph showing the amount of intracellular ROS determined before and after treatment with M0S2 nanoflowers (1:6). MoS2 treatment significantly suppressed ROS production (n=3; ***p<0.001). FIG. 2, Panel C - Bar graph showing the amount of mitochondrial ROS determined using MitoSox before and after treatment with M0S2 nanoflowers (1:6). M0S2 treatment significantly suppressed mitochondrial ROS production (n=3; ****p<0.0001 ). FIG.2, Panel D - Western blotting results and corresponding bar graphs showing the relative expression of key mitochondrial proteins. M0S2 (1:6) treatment resulted in significant upregulation of VD AC 1 andPGC-laat7 days, following treatment (n=3; *p<0.05; **p<0.01). FIG. 2, Panels E-G - Bar graphs (Panels E and G) and plot (Panel F) showing the effect of treatment with high atomic vacancy M0S2 nanoflowers on mitochondrial biogenesis. A significant increase in mtDNA encoded transcript (ND2), as well as copy number (mitochondrial DNA / nuclear DNA), shows that M0S2 (1:6) treatment resulted in a significant increase in mitochondrial biogenesis. (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 2, Panel H - Bar graphs showing ATP levels in cells treated with M0S2 (1:6) nanoflowers. The results suggest a marked increase in ATP levels compared to control hMSCs not treated with M0S2 (1:6) nanoflowers (n=4; **p<0.01). FIG. 2, Panel I - Plot and bar graphs showing the effect of M0S2 nanoflower treatment on oxygen consumption rate (OCR) as determined in Human Umbilical Artery Smooth Muscle Cells (HUASMC) cells treated with M0S2 nanoflowers (25 pg / mL). An increase in spare respiratory capacity was observed, indicating the strong ability of M0S2 nanoflowers to trigger mitochondrial respiration machinery. Data points are shown as mean ± SEM (n=5). FIG. 2, Panel I - Plot showing the effect of M0S2 nanoflower treatment on ECAR as determined in IIUASMCs. The results show no changes in glycolytic capacity as a result of nanoflower treatment. Data points are shown as mean ± SEM (n=5; **p<0.01).
[0004] FIG. 3 demonstrates the effects of M0S2 nanoflowers on mitochondrial transfer between cells. FIG. 3, Panel A - Confocal laser scanning microscopy (CESM) images of intercellular structures facilitating the transfer of mitochondria between HUASMCs and hMSC donor cells treated with Small M0S2 (S_Mo). (Blue: DAPI, nucleus. Yellow: Wheat Germ6US_ACTIVE\131850427W-2Agglutinin, membrane. White: reflected light, nanoparticle. Red; MitoTracker Deep Red FM, Mitochondria). FIG. 3, Panel B - Bar graphs showing the quantitative analysis of mitochondrial transfer rates of hMSCs and S_Mo-hMSCs in C2C12, H9C2, HUASMC, and NHCF-V recipient cells after 24 h co-culture (n=3; ****p<0.0001). FIG. 3, Panel C - Flow cytometry analysis of mitochondrial transfer rate comparing a co-culture and trans-wcll system between hMSC donor cells and C2C12 recipients. (n=3; **p<0.01). FIG. 3, Panel D -Comparison of transfer rate of hMSCs and S_Mo-hMSCs in the presence of tunneling nanotube (TNT) inhibitor Cytochalasin B (350 nM) (n=3; ****p<0.0001). FIG. 3, Panel E -Principal component analysis (PC A) of HUASMC samples co-cultured with hMSCs or S_Mo-hMSCs based on mRNA expression obtained from RNA-seq (n=3). Untreated smooth muscle cells (SMCs) were used as the control. PCA was performed on mRNA expression profile of the top 20% most variable genes across all samples (Log2FPKM). FIG. 3, Panel F - MA plot showing differences in gene expression (log2(Fold Change)) between SMCs alone and hMSCs or S_Mo-hMSCs, respectively. Genes with a significantly high expression are shown in red. Genes with a significantly low expression are shown in blue (P-adj). Gray denotes no significant differences. FIG. 3, Panel G - Hierarchical clustering of SMC samples co-cultured with hMSCs and S_Mo-hMSCs based on mRNA expression form RNA-seq. The heatmap shows DEGs (Log2FPKM of DEGs, P-adj<05) across all treatment groups (red: up-regulated, blue: down-regulated). FIG. 3, Panel H - GO annotation of biological processes comparing the co-culture systems hMSCs vs S_Mo-hMSCs. Resulting analysis reveals cluster of mitochondrial and metabolism related terms (P-adj < 0.01).
[0005] FIG. 4 demonstrates the effect of MoS2-mediated mitochondrial transfer for cellular bioenergetics. FIG. 4, Panel A - Schematic illustration of TNT mediated mitochondrial transfer between hMSC donor cells and recipient SMCs. FIG. 4, Panel B - SEM and CESM images of nanotubes formed between hMSCs and SMCs in co-culture. FIG. 4, Panel C - Mitochondrial copy number in SMC before and after transfer from hMSCs and S_Mo-hMSCs (n=4; ****p<0.0001). FIG. 4, Panel D - Volcano plot highlighting genes involved in mitochondrial ATP synthesis coupled proton transport and oxidative phosphorylation for S_M-hMSCs mediated co-culture (gray: all expressed genes; blue: all genes associated with the GO term; red: genes associated with the GO term that show significant difference). FIG. 4, Panel E -Gene Set Enrichment Analysis (GSEA) results showing a positive enrichment of MRC related terms. A positive NES indicates a significant number of genes belonging to these terms are upregulated (P-adj<0.01). FIG. 4, Panel F - GSEA enrichment results showing NES for7US_ACTIVE\131850427W-2MitoPathways, including Protein Import sorting and homeostasis, mitochondrial central dogma, and OXPHOS assembly factors for S_Mo-hMSC co-culture. The vertical lines (“bar code”) represent the projection onto the ranked gene list of individual genes of the gene set. FIG. 4, Panel G - Plot showing the effect of S_Mo-hMSCs on OCR of SMCs. A significant increase in basal respiration capacity was observed in S_Mo-hMSCs groups indicating the ability to contribute to mitochondrial respiration over hMSCs alone. Data points are shown as mean ± SEM (n=5; ****p<0.0001). FIG. 4, Panel H - Evaluation of ATP levels in cells cocultured with S_Mo-hMSCs in HUASMCs and NHCF-Vs under physiological conditions (n=3; *p<0.05).
[0006] FIG. 5 demonstrates that MoS2-mediated mitochondrial transfer increases therapeutic ability to restore injured cells. FIG. 5, Panel A - Schematic illustration of mitochondrial damage induced via various treatments: Doxorubicin, Antimycin A, carbonyl cyanide 3-cholorophenylhydrazone (CCCP). FIG. 5, Panel B - qPCR indication of MFN1 / 2 and OPA1 relative expression in SMCs after mitochondrial transfer under physiologically induced and Antimycin A-induced mitochondrial damage. Data suggests upregulation of mitochondrial fusion with existing networks within recipient cells (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 5, Panel C - Total Intracellular ATP levels following treatment with Antimycin A, showing ability of MoS2-mediated mitochondrial transfer to restore and replenish ATP from damaged mitochondria (n=3; **p<0.01, ****p<0.0001). FIG. 5, Panel D - Relative mitochondrial ROS levels of SMCs after the indicated treatments with Antimycin A. The fluorescence intensity of the ROS probe was evaluated by flow cytometry (n=3; ***p<0.001, ****p<().()0001). FIG. 5, Panel E - Mitochondrial membrane potentials of SMCs after the indicated treatment with CCCP, assessed by comparing the ratio of healthy mitochondria to damaged mitochondria (n=3; **p<0.01 ). FIG. 5, Panel F - Cellular apoptosis, viability, and caspase activity of NHCF-V cells after Doxorubicin treatment in the indicated co-cultures (n=3; *p<0.05, **p<0.01, ****p<0.0001). FIG. 5, Panel G - Relative mitochondrial ROS levels following Doxorubicin treatment in NHCF-V cells after co-culture (n=3; *p<0.05, ****p<0.0001). FIG. 5, Panel H - Intercellular ATP levels of NHCF-V cells co-cultured with hMSCs or S_Mo-hMSCs after Doxorubicin treatment (n=4; *p<0.05, **p<0.01). FIG. 5, Panel I - Graphs and images showing results from western blotting. Results show the relative expression of AIF levels of NHCF-V cells after indicated treatments (n=3; **p<0.01, ***p<0.001).8US_ACTIVE\131850427W-2
[0007] FIG.6 demonstrates the isolation and packaging of mitochondria isolated from M0S2 treated cells. FIG. 6, Panel A - Schematic representation of mitochondrial transplantation and potential outcomes for the introduction of exogenous mitochondria to recipient cells. FIG. 6, Panel B - Western blot analysis of mitochondrial porin VDAC from isolated mitochondria populations from H9C2 cardiomyocytcs and NHCF-v cardiac fibroblasts. The results show an increase in available total mitochondria from 107 cells following M0S2 treatment. FIG. 6, Panel C - Schematic representation of lipid layer coating process of mitochondria. Isolated populations were added to a solution of DOTAP and DOPE (1:1) and centrifuged. FIG. 6, Panel D - hydrodynamic size of isolated mitochondria before and after lipid coating. After coating, the zeta potentials of the mitochondria were changed.
[0008] FIG.7 shows SEM images depicting morphology of M0S2 nanoflowers synthesized at 130 °C (left Panel) and 140 °C (right Panel). Nanoflower morphology is not apparent at 130
[0009] FIG. 8 is a bar graph demonstrating the effect of atomic vacancy-rich M0S2 on mitochondrial membrane potential. Membrane potential was evaluated using the JC-1 dye. hMSCs treated with M0S2 (100, 130, and 250 nm) showed no significant changes in mitochondrial membrane potential compared to untreated cells. Cell number variation was normalized using nuclear stain (DAPI) (n=6; *p<0.05).
[0010] FIG. 9 demonstrates that treatment of cells with M0S2 nanoflowers stimulates mitochondrial biogenesis and bioenergetics. FIG. 9, Panel A - Bar graphs showing the effect of atomic vacancy-rich small (100 nm) and large (250 nm) M0S2 nanoflowers on mitochondrial biogenesis after 7 days. A significant increase in relative mitochondrial copy number (determined as a ratio of mitochondrial DNA / nuclear DNA abundance) indicates that M0S2 treatment significantly increases mitochondrial biogenesis. (n=4; ***p<0.001, ****p<0.0001). FIG. 9, Panel B - Bar graphs showing the evaluation of relative mitochondrial copy number in transduced cells following treatment with M0S2 for 72 h. Following treatment with vacancyrich M0S2 nanoflowcrs, cells transduced with empty vector show a significant increase in mitochondrial copy number, while PGC- la-knocked cells show no significant change in mitochondrial copy number (n=3; **p<0.01, ****p<0.0001).
[0011] FIG. 10 shows bar graphs of glycolysis and glycolytic rates determined via ECAR following glycolysis stress test on a Seahorse Bioanalyzer. No significant change in either9US_ACTIVE\131850427W-2glycolysis or glycolytic capacity was observed following small M0S2 treatment for 7 days in HUASMCs (n=5, *p<.05).
[0012] FIG.11 shows CLSM images of mitochondrial translocation. FIG.11 , Panel A - CLSM images depicting mitochondrial translocation in recipient cells following co-culture with small and large M0S2 nanoflower-treated hMSCs in C2C12s. FIG. 11, Panel B - CLSM images depicting mitochondrial translocation in recipient cells following co-culture with small M0S2 nanoflower-treated hMSCs in NHCF-Vs. (Blue: DAPI, nucleus. Yellow: Wheat Germ Agglutinin, membrane. White: reflected light, nanoparticle. Red; MitoTracker Deep Red FM, Mitochondria).
[0013] FIG. 12 shows mitochondrial transfer rates in cells. FIG. 12, Panel A - Bar graphs showing quantitative analysis of mitochondrial transfer rates of hMSCs and S_Mo-hMSCs in C2C12, H9C2, HUASMC, and NHCF-V recipient cells after 24 h co-culture (n=3; ****p<0.0001). FIG. 12, Panel B - Bar graph showing flow cytometry analysis of mitochondrial transfer rate comparing co-culture with M0S2 nanoflower-treated hMSCs and Resveratrol-treated hMSCs in C2C12 recipients. (n=3; ***p<0.001).
[0014] FIG. 13 shows bar graphs of data obtained from qPCR determination of relative mitochondrial copy number (determined as a ratio of mitochondrial DNA I nuclear DNA abundance) for hMSCs (left Panel) and S_Mo-hMSCs (right Panel). The bar graphs indicate that hMSCs experience significant decrease in mitochondrial number following mitochondrial transfer. (n=3; *p<0.05, ***p<0.001).
[0015] FIG. 14 shows a comparison of transfer rate of hMSCs (left Panel) and S_Mo-hMSCs (right Panel) in the presence of TNT inhibitor Cytochalasin B (350 nM) (n=3; ****p<0.0001).
[0016] FIG. 15 demonstrates the ability of M0S2 nanoflowers to increase mitochondrial transfer rates via increases in mitochondrial mass. FIG. 15, Panel A - Western blot analysis of Rhotl (Mirol) expression in hMSCs following co-culture with HUASMCs indicating M0S2 has no effect on expression (n=3). FIG. 15, Panel B - Cellular internalization of M0S2 nanoflowers following co-culture was explored using ICP-MS elemental analysis. The levels of Mo are plotted for recipient C2C12s co-cultured with and without MoS2 hMSCs (n=3; ***P<0.001).
[0017] FIG. 16 shows key GO terms generated from the DEGs in SMCs co-cultured with hMSCs and small M0S2 nanoflower-treated hMSCs (Mito-transfer and MitoFactory-transfer respectively) (p<0.01). GO terms associated with mitochondrial activity and respiration are 10US_ACTIVE\131850427W-2uniquely activated in MitoFactory co-culture. GO terms associated with the extracellular matrix and cell interaction are activated in both. Circle size correlates to the gene ratio, i.e., the DEGs associated with a GO term divided by the total number of genes mapped to the GO term. Color intensity is associated with increasing significance - log(p-adj) (dark circle: greater significance, light circle: less significance).
[0018] FIG. 17 shows compiled GO cellular components and molecular functions generated from DEGs from SMCs co-cultured with hMSC MitoFactories versus standard MitoTransfer alone. P-adjusted values are reported using -log 10 transformation with a Padj. < 0.01 threshold. Highlighted terms correspond to processes relating to mitochondria.
[0019] FIG. 18 demonstrates increased mitochondrial uptake following mitochondrial transfer. FIG. 18, Panel A - Bar graph showing relative mitochondrial copy number determined by PCR analysis of ratio of mitochondrial DNA to nuclear DNA abundance in NHCF-Vs following MitoFactory transfer (n=3; ****p<0.0001). FIG. 18, Panel B - Bar graph showing mitochondrial membrane potential in recipient cells following transfer. Mitochondrial membrane potential was evaluated using the JC-1 dye. SMCs co-cultured with hMSCs and M0S2 nanoflower-treated hMSCs showed no significant changes in mitochondrial membrane potential compared to untreated cells. Cell number variation was normalized using nuclear stain (DAPI) (n=7: *p<0.05).
[0020] FIG. 19 shows volcano plots of genes involved in mitochondrial ATP synthesis coupled proton transport, oxidative phosphorylation, and mitochondrial ribosome for coculture. (Gray: all expressed genes; Blue: all genes associated with the GO term shown above each plot).
[0021] FIG. 20 demonstrates that transferred mitochondria are quickly integrated into networks of recipient cells. FIG. 20, Panel A - Bar graph showing qPCR indication of MFN1 / 2 relative expression in NHCF-Vs after mitochondrial transfer under physiological conditions. Data suggests upregulation of mitochondrial fusion and translocation with existing networks within recipient cells (n=3; ***p<0.001, ****p<0.0001). FIG. 20, Panel B - Bar graph showing qPCR determination of relative mitochondrial copy number (determined as a ratio of mitochondrial DNA I nuclear DNA abundance). Data suggests SMCs gradually decrease copy number after transfer across 48 h, while mitochondria from M0S2 nanoflower-treated hMSCs retain significantly higher mitochondrial numbers (n=3; **p<0.01, ***p<0.001).11US_ACTIVE\131850427W-2
[0022] FIG. 21 is a bar graph showing qPCR determination of Rhotl (Mirol) expression in both healthy and damaged SMCs (Antimycin A). No significant changes were observed in mitochondrial transfer vs. MitoFactory transfer until mitochondrial damage is present. (n=4; ***p<0.001).
[0023] FIG. 22 demonstrates the effect of Doxorubicin on NHCF-V cardiac fibroblasts in general ROS and cell proliferation. FIG. 22, Panel A - Bar graph of general cellular ROS levels following 24 h doxorubicin exposure, indicating severe damage to cellular health (n=3; ****p<0.0001). FIG. 22, Panel B - Bar graph of cell proliferation following 24 h Doxorubicin treatment indicating significant cell death at >100 nM for 24 h (n=7; ****p<0.0001).
[0024] FIG. 23 illustrates metabolic reprogramming after mitochondrial transfer from MitoFactories. FIG. 23, Panel A - Schematic illustration of mitochondrial affects induced via TFAM knockdown. qPCR determination of mtDNA copy number and TFAM relative expression in C2C12s after knockdown (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 23, Panel B - qPCR determination of MFN1 / 2 relative expression in shTFAM cells after transfer for 72h (n=3; *p<0.05, **p<0.01, ***p<0.001). FIG. 23, Panel C - Real time ATP production rate after 24h in C2C12 and shTFAM cells after transfer indicating OXPIIOS and glycolytically produced ATP (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 23, Panel D - Real time ATP production rate after 72h in C2C12 and shTFAM cells after transfer indicating OXPHOS and glycolytically produced ATP (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 23, Panel E - Total intracellular ATP levels following mitochondrial transfer after 72h (n=3; *p<0.05). FIG. 23, Panel F -NAD / NADH ratio in cells following mitochondrial transfer after 24 and 72h (n=3; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).
[0025] FIG. 24 illustrates how mitochondrial transfer from MitoFactories restores calcium signaling in cells lacking functional mitochondria. FIG. 24, Panel A - Schematic representation of intercellular calcium dynamics in cells featuring cytoplasmic, endoplasmic reticulum, and mitochondrial components. FIG. 24, Panel B - Fluorescent ratio of CalBrytc-520 calcium dye in C2C12s and shTFAM cells after transfer, peak calcium flux is induced by lOpM ATP (n=3). FIG. 24, Panel C - Transient calcium signaling in C2C12s and shTFAM cells following mitochondrial transfer featuring frequency and peak amplitude (n=15, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).12US_ACTIVE\131850427W-2BRIEF DESCRIPTION OF THE SEQUENCES
[0026] SEQ ID NO:1 - A representative forward primer sequence for amplification of GAPDH.
[0027] SEQ ID NO:2 - A representative reverse primer sequence for amplification of GAPDH.
[0028] SEQ ID NO:3 - A representative forward primer sequence for amplification of mt-ND2.
[0029] SEQ ID NO:4 - A representative reverse primer sequence for amplification of mt-ND2.
[0030] SEQ ID NO:5 - A representative forward primer sequence for amplification of PGC-la.
[0031] SEQ ID NO:6 - A representative reverse primer sequence for amplification of PGC-la.DETAILED DESCRIPTION
[0032] The present disclosure provides compositions and methods for increasing mitochondrial biogenesis using nanomaterials. The present disclosure further provides a significant advance in the art by providing high efficacy, low toxicity mitochondria-based therapies based on eukaryotic cells with increased mitochondria biogenesis and / or mitochondria obtained from such cells.A. Mitochondrial dysfunction and disease
[0033] Dysfunctional mitochondria can lead to cellular damage and apoptosis, contributing to a wide range of diseases, including neurodegenerative disorders, cardiovascular diseases, and metabolic conditions. Despite growing awareness, there are currently no FDA- approved treatments or cures for mitochondrial diseases. Existing therapies focus solely on symptom management, failing to address the underlying cause. Fewer than 25% of registered clinical trials for mitochondrial diseases involve new experimental drugs, with only 10 Phase III trials, and just one completed. While some experimental therapies show potential in alleviating symptoms, none have demonstrated the ability to slow disease progression or offer a cure. Developing therapies that target the root cause of mitochondrial dysfunction remains an urgent medical priority with far-reaching implications.
[0034] Intercellular mitochondrial transfer is a fundamental biological process whereby eukaryotic cells (also referred to simply as “cells” herein) exchange mitochondria to mitigate 13US_ACTIVE\131850427W-2stress and promote tissue repair, an extension of mitochondrial movement and cellular communication. Occurring within a wide variety of cells, this innate mechanism has the potential to meet local energy demands where existing mitochondrial networks struggle. Mitochondrial stressors can arise from environmental and genetic factors that cause defects in oxidative phosphorylation, mitochondrial DNA (mtDNA) maintenance, and mitochondrial translation (gene expression). Intercellular mitochondrial transfer provides a comprehensive approach to alleviate mutant mtDNA load by altering the mtDNA content of recipient cells, while simultaneously restoring respiration and survival through additional energy-generating machinery. This transfer has been observed both in vitro and in vivo, under physiological and pathological conditions. Mesenchymal stem cells (MSCs) have shown a particular propensity for initiating mitochondrial transfer to nearby cells. The mitochondria provided by MSCs enhance cellular respiration, induce cell reprogramming, and repair metabolic function in recipient cells. Due to their lower energy demands, MSCs are favored for mitochondrial transfer to diseased cells with high bioenergetic needs. Their immune privilege, availability from various sources, and ease of use render MSCs ideal donor cells for delivering healthy mitochondria.
[0035] The primary mechanism for mitochondrial transfer involves tunneling nanotubes (TNTs), which are formed through membrane deformation and actin polymerization. Within these structures, motor proteins and adaptor proteins facilitate the movement of mitochondria along microtubules to recipient cells. However, despite growing recognition of the therapeutic potential of mitochondrial transfer, its widespread adoption is hindered by inefficiencies in replacing mitochondria in diseased cells, primarily due to limitations in the rate of mitochondrial translocation. Existing methods to enhance transfer rates — such as overexpressing mechanistic proteins like the motor protein Mirol and gap junction Cx43, or employing engineering techniques like "MitoCeption" and "MitoPunch" — are cumbersome and labor-intensive. Consequently, despite advances in understanding of mitochondrial dynamics, current therapeutic strategies often fall short due to limited efficacy and challenges in targeted delivery, underscoring the urgent need for new approaches to enhance mitochondrial function and intercellular transfer.
[0036] As described further below, using the methods and tools of this disclosure, new mitochondria can be introduced to alleviate poor mitochondrial function in recipient populations. Previously available pharmacological strategies for addressing mitochondria dysfunction aim to restore or augment existing mitochondrial integrity. Despite this,14US_ACTIVE\131850427W-2established therapeutics in both classes of treatment methodologies exhibit limited efficacy and suffer from poor solubility and low bioavailability under physiological conditions.B. Nanomaterial-enhanced mitochondrial biofactories
[0037] To address the above-described and other limitations of previous technologies, this disclosure provides a biomaterial-based therapeutic strategy employing molybdenum disulfide (M0S2) nanoflowers with atomic-scale modifications to transform mesenchymal stem cells (MSCs) into mitochondrial “biofactories.” By leveraging these atomic-level modifications to reprogram cellular metabolism, the approach of this disclosure transcends conventional smallmolecule therapies, offering a precise, biocompatible, and effective solution. The increased mitochondrial content within MSCs enhances their capacity for intercellular mitochondrial transfer via TNTs. Using the nanomaterial-based platforms and methods of this disclosure allows limitations in transfer rates to be bypassed and may eliminate the need for complex genetic interventions or extensive use of systemically administered drugs targeting mitochondrial function. The methods of this disclosure may capitalize on the natural propensity of MSCs to transfer mitochondria, while also amplifying this capability by enhancing the available mitochondrial mass by treating donor MSCs with M0S2 nanoflowers. The nanomaterial-enhanced intercellular mitochondrial transfer methods of this disclosure provide a viable therapeutic option for treating a wide range of mitochondrial dysfunctions.
[0038] This disclosure provides size-tunable molybdenum disulfide (M0S2) nanomaterials (also referred to as “nanoflowers”) with the unique ability to increase mitochondrial number in cells. These materials can effectively transform cells into biological factories (or “biofactories”) for the production of mitochondria. Using cells, such as MSCs, acting as biofactories for mitochondrial biogenesis is a low cost and low barrier-to-entry method to address mitochondrial dysfunction through the transfer or transplantation of mitochondria to cells in need. In this disclosure, cells are engineered using the disclosed nanomaterials to produce healthy, energetic mitochondria in excess. These mitochondria are then delivered to other cells through ccll-to-ccll transfer and / or isolation and transplantation. The disclosed technology promotes positive changes to biogenesis of mitochondria and can allow for improved efficacy and efficiency of mitochondrial transfer or transplantation to diseased cells and provide a rescue function to improve tissue and organ health. The disclosed technology is widely adaptable and effective in addressing both transfer and transplantation of mitochondria to a wide variety of tissues. As such, this disclosure provides cell- and organelle-based therapies that can be disease agnostic.15US_ACTIVE\131850427W-2
[0039] This disclosure overcomes challenges of previous therapies used to address disorders and diseases associated with mitochondrial dysfunction. As described above, mitochondria are semiautonomous organelles that account for maintenance of metabolic homeostasis, which is necessary for cell function. Mitochondrial dysfunction is associated with many human diseases that affect large portions of the population. These diseases can arise from environmental and genetic factors altering mtDNA. Damage to mtDNA and metabolic dysregulation are compounding effects that can be the cause or downstream problem of mitochondrial damage. As cells age, mtDNA mutations accumulate, and mitochondrial efficiency falls. It is uncommon for only one of these failures of energy metabolism to exist alone. Instead, during mitochondrial dysfunction, mutant or non-functional proteins may impact the entire network of downstream processes. In a similar manner, environmental stressors that alter the metabolic balance of cells can have a range of impacts on these interconnected pathways and processes. The clinical presentation of mitochondrial diseases encompasses the dysfunction of any organ or tissue including Parkinson's disease, cardiomyopathies, and Type 2 diabetes amongst others.
[0040] Given that mitochondria and their genomes operate semi-independently, it is possible to alter the ratio of the damaged to healthy mitochondria (and mtDNA) content of cells. Heteroplasmy, which is the ratio of mutant-type to wild-type mtDNA, generally determines the severity of mitochondria-related disorders. This disclosure recognizes that outright replacement of mitochondria in damaged cells provides a disease agnostic approach to address disease. Intercellular organelle transfer is an emerging field in which donor cells donate subcellular organelles, such as mitochondria, to dysfunctional cells. This disclosure helps to overcome efficiency and feasibility concerns encountered by previous technologies for intercellular mitochondrial transfer and transplantation from donor cells to diseased tissues. Using the technology of this disclosure, dysfunctional mitochondria can be replaced with healthy mitochondria derived using nanomaterial-based mitochondria production in order to improve health and function of subjects. The resulting process is efficient, requires fewer donor cells for efficacy, and can limit or eliminate the need for other pharmacological agents.
[0041] In certain embodiments, this disclosure provides a method of obtaining mitochondria for a mitochondria transplantation therapy. In this method, cells are exposed to nanomaterial structures causing increased mitochondrial biogenesis in at least a portion of the exposed cells. The cells may be exposed to an effective amount of the nanomaterial structures. An effective amount corresponds to a sufficient concentration of the nanomaterial to cause increased16US_ACTIVE\131850427W-2mitochondrial biogenesis in the cells. For example, an effective amount may increase mitochondrial biogenesis by at least 10%, 20%, 30%, 40%, 50%, or more compared to untreated cells.
[0042] The nanomaterial structures may be the M0S2 nanomaterials described further below. For example, the nanomaterial structures may be nanoflowers of molybdenum disulfide (M0S2)). The nanomaterial structure may further include or be combined or functionalized with a targeting molecule, such as one or more cell penetrating peptides. The targeting molecule may be cell-specific or tissue-specific. For example, the nanomaterial structure may be modified with or conjugated to a peptide, a protein, a colloidal molecule, lipid molecule, phospholipid molecule, or polymer to facilitate delivery or adsorption to the cells.
[0043] The nanomaterial structures may be prepared by combining a molybdenum precursor and sulfur precursor at a predefined ratio (e.g., at about 1:6 ratio of molybdenum precursor: sulfur precursor) and heating the combined precursors to a temperature of at least 140 °C for at least 6 hours. The resulting nanomaterial structures may be about 5 run to about 400 nni in diameter. Reaction time and temperature may be adjusted to control the size of the nanomaterial as described further with respect to the Examples below. In some embodiments, an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1. In some embodiments, an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1.
[0044] A therapeutic agent may be prepared using the exposed cells. The therapeutic agent may include the cells themselves and / or mitochondria obtained from the cells. Mitochondria may be obtained through an appropriate extraction process for the cell type and reaction conditions. For example, mitochondria may be obtained by isolating mitochondria from the cells (e.g., using a commercially available kit to extract mitochondria from cells). The obtained mitochondria may be used directly in the mitochondria transplantation therapeutic. However, it may be preferable to “package” the mitochondria for administration to a subject. For example, at least a portion of the obtained mitochondria may be encapsulated or coated with liposomes or a gel. For example, an emulsion may be formed that includes liposomes or a gel precursor, and the mitochondria may be added to this emulsion to form mitochondria encapsulated or coated with liposomes or gel.
[0045] The therapeutic agent may be prepared for administration to a subject as a mitochondria transplantation therapeutic. For example, cells with increased mitochondria count and / or17US_ACTIVE\131850427W-2extracted / encapsulated mitochondria may be placed in an acceptable carrier for administration. The mitochondria transplantation therapeutic may be combined with one or more other therapeutic agents. The other therapeutic agent(s) may include a chemotherapeutic agent, an immunotherapeutic agent, a mitochondrial therapeutic agent, a neurotherapeutic agent, a metabolic therapeutic agent, an ophthalmic therapeutic agent, a cardio therapeutic agent, or a radiotherapeutic agent. The mitochondria transplantation therapeutic may be combined with a detectable label, such as a paramagnetic ion, a radioactive isotope, a fluorochrome, an NMR-detectable agent, or an X-ray imaging agent. The mitochondrial therapeutic agent may include CoQlO (ubiquinone), idebenone, riboflavin, dichloroacetate, thiamine, creatine, lipoic acid, glutathione, X-acclylcysleine, cysteamine, EPI-743 ( o / o-benzoquinone analog), arginine, citrulline, cardiolipin, elamipretide, bezafibrate, resveratrol, AICAR (aminoimidazole carboxamide ribonucleoside), epicatechin, RTA 408 (synthetic isoprenoid), decanoic acid, a therapeutic peptide, and / or a therapeutic polynucleotide molecule.)i. M0S2 Nanomaterials
[0046] The present disclosure provides nanomaterial structures with controlled size and high atomic vacancies. While examples of the nanomaterial structures and their preparation are described in this disclosure, other examples of nanomaterial structures and their preparation are described in PCT / US24 / 50330, filed October 8, 2024, the contents of which are incorporated herein in their entirety. The vacancies, embedded within the layered architecture of the nanomaterial structures, serve to increase the number of active catalysis sites in the structures. As used herein the term “high atomic vacancy” refers to a nanomaterial comprising an atomic vacancy concentration of at least about 0.72 x 102pM g-1. Methods for calculating high atomic vacancy concentration are known in the art and any such method may be used according to the embodiments of the present disclosure. In one embodiment, methods for determining high atomic vacancy concentration may include those described in Jaiswal et al., Chem. Commun. 55: 8772-8775, 2019. In some embodiments, a high atomic vacancy concentration as described herein may be at least about 0.50 x 102pM g ’. at least about 0.60 x 102pM g-1, at least about 0.70 x 102pM g-1, at least about 0.80 x 102pM g-1, at least about 0.90 x 102pM g-1, at least about 1.00 x 102pM g-1, at least about 1.10 x 102pM g-1, at least about 1.20 x 102pM g-1, at least about 1.30 x 102pM g-1, at least about 1.40 x 102pM g-1, at least about 1.50 x 102pM g-1, at least about 1.60 x 102pM g-1, at least about 1.70 x 102pM g-1, at least about 1.80 x 102pM g-1, at least about 1.90 x 102pM g-1, at least about 2.00 x 102pM g-1, or at least about 2.10 x 102pM g-1, including all ranges and values derivable18US_ACTIVE\131850427W-2therebetween. In certain embodiments, a high atomic vacancy concentration may be about 0.50 x 102|1M g1to about 10.0 x 102gM g ’. about 0.60 x 102gM g1to about 10.0 x 102gM g-1, about 0.70 x 102gM g-1to about 10.0 x 102gM g-1, about 0.80 x 102gM g-1to about 10.0 x 102gM g-1, about 0.90 x 102gM g"1to about 10.0 x 102gM g"1, about 1.00 x 102gM g-1to about 10.0 x 102gM g-1, about 1.10 x 102gM g-1to about 10.0 x 102gM g-1, about 1.20 x 102gM g’1to about 10.0 x 102gM g"1, about 1.30 x 102gM g’1to about 10.0 x 102gM g-1, about 1.40 x 102gM g-1to about 10.0 x 102gM g-1, about 1.50 x 102gM g-1to about 10.0 x 102gM g"1, about 1.60 x 102gM g"1to about 10.0 x 102gM g"1, about 1.70 x 102gM g-1to about 10.0 x 102gM g-1, about 1.80 x 102gM g-1to about 10.0 x 102gM g-1, about 1.90 x 102gM g-1to about 10.0 x 102gM g-1, about 2.00 x 102gM g_|to about 10.0 x 102gM g-1, or about 2.10 x 102gM g-1to about 10.0 x 102gM g-1, including all ranges and values derivable therebetween. In certain embodiments of the present disclosure a high vacancy nanomaterial structure may be referred to as a high atomic vacancy nanoflower.
[0047] In particular embodiments, a high atomic vacancy nanomaterial slruclure of the present disclosure is about 5 nm to about 400 nm, about 50 nm to about 400 nm, about 50 nm to about 350 nm, about 50 nm to about 300 nm, about 50 nm to about 250 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, or about 50 nm to about 100 nm in diameter, including all ranges and values derivable therebetween. In one embodiment, the high atomic vacancy nanomaterial structure of the present disclosure is about 5 nm, about 10 nm, about 20 nm, about 30 nm, about 40 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 140 nm, about 150 nm, about 160 nm, about 170 nm, about 180 nm, about 190 nm, about 200 nm, about 210 nm, about 220 nm, about 230 nm, about 240 nm, about 250 nm, about 260 nm, about 270 nm, about 280 nm, about 290 nm, about 300 nm, about 310 nm, about 320 nm, about 330 nm, about 340 nm, about 350 nm, about 360 nm, about 370 nm, about 380 nm, about 390 nm, or about 400 nm in length, width, depth, or diameter, including all ranges and values derivable therebetween.
[0048] The nanomaterial structures of the present disclosure may be produced using any method known in the art. In particular embodiments, the nanomaterial structures may be produced by altering the molecular precursor ratio of the transition metal (e.g., molybdenum) and a chalcogen (e.g., sulfur) used to produce the nanomaterial structure. A person of ordinary skill in the art would understand appropriate precursor ratios for use according to the methods of the present disclosure based on the oxidation states, molar concentration of the transition metal and chalcogen in the precursors. In some embodiments, the molecular precursor ratio of19US_ACTIVE\131850427W-2the transition metal and the chalcogen may be about 0.5:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:15, about 1:20, about 1:25, about 1:30, about 1:35, or about 1:40, including all ranges and values derivable therebetween.
[0049] The resulting size-tunable M0S2 nanomaterials with predefined atomic vacancies within their atomic structure are used to stimulate mitochondria production in cells, as described above and below, effectively turning selected donor cells into biofactories for mitochondria production. Through the use of controlled synthesis conditions (e.g., time and temperature), these nanomaterials can be synthesized with desired size and number of atomic vacancies, as described with respect to the Examples presented below. The nanomaterials can increase mitochondrial biogenesis by at least 2-fold in a cell, leading to an increased number of available mitochondria for delivery or transplantation to cells suffering from mitochondrial dysfunction. Thus, the technology of this disclosure may increase the availability of functional mitochondria in donor cells that can be transferred / transplanted to recipient cells to improve the health and functions of the recipient tissues. Donor cells can directly transfer these new mitochondria to recipient cells, or mitochondria can be isolated and artificially transplanted into tissues. As a result of this influx of healthy mitochondria, more energetically demanding cells and tissues, including those of certain pathologies involving a lack of energy production as seen in mitochondrial dysfunction, can be addressed.ii. Mitochondrial transfer from donor cells
[0050] A benefit of the nanomaterial-based approach of this disclosure is the flexibility of donor cells that can be used to generate mitochondria for transplantation. In general, any healthy cell may be treated with M0S2 nanoflowers and used as a donor cell. For example, donor cells may be healthy cells obtained from a patient for which a therapy is needed. As another example, donor cells may be obtained from a cell repository, such as a public or private cell bank that cryogenically stores well -characterized and screened cell lines for research or therapeutic use. In preferred embodiments, the donor cells arc MSCs. However, other cell types known in the art may be used.
[0051] In some embodiments, a mitochondrial therapy is achieved by transplanting M0S2 nanoflower-treated donor cells with increased mitochondria content to a subject. For example, M0S2 nanoflower-treated donor cells may be administered to a target tissue of the subject. The transplanted cells deliver mitochondria via translocation processes, as described elsewhere in20US_ACTIVE\131850427W-2this disclosure. In some embodiments, other bioactive substances may be administered or transferred along with the mitochondria to provide further benefits. This disclosure improves the efficiency of this mitochondrial donation process by augmenting the number of healthy mitochondria in the donor cells, allowing significantly more mitochondria to reach recipient cells.
[0052] An example of such donor cell is a eukaryotic cell having a plurality of nanomaterial structures within the eukaryotic cell and a plurality of mitochondria within the eukaryotic cell, where the amount, or number, of the mitochondria is increased by the presence of the nanomaterial structures. The nanomaterial structures may be the MoS2 nanoflowers described above. The eukaryotic cell may be a stem cell, another cell type described in this disclosure, or another appropriate cell as would be appreciated by those of skill in the art.
[0053] In other embodiments, excess mitochondria produced using the unique nanomaterialbased approach of this disclosure can be transferred through artificial translocation after isolating mitochondria. Mitochondria can survive out of a donor cell for short periods of time. Once isolated, mitochondria can then be kept functioning and packaged or stored for later use. Exogenous mitochondria can be isolated and co-incubated (e.g., through an appropriate administration method, as described further below) with recipient tissues and / or cells where they are then engulfed via endocytosis. Although possible, use of bare mitochondria isolates may be relatively inefficient and sporadic because mitochondria randomly move to an appropriate location for being engulfed by a cell. To overcome this, synthetic liposome encapsulation and / or gel encapsulation may be used to package discrete volumes containing isolated mitochondria. These lipid- and / or gel-encapsulated liposomes can be functionalized, for example, with cell penetrating peptides to promote uptake and targeting of the mitochondria to a target tissue, thereby further improving mitochondria delivery.C.Therapeutic Methods and Agents
[0054] In certain aspects, the present disclosure is directed to a method of increasing mitochondrial function in a subject. The method may include obtaining a cell sample from the subject. In some cases, cells not from the subject may be used. The method includes exposing cells of the cell sample to nanomaterial structures, thereby increasing mitochondrial biogenesis in at least a portion of the cells of the cell sample. The nanomaterial structures may be the M0S2 nanoflowers described above. The nanomaterial structures are capable of increasing mitochondrial biogenesis in the exposed cells.21US_ACTIVE\131850427W-2
[0055] The method includes preparing a mitochondria transplantation therapeutic using at least one of the exposed cells and / or mitochondria obtained from the exposed cells. For example, an amount of the exposed cells may be collected and placed in a pharmaceutically acceptable carrier for administration. As another example, mitochondria may be obtained from the exposed cells and packaged for administration as the mitochondria transplantation therapeutic, as described in greater detail above. For instance, the mitochondria may be coated or encapsulated in liposomes or a gel.
[0056] The method includes administering an effective amount of the mitochondria transplantation therapeutic to the subject. For example, at least a portion of the exposed cells may be administered to the subject. In some embodiments, the administering includes injection, microneedle administration, oral administration, buccal administration, vaginal administration, inhalation, intraosseous administration, transnasal application, topical administration, transdermal application, or rectal administration. Non-limiting types of injection include intravenous injection, intramuscular injection, intraarticular injection, subcutaneous injection, and intraarterial injection.
[0057] In some embodiments, the method may further include administering a second therapy to the subject. In one embodiment, the second therapy is a therapeutic agent or surgery. In another embodiment, the methods of the present disclosure may further comprise administering a pharmaceutical composition comprising an effective amount of mitochondria obtained from cells treated with the nanomaterial structures of this disclosure. In some embodiments, the pharmaceutical composition includes the nanomaterial structures.
[0058] As used herein, “subject” or “patient” refers to animals, including humans, who are treated with the therapeutic compounds or compositions or in accordance with the methods described herein. For diagnostic or research applications, a wide variety of mammals may be suitable subjects, including rodents (e.g., mice, rats, hamsters), rabbits, primates, and swine, such as inbred pigs and the like. In particular embodiments, a subject in need of therapy may be any subject who comprises cells that exhibit decreased mitochondrial function, as described herein. In another embodiment, the subject may be afflicted with or at risk of developing a disease or condition associated with decreased mitochondrial function or increased cellular oxidative stress. Non-limiting examples of such diseases or conditions include Barth syndrome, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Myoclonus epilepsy with ragged-red fibers (MERRF), neuropathy, ataxia, and retinitis pigmentosa (NARP), Leber's hereditary optic neuropathy (LHON), Kearns-Sayre syndrome 22US_ACTIVE\131850427W-2(KSS), Pearson syndrome (PS), progressive external ophthalmoplegia (PEO), autosomal-dominant / recessive PEO (ad / ar PEO), mtDNA depletion syndrome (MDDS), mitochondrial neurogastrointestinal encephalopathy (MNGIE), mitochondrial recessive ataxia syndrome (MIRAS), Alpers syndrome (AS), Leigh syndrome (LS), optic nerve atrophy, subacute necrotizing encephalopathy, carly-onsct hepatocerebral disorder, juvenile catastrophic epilepsy, adult-onset ataxia-neuropathy syndrome, cardiomyopathy, cerebral white matter disease, ovarian dysfunction, hearing loss, cancer, diabetes mellitus, osteoporosis, and neurodegenerative disease.
[0059] In certain aspects, the present disclosure provides therapeutic compositions comprising cells with enhanced mitochondria levels via treatment with the nanomaterials of this disclosure and / or mitochondria obtained from such cells. In some embodiments, these cells and / or mitochondria may be combined with a pharmaceutically acceptable carrier. As used herein, a “pharmaceutically acceptable carrier,” “pharmaceutically acceptable adjuvant,” or “adjuvant” refers to reagents, cells, compounds, materials, compositions, and / or dosage forms that are not only compatible with the nanomaterial structures or other agents to be administered therapeutically, but also are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other complication commensurate with a reasonable benefit / risk ratio. Also included may be an agent that modifies the effect of other agents and is useful in preparing a therapeutic compound or composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable. Such an agent may be added to a therapeutic composition or pharmaceutical composition to modify for example the cellular target, cellular localization, or cellular uptake of a nanomaterial structure as described herein. Such an agent may include any excipient, diluent, earner, or adjuvant that is acceptable for pharmaceutical use. Such an agent may be non-naturally occurring, or may be naturally occurring, but not naturally found in combination with other agents in the therapeutic or pharmaceutical composition.
[0060] As used herein, a “therapeutic compound” or “therapeutic composition” refers to a composition comprising cells with an increased mitochondria count via exposure to the nanomaterial structures of this disclosure and / or mitochondria obtained from such cells. The mitochondria may be packaged as described in this disclosure, such as via encapsulation or coating with liposomes or a gel. The therapeutic compound or composition may further include the nanomaterial structures.23US_ACTIVE\131850427W-2
[0061] In general, a therapeutic composition is sterile, and preferably free of contaminants that are capable of eliciting an undesirable response within the subject (e.g., the compound(s) in the composition are pharmaceutical grade). Therapeutic compositions may be designed for administration to subjects in need thereof via a number of different routes of administration including oral, intravenous, intraarticular, intraarterial, buccal, rectal, parenteral, intraperitoneal, intradermal, intratracheal, intramuscular, subcutaneous, inhalation, vaginal, intraosseous, transnasal, injection, microneedle, topical, and transdermal. The appropriate dosage of a composition, as described herein, may be determined based on the type of disease to be treated, the severity and course of the disease, the clinical condition of the individual, clinical history, response to the treatment, and the discretion of the attending physician. In some embodiments, therapeutic compositions provided by the present disclosure may include various "unit doses." A unit dose is defined as containing a predetermined quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, is within the skill of determination of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. In some aspects, a unit dose comprises a single administrable dose.
[0062] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment (alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance or other therapies a subject may be undergoing.
[0063] A composition, as described herein, may include, in particular embodiments, a combination of therapeutic agents. In some embodiments, a composition as described here may be administered as a single composition or as more than one composition. Different compositions as provided herein, in certain embodiments, may be administered by the same route of administration or by different routes of administration.
[0064] In some embodiments, the methods of this disclosure may be used to improve mitochondrial health and provide therapies that are not only improved but also proactive. For example, detailed diagnostic and / or genetic analysis can be used on subjects seeking to undergo therapy. At the time of testing, the subjects may be presenting symptoms of a suspected disorder or disease or they may not. The analysis may include genetic testing, metabolomic profiling, and / or medical history analysis. Depending on the results of this analysis and whether a subject is considered sufficiently at risk for a disorder or disease, donor cells may be prepared 24US_ACTIVE\131850427W-2with enhanced levels of mitochondria using the nanomaterial-based approach of this disclosure. In some cases, the donor cells are administered to the subject, and mitochondrial transfer is performed to improve mitochondrial health of the subject. In other cases, mitochondria are collected from the donor cells, appropriately prepared (e.g., via liposome / gel encapsulation), and administered to the subject to improve mitochondrial health. These therapies may be targeted to impact target tissues to improve the function of these tissues and / or associated organs.
[0065] Therapeutic efficiency is dependent on the rate at which mitochondria are provided to recipient cells. While other methods have been developed to directly increase rates of mitochondrial transfer through the overexpression of proteins associated with mitochondria transfer or the use of microinj ections or an external pressure, these previous methods are cumbersome, laborious, and limited in scope, since they only address either transfer or transplantation separately. The poor ease-of-use of these methodologies limits their practicality and acts as a bottleneck to developing useful therapies. While these technologies provide some benefits, the nanomaterial-based approach of this disclosure can be applied in a broader range of applications with a greater flexibility, for example, in terms of the types of donor and recipient cells that are compatible with the disclosed therapies. The disclosed methods are not specific to a particular transfer mechanism, and the methods are scalable without being limited by the need to perform genetic modifications or introduce chemical agents to increase mitochondrial transfer. As such, this disclosure may address a wider range of pathologies involving mitochondrial dysfunction for regenerative medicine, disease treatment, and tissue rejuvenation than could be addressed using previous technologies.
[0066] In certain embodiments, the compositions and methods for treating an individual described herein may be combined with any other composition or method of treatment known in the art. The compositions and methods may be administered in any suitable manner known in the art. For example, a first and a second mitochondrial treatment may be administered sequentially (at different times) or concurrently (at the same time). In some aspects, a first and a second mitochondrial treatment may be administered in separate compositions. In certain embodiments, a first and a second treatment may be administered in the same composition.
[0067] Non-limiting examples of additional treatment modalities that may be included in combination with the compositions and methods provided herein include a therapeutic agent or surgery. In specific embodiments, the methods and compositions of the present disclosure 25US_ACTIVE\131850427W-2may be combined with other therapies directed towards increasing mitochondrial function or decreasing cellular oxidative stress as described herein.
[0068] The term "about" is used to indicate that a value includes the standard deviation of the mean for the device or method being employed to determine the value. The use of the term "or" in the claims is used to mean "and / or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive. When used in conjunction with the word "comprising" or other open language in the claims, the words "a" and "an" denote "one or more," unless specifically noted otherwise. The terms "comprise," "have," and "include" are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as "comprises," "comprising," "has," "having," "includes," and "including," are also open-ended. For example, any method that "comprises," "has," or "includes" one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps. Similarly, any system or method that "comprises," "has," or "includes" one or more components is not limited to possessing only those components and covers other unlisted components.
[0069] Other objects, features, and advantages of the present disclosure are apparent from detailed description provided herein. It should be understood, however, that the detailed description and any specific examples provided, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description. Any embodiment of the present disclosure may be used in combination with any other embodiment described herein.
[0070] For avoidance of doubt, different embodiments may be combined in whole or in part. Descriptions associated with the figures, various embodiments, and various examples are likewise combinable in whole or in part. Where alternative terms are used for the same or analogous features, such terms are intended to be interchangeable unless technically incompatible.
[0071] All references cited herein are incorporated herein by reference in their entirety.EXAMPLES
[0072] The following examples are included to illustrate embodiments of the present disclosure. It should be appreciated by those of skill in the art that the techniques disclosed26US_ACTIVE\131850427W-2in the examples that follow represent techniques discovered by the inventor to function well in the practice of the disclosure. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.Example 1: Synthesis and Characterization of size tunable M0S2 nanoflowers
[0073] To transform hMSCs into mitochondrial biofactories, mitochondrial biogenesis was increased using M0S2 nanoflowers. Previous tools for increasing mitochondrial biogenesis rely on use of small molecule drugs, which have a short half-life and can cleared by cells rapidly. To significantly increase biogenesis in hMSCs, these drugs may require continuous or high dosages which may lead to unintended side effects or even toxicity. To overcome these issues, M0S2 nanoflowers were prepared with atomic scale vacancies. These vacancy rich M0S2 nanoflowers have the unique ability to increase mitochondrial biogenesis through activation of PGC-la and TFAM, as described in Singh, K.A., et al., Nat Commun, 2024.15(1): p. 8136. These nanoflowers are believed to scavenge reactive oxygen species (ROS) within cells to activate genes linked to mitochondrial biogenesis. The use of atomic vacancies to turn cells into efficient mitochondrial donors is a new strategy.
[0074] Vacancy rich M0S2 nanoflowers of multiple sizes were synthesized. M0S2 with diameters ranging from 50-250 nm were prepared by varying synthesis time and temperature (FIG. 1, Panel A). At excessively low temperatures and reaction times (120 °C, 6 h), solutions displayed evidence of incomplete reactions with poor solubility and altered colors. These solutions were discarded and excluded from further analysis. X-ray diffraction (XRD) was used to determine the crystallographic arrangement of Mo and S atoms within the nanoflowcrs as well as to determine the effect of atomic vacancies on crystalline structure (FIG. 1, Panel B). The diffraction peaks (002, 100, 110) of the M0S2 nanoflowers indicate the presence of a hexagonal crystal structure, similar to hexagonal M0S2 (JCPDS card No. 73-1508).
[0075] The morphology of the nanoflowers was characterized by transmission electron microscopy (TEM), with individual nanosheets stacking together, possibly due to Ostwald27US_ACTIVE\131850427W-2ripening, to form a concentric, hierarchical flower-like structure. This morphology was observed for all synthesis attempts performed at temperatures above 140 °C. Temperatures above 140 °C and a duration of 6 h only affected the size and not the morphology of the nanoflowers, with synthesis at 130°C for 6 h showing alterations in morphology (FIG. 1 , Panel C). This change in morphology was further confirmed via scanning electron microscopy (SEM). M0S2 synthesized at 130 °C did not exhibit the nanoflower morphology exhibited by M0S2 synthesized at 140 °C (FIG. 7). This indicates that at temperatures below 140 °C and short hydrothermal durations e.g., less than 6 hours), the characteristic nanoflower morphology did not form. Formulations obtained under these conditions were therefore omitted from further analysis. To simplify analysis and decrease the total nanoparticle formulations to be evaluated, synthesis reactions were performed for 6 hours in this example. This provided the dual benefits of rapid reaction time and increased surface area to volume ratio.
[0076] The chemical compositions of the synthesized nanoflowers were determined using X-ray photoelectron spectroscopy (XPS). Analysis of the binding energies (BE) of molybdenum (Mo) and sulfur (S) core-level electrons indicated the presence of Mo4+(3d52~ 228 eV and 3d32-231 eV), and S2“ (2p32-161 eV and 2pI / 2~ 162 eV) within the M0S2 nanoflowers. The XPS data indicated a high purity of the samples and confirmed that the synthesized nanoparticles chemically consisted of M0S2 and not a different molybdenum compound. Further deconvolution of the XPS spectra indicated the presence of predominantly 2H phase (hexagonal symmetry) within the trigonal prismatic M0S2 crystal (IT phase) (FIG. 1, Panel C). This result indicated that change in synthesis methodology did not cause any appreciable changes in the morphology or crystal structure of the M0S2 nanoflowers.
[0077] The smallest M0S2 nanoflowers were synthesized for 6 h at 140 °C and 160 °C, yielding 100 and 130 nm nanoparticles, respectively. Larger M0S2 nanoflowers were synthesized at 200 °C for 18 h, yielding approximately 250 nm nanoparticles. The effect of nanoparticle size on stability was evaluated using zeta potential measurements. The nanoparticle formulations were evaluated in deionized (DI) water and cell culture media (with fetal bovine serum (FBS)). In the DI water, all M0S2 nanoparticles exhibited a strong negative surface charge (ranging from -35 mV to -40 mV ). Changes in size did not result in a significant change in zeta potential. In cell culture media, the zeta potentials of all nanoparticles increased to a range from -8 mV to -11 mV. This increase may be attributed to absorption of proteins onto the nanoflower’s surfaces and resultant charge shielding (FIG. 1,28US_ACTIVE\131850427W-2Panel D). The type of proteins adsorbed onto the M0S2 nanoflowers was further evaluated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein band pattern obtained by SDS-PAGE indicated that the size of nanoflowers did not alter the types of proteins adsorbed.
[0078] M0S2 nanoflowers prepared according to this disclosure have active sites within their layered structure, as described in Singh, K.A., et al., Nat Commun, 2024. 15(1): p. 8136. These active sites enhance the catalytic decomposition of hydrogen peroxide (H2O2). The catalysis of this reaction was evaluated using a biochemical catalase enzyme activity assay. The assay indicated both the smallest and largest M0S2 nanoflowers exhibit catalytic activity regardless of size (FIG. 1, Panel E).
[0079] Cellular compatibility of the M0S2 nanoflowers was investigated in human mesenchymal stem cells (hMSCs) by measuring total DNA content of cells after 24 h of nanoparticle exposure. The concentration of M0S2 nanoflowers at which the cell viability is reduced to 50% was regarded as the half-maximal inhibitory concentration (ICAO) as determined by fitting a logarithmic dose-response curve. All M0S2 formulations were found to have a high cytocompatibility at concentrations below 100 pg / mL with no significant effect of nanoparticle size on cellular cytocompatibility (IC50-200-250 pg / mL for all formulations) (FIG. 1, Panel E). Based on these results, further studies with M0S2 nanoflowers described herein were performed at a concentration of 25 pg / mL, unless otherwise indicated.
[0080] Given the similarity of the cellular compatibilities of the nanoparticle formulations, further analysis was performed to compare the smaller 100 nm formulation to the 250 nm formulation. The effect of M0S2 nanoflowers on broader cell cycle stages was evaluated by treating hMSCs with 25 pg / mL of M0S2 nanoflowers for 72 h (FIG. 1, Panel F). The different sizes of M0S2 nanoflowers showed no significant impact on cell cycle in this time frame and no impact on the proliferation of cells. The internalization of M0S2 nanoflowers by cells was visualized using F-actin and nuclear fluorescence staining, and the M0S2 nanoflowers were visualized using reflected light (FIG. 1, Panel G). Elsewhere in this disclosure, the 100 nm M0S2 nanoflowers are referred to as “Small M0S2” and the 250nm M0S2 nanoflowers are referred to as “Large M0S2”.Example 2: Size-tunable MoS2 induces mitochondrial biogenesis through PGC-la
[0081] In mammalian cells, the mitochondria are one of the few locations of extra-chromosomal DNA within the cell. The genetic regulation of mitochondria is dependent on29US_ACTIVE\131850427W-2both the nuclear and mitochondrial genome. The pathway by which atomic vacancies in M0S2 increases mitochondrial copy number in treated cells is described in Singh, K.A., et al., Nat Commun, 2024. 15(1): p. 8136. Activation of mitochondrial biogenesis involves the replication of both mitochondrial and genomic encoded genes in a coordinated manner. This process is regulated mechanistically by a transcriptional cascade beginning with activation of proliferator- activated receptor gamma coactivator 1 alpha (PGC-la), which in turn activates key downstream targets such as NRF-1 / 2 and TFAM. The post-transcriptional activation of PGC-la can occur via pathways such as SIRTs or AMP-activated protein kinase (AMPK). SIRTs directly respond to levels of oxidative stress within the cells and act as ROS-suppressors while providing antioxidative effects. SIRT1 is responsible for the activation of PGC-la by deacetylation of inactive PGC-la in the cytosol. High atomic vacancy M0S2 nanoflowers are believed to activate the PGC-la cascade by modulation of cellular ROS and activation of the SIRT signaling pathway regardless of nanoflower size (FIG. 2, Panel A).
[0082] Vacancies in M0S2 may activate this PGC-la pathway through scavenging of reactive oxygen species (ROS) within the cell. Given the importance of active sites in high vacancy M0S2, increasing surface area of the M0S2 nanoflowers may result in improved effectiveness. To demonstrate the ability of M0S2 nanoflowers to enhance mitochondrial biogenesis through PGC-1 a activation, tests were performed to determine whether the Small M0S2 (100 nm M0S2 nanoflowers) exhibited similar performance as the Large M0S2 (250 nm M0S2 nanoflowers) on the SIRTl / PGC-la pathway depicted.
[0083] Both sizes of vacancy-rich M0S2 nanoflowers caused a decrease in total cellular ROS levels in treated cells as compared to untreated cells (FIG. 2, Panel B). A similar decrease in mitochondria- specific ROS was also observed, as determined using mitochondrial superoxide indicator MitoSOX (FTG. 2, Panel C). Additionally, neither size nanoparticle displayed evidence of adverse effects on mitochondrial quality and health, as observed by the mitochondrial membrane potential indicator JC-1 (FIG. 8). Importantly, an increased expression of PGC-la was observed following exposure to M0S2 nanoflowers, regardless of their size. These results were corroborated by an increase in voltage-dependent anion channel (VDAC) expression and evidence of a highly conserved mitochondrial porin, indicating an increase in mitochondrial mass (FIG. 2, Panel D).
[0084] The human mitochondrial genome is comprised of independent circular doublestranded DNA. Thus, to evaluate the effect of M0S2 size on mitochondrial biogenesis through activation of PGC-la, mtDNA copy number was assessed in hMSCs by qPCR analysis, which 30US_ACTIVE\131850427W-2revealed a two-fold increase in relative mtDNA levels in cells treated with high atomic vacancy M0S2 after 7 days (FIG. 2, Panel E). This observation was replicated in other cell types as well such as SMCs and NHCF-Vs (FIG. 9, Panel A). The ability to enhance mitochondrial biogenesis through PGC-la was further validated using PGC- la knockdown cells, as described in Singh, K.A., et al., Nat Commun, 2024. 15(1): p. 8136. PGC-la knockdown cells showed no significant increase in mtDNA copy number following exposure to vacancy rich M0S2, in contrast to cells transfected with empty pLKO vector (FIG. 9, Panel B).
[0085] In further analysis of copy number as the result of M0S2 treatment, it was found that altering the nanoflower size may resolve differences in mitochondrial dynamics at lower concentrations due to increased particle numbers and surface area-to-volume ratio. Interestingly, Small M0S2 caused a peak in mitochondrial copy numbers at lower concentrations than Large M0S2 (FIG. 2, Panel F).
[0086] PGC-la activation and subsequent mitochondrial biogenesis has also been observed in other therapeutic compounds such as Resveratrol and 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). Resveratrol is known to increase mitochondrial copy number similarly to the M0S2 nanoflowers of this disclosure through reduction of oxidative stress and SIRT1, while AICAR stimulates mitochondrial biogenesis and PGC-la through activation of AMPK. See, e.g., Li, Y.G., et al., Biochem Biophys Res Commun, 2013. 438(2): p. 270-6; Morishita, M., et al., Int J Oncol, 2017. 50(1): p. 23-30. However, compared to the M0S2 nanoflowers of this disclosure, a single dose treatment with Resveratrol or AICAR fails to produce as robust an increase in mitochondrial biogenesis at 3 days and 7 days post treatment (FIG. 2, Panel G).
[0087] Increased mitochondrial mass is expected to and has been demonstrated to increase mitochondrial respiration and ATP production. Total ATP production in hMSCs treated with M0S2 was enhanced as compared to that of untreated cells regardless of the size of the M0S2 nanoflowers (FIG. 2, Panel H). In addition to these results, oxygen consumption rate (OCR) measurements obtained using a Seahorse XF24 assay in SMCs treated with or without Small M0S2 showed that M0S2 treatment increased both the spare and maximal respiratory capacity. Notably, M0S2 has no effect on the glycolytic capacity of cells, indicating that increase in mitochondrial mass alone is responsible for increase in cellular bioenergetics observed (FIG.2, Panels I and J, FIG. 10).31US_ACTIVE\131850427W-2Example 3: M0S2 nanoflowers enhance intercellular mitochondrial transfer
[0088] The initial objective was to introduce simpler reaction times and smaller sizes of transition metal nanoparticles (M0S2 nanoflowers) to modulate intercellular mitochondrial biogenesis. That M0S2 nanoflowers enhance mitochondrial biogenesis, resulting, in some cases, in a two-fold increase in mitochondria in treated cells, poses an incredible therapeutic opportunity. The replenishment of damaged mitochondria in diseased cells with healthy mitochondria to maintain mitochondrial homeostasis is possible reparative strategy. MSCs have been shown to maintain their ability to donate mitochondria to a number of recipient cells. (See, e.g., Liu, D., et al., Signal Transduct Target Ther, 2021. 6(1): p. 65.) Furthermore, the M0S2 nanoflowers of this disclosure provide a possible solution to the previously unmet need of meeting the high demands of reversing mitochondrial dysfunction. Intercellular mitochondrial transfer is possible through several major mechanisms. Tunneling nanotubes (TNTs) are transient filamentary membranes connecting cells. TNTs consist of cell membrane, f-actin, myosin, and tubulin capable of transporting proteins, RNA, or mitochondria and endoplasmic reticulum to neighboring cells (See, e.g., Austefjord, M.W., et al. Commun Integr Biol, 2014. 7(1): p. e27934.) Extracellular vesicles (EVs) include cell-secreted exosomes and microvesicles that can carry cargo. (See, e.g., Meng, W., et al., Drug Deliv, 2020. 27(1): p.585-598; Abraham, A. and A. Krasnodcmbskaya, Stem Cells Transl Med, 2020. 9(1): p. 28-38.) Finally, gap junction channels (GJCs) are the most direct material exchange channels between two adjacent cells formed by docking their respective hemichannels formed by the oligomerization of six connexin (Cx) subunits. (See, e.g., Delvaeye, T., et al., Trends Mol Med, 2018. 24(12): p. 1036-1053.)
[0089] This disclosure reveals that cells treated with M0S2 nanoflowers exhibit an increase in expression of PGC-la and an at least two-fold increase in mtDNA copy number. An increase in available mitochondria can be utilized in the intercellular transfer of mitochondria. It is possible that cells may be able to immediately utilize these extra mitochondria and donate them to cells in need. To evaluate mitochondrial transfer, hMSCs were grouped into Small M0S2-treated and untreated groups. Separately, hMSC samples were incubated with MitoTracker. The cells were washed several times with PBS, harvested, and plated in a 3:1 ratio (recipients:hMSCs) as a co-culture for 24 hours. After this time, confocal microscopy revealed the transfer of mitochondria between cells and revealed the presence of cell-cell connections. These results demonstrate the active transfer of mitochondrial networks between connected32US_ACTIVE\131850427W-2cells through the presence of stained mitochondria in unstained recipient cells (FIG. 3, Panel A, FIG. 11, Panels A and B).
[0090] Mitochondrial transfer was quantified through flow cytometry, confirming the availability of mitochondria in MSCs treated with M0S2. The excess mitochondria present in these cells was readily transferred to various cell types. Flow cytometry revealed that hMSCs treated with M0S2 for 7 days exhibited an increased mitochondrial transfer of ~2 fold in C2C12 and NHCF-V cells and of ~3-4 fold in H9C2 and SMCs (FIG. 3, Panel B). Furthermore, Small M0S2 (S_Mo) treated hMSCs behave similarly to Large M0S2 (L_Mo) treated hMSCs in these transfer tests (FIG. 12, Panel A). Resveratrol, which has been indicated to act through a similar mechanisms as M0S2, results in a less significant increase in mitochondrial transfer rate as compared to S_Mo-hMSCs in C2C12 cells (FIG. 12, Panel B).
[0091] Furthermore, a proportional decrease in the copy number of mitochondria in hMSC populations was observed after transfer through qPCR as well as through Mito-Tracker intensity of mitochondrial mass in hMSC populations co-cultured with SMCs, demonstrating these cells as the source of mitochondria and eliminating dye transfer as a possibility (FIG.13).
[0092] Trans- well plates were used to determine if EVs were a possible route of mitochondrial transfer due to the physical separation of cells in co-culture. For the Trans-well test, 6-well trans-well plates (Corning Costar) with 0.4 pm pore membranes were used. C2C12 cells were plated on the lower chamber, and hMSCs were plated on the upper insert. After 24 h of incubation, mitochondrial transfer was evaluated and found to be nearly nonexistent in the trans-well system (FIG. 3, Panel C). These results suggest that, at the very least, cell contact is necessary for mitochondrial transfer to occur.
[0093] To further explore the mechanism by which MSCs transfer mitochondria, transfer via GJCs and TNTs were tested. In TNTs, TNFaip2 / M-Sec elicits membrane deformation and facilitates TNT formation via actin polymerization. Cytochalasin B at nanomolar concentrations, while cytotoxic, has been reported to block the formation of TNT through inhibition of actin polymerization without affecting endocytosis and phagocytosis and has been used to block TNT formation. (See, e.g., Zhang, Y., et al., Stem Cell Reports, 2016. 7(4): p.749-763.) By selectively blocking the formation of TNTs via the actin-binding toxin, cytochalasin B, at nanomolar concentration (350 nM) during co-culture (as described in ackson, M.V., etal., Stem Cells, 2016. 34(8): p. 2210-23), the organelle transfer between cells33US_ACTIVE\131850427W-2was dramatically reduced in C2C12s in both hMSC and Small M0S2 treated hMSC (S-Mo_hMSCs) populations (FIG. 3, Panel D). These results suggest that TNTs mediate transfer. Similar results were also observed for different cell types (FIG. 14). Based on these results, TNT-based mitochondrial transfer appears to be likely between hMSCs and many other cell types. This transfer is enhanced when excess mitochondria arc generated through M0S2 treatment.
[0094] Miros are Rho-GTPases located on the mitochondrial outer membrane and are responsible for transporting mitochondria. These species act as adaptor proteins to help mitochondria couple with microtubule motor proteins. (See, e.g., Paliwal, S., et al., J Biomed Sci, 2018. 25(1): p. 31; Macaskill, A.F., et al., Neuron, 2009. 61(4): p. 541-55.) Miros binds to the kinesin motor protein KIF5 to form a motor-adaptor molecular complex to facilitate and regulate mitochondrial movement. The role of Mirol has been well established in mitochondrial transfer. Evaluating the expression levels of this key gene provides insight into how M0S2 impacts hMSC behavior. (See, e.g., Zhang, Y., et al., Stem Cell Reports, 2016.7(4): p. 749-763.) Rhotl exhibits no significant increased expression in hMSCs vs S_Mo-hMSCs isolated from the co-culture system according to western blotting (FIG. 15, Panel A). These findings suggest the ability of M0S2 to increase transfer rate by sheer mitochondrial mass as opposed to direct influences on TNT transfer machinery. Additionally, the M0S2 in S_Mo-hMSCs were not transferred to the recipient cells (FIG. 15, Panel B). Collectively, M0S2 nanoflowers have unique effects on the mitochondrial mass of hMSCs, thereby promoting more efficient transfer through TNTs.Example 4: Mitochondrial transfer effects on transcriptoinic profile of recipient cells
[0095] Intercellular transfer of mitochondria from hMSCs to healthy SMCs was investigated to determine the capability of hMSCs to transfer mitochondria as mitochondrial donor cells. Given their elevated transfer efficiency with S_Mo-hMSCs and species similarity, experiments were performed to uncover how mitochondrial transfer may have lasting effects other than the addition of mitochondria. Smooth muscle cells such as HUASMCs arc responsible for contractile and cell signaling in vasculature and thus have a high capacity for mitochondria and mitochondrial respiration. (See, e.g., Chalmers, S., et al., Arterioscler Thromb Vase Biol, 2012. 32(12): p. 3000-11; Li, J., et al., Redox Biol, 2023. 64: p. 102778; Liu, Y.Z., et al., Front Cardiovasc Med, 2022. 9: p. 972836; Pearce, W.J., Am J Physiol Cell Physiol, 2024. 326(2): p. C442-C448; Qin, H.L., et al.. Am J Physiol Cell Physiol, 2023.324(1): p. C183-C192; Xia, Y., et al., Int J Mol Sci, 2023. 24(4).) Since Small M0S2 treated 34US_ACTIVE\131850427W-2hMSCs exhibit elevated mitochondrial transfer due to the generation of mitochondrial mass, their mitochondrial transfer are referred to herein as “MitoFactory-transfer”, while standard donor hMSC transfer is referred to as “Mito-transfer”.
[0096] To investigate the effect of elevated mitochondrial transfer in MitoFactory-transfer on transcriptome, whole transcriptome sequencing (RNA-seq) was performed on HUASMCs cocultured with hMSCs (with and without Small M0S2) for 24 hours, the duration of the tested mitochondrial transfer process. MitoFactory mediated transfer resulted in substantial differences in transcriptome profiles as evidenced from principal component analysis (PCA) of differentially expressed genes (DEGs) (FIG. 3, Panel E). PCA of the 50% most variable genes (assessed by median absolute deviation) from the study group revealed a pronounced distinction (represented by PCI, accounting for 41.62% of the total variance) between hMSCs treated with and without M0S2. PC2 further accounted for 27.47% of the variance, adding to the interpretability of the data. DEGs were further identified between Mito-transfer and MitoFactory-transfer. It was found that the co-culture of SMCs with hMSCs significantly iPad] < 0.01) affected the expression of 2,617 genes (1,256 upregulated and 1,361 downregulated) (FIG. 3, Panel F). Meanwhile, for SMCs co-cultured with M0S2 treated hMSCs, the expression profile of 3,625 genes changed significantly (1,863 upregulated and 1,762 downregulated genes) respectively (FIG. 3, Panels F and G).
[0097] The key biological processes in SMCs that were affected by Mito-transfer and MitoFactory-transfer were identified via Gene Ontology (GO) enrichment analysis. Gene ontology consists of explicitly defined terms that are names for biological objects or events. GO analysis hierarchically classifies gene and gene products, utilizing statistical tests (hypergeometric test) to identify modulated cellular processes across samples. The unique significant GO terms were refined (Padj<0.01). Similarly, for Mito-transfer and MitoFactory-transfer, GO terms such as “extracellular matrix”, “cell-matrix regulation”, and “Cell Migration” were enriched, followed by terms associated with smooth muscle cell morphogenesis (FIG. 16). Notably, GO term clusters relating to biological processes primarily involved in cellular metabolism and respiration were more enriched in MitoFactory-transfer compared to Mito-transfer. Some of these uniquely regulated GO terms pointed to genes encoding OXPIIOS and mitochondrial dynamics, including mitochondrial respiratory chain complex assembly (G0:0033108), mitochondrial respiratory chain complex I assembly (G0:0032981), mitochondrial electron transport (G0:0006120), NADH Dehydrogenase (G0:0010257), ATP synthesis coupled electron transport (G0:0042773), mitochondrial35US_ACTIVE\131850427W-2translation (GO: 0032543), and mitochondrial gene expression (GO: 0140053) (FIG. 3, Panel H).
[0098] In addition to the above, experiments examined how key cellular components (CC) and molecular functions (MF) were impacted. CC reveals locations of genes within the cell, and MF describes the molecular activity of the gene. Key terms were observed and compared to Mito-transfer alone. MitoFactory-transfer again contained terms associated with localization at the mitochondria and OXPHOS (FIG. 17).Example 5: M0S2 Mitochondrial Transfer effects on cellular mitochondrial dynamics
[0099] Mitochondrial transfer is a dynamic process that depends on signaling and biomolecules in both the donor and recipient cells, as depicted in FIG. 4, Panel A. Confocal laser scanning microscopy (CLSM) and SEM images confirmed the formation of TNTs within co-cultures of HUASMCs and hMSCs. As described above, TNTs mediated the transfer of mitochondria between cells. Once mitochondria enter a recipient cell, the mitochondria can be subject to multiple fates. The mitochondria may act immediately, supplementing or replacing current mitochondria, or they may be fused with existing networks (FIG. 4, Panel B). To unequivocally demonstrate mitochondrial uptake, mitochondrial copy number was measured through qPCR, as described elsewhere in this disclosure. Increased mitochondrial number was observed through expression of mtDNA encoded MT-ND2 in cells that were cocultured with hMSCs treated with M0S2 in accordance with increases in transfer rates (FIG.4, Panel C, FIG. 18, Panel A). IC-1 dye confirmed that these transferred mitochondria remained in good health and function (FIG. 18, Panel B).
[0100] MitoFactory-transfer resulted in the stimulation of biological processes such as Mitochondrial ATP synthesis coupled proton transport (G0:004277) and Oxidative Phosphorylation (G0:0006119) with significant upregulation of DEGs, indicating the promotion of cellular bioenergetics as a result of the upsurge of mitochondria within the cell (FIG. 4, Panel D, FIG. 19).
[0101] Gene Set Enrichment Analysis (GSEA) was performed. GSEA of SMCs after MitoFactory-transfer indicated a significant upregulation (normalized enrichment score (NES) >1) of processes relating to OXPHOS and mitochondrial dynamics, which correlated well with the GO enrichment analysis described above. A selective inspection of the DEGs was performed using the MitoPathways 3.0 dataset, which is a curated repository of 146 mitochondrial pathways, as described by Rath, S., et al., Nucleic Acids Research, 2020.36US_ACTIVE\131850427W-249(D1): p. D1541-D1547. After MitoFactory-transfer, SMCs showed consistent enrichment of mitochondrial pathways associated with metabolism and mitochondrial dynamics as compared to standard transfer (FIG. 4, Panels E and F). Among OXPHOS related terms, the gene sets Protein Sorting and Homeostasis (NES= 1.75, P-adj<0.01 ), Mitochondrial Central Dogma (NES= 1.89, P-adj <0.01), and Oxphos Assembly Factors (NES= 1.76, P-adj<0.01) showed a positive correlation, indicating mitochondrial energy metabolism and dynamics as key processes affected by the co-culture. This indicates mitochondrial energy metabolism and mitochondrial dynamics as key cellular processes affected by the co-cultured SMCs. Smooth muscle cells make up contractile tissues and respond strongly to mitochondrial energetics and ROS levels. Mitochondria are critical for SMC function, SMC contraction is dependent on energy from adenosine triphosphate (ATP), which is mainly generated through oxidative phosphorylation in the mitochondria. See Chalmers, S., et al., Arterioscler Thromb Vase Biol, 2012. 32(12): p. 3000-11.) Increased mitochondria count as the result of intercellular mitochondrial transfer via MitoFactory-transfer induces remodeling of mitochondrial dynamics within the cell.
[0102] To determine how mitochondrial transfer impacts energy production of the cell, oxygen consumption rate was measured. The oxygen consumption rates revealed that SMCs which received mitochondria via MitoFactory-transfer had significantly higher basal levels of respiration, owing to the excess mitochondria now present within the cells (FIG. 4, Panel G). Additionally, total cellular ATP levels were assayed from cell lysates. The ATP levels indicated that mitochondrial transfer elevated total ATP concentrations following co-culture in multiple cell types similarly, with MitoFactory-transfer cells showing higher significant changes in intracellular ATP (FIG. 4, Panel H).Example 6: M0S2 mediated Mitochondrial transfer ameliorates mitochondrial damage
[0103] From the above, it is clear based on transcriptomics and increased respiration afforded to SMCs through transfer with MitoFactory hMSCs that the new mitochondria are active participants within the cell, contributing to increases in ATP generation, oxygen consumption, and associated machinery. To check whether the transferred mitochondria can be utilized to repair damage to cellular respiration, mitochondrial damage was induced using Antimycin, CCCP, and Doxorubicin. Markers of cellular health and function were then assayed (FIG. 5, Panel A). Mitochondria produce approximately 95% of a cell’s ATP, and when mitochondrial function is impaired, cellular metabolism to produce ATP cannot proceed normally. The resulting chronic energy deficiency threatens cell survival and can even induce cell death to 37US_ACTIVE\131850427W-2cause disease. The transfer of mitochondria between cells supplements and / or restores ATP production to support the survival of cells with impaired energy metabolism.
[0104] After the cell uptakes extracellular mitochondria, internalized mitochondria are transported within the new cell and must effectively integrate with the endogenous mitochondrial network. In both healthy and damaged cells, the mitochondrial network is responsible for the maintenance of homeostasis and energy production. Dysfunction in this tightly regulated network can lead to a host of downstream affects. Thus, integration into existing networks is essential to show functionality and therapeutic potential of these outsourced organelles. Mitofusinl(MFNl), Mitofusin2 (MFN2), and optic atrophy 1 (OPA1) are known to facilitate the fusion of exogenous mitochondria with endogenous mitochondrial networks with MFNs responsible for the outer membrane and OPA for the inner. (See, e.g., Cipolat, S.M.d.B., et al., PNAS, 2004. 101(45): p. 15927-15932; Gao, S. and J. Hu, Trends Cell Biol, 2021. 31(1): p. 62-74.) Beyond this, MFNs have been associated with the tethering of mitochondria to each other and other organelles, as physical association is the necessary first step in fusing two mitochondria. (See, e.g., Zacharioudakis, E., et al., Nat Commun, 2022.13(1): p. 3775: Dorn, G.W., J Mol Cell Cardiol, 2020. 142: p. 146-153; Misko, A., et al., J Neurosci, 2010. 30(12): p. 4232-40.) Thus, integration into mitochondrial network can be evaluated through mRNA expression of MFN1 , MFN2 and OPA1. Mitochondrial dynamics within the recipient cells displayed a gradual decrease in copy number across the next 48 h after transfer, indicating that transferred mitochondria, while effective in promoting bioenergetics, are also quickly integrated into existing networks, likely through processes such as mitochondrial fusion, with recipient SMCs of MitoFactory-transfer retaining elevated levels as a result of the higher copy numbers immediately post transfer (FIG. 20). MFN1 / 2 were significantly upregulated in SMCs and NHCF-Vs under physiological co-culture conditions for 24 h. OPA1 were upregulated significantly only after MitoFactory-transfer. These results may indicate MFNs are responsible for tethering mitochondria within recipient cells and that the fusion process begins to occur with high levels of excess mitochondria (FIG. 5, Panel B, FIG. 21, Panel A). When recipient cells were placed under metabolic stress (induced by Antimycin A), these key genes of mitochondrial fusion were still more significantly upregulated, suggesting that new mitochondria could be aiding in the repair of mitochondrial bioenergetics through fusion. Results of qPCR revealed non-significant increases in Rhotl expression under physiological conditions across both M0S2 treated and control hMSCs in the co-culture system. However, Rhotl expression increased when recipient cells were injured38US_ACTIVE\131850427W-2with antimycin A, indicating the capacity for Mirol to play a role not only in the translocation and positioning of mitochondria but also in re-establishing functional connections as well (FIG.21, Panel B). These results reveal unique behavior of the co-culture model when mitochondrial damage is present, as also observed in other studies where mitochondrial transfer is preferred where increased need is present via damage in recipient populations. (See, e.g., Chen, J., et al., Front Cardiovasc Med, 2021. 8: p. 771298; Huang, T., Science Advances, 2021. 7(40); Abraham, A. and A. Krasnodembskaya, Stem Cells Transl Med, 2020. 9(1): p. 28-38.)
[0105] To further evaluate of the therapeutic potential of mitochondrial transfer from MitoFactory hMSCs, mitochondrial damage was induced in a variety of forms. Administration of Antimycin A inhibits electron transport at complex III, which can result in elevated superoxide levels. Carbonyl cyanide 3-cholorophenylhydrazone (CCCP) disrupts electron transport by uncoupling the proton gradient at the mitochondrial membrane, causing mitochondrial depolarization. Significant improvements were observed in mitochondrial health post treatment with these inhibitors after MitoFactory-transfer. Not only can mitochondrial transfer from M0S2 treated hMSCs increase total ATP production after mitochondrial damage induced by Antimycin A but mitochondrial transfer also fully restores cellular ATP production (FIG. 5, Panel C). Furthermore, Mitochondrial membrane potential measured via JC-1 revealed improvements in the membrane potentials of cells, and mitochondrial- specific superoxide measured for antimycin revealed significant recovery to basal levels after MitoFactory-transfer (FIG. 5, Panels D and E). Overall, the data suggest that enhanced mitochondrial transfer from MitoFactory-transfer can address multiple forms of dysfunction and result in increased viable mitochondria in recipient cells.
[0106] Following the establishment of the mechanism of mitochondrial transfer from hMSCs treated with M0S2 and the significant increases in efficiency, the clinically relevant therapeutic potential of MitoFactory-transfer was also evaluated. Anthracycline-based chemotherapy can result in the development of a cumulative and progressively developing cardiomyopathy. Doxorubicin (Dox) is one of the most popular chemotherapeutics or anti-cancer drugs in this class. Interference with different mitochondrial processes is chief among the molecular and cellular determinants of doxorubicin cardiotoxicity, contributing to the development of cardiomyopathy. (See, e.g., Wallace, K.B., etal., Circ Res, 2020. 126(7): p. 926-941; Abe, K., Science Signaling, 2022; Rawat, P.S., et al., Biomed Pharmacother, 2021. 139: p.111708.). Dox is closely related to mitochondrial dysfunction of cardiac tissues. The complexity of certain mitochondrial dysfunctions prevents them from being mitigated by these39US_ACTIVE\131850427W-2methods alone. Anti-cancer drugs of this class, especially Dox, are known to not only cause oxidative stress but also epigenetic alterations that damage mtDNA. Resulting damage can be found in non-target tissues such as the case with Anthracycline-induced cardiomyopathy. Treatments, such as ROS scavenging and ion chelation, have shown limited efficacy and do not address all facets of the pathology. (See, e.g., Wallace, K.B., et al., Circ Res, 2020. 126(7): p. 926-941; Abe, K., Science Signaling, 2022; Rawat, P.S., etal., Biomed Pharmacother, 2021.139: p. 111708.) Several experimental models demonstrate that Dox inhibits mitochondrial respiration and accumulates in mitochondria and nuclei. The abundance of the former in cardiac tissues results in increased cardiotoxicity. Cardiac fibroblasts comprise a large portion of cellular mass within the myocardium and are responsible for generating ECM and supporting the heart’s structure and function.
[0107] An impaired mitochondrial function disrupts the efficiency of cellular metabolism, induces metabolic reprofiling, increases production of reactive oxygen species (ROS), and increases autophagy (and mitophagy) responses in an attempt to remove damaged mitochondrial and cellular structures. In this regard, the improved mitochondrial transfer capability of MitoFactory-transfer may provide an opportunity to immediately restore mitochondrial functions and maintain intracellular ROS, while limiting autophagy. To explore this, mitochondrial functions of injured NHCF-V cells after different concentrations of Dox treatments were evaluated (FIG. 22). Doxorubicin (Dox, 1 pM) for 24 h was used to induce in vitro cardiotoxicity as a clinically relevant source of mitochondrial dysfunction. At this concentration, acute Dox treatment for 24 h results in a significant increase in total cellular ROS as well as a marked decrease in cellular proliferation. In this regard, the improved mitochondrial transfer capability provided by S_Mo-hMSCs may provide an opportunity to restore mitochondrial functions and maintain cellular health. To demonstrate this, mitochondrial functions and cellular apoptosis of injured NHCF-V cells were evaluated after different treatments.
[0108] Compared with standard transfer, MitoFactory-transfer achieved much higher cell survival in the treated cells, while also exhibiting much higher efficiency in the reduction of cellular apoptosis and caspase activation (FIG. 5, Panel F). At the mitochondrial level, MitoFactory-transfer almost fully restored the injured NIICF-V cells in terms of mitochondrial specific superoxide levels. MitoFactory-transfer treated NHCF-V displayed no statistical difference from the healthy control group (FIG. 5, Panel G). Alongside this, compared to Mito-transfer, Mitofactory-transfer resulted in replenished intercellular ATP concentrations40US_ACTIVE\131850427W-2following the Dox treatment (FIG. 5, Panel H). Overall, these results suggest that mitochondrial transfer has the ability to restore health and function after Doxorubicin treatment in cardiac fibroblasts. MitoFactory -transfer exhibited efficient mitochondrial replenishability to quickly reverse mitochondrial membrane potential damage.
[0109] In addition, the mitochondrial-dependent apoptotic pathway is the most thoroughly described mechanism of cell death via Doxorubicin. Damage to mitochondria and activation of mitochondrial-dependent apoptotic pathway in cardiac cells after Dox-induced oxidative stress has been reported. Activation of the apoptotic pathway involving the release of mitochondrial AIF (apoptosis-inducing factor) is a known signal of Dox-related cell death. Along with this, a restoration of mitochondrial function was observed, as MitoFactory-transfer was significantly more effective at relieving levels of AIF in cells as compared to hMSCs alone (FIG. 5, Panel I).Example 7: Engineered approach to isolate and package M0S2 derived mitochondria as an efficient intervention of mitochondrial dysfunction
[0110] Independent of co-culture models which rely on the spontaneous process of mitochondrial transfer through stem cells and their machinery, excess mitochondria can be transferred through artificial transfer after isolation of mitochondria from any tissue where they are then engulfed via endocytosis. (See, e.g., Ali Pour, et al., J Am Heart Assoc, 2020. 9(7): p. e014501.) Once isolated, mitochondria can then be kept functioning and packaged or stored for later use, as described by Liu, Z., et al., Cell Biosci, 2022. 12(1): p. 66. This disclosure recognizes that co-culture of naked mitochondria isolates is inefficient and sporadic, as mitochondria randomly move around the recipient cell and have chances to be engulfed by the cell when contacting it. Droplet microfluidics and synthetic encapsulation are methods that utilize a continuous flow of emulsions carrying desired cargo into discrete volumes at the micrometer scale Artificial packaging via these types of methods may be used to prepare thousands of droplets with the resulting structures varying in size and composition. (See, e.g., Giannitclli, S.M., et al., Nanoscalc, 2022. 14(31): p. 11415-11428; Sun, I., Science Advances, 2022. 8(33).)
[0111] Autologous tissue obtained from a non-pathological site from the subject’s or patient's body offers a clinically relevant source of donor cells for obtaining mitochondria. Tests were performed to explore the use of mitochondria isolated from healthy H9C2, HUASMC, and NHCF-V cells in order to replace the damaged mitochondria present in cells of the same type,41US_ACTIVE\131850427W-2which had been exposed to a number of inhibitors of mitochondrial function, including the chemotherapeutic Doxorubicin.Task 1A: Successfully isolate mitochondria from various cell types after M0S2 treatment, confirming functionality and health of isolates.
[0112] Various methods of extracting purified mitochondria are available, including those that then co-incubate the purified mitochondria with cells for internalization. (See, e.g., Nzigou Mombo, B., et al., J Vis Exp, 2017(120); Preble, J.M., et al., J Vis Exp, 2014(91): p. e51682; Frezza, C., et al., Nat Protoc, 2007. 2(2): p. 287-95; Shibata, T., et al., Biochcm Biophys Res Commun, 2015. 463(4): p. 563-8; Zhou, D., et al., STAR Protoc, 2023. 4(1): p. 102088.) The organelle transplant aims to directly address mitochondrial dysfunction by outright replacing damaged mitochondria through the transplantation of viable, respiration-competent mitochondria isolated from healthy tissues of the same type. The coincubation method is limited by the endocytosis effect of recipient cells. Various methods can be used to improve the efficiency of mitochondrial transfer to cells, for example, using synthetic liposomes, inclusion of cell-penetrating peptides, or adding additional centrifugation (FIG. 6, Panel A).
[0113] Functional, purified, intact mitochondria were obtained from cells using commercially available kits. These mitochondria were isolated with and without treatment with M0S2 nanoflowers. Mitochondria were freshly isolated from respective cells following the protocol of the mitochondria isolation kit for cultured cells (ThermoFisher). First, donor cells were treated with M0S2 nanoflowers in order to increase the mitochondrial copy number in these cells, as described above. At this point, cells were counted to achieve 107cells / mE. A final pellet was prepared that contained the isolated mitochondria. The mitochondrial pellet was maintained on ice before downstream processing. The mitochondria isolated from 107cells was suspended in serum free media for downstream processing.
[0114] Western blotting for the mitochondrial porin VDAC was used to evaluate purity and quantity of isolated mitochondria. GAPDH was used to detect any cytoplasmic contaminants. For analysis by western blotting, equal volumes of the mitochondrial pellet across M0S2 and untreated samples was boiled with an SDS-PAGE sample buffer and loaded into the gel. In preliminary experiments, isolated mitochondrial fractions displayed enhanced mitochondrial mass as detected by VDAC expression in lysates following M0S2 treatment. Furthermore, minimal cytosolic contamination was found via GAPDH (FIG. 6, Panel B).42US_ACTIVE\131850427W-2Task IB: Develop an artificial lipid membrane to package isolated mitochondria in droplets for subsequent uptake.
[0115] Packaging of exogenous mitochondria may be performed to improve transplantation efficiency. While some methods involve microfluidics, all methods generate create an emulsion that holds a cargo. (See, e.g., Giannitelli, S.M., et al., Nanoscale, 2022. 14(31): p.11415-11428; Sun, J., Science Advances, 2022. 8(33).) To package mitochondria, an artificial lipid membrane was prepared that can be readily engulfed by a recipient. To do this, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), a cationic lipid, and 1,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), a neutral phospholipid, were used to create an artificial membrane around isolated mitochondria. As adapted from Westensee et al. Small, 2021. 17(24): p. e2007959 and Nakano et al., Commun Biol, 2022. 5(1): p. 745, briefly, isolated mitochondria were suspended in a storage buffer of 10 mM HEPES pH 7.5, 250 mM Sucrose, 1 mM ATP, 0.1 mM ADP, 5 mM sodium succinate, 2 mM dipotassium phosphate, and 1% polyvinyl alcohol. Mitochondrial suspensions were then mixed with mineral oil containing 1 mM of DOTAP / DOPE (1:1 ratio) followed by generation of a water / oil emulsion via gentle pipetting. This emulsion was then transferred dropwise to a new tube containing 1 mM DOTAP / DOPE in mineral oil and PBS and left to incubate for 5 min. Suspensions were then spun down at 4C. Supernatant was discarded, and the precipitate was resuspended in mitochondrial storage buffer and washed once more via centrifugation (FIG. 6, Panel C). Results indicate that mitochondria can be successfully coated in lipids, as evidenced by the change in hydrodynamic size and surface charge following this process (FIG. 6, Panel D). The lipid-coated or encapsulated mitochondria can be administered to a subject as a therapeutic.Example 8: Materials and Methods
[0116] Nanoparticle synthesis. To synthesize M0S2 nanoflowers with atomic scale defects, a 1:6 molar ratio of molecular precursors of molybdenum and sulfur (Hexaammonium heptamolybdate tetrahydrate and thiourea, respectively) were added to 15 mL of water. This solution was then transferred to a hydrothermal device and placed at 120-200 °C for 6-18 h. The solution obtained was subsequently washed with water and ethanol three times each to remove any unreacted precursors and impurities. Subsequently, particles were returned to ultrapure water and frozen overnight. This was followed by lyophilization for 24 h to achieve a nanoparticle powder. In this manner, different sizes of M0S2 nanoflowers were synthesized.43US_ACTIVE\131850427W-2
[0117] Nanoparticle characterization. As described above, transmission electron microscopy (TEM) was performed on a carbon grid at an accelerating voltage of 200 kV using a JEOL-JEM 1200 (Japan). For sample preparation, aqueous dispersions of M0S2 samples were drop-casted and air-dried on a copper grid (Ted Pella Inc.). Scanning electron microscopy (SEM) was performed on M0S2 samples drop spin-coated onto a silicon wafer (Ted Pella), coated with gold (5 nm), and imaged using an FEI Quanta 600 FE-SEM.
[0118] The zeta potentials and hydrodynamic sizes of MoS2-albumin solutions were measured with a Zetasizer Nano ZS (Malvern Instrument, U.K.) at 25 °C.
[0119] The crystallographic phases of monolayer M0S2 sheets together with the bulk counterpart were confirmed by X-ray powder diffraction (Bruker D8 advanced) using a copper Ka source (wavelength, 1.54 A). The data were recorded from 5 to 70 degrees, and the obtained peaks were indexed using JCPDS card No. 73-1508. The characteristic peak (002) was used to calculate crystallite size (D) using the Scherrer equation. The crystallographic arrangement of Mo-S atoms within the M0S2 nanoflowers following the synthesis was determined using X-ray photoelectron spectroscopy (XPS, Omicron Inc.). The binding energies (BE) for Mo (3d) and S (2p) for M0S2 samples, along with that of adventitious carbon (Cis) for both bulk and monolayer counterparts were recorded. The raw data was further processed and deconvoluted by XPS-41 multiple peak fit software and indexed using the standard library.
[0120] Catalase Activity. The catalytic activity of M0S2 nanoflowers was determined by comparing the reduction of hydrogen peroxide by M0S2 nanoflowers to the reduction caused by the bovine catalase enzyme. The assay was performed using the Catalase Colorimetric Activity Kit (Invitrogen, catalog no: EIACATC) with the M0S2 nanoflowers dispersed in PBS at a concentration of 25 iig / inE.
[0121] Cell culture. Human mesenchymal stem cells (hMSCs) (ATCC) were cultured in normal media conditions consisting of a-minimal essential media (alpha-MEM, Hyclone, GE Sciences) with 10% fetal bovine serum (Cytiva) and 1% penicillin / streptomycin (100 U / 100 pg / mL, Life Technologies). After every 2-3 days, the culture media was exchanged for fresh media. Cells were passaged with TrypLE Express Enzyme (Gibco) upon reaching a confluency of -70-80%. All experiments were completed with cell populations under passage 5 for this cell type.44US_ACTIVE\131850427W-2
[0122] H9C2 and C2C12 cells were cultured in high-glucose Dulbecco’s Modified Eagle Medium (DMEM) media supplemented with 10% fetal bovine serum (FBS) (Sigma), 1 mM sodium pyruvate and Pen / Strep (Life Technologies). Cells were passaged with TrypLE Express Enzyme upon reaching a confluency of -70-80% .
[0123] Human Umbilical Artery Smooth Muscle Cells (HUASMCs) (PromoCell) were cultured in Endothelial Cell Medium (ECM) kit (ScienCell) containing fetal bovine serum (FBS), Endothelial Cell Growth Supplement, and penicillin / streptomycin solution. Cells were passaged with TrypLE Express Enzyme (Gibco) upon reaching a confluency of -70-80%. All experiments were completed with cell populations under passage 5 for this cell type.
[0124] Normal Human Ventricular Cardiac Fibroblasts (NHCF-V) (Lonza) were cultured in FGM™-3 Cardiac Fibroblast Growth Medium-3 BulletKit (Lonza) containing Insulin, hFGF-B, GA-1000, and FBS (Lonza). Cells were passaged with TrypLE Express Enzyme (Gibco) upon reaching a confluency of -70-80%. All experiments were completed with cell populations under passage 5 for this cell type. Cells were cultured under 5% CO2 at 37 °C.
[0125] Protein corona formation. The composition of the protein corona formed around the nanoflower was investigated by an SDS-PAGE gel electrophoresis. Briefly, the nanoflowers were incubated with serum-supplemented alpha MEM media for 4 h at 37 °C. The samples were then centrifuged at 10,000g and washed 3 times with PBS. The nanoflowers were then suspended in LDS loading buffer (Thermo Fisher), followed by incubation at 95 °C for 5 minutes, and subsequent gel electrophoresis was performed. The gels were then stained using Imperial Blue stain (Thermo Fisher).
[0126] In vitro assays. For cytotoxicity assays, hMSCs were seeded in 96 well plates at a seeding density of 5,000 cells per well. The cells were exposed to varying concentrations of M0S2 nanoflowers of varying sizes for 24 h to determine cytotoxicity, followed by measurement of toxicity using Cyquant (Thermo Scientific) as per the manufacturer’s protocols.
[0127] For cell cycle analysis, hMSCs were cultured in 25 cm2flasks. After reaching 50% confluency, hMSCs were serum starved (only 1% FBS in media) for 12 h to synchronize cell populations, followed by treatment with M0S2 nanoflowers (25 pg / mL). After 72 h of exposure, the cells were detached and fixed in ice-cold 70% ethanol. The cells were then centrifuged and washed with PBS 3 times, followed by incubation with PI (40 pg / mL) and45US_ACTIVE\131850427W-2Rnase (100 pg / mL) at 37 °C for 1 h. Cells were stored at 4 °C until flow cytometry analysis was performed using the BD Accuri C6 flow cytometer.
[0128] Fluorescence Microscopy. Imaging of hMSCs treated with M0S2 nanoflowers was performed using a confocal microscope (Leica Sp8). Cells were cultured in chambered coverslips (Ibidi) followed by exposure to M0S2 nanoflowers for 7 days, after which cells were washed 3 times with PBS and fixed by incubation samples with 4% paraformaldehyde (PFA) for 15 minutes at room temperature. Cells were permeabilized with 0.1 % Triton X-100 for 10 minutes at room temperature. M0S2 nanoflowers were imaged using reflective light, with the nucleus, f-actin, and mitochondria stained using DAPI (Biotium), Rhodamine Phalloidin (Biotium), and Mito tracker Deep Red (Thermo Fisher), respectively. Cell connections in mitochondrial transfer were labeled using wheat germ agglutinin (Biotium) or nanotubes imaged via F-Actin staining using Acti-stain Phalloidin (Cytoskeleton Inc.).
[0129] Scanning Electron Microscopy. SEM Images of nanotubes were obtained via plating of cells on glass coverslips. After 24 h of co-culture, cells were fixed in 4% PFA and 2.5% glutaraldehyde, followed by washing with PBS. Cells were then dehydrated in a graded ethanol series for 10 minutes each (35, 50, 70, 90, 100%). Following fixation and dehydration, the coverslips were left desiccated for 72 h. Coverslips were sputter coated with Au or Pt / Pd (5 nm). Images were acquired using a JEOL JSM-7500F scanning electron microscope.
[0130] Reactive oxygen species (ROS). For direct nanomaterial cell interactions, untreated hMSCs (negative control) and M0S2 (1:6) treated cells were seeded in a 6-well plate at 60% confluency. After 24 h of growth, the media was replaced by PBS, and samples were incubated with 1-2 pM CM-H2DCFDA (for cellular ROS) for 10-15 min in the dark. The cells were then harvested, and fluorescence was measured using flow cytometry (BD Accuri C6). Cells exposed to 100 pM H2O2 for 10 minutes at 37 °C were used as a positive control. Similarly, to determine mitochondria-specific ROS production, mitoSOX Red superoxide indicator (5 pM) (Thermo Fisher) was used according to the manufacturer’s protocol. In the case of mitochondrial ROS generation, cells exposed to 5 pM Antimycin A for 20 minutes at 37 °C were used as a positive control. For intracellular ROS evaluation withing mitochondrial transfer, cell samples were stained as described above, washed with neutral PBS three times, and harvested for quantitative evaluation using flow cytometry. The stained cells were washed with HBSS three times, and the positive cells were quantitatively analyzed by flow cytometry.46US_ACTIVE\131850427W-2
[0131] Western blot analysis. Cells were harvested, washed with phosphate-buffered saline (PBS), and lysed on ice in radioimmunoprecipitation assay (RIP A) extraction buffer (Thermo Scientific). Lysed cells were supplemented with a lx complete protease inhibitor cocktail (Thermo Scientific), and the lysates were centrifuged at 14,000 x g for 15 min at 4 °C. Clear supernatants were collected, and protein concentration was determined using the microBCA assay (Invitrogen). Proteins were separated in 12% NuPAGEBis-Tris gel (Life Technologies) followed by transfer (Invitrogen, iBlot 2) to a nitrocellulose membrane as per manufacturer’s instructions. Membranes were blocked with Superblock T20 (TBS) (Thermo Scientific) for 30 min prior to antibody staining. Primary antibody incubation was performed overnight at 4 °C, while secondary antibody incubation was performed at room temperature for 1 h. Membranes were washed three times for 5 minutes with TBST after both the primary and secondary antibody incubation. Following this, the membranes were developed (SuperSignal™ West Pico PLUS Chemiluminescent Substrate, Thermo Scientific) and imaged using a LI-COR® 3600 C-Digit Blot Scanner. Quantification of bands was performed using ImageJ.
[0132] Gene expression analysis and mtDNA copy number. To measure transcript levels, cells were harvested, followed by RNA extraction using RNA extraction kit (Zymo research). The RNA was converted into cDNA using a first-strand cDNA synthesis kit (Qunatbio) following the manufacturer’s recommended protocol. The generated cDNA was then stored at -20 °C until further use.
[0133] Quantitative real-time polymerase chain reaction (qRT-PCR) experiments were performed using TaqMan assays for target genes (mt-ND2 assay ID: Hs02596874_gl; ACTB assay ID: Hs03023943_gl; GAPDH assay ID: Hs0275899I_gI; Rhotl assay ID) and TaqMan Fast Advanced Master Mix (Thermo Fisher) with an initial cDNA mass of 2 ng per reaction. Changes in the expression levels of target genes as a result of M0S2 exposure were determined using comparative CT (AACT) analysis with GAPDH acting as an endogenous control.
[0134] The relative mtDNA copy number was determined using DNA extracted via a DNA extraction kit (Zymo research). By comparing the expression levels of a mitochondrial encoded gene (mt-ND2) and with that of nuclear DNA (GAPDH), the relative change in mtDNA expression was determined when comparing MoS2-treated cells to untreated (control) cells. qRT-PCR assays were performed in a manner similar to those described above, with total cellular DNA being utilized in place of mRNA-derived cDNA. All qRT-PCR experiments were performed using a QuantStudio™ 3 System (Applied Biosystems).47US_ACTIVE\131850427W-2
[0135] For Human cell lines, RT-PCR experiments were performed using SYBR chemistry for the following targets:GAPDH F: CATCACTGCCACCCAGAAGACTG (SEQ ID NO:1);GAPDH R ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NO:2),mt-ND2 F: AGGGATCCCACTGCACATAG (SEQ ID NO:3);mt-ND2 R: TGAGGGATGGGTTGTAAGGA (SEQ ID NO:4).
[0136] For mouse cell lines, RT-PCR experiments were performed using SYBR chemistry for the following targets:PGC-la F: GAATCAAGCCACTACAGACACCG (SEQ ID NO:5);PGC-la R: CATCCCTCTTGAGCCTTTCGTG (SEQ ID NO:6),GAPDH (F: CATCACTGCCACCCAGAAGACTG (SEQ ID NO:1);GAPDH R: ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NOG),mt-ND2 (F: AGGGATCCCACTGCACATAG (SEQ ID NOG);mt-ND2 R: TGAGGGATGGGTTGTAAGGA (SEQ ID NO:4).
[0137] shRNA lentiviral infection and knockdown generation. Gene-specific shRNA plasmids (PGC-la: TRCN0000234017, TEAM: TRCN0000311846, Empty pLKO vector: SHC001V) were purchased from the Mission shRNA collection (Sigma). Lentiviral particle production and infection were performed as described in Wallace, K.B., et al, Circ Res, 2020.126(7): p. 926-941. For constructing stable knockdown cell lines, 100,000 C2C12 cells were seeded in a six- well dish, and 100 pL of viral supernatant was added to cells to a final volume of 2 mL of medium containing 8 pg / mL polybrene. The plates were spun at 805g for 30 min at 30 °C, returned to a 37 °C incubator, and selected for infection after 24 h with 2 pg / mL puromycin-containing medium for 72 h. Knockdown efficiency was determined using RT-PCR using C2C12 cells transfected with empty pLKO vectors as controls.
[0138] Mitochondrial membrane potential. Mitochondrial membrane potential in cells was evaluated using the JC-1 assay (AAT Bioquest). JC-1 dye exhibits different fluorescence in response to membrane potential (under high membrane potential JC-1 exhibits red fluorescence, while at low membrane potential, the dye remains in monomeric form, giving a green fluorescence signal). The ratio of these signals can be measured to detect a change in mitochondrial membrane potential in response to treatment conditions. Cells treated with 10048US_ACTIVE\131850427W-2pm CCCP for 20 minutes at 37 °C were used as a positive control. Cell numbers across different treatments were normalized using Hoechst nuclear staining. Fluorescence was measured on a Cytation 5 (Agilent) using appropriate filters.
[0139] ATP production. Total intercellular ATP was measured using a bioluminescence assay (Cayman Chemical). For this assay, cells were seeded in a 96-well plate at a density of 10,000 cells per well, after which ATP levels were measured using an ATP determination kit (Theimo Fisher) as per manufacturer’s protocol.
[0140] Seahorse assay. Oxygen consumption rate (OCR) was measured using the Seahorse XF24 Extracellular Flux Analyzer per the manufacturer’s protocol. Briefly, the cells were seeded in XF24-well cell culture microplates (Agilent Technologies) at 60,000 cells / well in 200-pL growth media and incubated at 37 °C in a 5% CO2 incubator overnight. Before measurements, media was exchanged for pre-warmed XFe medium prepared as per manufacturer’s directions (1 mM Pyruvate, 2 mM Glutamine, 10 mM Glucose) in each well, and cells were further incubated at 37 °C for 1 hour. OCR measurements were carried out in intact cells using Seahorse XF24 Extracellular Flux Analyzer (Agilent Technologies). For the mitochondrial stress test, oligomycin, carbonyl cyanide 3-cholorophenylhydrazone (CCCP), and antimycin A (Cayman Chemical) were sequentially injected to achieve final concentrations of 1, 10, and 1.5 pM, respectively. For the glycolysis stress test, cells were prepared in the same manner, and XFe assay medium prepared per the manufacturer’s instructions (2mM Glutamine). Glucose, Oligomycin, and 2-Deoxy-D-Glucose (Thermo Scientific) were sequentially injected to achieve final concentrations of 10 mM, 1 pM, and 50 mM, respectively. For both stress tests, post-assay cell normalization was performed by quantifying cellular DNA content using CyQuant (Thermo Scientific).
[0141] Bioengineering of hMSCs using M0S2. hMSCs were seeded in culture dishes beforehand for 24 hours. The culture medium was replaced with medium containing 25 pg / mL M0S2. M0S2 was added to hMSCs for 24 hours of incubation, followed by replacement with fresh scrum-containing culture medium for an additional 7 days. After every 2-3 days, the culture media was exchanged with fresh media. This generated enhanced hMSCs with elevated levels of mitochondria.
[0142] Assessments of the in vitro mitochondrial transfer. Mitochondrial transfer was observed by confocal laser scanning microscopy (CLSM), and the transfer efficiency was assessed using a flow cytometer. Briefly, hMSCs (with or without M0S2 as described) were49US_ACTIVE\131850427W-2incubated in a prewarmed staining solution containing the MitoTracker probe (MitoTracker Deep Red FM, 100 nM) for 15 min. After being washed three times with neutral PBS, hMSCs were co-cultured with un-stained recipient cells for 24 hours. These co-cultured cells were fixed by 4% paraformaldehyde and stained with DAPI and wheat germ agglutinin CF-555 (Biotium). CLSM was used to observe the mitochondrial transfer from hMSCs to recipient cells. Reflected light was utilized to identify hMSC populations through the presence of M0S2 within the cells. In addition, CellTracker Green (Thermo Scientific) stained cells were prepared through staining 100 pM for 20 min and co-cultured with MitoTracker Red FM-labeled hMSCs (as described above) for quantitative measurements of the mitochondrial transfer rate using a flow cytometer (BD Accuri C6, BD Fortessa X-20). For the co-culture system, recipient cells and hMSCs were co-cultured at a cell number ratio of 3:1. For the Transwell test, 24-well Transwell plates (Corning Costar, Cambridge, USA) with 0.4 pm pore membranes were used in the same manner. Recipient cells were plated on the lower chamber, and hMSCs at the same ratio were plated on the upper insert.
[0143] Mitochondrial transfer efficiency quantified using flow cytometry. MitoTracker Red FM-labeled hMSCs and CellTracker Green recipient cells were first collected by trypsinization and subsequently washed twice with neutral PBS. Cell samples were resuspended in PBS for quantitative analysis using flow cytometry (BD Accuri C6, BD Fortessa X-20). CellTracker positive cells were gated, and the ratio of MitoTrackerpositive green cells was used as the transfer efficiency. In some experiments, fresh medium supplemented with 350 nM cytoB (Sigma- Aldrich) was added 1 h after the start of co-culture.
[0144] Isolation of recipient cells from the co-culture system. Briefly, all cells in the coculture system were collected by trypsinization and subsequently washed twice with neutral PBS. For assays requiring separation of populations, hMSCs were differentially stained with CellTracker Red and recipients with CellTracker Green. The green-positive recipient cells in the mixed cell samples were isolated using a fluorescence-activated sorting flow cytometer (FACS) (MoFlo Astrios EQ,). All cells were gated and collected.
[0145] Inductively coupled plasma-mass spectrometry (ICP-MS). Cellular levels of Mo were measured by ICP-MS using a NexION 300D (PerkinElmer). Briefly, 1-3 x 106cells from each group were harvested after 24 h of co-culture or single culture via FACS as described above. Cells were washed twice with 1 mL of PBS, followed by two more washes with 0.9% NaCl prepared in ultrapure water. Following this, the samples were digested with 40% (w / v) nitric acid (TraceSELECT; Sigma- Aldrich) at 90 °C for 18 h, after which samples were 50US_ACTIVE\131850427W-2subjected to a 6 h digestion with 0.75% H2O2(Sigma-Supelco) and then serially diluted in ultrapure water. A calibration curve was generated by serially diluting ammonium molybdate in 1.5% nitric acid.
[0146] Transcriptome sequencing (RNA-seq). Pre-Stained SMCs were co-cultured with prestained hMSCs and hMSCs treated with M0S2 nanoflowers for 7 days, respectively, for a period of 24 h, with single culture cells acting as a control group. After co-culture duration, the cells were harvested and separated via FACS as described above, and total RNA was extracted using the Zymogen Quick RNA Miniprep kit. mRNA concentration and quality was assessed using NanoDrop with an absorbance ratio threshold A260 / A280 > 2 for samples used for sequencing.
[0147] Sequencing was performed using a Nova seq platform (Illumina Nova sEq. 6000), using a Truseq RNA preparation and paired-end read length. Following sequencing, reads were aligned in reference to the human genome (hg38, GRCh37 Genome Reference Consortium Human Reference, obtained from University of California, Santa Cruz) using the R-B ioconductor package Spliced Transcripts Aligned to a Reference (STAR). See Ali Pour, et al., J Am Heart Assoc, 2020. 9(7): p. e014501. mRNA levels of SMCs treated hMSCs samples were compared to untreated SMCs to determine co-culture exposure -induced differential expression of genes as well as between hMSC groups for increasing mitochondrial transfer. Foruntreated SMCs, 77717013 (71062454 uniquely mapped), 73288323 (67911362 uniquely mapped), and 62609846 (57297000 uniquely mapped) reads were aligned to the genome for the 3 replicates. For SMCs treated with hMSCs alone, 53973971 (49515431 uniquely mapped), 53133427 (49130272 uniquely mapped), and 60973908 (56144044 uniquely mapped) reads were aligned to the genome for the 3 replicates. In the case of hMSCs treated with M0S2, 59041001 (54942734 uniquely mapped), 57993395 (54122903 uniquely mapped), and 55258564 (52442474 uniquely mapped) reads were aligned to the genome for the 3 replicates.
[0148] Only uniquely mapped reads were utilized for further analysis. RcfScq gene models were retrieved from UCSC, and expression was quantified to read counts using the uniquely mapped reads of the coding exons, normalized by gene length using reads per kilobase of transcript per million mapped reads (RPKM) factor. Genes expressed with RPKM > 1 in at least half of the samples of any condition were considered expressed, and genes with RPKM <1 were considered to have minimal to no expression. Bioconductor package DESeq2 was utilized for genes expressed in treatment conditions (z.e., differentially expressed genes) via 51US_ACTIVE\131850427W-2negative binomial distribution. Following this, Log2-adjusted RPKM was used to perform high dimensional clustering (HDC). Differentially expressed genes (DEGs) were sorted with a statistical threshold (Benjamini-Hochberg false discovery rate (FDR) adjust) Padj <0.01. Statistically significant DEGs were used to determine functional annotation enrichment of gene ontology terms belonging to Biological Processes (BP), Molecular Functions (MF), and Cellular Components (CC). Enrichment analysis was performed using the Bioconductor package GoStats (using conditional hyperGTest of overrepresentation) and EnrichR, as described in Liu, Z., et al., Cell Biosci, 2022. 12(1): p. 66; Sun, J., Science Advances, 2022.8(33); Nzigou Mombo, B., et al., J Vis Exp, 2017(120); and Preble, J.M., et al., J Vis Exp, 2014(91): p. e51682. Genetracks for key target genes were generated using the Gviz package, as described in Frezza, C., S. Cipolat, and L. Scorrano, Nat Protoc, 2007. 2(2): p. 287-95. Data visualization via bubble plots was generated with ggplot2, as described in Shibata, T., et al., Biochem Biophys Res Commun, 2015. 463(4): p. 563-8.
[0149] Gene set enrichment analysis (GSEA) was performed using the GSEA java desktop application against the current Molecular Signatures Database (v2024 MsigDB), as described in Zhou, D., et al., STAR Protoc, 2023. 4(1): p. 102088 and Westensee, I.N., el al., Small, 2021. 17(24): p. e2007959. DEG rank lists were constructed according to the following function: Rank = -lx)gl0(P value)*sign(Fold Change). Ranked lists were uploaded to the GSEA desktop application and used in performing GSEA Preranked analysis with default test parameters (which included “no-collapse” and excluded gene set sizes of greater than 500 and less than 15) where the ranked list was compared to a priori sets of genes in the curated collection of the Molecular Signatures Database (v7.4 MsigDB). The chip platform used for analysis was “Human_ENSEMBL_Gene_ID_MsigDB.v2024.chip”. Probed databases included current releases of curated Hallmarks (h.all.v2024.symbols.gmt), all chemical and genetic perturbations (CGP) and canonical pathways (CP) (C2.all.v2024.1.Hs.symbols.gmt), and MitoPathways 3.0 (MitoPathways3.0.gmx). See Rath, S., et al., Nucleic Acids Research, 2020. 49(D1): p. D1541-D1547. Enriched GSEA terms are represented using LoglO transformation of FDR-adjusted P value (z.e. Q value) and normalized enrichment score (NES). Gene sets with an FDR of less than 10% (FDR < 0.1) were considered significant.
[0150] Cell apoptosis and mitochondrial health determination. Annexin V Alexa 488 ReadyFlow (Thermo Scientific) and CellEvent Caspase 3 / 7 Green Ready Flow Reagent (Thermo Scientific) staining was used for apoptosis detection according to the manufacturer’s instructions. Briefly, cell samples were collected by trypsinization and subsequently washed52US_ACTIVE\131850427W-2twice with precooled PBS twice. For Annexin staining, cell samples were then collected by centrifugation and resuspended in lx binding buffer. Afterward, 1 drop of annexin V was added into the cell suspension and incubated at room temperature for 15 min in a dark environment. The stained cells were analyzed using flow cytometry within 1 hour. For Caspase activity, cells were prepared and collected as described and resuspended in 500 pL PBS, 1 drop of component A was added and incubated at 37 °C for 30 min. hMSCs were excluded from populations via pre-staining with Cell Tracker Deep Red (Thermo Scientific). For mitochondrial membrane potential and mitochondrial ROS production, JC-1 (AAT Bioquest) and MitoSox Red (Thermo Scientific) were utilized respectively, as described above. For MitoSox Red, hMSCs were pre-stained with CellTracker Green. The ratio of healthy cells in these experiments was obtained by counting the double-negative stained cells in the gated population and expressed as a percentage of the total cell tracker negative cell count (BD Accuri C6, BD Fortessa X-20).
[0151] Mitochondrial dysfunction was induced via several methods. Antimycin A (Cayman) (2 |iM) and Doxorubicin (VWR) (1 pM) were incubated with recipient cells prior to co-culture for 24 h, followed by several washes and staining, as described above. CCCP (50pM) was incubated with SMCs for 20 min at 37 °C to induce mitochondrial depolarization, followed by several washes and co-culture.
[0152] Statistical analysis. Determination of statistical significance when directly comparing untreated cells and M0S2 treated cells was determined using the student t-test. Similarly, the determination of statistical significance between multiple groups was achieved via ANOVA with the post hoc Tukey method. Significant P values were considered <0.05 unless otherwise noted. All analysis was completed in GraphPad Prism 9.0.Example 9: MitoFactory-Mediated Rescue of Bioenergetic and Metabolic Function in TF M-Deficient Cells
[0153] MitoFactory hMSCs, enhanced by M0S2 nanoflowers of this disclosure significantly improve the efficiency of mitochondrial transfer to recipient cells. The transferred mitochondria integrate into the recipient mitochondrial network, aiding in the restoration of cellular bioenergetics, especially under conditions of mitochondrial dysfunction. This enhanced transfer shows potential therapeutic benefits in addressing mitochondrial-related diseases and mitigating the cardiotoxic effects of agents like Doxorubicin. The data presented53US_ACTIVE\131850427W-2herein indicate the possibility of a novel mechanism that could be used to target mitochondrial disease, indicating mitochondrial transfer’s remedial effects in damaged tissues.
[0154] Genetic abnormalities also affect mitochondria in a number of diseases. These diseases encompass deleterious mutations and the generation of non-functional proteins that make mitochondria non-functional. The consequence of this extends beyond OXPHOS and energy production. Mitochondria are responsible for a significant amount of intercellular organelle and intracellular signaling. Although most mitochondrial genes exist in the nuclear genome, subunits of the OXPHOS system remain in the circular mitochondrial genome. Functional communication between the nucleus and mitochondria is mediated PGC-la, NRF-1 and -2, and TFAM that carry out the replication, transcription, and translation of mtDNA. In order to simulate mtDNA mutations affecting function beyond induced drug effects, cells exhibiting a knockdown expression of TFAM were used. Genetic disorders of mitochondria can cause neural degeneration, MELAS, cardiovascular and muscular deficiencies. Mitochondrial transfer from Mitofactories can be an effective tool to combat this.
[0155] TFAM maintains mtDNA copy number by regulating mtDNA replication and protects mtDNA by coiling. Without TFAM, cells exhibit severe mtDNA depletion, mitochondria damage and non-functional OXPIIOS systems (FIG. 23, Panel A). In this study, TFAM knockdown cells (shTFAM) were shown to have sufficiently decreased expression of TFAM and reduced expression of mtDNA copies to -30% of normal levels (FIG. 23, Panel A). As time progressed, a similar trend was observed in upregulation of mitochondrial fusion genes MFN1 and MFN2, indicating that the cells processed the newly introduced mitochondria after co-culture (FIG. 23, Panel B).
[0156] A hallmark of this knockdown is a shift away from OXPHOS toward glycolysis that provides cells with sufficient substrates for growth. This metabolic reprogramming is known as the Warburg effect. In order to explore how mitochondrial transfer from MitoFactories could combat this metabolic shift, real-time ATP production was evaluated after transfer. HATP production generated via OXPHOS and glycolysis was delineated in order to evaluate metabolic shifts in the knockdown cells. After co-culture, cells were separated via magnetic separation. Cells were cultured for 24 h-72 h, and a Seahorse real-time atp assay was run. At 24 h, an increase in OXPHOS production of ATP was observed in both C2C12 and shTFAM with MitoFactories outperforming hMSCs in both healthy and dysfunctional cells (FIG. 23, Panel C). After 72 h of maintenance, this affect was further pronounced. C2C12's retained an elevated OXPHOS related ATP production with MitoFactories. Further, shTFAM cells 54US_ACTIVE\131850427W-2displayed a retained OXPHOS ATP production as a function of energetic dependence on the new functional mitochondria in both MitoTransfer and MitoFactories, with MitoFactories retaining a more significant increase (FIG. 23, Panel D). Total intercellular ATP levels matched this trend at 72 h in shTFAM cells (FIG. 23, Panel E)
[0157] Another consequence of TFAM knockdown cell metabolic shift was found to be an alteration to the NAD / NADH ratio of cells. The intracellular NAD+ / NADH ratio controls the rate of ATP synthesis by regulating flux through dehydrogenases and by activating NAD+dependent enzymes. Thus, mitochondrial energy transduction pathways can be substantially evaluated by NAD+levels. Here, as a consequence of the introduction of naive mitochondria, NAD levels were replenished in shTFAM cells as the accumulation of NADH was observed due to a non-functional by Complex I, a major site of aerobic NAD+regeneration in the cell (FIG. 23, Panel F).Example 10: Restoration of Calcium Signaling in TFAM-Deficient Cells via MitoFactory-Mediated Mitochondrial Transfer
[0158] Beyond purely metabolic roles, the mitochondria also transmit and receive signals regarding the metabolic states in cells to the nucleus or endoplasmic reticulum (ER) using calcium (Ca2+). Dysregulation of this signaling is a hallmark of a number of metabolic diseases. Mitochondria regulate Ca2+flux via changing the mitochondrial membrane potential and signals to other organelles and even effect cellular Ca2+signaling. Since TFAM is involved in the metabolic function in the mitochondria, Ca2+flux and signaling mechanisms by which mitochondrial transfer affects Ca2+signaling can be investigated in response to metabolic changes (FIG. 24, Panel A).
[0159] Exploring Ca2+flux was achieved via the fluorescent calcium reporter CalBryte-520. shTFAM cells stained with the calcium reporter indicated a decreased calcium flux when induced with an injection of ATP. This was likely due to a lack of metabolic fitness and lack of mitochondrial ability to maintain membrane potential and thus Ca2+without proper gene expression, leading to altered cytosolic and ER levels. MitoFactory transfer resulted in an ability to restore these Ca2+stores in the knockdown cells (FIG. 23, Panel B).
[0160] Unexpectedly, while C2C12 cells lacked an ability to spontaneously synchronize without external stimulation, studies were designed to observe whether the presence of hMSCs or MitoFactories may affect transient calcium signaling in neighboring C2C12s after co-culture. A restoration of transient calcium flux was observed in cellular populations after55US_ACTIVE\131850427W-2transfer. The knockdown cells displayed a decrease in the frequency and amplitude of calcium signals, while the use of MitoFactories significantly improved shTFAM’s ability to transmit calcium signals during co-culture (FIG. 23, Panel C). In metabolically active C2C12s, transient spikes in cytosolic Ca2+reflect coordinated release from intracellular stores and uptake by mitochondria. When mitochondrial function is impaired, calcium buffering, uptake, and signaling become blunted or dysregulated. Therefore, the observed return of Ca2+activity after mitochondrial transfer indicates that mitochondria in the recipient cells are functionally integrated and able to support Ca2+handling and energy coupling with improved signaling fidelity.
[0161] In summary, the M0S2 nanoflowers are capable of serving a dual function by both enhancing mitochondrial biogenesis in donor cells and facilitating targeted delivery of mitochondria to recipient tissues. The various exemplary approaches described in this disclosure enables precise localization and integration of healthy mitochondria, supporting cellular repair and regeneration. Additionally, while this disclosure primarily focuses on interactions with mitochondria, the M0S2 nanoflowers may contribute to therapeutic outcomes through the transfer of other cellular components. Overall, the described methods provide a versatile and effective platform for mitochondrial replacement and tissue restoration.* *
[0162] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments or aspects, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.56US_ACTIVE\131850427W-2
Claims
CLAIMSWhat is claimed is:
1. A method of preparing a mitochondria transplantation therapy, the method comprising:exposing cells to nanomaterial structures causing increased mitochondrial biogenesis in at least a portion of the exposed cells;obtaining exposed cells; andpreparing the obtained cells and / or mitochondria from the obtained cells for administration as a mitochondria transplantation therapeutic.
2. The method of claim 1, wherein the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide.
3. The method of claim 2, further comprising preparing the nanomaterial structures by:combining a molybdenum precursor and sulfur precursor at a predefined ratio; and heating the combined molybdenum precursor and sulfur precursor to a temperature of at least 140 °C for at least 6 hours.
4. The method of claim 2, further comprising exposing the cells to an effective amount of the nanoflowers.
5. The method of claim 2, wherein an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1.
6. The method of claim 2, wherein an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1.
7. The method of claim 1, wherein the nanomaterial structures are about 5 nm to about 400 nm in diameter.
8. The method in claim 1, further comprising preparing a whole cell therapy by collecting at least one of the exposed cells.
9. The method of claim 1, further comprising obtaining the mitochondria from the obtained cells by extracting mitochondria from the obtained cells.
10. The method of claim 9, further comprising packaging the extracted mitochondria by encapsulating at least a portion of the obtained mitochondria in liposomes or a gel.57US_ACTIVE\131850427W-211. A method of increasing mitochondrial function in a subject in need thereof, the method comprising:obtaining a cell sample from the subject or a cell repository;exposing cells of the cell sample to nanomaterial structures, thereby increasing mitochondrial biogenesis in at least a portion of the cells of the cell sample;preparing a mitochondria transplantation therapeutic using at least one of the exposed cells or mitochondria obtained from the exposed cells; andadministering to the subject an effective amount of the mitochondria transplantation therapeutic.
12. The method of claim 11, wherein:preparing the mitochondria transplantation therapeutic comprises obtaining an amount of the exposed cells; andadministering to the subject the effective amount of the mitochondria transplantation therapeutic comprises administering at least a portion of the exposed cells to the subject.
13. The method of claim 11, further comprising preparing the mitochondria transplantation therapeutic through obtaining mitochondria from the exposed cells; andpackaging the mitochondria for administration as the mitochondria transplantation therapeutic.
14. The method of claim 13, wherein packaging the mitochondria for administration as the mitochondria transplantation therapeutic comprises coating or encapsulating the mitochondria in liposomes or a gel.
15. The method of claim 11, wherein the subject is afflicted with or at risk of developing a disease or condition associated with decreased mitochondrial function.
16. The method of claim 15, wherein the disease or condition associated with decreased mitochondrial function is selected from the group consisting of: Barth syndrome, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Myoclonus epilepsy with ragged-red fibers (MERRF), neuropathy, ataxia, and retinitis pigmentosa (NARP), Leber's hereditary optic neuropathy (LHON), Kearns-Sayre syndrome (KSS), Pearson syndrome (PS), progressive external ophthalmoplegia (PEO), autosomal-dominant / recessive PEO (ad / ar PEO), mtDNA depletion syndrome (MDDS), mitochondrial neurogastrointestinal encephalopathy (MNGIE), mitochondrial recessive ataxia syndrome (MIRAS), Alpers syndrome (AS), Leigh syndrome (LS), optic nerve atrophy, subacute58US_ACTIVE\131850427W-2necrotizing encephalopathy, early-onset hepatocerebral disorder, juvenile catastrophic epilepsy, adult-onset ataxia-neuropathy syndrome, cardiomyopathy, cerebral white matter disease, ovarian dysfunction, hearing loss, cancer, diabetes mellitus, osteoporosis, dyskeratosis congenita (DC), bone marrow failure, idiopathic pulmonary fibrosis, cryptogenic liver cirrhosis, telomere biology disorders, and ncurodcgcncrativc disease.
17. The method of claim 11, wherein said administering comprises injection, microneedle administration, oral administration, buccal administration, vaginal administration, inhalation, intraosseous administration, transnasal application, topical administration, transdermal application, or rectal administration.
18. The method of claim 11, further comprising administering a second therapy to said subject.
19. The method of claim 18, wherein the second therapy is a therapeutic agent or surgery.
20. A composition comprising mitochondria obtained by a method comprising:exposing cells to nanomaterial structures causing increased mitochondrial biogenesis in at least a portion of the exposed cells;obtaining mitochondria from the exposed cells; andpreparing the obtained mitochondria for administration.
21. The composition of claim 20, wherein the mitochondria are coated or encapsulated in liposomes or a gel.
22. The composition of claim 20, wherein the cells are eukaryotic cells, comprising: a plurality of nanomaterial structures within each eukaryotic cell; anda plurality of mitochondria within each eukaryotic cell, wherein an amount of the mitochondria is increased by a presence of the plurality of nanomaterial structures.
23. The composition of claim 22, wherein the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide.
24. The composition of claim 23, wherein an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1.
25. The composition of claim 23, wherein an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g1to about 10.0 x 102pM g26. The composition of claim 22, wherein the nanomalerial structures are about 5 nm to about 400 nm in diameter.59US_ACTIVE\131850427W-227. The composition of claim 22, wherein the eukaryotic cell is a stem cell.
28. A eukaryotic cell, comprising:a plurality of nanomaterial structures within the eukaryotic cell; anda plurality of mitochondria within the eukaryotic cell, wherein an amount of the mitochondria is increased by a presence of the plurality of nanomaterial structures.
29. The eukaryotic cell of claim 28, wherein the nanomaterial structures comprise nanoflowers, the nanoflowers comprising molybdenum disulfide.
30. The eukaryotic cell of claim 29, wherein an atomic vacancy concentration of the nanoflowers is greater than about 0.50 x 102pM g-1.
31. The eukaryotic cell of claim 29, wherein an atomic vacancy concentration of the nanoflowers is about 0.50 x 102pM g-1to about 10.0 x 102pM g-1.
32. The eukaryotic cell of claim 28, wherein the nanomaterial structures are about 5 nm to about 400 nm in diameter.
33. The eukaryotic cell of claim 28, wherein the eukaryotic cell is a stem cell.60US_ACTIVE\131850427W-2